DIARYLALKYLAMINE REV-ERB ANTAGONISTS AND THEIR USE AS MEDICAMENTS
20170136009 ยท 2017-05-18
Inventors
- Benedetto GRIMALDI (Genova, IT)
- Esther Torrente (Genova, IT)
- Rita Scarpelli (Genova, IT)
- Giovanni Bottegoni (Genova, IT)
- Tiziano Bandiera (Genova, IT)
- Marina Veronesi (Genova, IT)
Cpc classification
A61K31/4453
HUMAN NECESSITIES
C07D333/08
CHEMISTRY; METALLURGY
C07D309/14
CHEMISTRY; METALLURGY
C07D211/06
CHEMISTRY; METALLURGY
C07D241/38
CHEMISTRY; METALLURGY
A61K31/495
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C07D295/04
CHEMISTRY; METALLURGY
A61K31/496
HUMAN NECESSITIES
C07D295/08
CHEMISTRY; METALLURGY
International classification
A61K31/496
HUMAN NECESSITIES
A61K31/495
HUMAN NECESSITIES
Abstract
The present invention relates to compounds of Formula (I) or pharmaceutically acceptable salts or solvates thereof:
##STR00001##
It further discloses a pharmaceutical composition comprising the compounds of Formula (I) and their uses as anti-proliferative and proapoptotic agents for cancer therapy.
Claims
1. A method of modulating REV-ERBs activity in a cell, wherein the method comprises contacting the cell with a modulating amount of a compound of Formula (I) or a pharmaceutically acceptable salt or solvate thereof: ##STR00127## wherein Ar and Ar are independently selected from the group consisting of a 5- to 10-membered aromatic and heteroaromatic single or fused rings comprising up to 3 heteroatoms selected from N, O and S; R is selected from the group consisting of hydrogen, a linear or branched unsubstituted or substituted C.sub.1-6 alkyl and an unsubstituted or substituted aryl C.sub.1-6 alkyl; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, halogen, linear or branched, unsubstituted or substituted C.sub.1-6 alkyl, C.sub.1-6 alkoxy, hydroxy C.sub.1-6 alkyl, OH, CN, fluoro C.sub.1-6 alkyl and fluoro C.sub.1-6 alkoxy; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 can be attached to any position of Ar and Ar group, respectively; Y is selected from the group consisting of N and CH; X is selected from the group consisting of CH and N; R.sub.5 and R.sub.6 are independently selected from the group consisting of H, halogen, unsubstituted or substituted linear or branched C.sub.1-6 alkyl, O, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, hydroxy C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted arylCO, unsubstituted or substituted aryl C.sub.1-6 alkylCO, COOR.sub.7, CONR.sub.8R.sub.9 and SO.sub.2R.sub.10 wherein R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are independently selected from the group consisting of hydrogen and linear or branched C.sub.1-6 alkyl; R.sub.5 and R.sub.6 can be attached to any carbon atom of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; and R.sub.11 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, aryl and aryl C.sub.1-6 alkyl; or R.sub.5 and R.sub.6, or R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring, saturated or unsaturated, and containing up to two nitrogen atoms; q and p are, independently, 0 or an integer from 1 to 2 with the proviso that when both Y and X are N, neither q and p are 0; R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, C.sub.1-6 alkyl, C.sub.1-6 alkyl-OH, O, OH, COOH, CO.sub.2Me, CONH.sub.2, CONHMe and CONMe.sub.2 and can be attached to any position of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; W is selected from the group consisting of a bond and a heteroatom selected from the group consisting of O, S and NR.sub.14, wherein R.sub.14 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, unsubstituted or substituted arylCO, SO.sub.2R.sub.15, CONR.sub.16R.sub.17 and COOR.sub.18, wherein R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are independently selected from the group consisting of H and linear or branched C.sub.1-6 alkyl; m is an integer from 1 to 3, n is 0 or an integer from 1 to 3 with the proviso that when W is bond, n is not 0.
2. A method of treating a disease or pathology associated with REV-ERBs activity in a mammal, wherein the method comprises administering to the mammal an effective amount of a compound of Formula (I) or a pharmaceutically acceptable salt or solvate thereof: ##STR00128## wherein Ar and Ar are independently selected from the group consisting of a 5- to 10-membered aromatic and heteroaromatic single or fused rings comprising up to 3 heteroatoms selected from N, O and S; R is selected from the group consisting of hydrogen, a linear or branched unsubstituted or substituted C.sub.1-6 alkyl and an unsubstituted or substituted aryl C.sub.1-6 alkyl; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, halogen, linear or branched, unsubstituted or substituted C.sub.1-6 alkyl, C.sub.1-6 alkoxy, hydroxy C.sub.1-6 alkyl, OH, CN, fluoro C.sub.1-6 alkyl and fluoro C.sub.1-6 alkoxy; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 can be attached to any position of Ar and Ar group, respectively; Y is selected from the group consisting of N and CH; X is selected from the group consisting of CH and N; R.sub.5 and R.sub.6 are independently selected from the group consisting of H, halogen, unsubstituted or substituted linear or branched C.sub.1-6 alkyl, O, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, hydroxy C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted arylCO, unsubstituted or substituted aryl C.sub.1-6 alkylCO, COOR.sub.7, CONR.sub.8R.sub.9 and SO.sub.2R.sub.10 wherein R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are independently selected from the group consisting of hydrogen and linear or branched C.sub.1-6 alkyl; R.sub.5 and R.sub.6 can be attached to any carbon atom of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; and R.sub.11 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, aryl and aryl C.sub.1-6 alkyl; or R.sub.5 and R.sub.6, or R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring, saturated or unsaturated, and containing up to two nitrogen atoms; q and p are, independently, 0 or an integer from 1 to 2 with the proviso that when both Y and X are N, neither q and p are 0; R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, C.sub.1-6 alkyl, C.sub.1-6 alkyl-OH, O, OH, COOH, CO.sub.2Me, CONH.sub.2, CONHMe and CONMe.sub.2 and can be attached to any position of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; W is selected from the group consisting of a bond and a heteroatom selected from the group consisting of O, S and NR.sub.14, wherein R.sub.14 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6alkyl, unsubstituted or substituted arylCO, SO.sub.2R.sub.15, CONR.sub.16R.sub.17 and COOR.sub.18, wherein R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are independently selected from the group consisting of H and linear or branched C.sub.1-6 alkyl; m is an integer from 1 to 3, n is 0 or an integer from 1 to 3 with the proviso that when W is bond, n is not 0; or a pharmaceutical composition comprising a compound of Formula (I), or pharmaceutically acceptable salts or solvates thereof, and a pharmaceutically acceptable carrier, stabilizer, diluent or excipient thereof.
3. A method of treating cancer associated with REV-ERBs activity in a mammal, wherein the method comprises administering to the mammal an effective amount of a compound of Formula (I) or a pharmaceutically acceptable salt or solvate thereof: ##STR00129## wherein Ar and Ar are independently selected from the group consisting of a 5- to 10-membered aromatic and heteroaromatic single or fused rings comprising up to 3 heteroatoms selected from N, O and S; R is selected from the group consisting of hydrogen, a linear or branched unsubstituted or substituted C.sub.1-6 alkyl and an unsubstituted or substituted aryl C.sub.1-6 alkyl; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, halogen, linear or branched, unsubstituted or substituted C.sub.1-6 alkyl, C.sub.1-6 alkoxy, hydroxy C.sub.1-6 alkyl, OH, CN, fluoro C.sub.1-6 alkyl and fluoro C.sub.1-6 alkoxy; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 can be attached to any position of Ar and Ar group, respectively; Y is selected from the group consisting of N and CH; X is selected from the group consisting of CH and N; R.sub.5 and R.sub.6 are independently selected from the group consisting of H, halogen, unsubstituted or substituted linear or branched C.sub.1-6 alkyl, O, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, hydroxy C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted arylCO, unsubstituted or substituted aryl C.sub.1-6 alkylCO, COOR.sub.7, CONR.sub.8R.sub.9 and SO.sub.2R.sub.10 wherein R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are independently selected from the group consisting of hydrogen and linear or branched C.sub.1-6 alkyl; R.sub.5 and R.sub.6 can be attached to any carbon atom of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; and R.sub.11 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, aryl and aryl C.sub.1-6 alkyl; or R.sub.5 and R.sub.6, or R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring, saturated or unsaturated, and containing up to two nitrogen atoms; q and p are, independently, 0 or an integer from 1 to 2 with the proviso that when both Y and X are N, neither q and p are 0; R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, C.sub.1-6 alkyl, C.sub.1-6 alkyl-OH, O, OH, COOH, CO.sub.2Me, CONH.sub.2, CONHMe and CONMe.sub.2 and can be attached to any position of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; W is selected from the group consisting of a bond and a heteroatom selected from the group consisting of O, S and NR.sub.14, wherein R.sub.14 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6alkyl, unsubstituted or substituted arylCO, SO.sub.2R.sub.15, CONR.sub.16R.sub.17 and COOR.sub.18, wherein R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are independently selected from the group consisting of H and linear or branched C.sub.1-6 alkyl; m is an integer from 1 to 3, n is 0 or an integer from 1 to 3 with the proviso that when W is bond, n is not 0; or a pharmaceutical composition comprising a compound of Formula (I), or pharmaceutically acceptable salts or solvates thereof, and a pharmaceutically acceptable carrier, stabilizer, diluent or excipient thereof.
4. The method according to claim 3 wherein the cancer is Erb-B2 positive cancer.
5. The method according to claim 3 wherein the cancer is selected from the group consisting of ovary cancer, colon cancer, liver cancer, central nervous system cancer, kidney cancer pancreas cancer and prostate cancer.
6. The method according to claim 4 wherein the Erb-B2 positive cancer is Erb-B2 positive breast cancer.
7. The method according to claim 3 wherein the cancer is selected from a cancer with deletion or mutation of the tumour suppressor p53 gene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
DISCLOSURE OF INVENTION
[0033] The aim of the present invention is to provide novel compounds having anti-proliferative and pro-apoptotic activity for their use in cancer therapy, particularly in a breast cancer with the ErbB2-signature and in liver and colon cancers, independently from the expression of the tumor suppressor p53 (i.e. tumors expressing a wild-type or mutated p53 protein, and tumors in which p53 expression is ablated).
[0034] The aforementioned objective has been met according to the appended independent claims. Preferred embodiments are set out within the appended dependent claims.
[0035] The following paragraphs provide definitions of the various chemical moieties of the compounds according to the invention and are intended to apply uniformly through-out the specification and claims unless an otherwise expressly set out definition provides a broader definition.
[0036] The term alkyl, as used herein, refers to saturated or unsaturated aliphatic hydrocarbon groups. Such term includes straight (unbranched) chains or branched chains. It includes alkenyl groups or alkynyl groups.
[0037] Non-limiting examples of alkyl groups according to the invention are, for example, methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, tert-butyl, n-pentyl, iso-pentyl, n-hexyl, ethenyl, 1-propenyl, 2-propenyl, 1- or 2-butenyl, ethynyl, 1-propynyl, 2-propynyl, 1- or 2-butynyl, and the like.
[0038] Alkyl groups according to the present invention may be unsubstituted or substituted by one or more substituents.
[0039] The term cycloalkyl, as used herein, refers to a saturated or partially unsaturated carbocyclic group having a single ring. It includes cycloalkenyl groups.
[0040] Non-limiting examples of cycloalkyl groups according to the invention are, for example, cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclopentene, cyclohexene, cyclohexadiene and the like.
[0041] Cycloalkyl groups according to the present invention may be unsubstituted or substituted by one or more substituents.
[0042] The term heteroalkyl, as used herein, refers to an alkyl group, as defined above, that is linked to the remainder of the compound via an heteroatom. Heteroalkyl groups can be unsubstituted or substituted by one or more substituents.
[0043] As used herein, the term heteroatom refers to an atom other than carbon or hydrogen. Heteroatom typically is meant to include oxygen (O), nitrogen (N), and sulphur (S).
[0044] The term alkoxy, as used herein, refers to an alkyl group that is linked to the remainder of the compound by an oxygen atom.
[0045] The term heterocycloalkyl group, (non-aromatic heterocycle group), refers to a cycloalkyl group (non aromatic group) that wherein at least one of the carbon atoms has been replaced by a heteroatom selected from nitrogen, oxygen and sulfur. Heterocycloalkyl groups can be unsubstituted or substituted.
[0046] Examples of heterocycloalkyls include, but are not limited to, lactams, lactones, cyclic imides, cyclic thioimides, cyclic carbamates, 1-(1,2,5,6-tetrahydropyridyl), tetrahydrothiopyran, 4H-pyran, tetrahydropyran, piperidine (2-piperidinyl, 3-piperidinyl), 1,3-dioxin, 1,3-dioxane, 1,4-dioxin, 1,4-dioxane, piperazine, 1,3-oxathiane, 1,4-oxathiin, 1,4-oxathiane, tetrahydro-1,4-thiazine, 2H-1,2-oxazine, morpholine (4-morpholinyl, 3-morpholinyl) trioxane, hexahydro-1,3,5-triazine, tetrahydrothiophene, tetrahydrofuran (tetrahydrofuran-2-yl, tetrahydrofuran-3-yl), pyrroline, pyrrolidine, pyrrolidone, pyrrolidione, pyrazoline, pyrazolidine, imidazoline, imidazolidine, 1,3 dioxole, 1,3-dioxolane, 1,3-dithiole, 1,3-dithiolane, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, and 1,3-oxathiolane.
[0047] The term halogen, as used herein, refers to fluorine, chlorine, bromine and iodine.
[0048] The term aryl, as used herein, refers to a hydrocarbon consisting of a unsubstituted or substituted mono-, bi- or tricarbocyclic ring system, wherein the rings are fused together and at least one of the carbocyclic ring is aromatic. The term aryl means for example a cyclic aromatic such as a 6-membered hydrocarbon ring, a two six-membered fused hydrocarbon rings. Non-limiting examples of aryl groups are, for example, phenyl, alpha- or beta-naphthyl, 9,10-dihydroanthracenyl, indanyl, fluorenyl and the like. Aryl groups according to the present invention may be unsubstituted or substituted by one or more substituents.
[0049] The term heteroaryl, as used herein, refers to an aryl as defined above wherein one to four carbon atoms are independently replaced by heteroatoms chosen from the group consisting of nitrogen, oxygen and sulphur. Non-limiting examples of heteroaryl groups are, for example, pyrrolyl, furyl, thiophenyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, indolyl, benzofuranyl, benzothiophenyl, benzimidazolyl, benzopyrazolyl, benzoxazolyl, benzoisoxazolyl, benzothiazolyl, benzoisothiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl. Heteroaryl groups according to the present invention may be unsubstituted or substituted by one or more substituents.
[0050] The term aromatic ring, as used herein, refers to a moiety wherein the constituent carbon atoms make up an unsaturated ring system, all atoms in the ring system are sp.sup.2 hybridized and the total number of n-electrons is equal to 4n+2, wherein n is an integer.
[0051] The term heteroaromatic ring, as used herein, refers to an aromatic ring as defined above wherein one or more carbon atoms are independently replaced by heteroatoms chosen from the group consisting of nitrogen, oxygen and sulfur.
[0052] Unless otherwise indicated, the term substituted, as used herein, means that one or more hydrogen atoms of the above mentioned groups are replaced with another non-hydrogen atom or functional group, provided that normal valencies are maintained and that the substitution results in a stable compound. Non-limiting example of substitution are, for example, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxy, cycloalkyloxy, aryloxy, arylalkyloxy, hydroxy, heteroaryl, heteroaryloxy, heterocyclyloxy, trifluoromethyl, trifluoromethoxy, carboxy, acyl, aroyl, heteroaroyl, halogen, nitro, cyano, alkoxycarbonyl, aryloxycarbonyl, aralkyloxycarbonyl, cycloalkyloxycarbonyl, heteroaryloxycarbonyl, acyloxy, alkylthio, arylthio, alkylsulfinyl, arylsulfinyl, alkylsulfonyl, arylsulfonyl, O-aroyl, O-heteroaroyl, oxo (O), C(O)NR.sup.hR.sup.k, and NR.sup.pR.sup.q, wherein each of R.sup.h, R.sup.k, R.sup.p, and R.sup.q independently represents hydrogen, unsubstituted or substituted alkyl, unsubstituted or substituted cycloalkyl, unsubstituted or substituted aryl, unsubstituted or substituted arylalkyl, unsubstituted or substituted heteroaryl, unsubstituted or substituted heterocyclyl, acyl, aroyl, heteroaroyl, and when R.sup.h and R.sup.k, or R.sup.p and R.sup.q are taken together with the nitrogen atom to which they are bound, the group NR.sup.hR.sup.k or the group NR.sup.pR.sup.q represent a heterocyclyl residue and wherein the terms alkyl, cycloalkyl, aryl, heteroaryl, heterocyclyl are as above defined.
[0053] The term pharmaceutically acceptable salts refers to salts of the below identified compounds of Formula (I) that retain the desired biological activity and are accepted by regulatory authorities.
[0054] As used herein, the term salt refers to any salt of a compound according to the present invention prepared from an inorganic or organic acid or base and internally formed salts. Typically, such salts have a physiologically acceptable anion or cation.
[0055] Furthermore, the compounds of Formula (I) may form an acid addition salt or a salt with a base, depending on the kind of the substituents, and these salts are included in the present invention, as long as they are pharmaceutically acceptable salts.
[0056] Examples of such salts include, but are not restricted to acid addition salts formed with inorganic acids (e. g. hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like), and salts formed with organic acids such as acetic acid, trifluoroacetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, fumaric acid, maleic acid, ascorbic acid, benzoic acid, alginic acid, polyglutamic acid and naphthalene sulfonic acid. The hydrochloric salt is preferred.
[0057] Physiologically or pharmaceutically acceptable salts are particularly suitable for medical applications because of their greater aqueous solubility relative to the parent compound.
[0058] Pharmaceutically acceptable salts may also be prepared from other salts including other pharmaceutically acceptable salts of the compounds of Formula (I) using conventional methods.
[0059] The terms derivative and derivatives refer to each of the compounds of Formula (I) and are meant to include their pharmaceutically acceptable hydrates, solvates, crystalline forms, isotopically-labelled derivatives, tautomers, geometrical or optical isomers, stereoisomers, pharmaceutically active derivatives and also any suitable forms as illustrated hereinafter.
[0060] Those skilled in the art of organic chemistry will appreciate that many organic compounds can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as solvates. For example, a complex with water is known as a hydrate. Solvates of the compounds of the invention are within the scope of the invention. The compounds of Formula (I) may readily be isolated in association with solvent molecules by crystallization or evaporation of an appropriate solvent to give the corresponding solvates.
[0061] The compounds of Formula (I) may be in crystalline form. In certain embodiments, the crystalline forms of the compounds of Formula (I) are polymorphs.
[0062] The subject invention also includes isotopically-labelled compounds, which are identical to those recited in Formula (I) and following, but differ for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into the compounds of the invention and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, sulfur, fluorine, iodine, and chlorine, such as .sup.2H, .sup.3H, .sup.11C, .sup.13C, .sup.14C, .sup.15N, .sup.17O, .sup.18O, .sup.31P, .sup.32P, .sup.35S, .sup.18F, .sup.36Cl, .sup.123I, .sup.125I.
[0063] Compounds of the present invention and pharmaceutically acceptable salts of said compounds that contain the aforementioned isotopes and/or other isotopes of other atoms are within the scope of the present invention. Isotopically-labelled compounds of the present invention, for example those into which radioactive isotopes such as 3H, .sup.14C are incorporated, are useful in drug and/or substrate tissue distribution assays. Tritiated, i.e. .sup.3H, and carbon-14, i.e. .sup.14C, isotopes are particularly preferred for their ease of preparation and detectability. .sup.11C and .sup.18F isotopes are particularly useful in PET (Positron Emission Tomography), and .sup.125I isotopes are particularly useful in SPECT (Single Photon Emission Computerized Tomography), all useful in brain imaging. Furthermore, substitution with heavier isotopes such as deuterium, i.e. .sup.2H, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances. Isotopically-labelled compounds of Formula (I) and following of this invention can generally be prepared by carrying out the procedures disclosed in the Schemes and/or in the Examples below, by replacing a non-isotopically-labelled reagent with a readily available isotopically-labelled reagent.
[0064] Certain groups/substituents included in the present invention may be present as isomers or in one or more tautomeric forms. Accordingly, in certain embodiments, the compounds of Formula (I) may exist in the form of other tautomers or geometrical isomers in some cases, depending on the kinds of the substituents. In the present specification, the compounds may be described in only one form of such isomers, but the present invention includes all such isomers, isolated forms of the isomers, or a mixture thereof. Furthermore, the compounds of Formula (I) may have asymmetric carbon atoms or axial asymmetries in some cases and, correspondingly, it may exist in the form of optical isomers such as an (R)-form, an (S)-form, and the like. The present invention includes within the scope all such isomers, including racemates, enantiomers and mixtures thereof.
[0065] In particular, within the scope of the present invention are included all stereoisomeric forms, including enantiomers, diastereoisomers, and mixtures thereof, including racemates and the general reference to the compounds of Formula (I) includes all the stereoisomeric forms, unless otherwise indicated.
[0066] In general, the compounds or salts of the invention should be interpreted as excluding those compounds (if any) which are so chemically unstable, either per se or in water, that they are clearly unsuitable for pharmaceutical use through all administration routes, whether oral, parenteral, or otherwise. Such compounds are known to the skilled chemist.
[0067] The term pharmaceutically active derivative refers to any compound derived from the compounds of Formula (I) that upon administration to the recipient, is capable of providing directly or indirectly, the activity disclosed herein.
[0068] The present invention also encompasses active metabolites of compounds of Formula (I).
[0069] According to a first aspect of the invention, compounds of Formula (I)
##STR00002##
[0070] or pharmaceutically acceptable salts or solvates thereof are provided.
[0071] In the compounds of Formula (I):
[0072] Ar and Ar are independently selected from the group consisting of a 5- to 10-membered aromatic or heteroaromatic single or fused rings comprising up to 3 heteroatoms selected from N, O, S;
[0073] R is selected from the group consisting of hydrogen, a linear or branched unsubstituted or substituted C.sub.1-6 alkyl and an unsubstituted or substituted aryl C.sub.1-6 alkyl;
[0074] R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, halogen, linear or branched, unsubstituted or substituted C.sub.1-6 alkyl, C.sub.1-6 alkoxy, hydroxy C.sub.1-6 alkyl, OH, CN, fluoro C.sub.1-6 alkyl, fluoro C.sub.1-6 alkoxy; R.sub.1, R.sub.2, R.sub.3 and R.sub.4 can be attached to any position of Ar and Ar group, respectively;
[0075] Y is selected from the group consisting of N or CH;
[0076] X is selected from the group consisting of CH or N;
[0077] R.sub.5 and R.sub.6 are independently selected from the group consisting of H, halogen, unsubstituted or substituted linear or branched C.sub.1-6 alkyl, O, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, hydroxy C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted arylCO, unsubstituted or substituted aryl C.sub.1-6 alkylCO, COOR.sub.7, CONR.sub.8R.sub.9, SO.sub.2R.sub.10 wherein R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are independently selected from the group consisting of hydrogen, linear or branched C.sub.1-6 alkyl; R.sub.5 and R.sub.6 can be attached to any carbon atom of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring; and
[0078] R.sub.11 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, aryl, aryl C.sub.1-6 alkyl;
[0079] or R.sub.5 and R.sub.6, or R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring, saturated or unsaturated, and containing up to two nitrogen atoms;
[0080] q and p are, independently, 0 or an integer from 1 to 2 with the proviso that when both Y and X are N, neither q and p are 0;
[0081] R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, C.sub.1-6 alkyl, C.sub.1-6 alkyl-OH, O, OH, COOH, CO.sub.2Me, CONH.sub.2, CONHMe, CONMe.sub.2 and can be attached to any position of the ring to which they are connected and they may be connected to the same carbon atom or to different carbon atoms of the ring;
[0082] W is selected from the group consisting of a bond and a heteroatom selected from the group consisting of O, S and NR.sub.14, wherein R.sub.14 is selected from the group consisting of H, linear or branched C.sub.1-6 alkyl, C.sub.1-6 alkylCO, unsubstituted or substituted aryl, unsubstituted or substituted aryl C.sub.1-6 alkyl, unsubstituted or substituted arylCO, SO.sub.2R.sub.15, CONR.sub.16R.sub.17, COOR.sub.18, wherein R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are independently selected from the group consisting of H, linear or branched C.sub.1-6 alkyl;
[0083] m is an integer from 1 to 3, n is 0 or an integer from 1 to 3 with the proviso that when W is bond, n is not 0;
[0084] provided that the compound of Formula (I) is not [0085] 4-[[[1-(4-methoxyphenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol; [0086] 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol and [0087] 4-[[[1-(2-methoxyphenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol.
[0088] Preferably, Ar and Ar are, independently, selected from benzene, pyridine, naphthalene, thiophene rings;
[0089] R is selected from the group consisting of H, CH.sub.3, unsubstituted or substituted phenylCH.sub.2;
[0090] R.sub.1, R.sub.2, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, F, Cl, CH.sub.3, OH, OCH.sub.3, CH.sub.2OH, CF.sub.3, CHF.sub.2, CH.sub.2F, CF.sub.2CF.sub.3, OCF.sub.3, OCF.sub.2CF.sub.3, CN;
[0091] R.sub.5 and R.sub.6 are independently selected from the group consisting of H, F, CH.sub.3, O, unsubstituted or substituted phenyl, unsubstituted or substituted pyridyl, unsubstituted or substituted phenylCH.sub.2, CH.sub.2OH, CH.sub.3CO, unsubstituted or substituted phenylCO, unsubstituted or substituted phenylCH.sub.2CO, COOR.sub.7, CONR.sub.8R.sub.9, SO.sub.2R.sub.10 wherein R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are independently selected from the group consisting of H and CH.sub.3;
[0092] R.sub.11 is selected from the group consisting of H, CH.sub.3, Et, i-Pr, phenylC.sub.1-6 alkyl, CH.sub.3CO, phenyl;
[0093] or R.sub.5 and R.sub.6, or R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form a ring and thus the moiety
##STR00003##
has a meaning selected from the group consisting of:
##STR00004##
[0094] p and q are, independently, 0 or 1;
[0095] R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, CH.sub.3, CH.sub.2OH, OH, O, and they are connected to the same carbon atom or to different carbon atoms of the ring;
[0096] W is selected from the group consisting of a bond and a heteroatom selected from the group consisting of O and NR.sub.14, wherein R.sub.14 is H, CH.sub.3, COCH.sub.3, unsubstituted or substituted phenyl, unsubstituted or substituted phenyl CH.sub.2, unsubstituted or substituted phenylCO, SO.sub.2R.sub.15, CONR.sub.16R.sub.17, COOR.sub.18, wherein R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are independently selected from the group consisting of H and CH.sub.3; more preferably W is selected from the group consisting of a bond, O, NH, NCH.sub.3, NCOCH.sub.3; NCH.sub.2phenyl;
[0097] m is an integer from 1 to 3, and n is an integer from 1 to 2.
[0098] According to a first embodiment of the above aspect, the compounds of the invention can have the following Formula (I):
##STR00005##
[0099] wherein Ar, Ar, R, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.11, R.sub.12, R.sub.13, Y, W, n, m, p and q are as defined above.
[0100] In particular, according to this embodiment:
[0101] Ar and Ar are, independently, selected from benzene, pyridine, naphthalene, thiophene rings;
[0102] R is selected from the group consisting of H and CH.sub.3;
[0103] R.sub.1 and R.sub.3 are independently selected from the group consisting of H, F, CH.sub.3, OCH.sub.3, OH, CF.sub.3, CN;
[0104] R.sub.2 and R.sub.4 are, independently, H, F;
[0105] p and q are equal to 1, m is an integer from 1 to 2, n is an integer from 1 to 2;
[0106] R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, CH.sub.3, CH.sub.2OH, O, OH, and they are connected to the same carbon atom or to different carbon atoms of the ring;
[0107] W is a bond or O, NH, NCH.sub.3, NCOCH.sub.3, NCH.sub.2phenyl;
[0108] Y is selected from the group consisting of N and CH;
[0109] R.sub.5 and R.sub.6 are independently selected from the group consisting of H, F, CH.sub.3, O, phenyl, pyridyl, phenylCH.sub.2, CH.sub.2OH, CH.sub.3CO, COOH;
[0110] R.sub.11 is selected from the group consisting of H, CH.sub.3, Et, i-Pr, phenylCH.sub.2, CH.sub.3CO, phenyl, pheny(CH.sub.2).sub.2;
[0111] or R.sub.5 and R.sub.6, R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring wherein the moiety:
##STR00006##
has a meaning selected from the group consisting of:
##STR00007##
In particular, the moiety:
##STR00008##
has a meaning selected from the group consisting of:
##STR00009##
[0112] According to a second embodiment of the above aspect, the compounds of the invention can have the following Formula (I):
##STR00010##
[0113] wherein Ar, Ar, R, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.11, R.sub.12, R.sub.13, Y, W, n, m, p and q are as defined above.
[0114] In particular, according to this embodiment:
[0115] Ar and Ar are, independently, selected from benzene, pyridine, naphthalene, thiophene rings, in particular Ar and Ar are benzene;
[0116] R is H and CH.sub.3;
[0117] R.sub.1 and R.sub.3 are independently selected from the group consisting of H, F, CH.sub.3, OCH.sub.3, OH, CF.sub.3;
[0118] R.sub.2 and R.sub.4 are both H;
[0119] p and q are equal to 1, m is an integer from 1 to 2, n is an integer from 1 to 2;
[0120] R.sub.12 and R.sub.13 are independently selected from the group consisting of H, F, CH.sub.3, CH.sub.2OH, O, OH, or R.sub.12 and R.sub.13 are connected to the same carbon atom and have both the same meaning selected from F and CH.sub.3;
[0121] W is a bond or O, NH, NCH.sub.3, NCOCH.sub.3; NCH.sub.2phenyl;
[0122] Y is N or CH;
[0123] R.sub.5 and R.sub.6 are independently selected from the group consisting of H, F, CH.sub.3, O, phenyl, pyridyl, phenylCH.sub.2, CH.sub.2OH, CH.sub.3CO, COOH;
[0124] R.sub.11 is selected from the group consisting of H, CH.sub.3, Et, i-Pr, phenylCH.sub.2, CH.sub.3CO, phenyl;
[0125] or R.sub.5 and R.sub.6, R.sub.5 and R.sub.11 or R.sub.6 and R.sub.11 are linked together to form an unsubstituted or substituted 4- to 10-membered ring wherein the moiety:
##STR00011##
has a meaning selected from the group consisting of:
##STR00012##
[0126] In particular, the moiety:
##STR00013##
has a meaning selected from the group consisting of:
##STR00014##
[0127] According to a further embodiment of the above aspect, the compounds of Formula (I) can be selected from the group consisting of: [0128] 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-(1-piperidylmethyl)phenol dihydrochloride; [0129] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl) methyl]phenol trihydrochloride; [0130] 1-(2-fluorophenyl)-N-[[3-[(4-methylpiperazin-1-yl)methyl]phenyl]methyl]cyclopentanamine trihydrochloride; [0131] 1-(2-fluorophenyl)-N-[[4-methoxy-3-[(4-methylpiperazin-1-yl)methyl]phenyl]methyl]cyclopentanamine trihydrochloride; [0132] 4-[[[1-(2-fluorophenyl)cyclopentyl]-methyl-amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride; [0133] 2-[(4-methylpiperazin-1-yl)methyl]-4-[[(1-phenylcyclopentyl) amino]methyl]phenol trihydrochloride; [0134] 1-[4-[[5-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-hydroxyphenyl]methyl]piperazin-1-yl]ethanone dihydrochloride; [0135] 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-phenylpiperazin-1-yl)methyl]phenol trihydrochloride; [0136] 2-[(4-ethylpiperazin-1-yl)methyl]-4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]phenol trihydrochloride; [0137] 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-(piperazin-1-ylmethyl) phenol; [0138] 2-[(4-benzylpiperazin-1-yl)methyl]-4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]phenol trihydrochloride; [0139] 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-isopropylpiperazin-1-yl)methyl]phenol trihydrochloride; [0140] 4-[[[1-(2-fluorophenyl)tetrahydropyran-4-yl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride; [0141] 4-(2-fluorophenyl)-4-[[4-hydroxy-3-[(4-methylpiperazin-1-yl)methyl]phenyl]methylamino]cyclohexanone trihydrochloride; [0142] 4-[[[4,4-difluoro-1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(4-methyl-piperazin-1-yl)methyl]phenol trihydrochloride; [0143] 1-(2-fluorophenyl)-N-[[3-[(1-methyl-4-piperidyl) methyl]phenyl]methyl]cyclopentanamine dihydrochloride; [0144] 1-(2-fluorophenyl)-N-methyl-N-[[3-[(1-methyl-4-piperidyl)methyl]phenyl]methyl]cyclopentanamine dihydrochloride; [0145] 4-[[[1-benzyl-4-(2-fluorophenyl)-4-piperidyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol tetrahydrochloride; [0146] 4-[[[1-(2,4-difluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride; [0147] 4-[[[1-(3-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride; [0148] 4-[[[1-(4-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride; [0149] 2-[(4-methylpiperazin-1-yl)methyl]-4-[[[1-(3-thienyl) cyclopentyl]amino]methyl]phenol trihydrochloride.
[0150] The following compounds may be also synthesized with the same method used for the compounds above: [0151] 2-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-6-[(4-methylpiperazin-1-yl)methyl]phenol; [0152] 1-(2-fluorophenyl)-N-[[2-[(4-methylpiperazin-1-yl) methyl]-4-pyridyl]methyl]cyclohexanamine; [0153] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(5-methyl-2,5-diazabicyclo[2.2.2]octan-2-yl)methyl]phenol; [0154] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(4-methyl-2,3-dihydroquinoxalin-1-yl)methyl]phenol; [0155] 2-(1,3,4,6,7,8,9,9a-octahydropyrido[1,2-a]pyrazin-2-ylmethyl)-4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]phenol; [0156] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(9-methyl-3,9-diazabicyclo[3.3.1]nonan-3-yl)methyl]phenol; [0157] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-[(8-methyl-3,8-diazabicyclo[3.2.1]octan-3-yl)methyl]phenol; [0158] 4-[[[1-(3,5-difluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0159] 4-[[[1-(3-fluoro-2-naphthyl)cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0160] 4-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-3-[(4-methylpiperazin-1-yl)methyl]phenol; [0161] 2-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-4-[(4-methylpiperazin-1-yl)methyl]phenol; [0162] 4-[[[1-(2-hydroxyphenyl)cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0163] 4-[[[1-(2-fluorophenyl)-4-methyl-cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0164] 4-[[[1-(2-fluorophenyl)-4-(hydroxymethyl)cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0165] 4-[[[1-(2-fluorophenyl)-4-hydroxy-cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0166] 1-(2-fluorophenyl)-N-[[3-[(1-phenethyl-4-piperidyl)methyl]phenyl]methyl]cyclohexanamine; [0167] 4-[[[1-(2-fluorophenyl)-4-hydroxy-4-methyl-cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0168] 4-[[[1-(2-fluorophenyl)-4,4-dimethyl-cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol; [0169] 4-[[5-[[[1-(2-fluorophenyl)cyclohexyl]amino]methyl]-2-hydroxy-phenyl]methyl]-1-methyl-piperidine-2-carboxylic acid; [0170] 1-(2-fluorophenyl)-N-[[3-[(1-methyl-4-piperidyl) methyl]phenyl]methyl]cyclohexanamine; [0171] 1-(3-fluorophenyl)-N-[[3-[(1-methyl-4-piperidyl)methyl]phenyl]methyl]cyclopentanamine; [0172] N-[[3-[(1-benzyl-4-piperidyl)methyl]phenyl]methyl]-1-(2-fluorophenyl) cyclohexanamine; [0173] 1-(2-fluorophenyl)-N-[[3-[(1-methyl-3,4-dihydro-2H-quinolin-4-yl)methyl]phenyl]methyl]cyclohexanamine; [0174] N-[[3-(cyclohexylmethyl)phenyl]methyl]-1-(2-fluorophenyl)cyclohexanamine; [0175] 1-(2-fluorophenyl)-N-[[3-[(4-methylcyclohexyl) methyl]phenyl]methyl]cyclohexanamine.
[0176] The compounds exemplified in this invention may be prepared from readily available starting materials using the following general methods and procedures for example exemplified in Michael Smith, Jerry MarchMarch's Advanced Organic Chemistry: reactions mechanisms and structure6th Edition, John Wiley & Sons Inc., 2007.
[0177] It is well known to one of ordinary skill in the art that transformation of a chemical function into another may require that one or more reactive centers in the compound containing this function be protected in order to avoid undesired side reactions. Protection of such reactive centers, and subsequent de-protection at the end of the synthetic transformations, can be accomplished following standard procedures described, for instance, in Theodora W. Green and Peter G. M. WutsProtective Groups in Organic Synthesis, Fourth Edition, John Wiley & Sons Inc., 2006.
[0178] It will be appreciated that where typical or preferred experimental conditions (i.e. reaction temperatures, time, moles of reagents, solvents etc.) are given, other experimental conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by the person skilled in the art, using routine optimisation procedures.
[0179] The synthesis of a compound of Formula (I), according to the synthetic processes described below, can be conducted in a stepwise manner, whereby each intermediate is isolated and purified by standard purification techniques such as, for example, column chromatography, before carrying out the subsequent reaction. Alternatively, two or more steps of the synthetic sequence can be carried out in a so-called one-pot procedure, as known in the art, whereby only the compound resulting from the two or more steps is isolated and purified.
[0180] The compounds of Formula (I), prepared with the methods described herein below, may be treated or purified by conventional techniques or means for example by filtration, distillation, chromatography, recrystallization and combination thereof.
[0181] The salts of compounds of Formula (I) may be prepared by reacting a basic compound with the desired acid in solution.
[0182] General Procedures
[0183] In one embodiment, a compound of Formula (I) can be obtained by application of the chemical transformations reported in the schemes herein described.
[0184] According to Scheme 1, compounds of Formula (I), wherein R is H and R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.12, R.sub.13, R.sub.5, R.sub.6, R.sub.11, Ar, Ar, X, Y, W, n, m, p and q are as defined in Formula (I) above, named compounds of Formula Ia, can be prepared by reductive amination reaction of aldehydes of Formula II wherein R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.11, Ar, X, Y, p and q are as defined in Formula (I) above with amines of Formula III wherein R.sub.1, R.sub.2, R.sub.12, R.sub.13, Ar, W, n and m are as defined in Formula (I) in the presence of reducing agent, such as sodium triacetoxyborohydride (NaBH(OAc).sub.3) and using a moderately polar aprotic solvent, such as dichloromethane (DCM).
##STR00015##
[0185] According to Scheme 2, compounds of Formula (I), wherein R is different from H, and R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.12, R.sub.13, R.sub.5, R.sub.6, R.sub.11, Ar, Ar, X, Y, W, n, m, p and q are as defined in Formula (I) above, named compounds of Formula Ib, can be prepared by reductive amination reaction of compounds of Formula Ia with aldehydes of Formula IV where R is H, C.sub.1-5 alkyl or aryl C.sub.1-5 alkyl.
##STR00016##
[0186] Alternatively, according to Scheme 3, compounds of Formula Ib can be prepared by one-pot procedure, consisting of reductive amination reaction of aldehydes of Formula II (or IV, where R is H, C.sub.1-5 alkyl or aryl C.sub.1-5 alkyl) with amines of Formula III in the presence of a reducing agent, such as NaBH(OAc).sub.3 and using moderately polar aprotic solvent, such as DCM until to complete transformation of the starting materials, followed by the addition of the appropriate aldehydes of Formula IV (or II), where R is H, C.sub.1-5 alkyl or aryl C.sub.1-5 alkyl.
##STR00017##
[0187] Synthesis of Compounds of Formula (II)
[0188] According to Scheme 4, compounds of Formula II, wherein Y is N and at least one of R.sub.3 and R.sub.4, is OH or OMe and R.sub.5, R.sub.6, R.sub.11, Ar, X, p and q are as defined in Formula (I) above, named compounds of Formula IIa, can be prepared by Mannich reaction of aldehydes of Formula Va with amines of Formula VI in presence of formaldehyde (HCHO). The reaction is preferably conducted in polar solvent, such as ethanol (EtOH) or moderately polar aprotic solvent as DCM, at temperatures ranging from 45 C. to 80 C. for 12 h.
##STR00018##
[0189] According to Scheme 5, compounds of Formula II, wherein Y is N and both R.sub.3 and R.sub.4 are different from OH or OMe and R.sub.5, R.sub.6, R.sub.11, Ar, X, p and q, are as defined in Formula (I) above, named compounds of Formula IIb, can be prepared in a three steps procedure which consists of: 1) reductive amination reaction of alkylcarboxylate-arylaldehydes (preferably methylcarboxylate-arylaldehydes or ethylcarboxylate-arylaldehydes) of Formula Vb with amines of Formula VI in the presence of a reducing agent, such as, NaBH(OAc).sub.3 in moderately polar aprotic solvent, such as DCM; 2) reduction reaction of alkylcarboxylates (preferably methylcarboxylates or ethylcarboxylates) of Formula IIb in the presence of a reducing agent, such as lithium aluminum hydride (LiAlH.sub.4); and 3) oxidation of the primary alcohols of Formula IIb to aldehydes of Formula IIb using oxidizing agents, such as manganese dioxide (MnO.sub.2) in apolar aprotic solvent, such as diethyl ether (Et.sub.2O).
##STR00019##
[0190] According to Scheme 6, compounds of Formula II, wherein Y is CH and R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.11, Ar, X, q and p are as defined in Formula (I) above, named compounds of Formula IIc, can be prepared in a five steps procedure which consists of: 1) preparation of triphenylphosphonium salts of Formula IIc by treatment of compound of Formula VII where Z is Br, or I, with triphenylphosphine in aprotic solvent as toluene; 2) olefination reaction of compounds of Formula IIc with ketones of Formula VIII in the presence of bases such as LHMDS at room temperature in apolar aprotic solvent such as tetrahydrofurane (THF); 3) hydrogenation reaction of compounds of Formula IIc in the presence of palladium/carbon (Pd/C) and triethylsilane (Et.sub.3SiH) in polar solvent such as methanol (MeOH); 4) reduction reaction of alkylcarboxylates (preferably methylcarboxylates or ethylcarboxylates) of Formula IIc in the presence of a reducing agent, such as LiAlH.sub.4; and 5) oxidation of primary alcohols of Formula IIc in aldehydes of Formula IIc using oxidizing agents, such as manganese dioxide (MnO.sub.2) in apolar aprotic solvent, such as Et.sub.2O.
##STR00020##
[0191] Synthesis of Compounds of Formula (III)
[0192] According to Scheme 7 (Method A), compounds of Formula III, wherein W is a bond, R.sub.12 and R.sub.13 is H and R.sub.1, R.sub.2, Ar, n and m, are as defined in Formula (I) above, named compounds of Formula IIIa, can be prepared following a standard synthetic procedure reported in Balderman et al., Synthesis, 1978; 24-26, which consists of: 1) nucleophilic addition of the corresponding organolithium or Grignard derivatives of arylhalides of Formula IX, where Z is Br or I, to ketones of Formula Xa; 2) treatment of arylcycloalkanols of Formula IIIa with sodium azide (NaN.sub.3) in the presence of trifluoroacetic acid (TFA) in DCM at low temperature from 20 C. to 5 C., preferably at 0 C.; and 3) reduction of azides of Formula IIIa by using LiAlH.sub.4 in aprotic polar solvent such as THF.
##STR00021## ##STR00022##
[0193] According to Scheme 7 (Method B), compounds of Formula III, wherein W is a bond or O and R.sub.12 and R.sub.13 is different from H and R.sub.1, R.sub.2, Ar, n and m are as defined in Formula (I) above, named compounds of Formula IIIb, can be prepared following standard synthetic procedure reported in McMahon et al., Org. Lett., 2004; 6: 1645-1647; Ellmann et al., Acc. Chem. Res., 2002; 35: 984-995, which consists in: 1) nucleophilic addition of the corresponding organolithium or Grignard derivatives of arylhalides of Formula IX, where Z is I, or Br, to tert-butylsulfinyl ketimines of Formula Xb and 2) treatment of sulfinamide of Formula IIIb under acidic conditions, such as HCl solution in MeOH.
[0194] According to Scheme 7 (Method C), compounds of Formula III, wherein W is a bond or N and R.sub.12, R.sub.13, R.sub.1, R.sub.2, Ar, n and m are as defined in Formula (I) above, named compounds of Formula IIIc, can be prepared following a standard synthetic procedure reported in de Koning et al., Org. Process. Dev., 2011; 15: 1256-1265; Content at al., Org. Process. Dev., 2013; 17: 193-201, which consists of: 1) nucleophilic addition of the corresponding organolithium or Grignard derivates of arylhalides of Formula IX, where Z is I, or Br, to ketones of Formula Xc; 2) treatment of cycloalkanols of Formula IIIc with chloroacetonitrile in the presence of strong acid such as sulfuric acid (H.sub.2SO.sub.4) or TFA and 3) chloroacetamide cleavage of compounds of Formula IIIc by using thiourea under acidic conditions, as for example acetic acid (CH.sub.3CO.sub.2H) in a polar solvent such as MeOH.
[0195] According to Scheme 8, compounds of Formula Xb wherein W, R.sub.12, R.sub.13, n and m are as defined in Formula (I) above, can be prepared by condensation of tert-butanesulfinamide with cyclic ketones of Formula Xa, employing titanium (IV) isopropoxide [Ti(OiPr).sub.4] in THF at room temperature (McMahon et al., Org. Lett., 2004; 6: 1645-1647; Ellmann et al., Acc. Chem. Res., 2002; 35: 984-995).
##STR00023##
[0196] Compounds of Formula IV, Va, Vb, VI, VII, VIII, IX, Xa and Xc are known compounds or can be easily prepared from known compounds by known methods.
[0197] A second aspect of the present invention is related to a pharmaceutical composition comprising a compound of Formula (I) as disclosed above, included 4-[[[1-(4-methoxyphenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol, 4-[[[1-(2-fluorophenyl) cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl) methyl]-phenol and 4-[[[1-(2-methoxyphenyl) cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl) methyl]-phenol and a pharmaceutically acceptable carrier, stabilizer, diluent or excipient thereof.
[0198] A person skilled in the art is aware of a whole variety of such carrier, diluent or excipient compounds suitable to formulate a pharmaceutical composition.
[0199] The compounds of the invention, together with a conventionally employed adjuvant, carrier, diluent or excipient may be placed into the form of pharmaceutical compositions and unit dosages thereof, and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, or capsules filled with the same, all for oral use, or in the form of sterile injectable solutions for parenteral administration (including subcutaneous and intravenous use). Such pharmaceutical compositions and unit dosage forms thereof may comprise ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
[0200] Pharmaceutical compositions containing a compound of this invention can be prepared in a manner well known in the pharmaceutical art and comprise at least one active compound. Generally, the compounds of this invention are administered in a pharmaceutically effective amount. The amount of the compound actually administered will typically be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the like.
[0201] The pharmaceutical compositions of the present invention can be administered by a variety of routes including oral, rectal, transdermal, subcutaneous, intravenous, intramuscular, intranasal and pulmonary routes. The compositions for oral administration can take the form of bulk liquid solutions or suspensions, or bulk powders. More commonly, however, the compositions are presented in unit dosage forms to facilitate accurate dosing. The term unit dosage forms refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient. Typical unit dosage forms include pre-filled, pre-measured ampoules or syringes of the liquid compositions or pills, tablets, capsules or the like in the case of solid compositions.
[0202] Liquid forms suitable for oral administration may include a suitable aqueous or non-aqueous vehicle with buffers, suspending and dispensing agents, colorants, flavours and the like. Solid forms may include, for example, any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatine; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavouring agent such as peppermint, methyl salicylate, or orange flavouring.
[0203] Injectable compositions are typically based upon injectable sterile saline or phosphate-buffered saline or other injectable carriers known in the art.
[0204] The pharmaceutical compositions may be in the form of tablets, pills, capsules, solutions, suspensions, emulsion, powders, suppository and as sustained release formulations.
[0205] If desired, tablets may be coated by standard aqueous or non-aqueous techniques. In certain embodiments, such compositions and preparations can contain at least 0.1 percent of active compound. The percentage of active compound in these compositions may, of course, be varied and may conveniently be between about 1 percent to about 60 percent of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that therapeutically active dosage will be obtained. The active compounds can also be administered intranasally as, for example, liquid drops or spray.
[0206] The tablets, pills, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. A syrup or elixir may contain, in addition to the active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavoring agent such as cherry or orange flavor. To prevent breakdown during transit through the upper portion of the gastrointestinal tract, the composition be an enteric coated formulation.
[0207] Compositions for topical administration include, but are not limited to, ointments, creams, lotions, solutions, pastes, gels, sticks, liposomes, nanoparticles, patches, bandages and wound dressings. In certain embodiments, the topical formulation comprises a penetration enhancer.
[0208] Compositions for pulmonary administration include, but are not limited to, dry powder compositions consisting of the powder of a compound of Formula (I) or a salt thereof, and the powder of a suitable carrier and/or lubricant. The compositions for pulmonary administration can be inhaled from any suitable dry powder inhaler device known to a person skilled in the art.
[0209] Administration of the compositions is performed under a protocol and at a dosage sufficient to reduce the inflammation and pain in the subject. In some embodiments, in the pharmaceutical compositions of the present invention the active principle or active principles are generally formulated in dosage units. The dosage unit may contain from 0.1 to 1000 mg of a compound of Formula (I) per dosage unit for daily administration.
[0210] In some embodiments, the amounts effective for topical formulation will depend on the severity of the disease, disorder or condition, previous therapy, the individual's health status and response to the drug. In some embodiments, the dose is in the range from 0.001% by weight to about 60% by weight of the formulation.
[0211] When used in combination with one or more other active ingredients, the compound of the present invention and the other active ingredient may be used in lower doses than when each is used singly.
[0212] With respect to formulations with respect to any variety of routes of administration, methods and formulations for the administration of drugs are disclosed in Remington's Pharmaceutical Sciences, 17.sup.th Edition, Gennaro et al. Eds., Mack Publishing Co., 1985, and Remington's Pharmaceutical Sciences, Gennaro A R ed. 20.sup.th Edition, 2000, Williams & Wilkins PA, USA, and Remington: The Science and Practice of Pharmacy, 21.sup.st Edition, Lippincott Williams & Wilkins Eds., 2005; and in Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 8.sup.th Edition, Lippincott Williams & Wilkins Eds., 2005.
[0213] The above described components for orally administered or injectable compositions are merely representative.
[0214] The compounds of this invention can also be administered in sustained release forms or from sustained release drug delivery systems.
[0215] Moreover, the pharmaceutical compositions according to the invention may comprise a second therapeutic agent, for example known anticancer agents for which cancer cells develop resistance to the treatment.
[0216] A third aspect of the present invention is related to the use of compounds of Formula (I) as disclosed above, included 4-[[[1-(4-methoxyphenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol, 4-[[[1-(2-fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl)methyl]-phenol and 4-[[[1-(2-methoxyphenyl) cyclopentyl]amino]methyl]-2-[(4-methyl-1-piperazinyl) methyl]-phenol or the pharmaceutical composition thereof, or their pharmaceutically acceptable salts or solvates as a medicament.
[0217] In particular the medicament is suitable for modulating REV-ERBs activity in a subject. According to this aspect, compounds of Formula (I) are suitable for the use in the treatment of pathologies associated with dysfunction of circadian rhythm and with benefit from an inhibition of REV-ERBs activity in tissues/cells with a chronodisruption.
[0218] Moreover, the compounds of Formula (I) and their pharmaceutical compositions are suitable for use in the treatment of cancers in which a modified circadian pattern of gene/protein expression occurs, in particular of Erb-B2 positive cancers, more particularly selected from the group consisting of breast cancer, ovary cancer, colon cancer, liver cancer, central nervous system cancer, kidney cancer pancreas cancer and prostate cancer. Preferred Erb-B2 cancer is Erb-B2 positive breast cancer.
[0219] Moreover, the compounds of Formula (I) and their pharmaceutical compositions are suitable for use in the treatment of cancers with deletion or mutation of the tumor suppressor p53 gene.
[0220] In the following, the present invention shall be illustrated by means of some examples, which are not construed to be viewed as limiting the scope of the invention.
[0221] The following abbreviations are hereinafter used in the accompanying examples:
Acetic acid (AcOH), acetonitrile (MeCN), ammonia (NH.sub.3), ammonium chloride (NH.sub.4Cl), n-butyl lithium (n-BuLi), chloroform (CHCl.sub.3), cyclohexane (Cy), diatomaceous earth (Celite), deuterated chloroform (CDCl.sub.3), deuterated dimethylsulfoxide (DMSO-d.sub.6), deuterium oxide (D.sub.2O), dichloromethane (DCM), diethyl ether (Et.sub.2O), electrospray (ES), dimethylsulfoxide (DMSO), ethanol (EtOH), ethyl acetate (EtOAc), formaldehyde (HCHO), hydrochloric acid (HCl), lithium aluminium hydride (LiAlH.sub.4), lithium hexamethyldisilazane (LHMDS), manganese dioxide (MnO.sub.2), mass spectrometry (MS), methanol (MeOH), monopotassium phosphate (KH.sub.2PO.sub.4), nuclear magnetic resonance (NMR), palladium on carbon (Pd/C), potassium carbonate (K.sub.2CO.sub.3), retention time (Rt), room temperature (rt), tetrahydrofuran (THF), sodium bicarbonate (NaHCO.sub.3), sodium hydroxide (NaOH), sodium sulphate (Na.sub.2SO.sub.4), sodium triacetoxyborohydride (NaBH(OAc).sub.3), sulfuric acid (H.sub.2SO.sub.4), titanium tetraisopropoxide (Ti(iOPr).sub.4), thin layer chromatography (TLC), triethylamine (Et.sub.3N), trifluoroacetic acid (TFA).
Chemicals, Materials and Methods
[0222] Solvents and reagents were obtained from commercial suppliers and were used without further purification. Automated column chromatography purifications were run using a Teledyne ISCO apparatus (CombiFlash Rf) with pre-packed silica gel columns of different sizes (from 4 g up to 24 g). Flash column chromatography was performed manually on pre-packed silica cartridges (from 2 g up to 10 g) from Biotage. In both cases, mixtures of increasing polarity of Cy and EtOAc or DCM and MeOH were used as eluents. Preparative TLCs were performed using Macherey-Nagel pre-coated 0.05 mm TLC plates (SIL G-50 UV254). NMR experiments were run on a Bruker Avance III 400 system (400.13 MHz for .sup.1H, and 100.62 MHz for .sup.13C), equipped with a BBI probe and Z-gradients. Spectra were acquired at 300 K, using deuterated dimethylsulfoxide (DMSO-d.sub.6), deuterated chloroform (CDCl.sub.3) as solvents. Chemical shifts () for .sup.1H and .sup.13C spectra are reported in parts per million (ppm) using the residual non-deuterated solvent resonance as the internal standard (for CDCl.sub.3: 7.26 ppm, .sup.1H and 77.16 ppm, .sup.13C; for D.sub.2O: 4.79 ppm, .sup.1H; for DMSO-d.sub.6: 2.50 ppm, .sup.1H; 39.52 ppm, .sup.13C). Data are reported as follows: chemical shift (sorted in descending order), multiplicity (indicated as: s, singlet; bs, broad singlet; d, doublet; t, triplet; q, quartet; p, pentet; m, multiplet and combinations thereof), coupling constants (J) in Hertz (Hz) and integration. UPLC-MS analyses were run on a Waters ACQUITY UPLC-MS system consisting of a SQD (Single Quadropole Detector) Mass Spectrometer equipped with an Electrospray Ionization interface and a Photodiode Array Detector. PDA range was 210-400 nm. Electrospray ionization in positive and negative mode was applied. UPLC mobile phases were: (A) 10 mM NH.sub.4OAc in H.sub.2O, pH 5; (B) 10 mM NH.sub.4OAc in MeCN/H.sub.2O (95:5) pH 5. Analyses were performed with method A below reported. Method A-UPLC (generic): Gradient: 5 to 95% B over 3 min. Flow rate 0.5 mL/min. Temperature 40 C. Pre column: Vanguard BEH C18 (1.7 m 2.15 mm). Column: BEH C18 (1.7 m 2.150 mm). Purifications by preparative HPLC/MS were run on a Waters Autopurification system consisting of a 3100 Single Quadropole Mass Spectrometer equipped with an Electrospray Ionization interface and a 2998 Photodiode Array Detector. HPLC system included a 2747 Sample Manager, 2545 Binary Gradient Module, System Fluidic Organizer and 515 HPLC Pump. PDA range was 210-400 nm. Purifications were performed on a XBridge Prep C.sub.18 OBD column (10019 mmID, particle size 5 m) with a XBridge Prep C18 (1019 mmID, particle size 5 m) Guard Cartridge. Mobile phases were 10 mM NH.sub.4OAc in H.sub.2O at pH 5 adjusted with AcOH (A) and 10 mM NH.sub.4OAc in MeCN/H.sub.2O (95:5) at pH 5.0 (B). Electrospray ionization in positive and negative mode was used.
[0223] With the aim of better illustrating the present invention, the syntheses of example compounds reported in Tables 1 and 17 are provided.
[0224] The compounds reported in Tables 1 and 17 were synthesized as described below.
[0225] General Procedure for the Synthesis of the Amines of Formula IIIa (Scheme 7, Method A)
[0226] Step 1
[0227] To a solution of IX (1.0 equiv.) in anhydrous THF (0.2 M) at 78 C. under argon atmosphere, a solution of n-BuLi (1.0 equiv., 2.5 M in hexanes) was added dropwise. The reaction mixture was stirred for 1 h at the same temperature, and then 1.0 equiv. of Xa was added dropwise. Stirring was continued until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with saturated aqueous NH.sub.4Cl solution and extracted with DCM. The organic layer was washed with brine and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the residue of IIIa was used in the next step without further purification.
[0228] Step 2
[0229] To a solution of IIIa (1.0 equiv.) in anhydrous DCM (0.4 M) sodium azide (2.2 equiv.) at rt under nitrogen atmosphere was added. The suspension was cooled at 5 C. and then a 1:2 mixture of TFA: DCM (8.4 equiv. of TFA) was added dropwise under vigorous stirring over a period of 15 min. The resulting suspension was stirred at 0 C. for additional 1 h. To the cold solution distilled water was then added dropwise, followed by the addition of a mixture of distilled water and aqueous 28% NH.sub.4OH solution (1:1) dropwise (5.0 mL). After 30 min, the reaction mixture was extracted with DCM, and the organic layer was washed with water, 1.0 N KH.sub.2PO.sub.4 solution, brine and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of IIIa was purified by column chromatography eluting with Cy (100%).
[0230] Step 3
[0231] To a solution of IIIa (1.0 equiv.) in anhydrous THF (0.3 M) LiAlH.sub.4 (1.05 equiv., 2.0 M solution in THF) at 0 C. under nitrogen atmosphere was added. The reaction mixture was stirred at rt for 3 h, and then quenched with 1.0 N NaOH. The reaction mixture was then portioned between Et.sub.2O and 1.0 N HCl solution. The aqueous layer was collected and basified with 28% NH.sub.4OH solution up to pH 8.0, and then extracted with DCM. After evaporation of the solvent, the residue of IIIa was used in the next step without further purification.
[0232] General Procedure for the Synthesis of Amines of Formula IIIb (Scheme 7, Method B)
[0233] Step 1
[0234] To a solution of IX (1.1 equiv.) in anhydrous THF (0.2 M) at 78 C. under argon atmosphere, a solution of n-BuLi (1.0 equiv., 2.5 M in hexanes) was added dropwise. The reaction mixture was stirred for 1 h at the same temperature, and then a solution of Xb (1.0 equiv.) in anhydrous THF (1.0 M) was added. The reaction mixture was stirred at 78 C. for 1 h and then allowed to warm to room temperature. Stirring was continued until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with saturated aqueous NH.sub.4Cl solution and extracted with DCM. The organic layer was washed with brine and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of IIIb was purified by column chromatography eluting with gradient mixture of DCM/MeOH or EtOAc/MeOH.
[0235] Step 2
[0236] To a stirred solution of IIIb (1.0 equiv.) in anhydrous MeOH (1.0 M) 4.0 M HCl in dioxane (4.0 equiv.) was added. The reaction mixture was stirred at rt for 45 min, and then diluted with EtOAc (5.0 mL). The organic layer was washed with 1.0 N NaOH (5.0 mL), brine and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the residue of IIIb was used in the next step without further purification.
[0237] General Procedure for the Synthesis of Amines of Formula IIIc (Scheme 7, Method C)
[0238] Step 1
[0239] To a solution of IX (1.1 equiv.) in anhydrous THF (0.2 M) at 78 C. under argon atmosphere, a solution of n-BuLi (1.0 equiv., 2.5 M in hexanes) was added dropwise. The reaction mixture was stirred for 1 h at the same temperature, and then 1.0 equiv. of Xc was added dropwise. The reaction mixture was stirred at 78 C. for 1 h and then allowed to warm to rt. Stirring was continued until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with saturated aqueous NH.sub.4Cl solution and extracted with DCM. The organic layer was washed with brine and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the residue of IIIc was used in the next step without further purification.
[0240] Step 2
[0241] To a mixture of IIIc (1.0 equiv.) and chloroacetonitrile (3.5 equiv.) AcOH (1.0 mL) was added, followed by the addition of H.sub.2SO.sub.4 (1.0 mL). The reaction mixture was stirred at rt overnight and then diluted with EtOAc (4.0 mL), washed with saturated aqueous NH.sub.4Cl solution and water and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of IIIc was purified by column chromatography eluting with gradient mixture of solvent DCM/MeOH.
[0242] Step 3
[0243] To a solution of IIIc (1.0 equiv.) in EtOH (0.13 M) thiourea (1.1 equiv.) and AcOH (6.0 equiv.) were added. The reaction mixture was heated at 80 C. overnight and then cooled at rt, diluted with EtOAc (4.0 ml), washed with 1.0 M NaOH solution (2.0 mL) and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the residue of IIIc was used in the next step without further purification.
[0244] General Procedure for the Synthesis of Aldehydes of Formula IIa (Scheme 4)
[0245] A mixture of Va (1.0 equiv.), VI (1.0 equiv.) and HCHO (1.0 equiv., 36% solution in water) in EtOH (0.8 M) was heated at reflux for 2 h, then an additional amount of HCHO (1.0 equiv.) was added. The reaction mixture was stirred at reflux overnight. After evaporation of the solvent, the crude of IIa was purified by column chromatography eluting with gradient mixture of DCM/MeOH or EtOAc/MeOH.
[0246] General Procedure for the Synthesis of Aldehydes of Formula IIb (Scheme 5)
[0247] Step 1
[0248] To a solution of Vb (1.0 equiv.) and VI (1.0 equiv.) in anhydrous DCM (0.4 M), NaBH(OAc).sub.3 (2.0 equiv.) was added at rt and the resulting suspension was stirred at room temperature overnight. The reaction mixture was extracted with DCM (10.0 mL), washed with aqueous 10% K.sub.2CO.sub.3 solution and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the residue of IIb was used in the next step without further purification.
[0249] Step 2
[0250] To a solution of IIb (1.0 equiv.) in anhydrous THF (0.2 M) LiAlH.sub.4 was carefully added (1.05 equiv., 2.0 M solution in THF) at rt under nitrogen atmosphere. Stirring was continued for 1.5 h at room temperature until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with water with the formation of precipitate. The reaction mixture was carefully quenched by the addition of 2.0 M HCl (5.0 mL) and then extracted with DCM (310.0 mL). After evaporation of the solvent, the residue of IIb was used in the next step without further purification.
[0251] Step 3
[0252] To a solution of IIb (1.0 equiv.) in Et.sub.2O (0.22 M), activated MnO.sub.2 (6.4 equiv.) was added. The reaction mixture was stirred at rt overnight and then filtered through a pad of Celite and washed with DCM (315.0 mL). After evaporation of the solvent, the residue of IIb was used in the next step without further purification.
[0253] General Procedure for the Synthesis of Aldehydes of Formula IIc (Scheme 6)
[0254] Step 1
[0255] To a stirred solution of compound VII (1.0 equiv.) in dry toluene (0.2 M) triphenylphosphine (1.0 equiv.) was added. The resulting mixture reaction was stirred at 120 C. overnight, after which time a white precipitate had formed. The reaction was cooled at rt and then was collected the solid by filtration. The solid was washed with minimum amount of cold toluene to afford the compound IIc as white solid, which was used in the next step without further purification,
[0256] Step 2
[0257] To a solution of IIc (1.0 equiv.) in anhydrous THF (0.16 M) at 78 C. under argon atmosphere, a solution of LHMDS (5.0 equiv., 1.0 M in THF) was added dropwise. The reaction mixture was stirred for 15 min at the same temperature, and then 1.0 equiv. of VIII was added dropwise. The mixture reaction was stirred at rt for 3 h. Then the solvent was evaporated under reduce pressure and the residue was dissolved in DCM (6.0 mL) and was washed twice with water. The resulted organic phase was dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of IIc was purified by column chromatography eluting with gradient mixture of solvent Cy/EtOAc.
[0258] Step 3
[0259] To a stirred suspension of IIc (1.0 equiv.) and 10% Pd-C (0.1 equiv.) in MeOH (0.05 M) neat triethylsilane (10.0 equiv.) was added dropwise by the use of a pressure-equalizing dropping funnel under nitrogen atmosphere. After 15 min, the reaction mixture was filtered through a pad of Celite and the solvent was removed under reduce pressure affording the intermediate IIc which was used in the next step without further purification.
[0260] Step 4
[0261] To a solution of IIc (1.0 equiv.) in anhydrous THF (0.2 M) LiAlH.sub.4 was carefully added (1.05 equiv., 2.0 M solution in THF) at rt under nitrogen atmosphere. Stirring was continued for 1.5 h at rt until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with water with the formation of precipitate. The reaction mixture was carefully quenched by the addition of 2.0 M HCl (5.0 mL) and then extracted with DCM (310.0 mL). After evaporation of the solvent, the residue of IIc was used in the next step without further purification.
[0262] Step 5
[0263] To a solution of IIc (1.0 equiv.) in Et.sub.2O (0.22 M), activated MnO.sub.2 (6.4 equiv.) was added. The reaction mixture was stirred at rt overnight and then filtered through a pad of Celite and washed with DCM (315.0 mL). After evaporation of the solvent, the residue of IIb was used in the next step without further purification.
[0264] General Procedure for the Synthesis of N-Tert-Butylsulfinyl Ketimines of Formula Xb (Scheme 8)
[0265] To a solution of Xa (1.2 equiv.) in THF (0.5 M) Ti(OiPr).sub.4 (2.0 equiv.) is added under nitrogen atmosphere followed by the addition of tert-butanesulfinamide (1.0 equiv.). The reaction mixture was stirred for 2 h, poured into a saturated aqueous NaHCO.sub.3 solution (4.0 mL) under vigorous stirring and then immediately filtered through a pad of Celite and washed with EtOAc. The two phases are separated and the aqueous layer is extracted with EtOAc (38.0 mL). The combined organic layer is dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of Xb was purified by column chromatography eluting with gradient mixture of DCM/MeOH and stored into a container at 20 C. until further use.
[0266] General Procedure for the Synthesis of Amines of Formula Ia (Scheme 1)
[0267] A mixture of II (1.0 equiv.) and III (1.0 equiv.) in anhydrous DCM (0.06 M) was stirred for 10 min at rt and then NaBH(OAc).sub.3 (2.0 equiv.) was added. Stirring was continued at rt overnight. The reaction mixture was diluted with DCM (4.0 mL), washed with aqueous 10% K.sub.2CO.sub.3 solution and dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of Ia was purified by column chromatography eluting with gradient mixture of DCM/MeOH, DCM/MeOH/Et.sub.3N, DCM/MeOH/NH.sub.3 or Cy/EtOAc.
[0268] General Procedure for the Synthesis of Amines of Formula Ib (Scheme 3)
[0269] A mixture of II (1.0 equiv.) and III (1.0 equiv.) in anhydrous DCM (0.06 M) was stirred for 10 min at rt and then NaBH(OAc).sub.3 (2.0 equiv.) was added. Stirring was continued overnight at rt, then IV (1.1 equiv.) was added followed by an additional amount of NaBH(OAc).sub.3 (2.0 equiv.). Stirring was continued until the disappearance of the starting material was noted by TLC analysis. The reaction mixture was then quenched with aqueous 10% K.sub.2CO.sub.3 solution and the two phases were separated. The organic layer was dried over Na.sub.2SO.sub.4. After evaporation of the solvent, the crude of Ib was purified by column chromatography eluting with DCM/MeOH.
[0270] Tables of Intermediates of Formula IIIa (Scheme 7, Method A)
[0271] Alcohol intermediates of Formula IIIa (Scheme 7, Method A, step 1) and their physico-chemical properties are described in Tables 2 and 18.
[0272] Azide intermediates of Formula IIIa (Scheme 7, Method A, step 2) and their physico-chemical properties are described in Tables 3 and 19.
[0273] Amine intermediates of Formula IIIa (Scheme 7, Method A, step 3) and their physico-chemical properties are described in Tables 4 and 20 (INTERMEDIATE 1, 2, 3, 19, 20, 21, 22, 23, 24).
[0274] Tables of Intermediates of Formula IIIb (Scheme 7, Method B)
[0275] tert-Butylsulfinamide intermediates of Formula IIIb (Scheme 7, Method B, step 1) and their physico-chemical properties are described in Table 5.
[0276] Amine intermediates of Formula IIIb (Scheme 7, Method B, step 2) and their physico-chemical properties are described in Table 6 (INTERMEDIATE 4, 5, 6).
[0277] Tables of Intermediates of Formula IIIb (Scheme 7, Method C)
[0278] Chloroacetamides intermediates of Formula IIIc (Scheme 7, Method C, step 1) and their physico-chemical properties are described in Table 7.
[0279] Amine intermediates of formula IIIc (Scheme 6, Method C, step 2) and their physico-chemical properties are described in Table 8 (INTERMEDIATE 7).
Preparation of 4-Hydroxy-3-[(4-methylpiperazin-1-yl)methyl]benzaldehyde (Intermediate 8, scheme 4)
[0280] ##STR00024##
[0281] Intermediate 8 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (1.0 g, 8.19 mmol), N-methyl piperazine (664.0 L, 8.19 mmol) and HCHO (1.8 mL, 16.34 mmol) in EtOH (10.0 mL). The crude was purified by column chromatography (DCM/20% MeOH in DCM, from 100:0 up to 50:50) to afford the title compound as a white solid (1.1 g, 57%). UPLC-MS (method generic) Rt 1.14 min; MS (ES) C.sub.13H.sub.18N.sub.2O.sub.2 requires m/z 234. found 235 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.79 (s, 1H), 7.73-7.61 (m, 2H), 6.95-6.85 (m, 1H), 3.71 (s, 2H), 2.45-2.26 (bs, 8H), 2.18 (s, 3H).
Preparation of 4-Hydroxy-3-(1-piperidylmethyl) benzaldehyde (Intermediate 9, scheme 4)
[0282] ##STR00025##
[0283] Intermediate 9 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (500.0 mg, 4.09 mmol), piperidine (404.0 L, 4.09 mmol) and HCHO (678.0 L, 8.19 mmol) in EtOH (6.0 mL). The crude was purified by column chromatography (Cy/EtOAc, 95: 15 to 30: 70) to afford the title compound as colorless oil (600.0 mg, 67%). UPLC-MS (method generic) Rt 1.75 min, MS (ES) C.sub.13H.sub.17NO.sub.2 requires m/z 219. found 220 [M+H].sup.+. .sup.1H-NMR (400 MHz, CDCl.sub.3) 9.82 (s, 1H), 7.70 (dd, J=8.4, 2.1 Hz, 1H), 7.56 (dt, J=1.9, 0.9 Hz, 1H), 6.91 (d, J=8.3 Hz, 1H), 3.77 (s, 2H), 2.57 (bs, 5H), 1.82-1.27 (m, 5H).
Preparation of 3-[(4-Acetylpiperazin-1-yl)methyl]-4-hydroxy-benzaldehyde (Intermediate 10, scheme 4)
[0284] ##STR00026##
[0285] Intermediate 10 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (250.0 mg, 2.05 mmol), N-acetyl piperazine (315.0 mg, 2.46 mmol) and HCHO (340.0 L, 4.10 mmol) in 5.0 mL of EtOH. The crude mixture was purified by column chromatography (DCM/MeOH (20% in DCM), from 100:0 up to 50:50) to afford the title compound as a colorless oil (140.0 mg, 26%). UPLC-MS (method generic) Rt 1.27 min, MS (ES) C.sub.14H.sub.18N.sub.2O.sub.3 requires m/z 262. found 263 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.80 (s, 1H), 7.75 (d, J=2.1 Hz, 1H), 7.70 (dd, J=8.3, 2.1 Hz, 1H), 6.96 (d, J=8.3 Hz, 1H), 3.67 (s, 2H), 3.63-2.90 (m, 8H), 1.99 (s, 3H).
Preparation of 4-Hydroxy-3-[(4-phenylpiperazin-1-yl)methyl]benzaldehyde (Intermediate 11, scheme 4)
[0286] ##STR00027##
[0287] Intermediate 11 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (2.05 mmol, 250.0 mg), N-phenyl piperazine (2.46 mmol, 375.0 L) and HCHO (4.10 mmol, 340.0 L) in 5.0 mL of DCM. The crude mixture was purified by column chromatography (EtOAc/MeOH gradient 100:0 up to 95:5) to afford the title compound as colorless oil (500.0 mg, 82%). UPLC-MS (method generic) Rt 2.42 min, MS (ES) C.sub.18H.sub.20N.sub.2O.sub.2 requires m/z 296. found 297 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.81 (s, 1H), 7.76 (d, J=2.1 Hz, 1H), 7.71 (dd, J=8.3, 2.1 Hz, 1H), 7.22 (t, J=7.8 Hz, 2H), 6.95 (dd, J=8.3, 5.5 Hz, 3H), 6.79 (t, J=7.2 Hz, 1H), 3.75 (s, 2H), 3.18 (t, J=4.9 Hz, 4H), 2.64 (t, J=4.9 Hz, 4H).
Preparation of 3-[(4-Ethylpiperazin-1-yl)methyl]-4-hydroxy-benzaldehyde (Intermediate 12, scheme 4)
[0288] ##STR00028##
[0289] Intermediate 12 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (2.05 mmol, 250.0 mg), N-ethyl piperazine (2.46 mmol, 316.0 L) and HCHO (4.10 mmol, 340.0 L) in 5.0 mL of EtOH. The crude mixture was purified by column chromatography (EtOAc/MeOH gradient 100:0 up to 85:15) to afford the title compound as a white solid (265.0 mg, 52%). UPLC-MS (method generic) Rt 1.14 min, MS (ES) C.sub.14H.sub.20N.sub.2O.sub.2 requires m/z 248. found 297 [M+H]. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.78 (s, 1H), 7.70 (d, J=2.2 Hz, 1H), 7.68 (m, 2H), 6.95-6.82 (m, 1H), 3.71 (s, 2H), 3.65-3.02 (bs, 8H), 2.45-2.15 (q, J=7.2 Hz, 2H), 0.99 (t, J=7.2 Hz, 3H).
Preparation of tert-Butyl 4-[(5-formyl-2-hydroxy-phenyl)methyl]piperazine-1-carboxylate (Intermediate 13, scheme 4)
[0290] ##STR00029##
[0291] Intermediate 13 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (2.05 mmol, 250.0 mg), N-Boc piperazine (2.46 mmol, 457.0 mg) and HCHO (4.10 mmol, 340.0 L) in 5.0 mL of EtOH. The crude mixture was purified by column chromatography (Cy/EtOAc gradient 95:5 up to 50:50) to afford the title compound as a white solid (453.0 mg, 70%). UPLC-MS (method generic) Rt 2.37 min, MS (ES) C.sub.17H.sub.24N.sub.2O.sub.4 requires m/z 320. found m/z 320 [M].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.80 (s, 1H), 7.79-7.75 (m, 1H), 7.75-7.66 (m, 1H), 7.02-6.80 (m, 2H), 3.65 (s, 2H), 3.50-3.15 (bm, 4H), 3.35 (t, J=5.1 Hz, 2H), 2.41 (t, J=5.1 Hz, 2H), 1.40 (d, J=1.8 Hz, 9H).
Preparation of 3-[(4-Benzylpiperazin-1-yl)methyl]-4-hydroxy-benzaldehyde (Intermediate 14, scheme 4)
[0292] ##STR00030##
[0293] Intermediate 14 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (1.18 mmol, 144.0 mg), N-benzyl piperazine (1.41 mmol, 250.0 mg) and HCHO (2.36 mmol, 196.0 L) in 5.0 mL of EtOH. The crude mixture was purified by column chromatography (Cy/EtOAc gradient 95:5 up to 0:100) to afford the title compound as a white solid (240.0 mg, 66%). UPLC-MS (method generic) Rt 1.97 min, MS (ES) C.sub.19H.sub.22N.sub.2O.sub.2 requires m/z 310. found m/z 311 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.78 (s, 1H), 7.73-7.62 (m, 2H), 7.36-7.28 (m, 4H), 7.28-7.22 (m, 1H), 6.94-6.83 (m, 1H), 3.88-3.40 (m, 8H), 3.71 (s, 2H), 3.49 (s, 2H).
Preparation of 4-Hydroxy-3-[(4-isopropylpiperazin-1-yl)methyl]benzaldehyde (Intermediate 15, scheme 4)
[0294] ##STR00031##
[0295] Intermediate 15 was prepared according to the general procedure for the synthesis of aldehydes of Formula IIa using 4-hydroxybenzaldehyde (2.05 mmol, 250.0 mg), N-isopropyl piperazine (2.46 mmol, 351.0 L) and HCHO (4.10 mmol, 340.0 L) in 5.0 mL of EtOH. The crude mixture was purified by column chromatography (EtOAc/MeOH gradient 100:0 up to 85:15) to afford the title compound as yellow oil (310.0 mg, 58%). UPLC-MS (method generic) Rt 1.19 min, MS (ES) C.sub.15H.sub.22N.sub.2O.sub.2 requires m/z 262. found m/z 263 [MH].sup.+. 1H NMR (400 MHz, DMSO-d.sub.6) 9.78 (s, 1H), 7.69 (d, J=8.2 Hz, 2H), 6.90 (d, J=8.1 Hz, 1H), 3.71 (s, 2H), 2.64 (dt, J=13.1, 6.5 Hz, 1H), 2.54-2.42 (bm, 8H), 0.97 (d, J=6.5 Hz, 6H).
[0296] Tables of Intermediates of Formula IIb (Scheme 5)
[0297] Methyl carboxylate arylamine intermediate of Formula IIb (Scheme 5, step 1) and their physico-chemical properties are described in Tables 9 and 21.
[0298] Alcohol intermediate of Formula IIb (Scheme 5, step 2) and their physico-chemical properties are described in Tables 10 and 22.
[0299] Aldehyde intermediates of Formula IIb (Scheme 5, step 3) and their physico-chemical properties are described in Tables 11 and 23 (INTERMEDIATE 16, 17, 25, 26, 27).
[0300] Triphenylphosphonium salt of Formula IIc (Scheme 6, step 1) and its physico-chemical properties are described in Table 12.
[0301] Compounds of Formula IIc (Scheme 6, step 2) and their physico-chemical properties are described in Tables 13 and 24.
[0302] Compounds of Formula IIc (Scheme 6, step 3) and their physico-chemical properties are described in Tables 14 and 25.
[0303] Alcohol intermediates of Formula IIc (Scheme 6, step 4) and their physico-chemical properties are described in Tables 15 and 26.
[0304] Aldehyde intermediates of Formula IIc (Scheme 6, step 5) and their physico-chemical properties are described in Tables 16 and 27 (INTERMEDIATES 18, 28, 29).
BEST MODE FOR CARRYING OUT THE INVENTION
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 1 [CAS number: 1287451-26-6])
[0305] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (100.0 mg, 0.42 mmol), INTERMEDIATE 8 (75.0 mg, 0.42 mmol) and NaBH(OAc).sub.3 (178.0 mg, 0.84 mmol) in DCM (4.5 mL). The crude was purified by column chromatography [DCM and MeOH/NH.sub.3 (19% MeOH and 1% NH.sub.3 in DCM), from 95:5 to 100:0] to afford the free base of the title compound as a colorless oil (137.0 mg, 82%). UPLC-MS (method generic): Rt 1.58 min, MS (ES) C.sub.24H.sub.32FN.sub.3O requires m/z 397. found m/z 398 [MH].sup.+. The free base (60.0 mg, 0.15 mmol) was then dissolved in DCM (1.5 mL) and 2.0 M HCl solution in Et.sub.2O (1.5 mL, 3.0 mmol, 20.0 equiv.) was added observing the formation of precipitate. The excess of solvent was removed under reduce pressure and the resulting solid was triturated with Et.sub.2O. The resulting solid was dissolved in a solution of CH.sub.3CN/H.sub.2O (1:1) and lyophilized, affording the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.07 (bs, 1H), 10.71 (bs, 1H), 9.53 (s, 2H), 7.65 (t, J=8.0 Hz, 1H), 7.56-7.47 (m, 1H), 7.41 (s, 1H), 7.37-7.28 (m, 2H), 7.23 (d, J=7.7 Hz, 1H), 6.96 (d, J=8.3 Hz, 1H), 3.73 (t, J=5.6 Hz, 2H), 3.71-3.22 (m, 10H), 2.79 (s, 3H), 2.51 (m, 2H), 2.37 (dt, J=12.4, 5.7 Hz, 2H), 2.02-1.83 (m, 2H), 1.67-1.48 (m, 2H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]-2-(1-piperidylmethyl)phenol dihydrochloride (Example 2)
[0306] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (68.0 mg, 0.36 mmol), INTERMEDIATE 9 (80.0 mg, 0.36 mmol) and NaBH(OAc).sub.3 (152.0 mg, 0.72 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [Cy/EtOAc, from 90:10 to 0:100] to afford the free base of the title compound as a colorless oil (45.0 mg, 33%). UPLC-MS (method generic): Rt 1.85 min, MS (ES) C.sub.24H.sub.31FN.sub.2O requires m/z 382. found m/z 383 [MH].sup.+. The free base (40.0 mg, 0.10 mmol) was then dissolved in 1.0 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.0 mL, 2.0 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.61 (s, 1H), 10.16 (s, 1H), 9.54 (s, 2H), 7.72-7.61 (m, 1H), 7.58-7.45 (m, 2H), 7.38-7.25 (m, 2H), 7.21 (dd, J=8.4, 2.2 Hz, 1H), 6.96 (d, J=8.4 Hz, 1H), 4.13 (d, J=4.4 Hz, 2H), 3.84-3.63 (m, 2H), 3.47-3.18 (m, 4H), 3.03-2.75 (m, 2H), 2.51 (dt, J=3.7, 1.9 Hz, 2H), 2.37 (dd, J=13.2, 6.4 Hz, 2H), 1.92 (d, J=8.2 Hz, 2H), 1.79 (d, J=12.9 Hz, 3H), 1.70-1.49 (m, 3H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclohexyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 3)
[0307] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 3 (58.0 mg, 0.42 mmol), INTERMEDIATE 8 (70.0 mg, 0.42 mmol) and NaBH(OAc).sub.3 (177.0 mg, 0.84 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM and MeOH/NH.sub.3 (19% MeOH and 1% NH.sub.3 in DCM), from 95:5 to 100:0] to afford the free base of the title compound as a colorless oil, (110.0 mg, 63%). UPLC-MS (method generic): Rt 1.67 min, MS (ES) C.sub.25H.sub.34FN.sub.3O requires m/z 382. found m/z 412 [MH].sup.+. The free base (76.0 mg, 0.18 mmol) was then dissolved in 1.5 ml and 2.0 M HCl solution in Et.sub.2O (1.5 mL, 3.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.06 (bs, 1H), 10.71 (bs, 1H), 9.51 (s, 2H), 7.78 (t, J=8.1 Hz, 1H), 7.56 (td, J=7.4, 4.1 Hz, 1H), 7.36 (ddd, J=22.0, 14.6, 8.1 Hz, 3H), 7.25 (dd, J=8.6, 2.3 Hz, 1H), 6.97 (d, J=8.3 Hz, 1H), 4.52-3.90 (bm, 4H), 3.80-3.50 (m, 6H), 3.49-3.30 (bm, 2H), 2.84 (dd, J=36.7, 8.2 Hz, 2H), 2.80 (bs, 3H) 2.12 (t, J=12.2 Hz, 2H), 1.77 (d, J=13.1 Hz, 2H), 1.67-1.48 (m, 1H), 1.34-1.05 (m, 3H).
Preparation of 1-(2-Fluorophenyl)-N-[[3-[(4-methylpiperazin-1-yl)methyl]phenyl]methyl]-cyclopentanamine trihydrochloride (Example 4)
[0308] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (72.0 mg, 0.40 mmol), INTERMEDIATE 16 (89.0 mg, 0.40 mmol) and NaBH(OAc).sub.3 (144.0 mg, 0.68 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 95:5 to 50:50] to afford the free base of the title compound as a colorless oil, (76.0 mg, 50%). UPLC-MS (method generic): Rt 1.77 min, MS (ES) C.sub.24H.sub.32FN.sub.3 requires m/z 381. found m/z 382 [MH].sup.+. The free base (50.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.2 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.18 (bs, 2H), 9.74 (bs, 2H), 7.65 (m, 2H), 7.51 (t, J=6.6 Hz, 2H), 7.42 (d, J=8.0 Hz, 2H), 7.36-7.20 (m, 2H), 3.97-3.72 (m, 2H), 3.70-3.11 (m, 10H), 2.80 (s, 3H), 2.58 (dd, J=14.1, 6.9 Hz, 2H), 2.38 (dt, J=12.1, 5.3 Hz, 2H), 1.93 (q, J=7.4, 6.8 Hz, 2H), 1.60 (dt, J=11.1, 5.4 Hz, 2H).
Preparation of 1-(2-Fluorophenyl)-N-[[4-methoxy-3-[(4-methylpiperazin-1-yl)methyl]-phenyl]methyl]cyclopentanamine trihydrochloride (Example 5)
[0309] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (28.0 mg, 0.15 mmol), INTERMEDIATE 17 (38.0 mg, 0.15 mmol) and NaBH(OAc).sub.3 (64.0 mg, 0.30 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM and MeOH/Et.sub.3N (19% MeOH and 1% Et.sub.3N in DCM), from 95:5 to 40:60] to afford the title compound as a colorless oil (40 mg, 65%). UPLC-MS (method generic): Rt 1.70 min, MS (ES) C.sub.25H.sub.34FN.sub.3O requires m/z 411. found m/z 412 [M+H].sup.+. The free base (50.0 mg, 0.12 mmol) was then dissolved in 1.0 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.2 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.07 (bs, 2H), 9.65 (bs, 2H), 7.66 (t, J=7.8 Hz, 1H), 7.50 (dq, J=10.8, 6.8, 6.3 Hz, 2H), 7.46-7.38 (m, 1H), 7.37-7.26 (m, 2H), 7.07 (d, J=8.4 Hz, 1H), 4.21 (bm, 2H), 3.84 (s, 3H), 3.77 (m, 2H), 3.72 (m, 8H), 2.79 (bs, 3H), 2.60-2.45 (m, 2H), 2.37 (m, 2H), 2.09-1.77 (m, 2H), 1.69-1.41 (m, 2H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]-methyl-amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 6)
[0310] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ib, starting from INTERMEDIATE 1 (32.0 mg, 0.18 mmol), INTERMEDIATE 8 (42.0 mg, 0.18 mmol), HCHO (240.0 L, 0.36 mmol) and NaBH(OAc).sub.3 (76.0 mg, 0.36 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM and MeOH/Et.sub.3N (19% MeOH and 1% Et.sub.3N in DCM), from 95:5 to 40:60] to afford the free base of the title compound as a colorless oil (65.0 mg, 62%). UPLC-MS (method generic): Rt 2.18 min, MS (ES) C.sub.25H.sub.34FN.sub.3O requires m/z 411. found m/z 412 [M+H].sup.+. The free base (30.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.3 mL, 1.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.36-11.48 (m, 2H), 10.78 (bs, 2H), 7.87 (t, J=7.5 Hz, 1H), 7.70-7.53 (m, 2H), 7.52-7.29 (m, 3H), 7.01 (d, J=8.0 Hz, 1H), 4.63 (d, J=12.3 Hz, 1H), 4.38-4.00 (m, 2H), 3.84-3.23 (m, 8H), 3.18-2.98 (m, 1H), 2.97-2.71 (m, 3H), 2.71-2.57 (m, 3H), 2.52-2.42 (m, 3H), 1.87 (m, 2H), 1.36 (m, 2H).
Preparation of 2-[(4-Methylpiperazin-1-yl)methyl]-4-[[(1-phenylcyclopentyl)amino]methyl]-phenol trihydrochloride (Example 7)
[0311] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 2 (40.0 mg, 0.24 mmol), INTERMEDIATE 8 (58.0 mg, 0.24 mmol) and NaBH(OAc).sub.3 (102.0 mg, 0.48 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 95:5 to 40:60] to afford the free base of the title compound as a colorless oil (57.0 mg, 63%). UPLC-MS (method generic): Rt 1.51 min, MS (ES) C.sub.24H.sub.33FN.sub.3O requires m/z 379. found m/z 380 [M+H].sup.+. The free base (57.0 mg, 0.15 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.5 mL, 3.0 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.32-11.61 (bs, 1H), 10.72 (bs, 1H), 9.81 (bs, 2H), 7.77 (m, 3H), 7.51 (t, J=7.2 Hz, 2H), 7.47-7.33 (m, 2H), 7.24 (d, J=8.1 Hz, 1H), 6.97 (d, J=8.0 Hz, 1H), 3.80-3.13 (m, 12H), 2.79 (s, 3H), 2.45-2.30 (m, 4H), 1.85 (m, 2H), 1.65-1.37 (m, 2H).
Preparation of 1-[4-[[5-[[[1-(2-Fluorophenyl) cyclopentyl]amino]methyl]-2-hydroxyphenyl]-methyl]piperazin-1-yl]ethanone dihydrochloride (Example 8)
[0312] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (41.0 mg, 0.23 mmol), INTERMEDIATE 10 (60.0 mg, 0.23 mmol) and NaBH(OAc).sub.3 (81.0 mg, 0.36 mmol) in DCM (3.0 mL). The crude was purified by column chromatography (EtOAc/Cy/Et.sub.3N, 4:1:0.1) to afford the free base of the title compound as a colorless oil (50.0 mg, 50%). UPLC-MS (method generic): Rt 1.88 min, MS (ES) C.sub.24H.sub.33FN.sub.3O requires m/z 425. found m/z 426 [M+H].sup.+. The free base (36.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.0 mL, 1.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.83 (d, J=11.3 Hz, 1H), 10.63 (s, 1H), 9.73-9.22 (m, 2H), 7.64 (t, J=7.9 Hz, 1H), 7.59-7.40 (m, 2H), 7.41-7.25 (m, 2H), 7.21 (d, J=8.1 Hz, 1H), 6.94 (d, J=8.2 Hz, 1H), 4.40 (d, J=13.7 Hz, 1H), 4.21 (bs, 2H), 3.97 (d, J=13.1 Hz, 1H), 3.73 (t, J=5.3 Hz, 2H), 3.55 (m, 1H), 3.45-3.20 (m, 2H), 3.21-2.97 (m, 2H), 2.88 (m, 1H), 2.54-2.46 (m, 2H), 2.42-2.30 (m, 2H), 2.03 (s, 3H), 1.96-1.85 (m, 2H), 1.63-1.50 (m, 2H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-phenylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 9)
[0313] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (45.0 mg, 0.25 mmol), INTERMEDIATE 11 (74.1 mg, 0.25 mmol) and NaBH(OAc).sub.3 (106.0 mg, 0.50 mmol) in DCM (3.0 mL). The crude was purified by column chromatography (Cy/EtOAc, from 100:0 to 60:40) to afford the free base of the title compound as a colorless oil (65.0 mg, 57%). UPLC-MS (method generic): Rt 3.24 min, MS (ES) C.sub.29H.sub.34FN.sub.3O requires m/z 459. found m/z 460 [M+H].sup.+. The free base (60.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.3 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.71 (m, 2H), 9.53 (bs, 2H), 7.65 (t, J=7.9 Hz, 1H), 7.52 (m, 2H), 7.38-7.19 (m, 5H), 6.98 (m, 3H), 6.86 (t, J=7.2 Hz, 1H), 4.27 (bs, 2H), 3.89-3.65 (m, 4H), 3.44 (d, J=9.4 Hz, 2H), 3.17 (m, 4H), 2.55-2.50 (m, 2H), 2.41-2.34 (m, 2H), 2.00-1.85 (m, 2H), 1.67-1.53 (m, 2H).
Preparation of 2-[(4-Ethylpiperazin-1-yl)methyl]-4-[[[1-(2-fluorophenyl)cyclopentyl]amino]-methyl]phenol trihydrochloride (Example 10)
[0314] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (45.0 mg, 0.25 mmol) and INTERMEDIATE 12 (62.0 mg, 0.25 mmol) and NaBH(OAc).sub.3 (106.0 mg, 0.50 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM and MeOH/Et.sub.3N (19% MeOH and 1% Et.sub.3N in DCM), from 95:5 to 40:60] to afford the free base of the title compound as a colorless oil (57.0 mg, 56%). UPLC-MS (method generic): Rt 1.63 min, MS (ES) C.sub.25H.sub.34FN.sub.3O requires m/z 411. found m/z 412 [M+H].sup.+. The free base (57.0 mg, 0.14 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (1.4 mL, 2.8 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.99 (bs, 1H), 10.74 (bs, 1H), 9.50 (bs, 2H), 7.65 (t, J=8.0 Hz, 1H), 7.51 (m, 1H), 7.44 (m, 1H), 7.38-7.27 (m, 2H), 7.24 (d, J=8.2 Hz, 1H), 6.96 (d, J=8.3 Hz, 1H), 4.38-4.10 (m, 2H), 3.73 (bs, 2H), 3.65 (s, 8H), 3.28-2.96 (m, 2H), 2.55-2.50 (m, 2H), 2.43-2.31 (m, 2H), 1.96-1.85 (m, 2H), 1.66-1.50 (m, 2H), 1.26 (t, J=7.0 Hz, 3H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]-2-(piperazin-1-ylmethyl)-phenol (Example 11)
[0315] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (66.0 mg, 0.36 mmol), INTERMEDIATE 13 (118.0 mg, 0.36 mmol) and NaBH(OAc).sub.3 (152.0 mg, 0.72 mmol) in DCM (4.0 mL). The residue was dissolved in dioxane (1.0 mL) and HCl 4.0 M solution in dioxane (0.5 mL) was added and the reaction mixture stirred at rt for 1 h. After evaporation of the solvents, the crude was purified by preparative HPLC/MS run on a Water autopurification system on a XBridge Prep C.sub.18 OBD column (10019 mmID, particle size 5 m) with a XBridge Prep C18 (1019 mmID, particle size 5 m) Guard Cartridge using a isocratic method with NH.sub.4OAc 10 mM in CH.sub.3CN/water 95:5 at pH 5 as mobile phase to afford the title compound as white solid. UPLC-MS (method generic): Rt 1.52 min, MS (ES) C.sub.23H.sub.30FN.sub.3O requires m/z 383. found m/z 384 [M+H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.41 (td, J=8.2, 1.9 Hz, 1H), 7.30 (tdd, J=7.5, 5.2, 1.8 Hz, 1H), 7.21-7.08 (m, 2H), 6.92-6.78 (m, 2H), 6.59 (d, J=8.1 Hz, 1H), 3.53 (s, 2H), 3.17 (bs, 2H), 2.69 (m, 4H), 2.35 (m, 4H), 2.20-2.07 (m, 2H), 1.88-1.74 (m, 2H), 1.70-1.55 (m, 4H), 1.36-1.16 (m, 2H).
Preparation of 2-[(4-Benzylpiperazin-1-yl)methyl]-4-[[[1-(2-fluorophenyl)cyclopentyl]amino]-methyl]phenol trihydrochloride (Example 12)
[0316] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (78.0 mg, 0.44 mmol), INTERMEDIATE 14 (136.0 mg, 0.44 mmol) and NaBH(OAc).sub.3 (186.0 mg, 0.88 mmol) in DCM (6.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 95:5 to 60:40] to afford the free base of the title compound as a white solid (64.0 mg, 31%). UPLC-MS (method generic): Rt 2.84 min, MS (ES) C.sub.30H.sub.36FN.sub.3O requires m/z 473. found m/z 474 [M+H].sup.+. The free base (60.0 mg, 0.12 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.6 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.22 (bs, 1H), 10.68 (bs, 1H), 9.47 (bs, 2H), 7.73-7.57 (m, 3H), 7.57-7.48 (m, 1H), 7.48-7.36 (m, 4H), 7.37-7.27 (m, 2H), 7.23 (dd, J=8.5, 2.2 Hz, 1H), 6.94 (d, J=8.4 Hz, 1H), 4.52-4.03 (m, 2H), 3.78-3.67 (m, 2H), 3.67-3.13 (m, 10H), 2.55-2.50 (m, 2H), 2.42-2.31 (m, 2H), 2.02-1.80 (m, 2H), 1.65-1.50 (m, 2H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-isopropylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 13)
[0317] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (42.0 mg, 0.26 mmol), INTERMEDIATE 15 (70.0 mg, 0.26 mmol) and NaBH(OAc).sub.3 (110.0 mg, 0.52 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 95:5 to 60:40] to afford the free base of the title compound as a colorless oil (81.0 mg, 74%). UPLC-MS (method generic): Rt 1.80 min, MS (ES) C.sub.26H.sub.36FN.sub.3O requires m/z 425. found m/z 426 [M+H].sup.+. The free base (81.0 mg, 0.20 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (2.0 mL, 4.0 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, D.sub.2O) 7.46-7.34 (bs, 2H), 7.21 (t, J=7.6 Hz, 1H), 7.17-7.05 (m, 2H), 7.03 (d, J=2.2 Hz, 1H), 6.83 (d, J=8.4 Hz, 1H), 4.26 (s, 2H), 3.89 (s, 2H), 3.73-3.25 (m, 10H), 2.43 (dt, J=12.0, 5.6 Hz, 2H), 2.17 (dt, J=14.4, 7.3 Hz, 2H), 1.89-1.72 (m, 2H), 1.63 (dt, J=13.8, 5.2 Hz, 2H), 1.27 (d, J=6.6 Hz, 6H).
Preparation of 4-[[[1-(2-Fluorophenyl)tetrahydropyran-4-yl]amino]methyl]-2-[(4-methyl-piperazin-1-yl)methyl]phenol trihydrochloride (Example 15)
[0318] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 4 (45.0 mg, 0.23 mmol), INTERMEDIATE 8 (54.0 mg, 0.23 mmol) and NaBH(OAc).sub.3 (97.0 mg, 0.46 mmol) in DCM (3.0 mL). The crude was purified by column chromatography (DCM/MeOH 95:5) to afford the free base of title compound as a colorless oil (38.0 mg, 50%). UPLC-MS (method generic): Rt 1.56 min, MS (ES) C.sub.24H.sub.32FN.sub.3O.sub.2 requires m/z 413. found m/z 414 [M+H].sup.+. The free base (35.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (0.8 mL, 1.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, D.sub.2O) 7.50 (dt, J=19.0, 7.6 Hz, 2H), 7.29 (t, J=7.6 Hz, 1H), 7.23-7.07 (m, 2H), 7.04 (d, J=2.2 Hz, 1H), 6.83 (d, J=8.4 Hz, 1H), 4.27 (s, 2H), 4.04-3.90 (m, 2H), 3.85 (s, 2H), 3.67-3.25 (m, 10H), 2.90 (s, 3H), 2.78 (d, J=13.6 Hz, 2H), 2.12 (td, J=12.9, 4.4 Hz, 2H).
Preparation of 4-(2-fluorophenyl)-4-[[4-hydroxy-3-[(4-methylpiperazin-1-yl)methyl]phenyl]-methylamino]cyclohexanone trihydrochloride (Example 16)
[0319] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 5 (45.0 mg, 0.22 mmol), INTERMEDIATE 8 (51.0 mg, 0.22 mmol) and NaBH(OAc).sub.3 (97.0 mg, 0.46 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 95:5 to 60:40] to afford the free base of title compound a colorless oil, (44.0 mg, 46%). UPLC-MS (method generic): Rt 1.84 min, MS (ES) C.sub.25H.sub.32FN.sub.3O.sub.2 requires m/z 425. found m/z 426 [M+H].sup.+. The free base (35.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of DCM and 2.0 M HCl solution in Et.sub.2O (0.8 mL, 1.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, D.sub.2O) 7.64 (td, J=8.4, 1.6 Hz, 1H), 7.60-7.47 (m, 1H), 7.34 (ddd, J=9.2, 6.3, 1.4 Hz, 1H), 7.25-7.05 (m, 3H), 6.89 (d, J=8.4 Hz, 1H), 4.33 (s, 2H), 4.00 (bs, 2H), 3.77-3.37 (m, 8H), 3.12 (bs, 1H), 2.97 (s, 3H), 2.82 (d, J=13.5 Hz, 1H), 2.60-2.35 (m, 4H), 2.25-2.06 (m, 1H), 1.92 (d, J=14.2 Hz, 1H), 1.63 (t, J=13.4 Hz, 1H).
Preparation of 4-[[[4,4-difluoro-1-(2-fluorophenyl) cyclohexyl]amino]methyl]-2-[(4-methyl-piperazin-1-yl)methyl]phenol trihydrochloride (Example 17)
[0320] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 7 (53.0 mg, 0.23 mmol), INTERMEDIATE 8 (54.0 mg, 0.23 mmol) and NaBH(OAc).sub.3 (97.0 mg, 0.46 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 100:0 to 60:40] to afford the free base of title compound a colorless oil, (53.0 mg, 50%). UPLC-MS (method generic): Rt 2.49 min, MS (ES) C.sub.25H.sub.32F.sub.3N.sub.3O requires m/z 447. found m/z 448 [M+H].sup.+. The free base (50.0 mg, 0.11 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in Et.sub.2O (1.0 mL, 2.2 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.98 (bs, 1H), 10.81 (bs, 1H), 9.86 (s, 2H), 7.85 (t, J=8.1 Hz, 1H), 7.62 (ddt, J=8.3, 5.4, 3.2 Hz, 1H), 7.49-7.33 (m, 3H), 7.27 (dd, J=8.5, 2.3 Hz, 1H), 6.97 (d, J=8.4 Hz, 1H), 4.30-4.05 (m, 2H), 3.72 (bs, 2H), 3.70-3.24 (m, 8H), 2.98 (d, J=12.5 Hz, 2H), 2.68 (bs, 3H), 2.45 (d, J=12.1 Hz, 2H), 2.35-2.13 (m, 2H), 1.80-1.51 (m, 2H).
Preparation of 1-(2-fluorophenyl)-N-[[3-[1-methyl-4-piperidyl)methyl]phenyl]methyl]cyclopentanamine dihydrochloride (Example 18)
[0321] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (50.0 mg, 0.23 mmol), INTERMEDIATE 18 (60.0 mg, 0.23 mmol) and NaBH(OAc).sub.3 (97.0 mg, 0.46 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 90:10 to 0:100] to afford the free base of title compound a colorless oil, (60.0 mg, 57%). UPLC-MS (method generic): Rt 2.04 min, MS (ES) C.sub.25H.sub.33FN.sub.2 requires m/z 380. found m/z 381 [M+H]+. The free base (30.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in Et.sub.2O (0.4 mL, 1.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.49 (bs, 1H), 9.52 (bs, 2H), 7.62 (td, J=8.5, 8.1, 1.9 Hz, 1H), 7.56-7.48 (m, 1H), 7.42-7.23 (m, 3H), 7.21-7.14 (m, 2H), 7.11 (s, 1H), 3.83 (t, J=5.1 Hz, 2H), 3.42-3.42 (m, 2H), 2.94-2.73 (m, 2H), 2.68 (d, J=4.8 Hz, 2H), 2.56-2.45 (m, 5H), 2.37 (dt, J=12.4, 5.6 Hz, 2H), 1.92 (td, J=11.9, 9.5, 5.5 Hz, 2H), 1.80-1.64 (m, 3H), 1.64-1.41 (m, 4H).
Preparation of 1-(2-fluorophenyl)-N-methyl-N-[[3-[(1-methyl-4-piperidyl)methyl]phenyl]methyl]cyclopentanamine dihydrochloride (Example 19)
[0322] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ib, starting from INTERMEDIATE 1 (15.0 mg, 0.08 mmol), INTERMEDIATE 18 (18.0 mg, 0.08 mmol), HCHO (20.0 L, 0.8 mmol) and NaBH(OAc).sub.3 (33.0 mg, 0.16 mmol) in DCM (3.0 mL). The crude was purified by column chromatography using Biotage column SI 2 g using as eluent DCM/MeOH 90:10 to afford the free base of the title compound as a colorless oil (20.0 mg, 65%). UPLC-MS (method generic): Rt 2.90 min, MS (ES) C.sub.26H.sub.35FN.sub.2 requires m/z 394. found m/z 395 [M+H]+. The free base (20.0 mg, 0.05 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in Et.sub.2O (0.250 mL, 1.0 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.84 (bs, 1H), 10.54 (bs, 1H), 7.94-7.79 (m, 1H), 7.65 (q, J=7.2, 6.8 Hz, 1H), 7.46-7.37 (m, 4H), 7.32 (t, J=7.5 Hz, 1H), 7.24 (d, J=7.5 Hz, 1H), 4.76-4.60 (m, 1H), 3.60-3.45 (m, 2H), 3.37-3.25 (m, 2H), 3.17-3.04 (m, 2H), 2.88-2.68 (m, 3H), 2.75-2.61 (m, 5H), 2.51 (s, 3H), 2.03-1.61 (m, 5H), 1.60-1.14 (m, 4H).
Preparation of 4-[[[1-Benzyl-4-(2-fluorophenyl)-4-piperidyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol tetrahydrochloride (Example 20)
[0323] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 6 (25.0 mg, 0.09 mmol), INTERMEDIATE 8 (21.0 mg, 0.09 mmol) and NaBH(OAc).sub.3 (38.0 mg, 0.18 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% MeOH in DCM), from 90:10 to 0:100] to afford the free base of title compound as colorless oil, (28.0 mg, 64%). UPLC-MS (method generic): Rt 1.84 min, MS (ES) C.sub.31H.sub.39FN.sub.4O requires m/z 502. found m/z 503 [M+H]+. The free base (28.0 mg, 0.05 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in Et.sub.2O (0.370 mL, 1.5 mmol, 30.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.96 (bs, 1H), 11.38 (bs, 1H), 10.74 (bs, 1H), 10.08 (bs, 2H), 7.87 (t, J=8.3 Hz, 1H), 7.81-7.70 (m, 1H), 7.70-7.53 (m, 3H), 7.52-7.32 (m, 6H), 7.31-7.13 (m, 2H), 6.97 (d, J=8.4 Hz, 1H), 4.60-4.50 (m, 1H), 4.32-3.97 (m, 3H), 3.85-3.35 (m, 13H), 3.24-3.04 (m, 2H), 2.99-2.56 (m, 6H).
Preparation of 1-(2-Fluorophenyl)-N-[[3-(1-piperidylmethyl) phenyl]methyl]cyclopentanamine dihydrochloride (Example 21)
[0324] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (50.0 mg, 0.24 mmol), INTERMEDIATE 25 (44.0 mg, 0.24 mmol) and NaBH(OAc).sub.3 (102.0 mg, 0.48 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH, from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil (50.0 mg, 57%). UPLC-MS (method generic A): Rt 2.12 min, MS (ES) C.sub.24H.sub.31FN.sub.2 requires m/z 366. found m/z 367 [M+H].sup.+. The free base (50.0 mg, 0.14 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.7 mL, 2.8 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.72 (bs, 1H), 9.71 (d, J=8.7 Hz, 2H), 7.65 (s, 2H), 7.58 (s, 1H), 7.57-7.47 (m, 1H), 7.46-7.37 (m, 2H), 7.35-7.23 (m, 2H), 4.20 (d, J=5.1 Hz, 2H), 3.86 (t, J=5.5 Hz, 2H), 3.33-3.15 (m, 2H), 2.96-2.74 (m, 2H), 2.62-2.47 (m, 2H), 2.46-2.28 (m, 2H), 2.06-1.50 (m, 9H), 1.47-1.15 (m, 1H).
Preparation of 4-[[[1-(3-Fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 22)
[0325] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 19 (46.0 mg, 0.19 mmol), INTERMEDIATE 8 (35.0 mg, 0.19 mmol) and NaBH(OAc).sub.3 (80.0 mg, 0.38 mmol) in DCM (2.5 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 95:5 to 50:50] to afford the free base of the title compound as a colorless oil, (50.0 mg, 67%). UPLC-MS (method generic A): Rt 1.70 min, MS (ES) C.sub.24H.sub.32FN.sub.3O requires m/z 397. found m/z 398 [M+H].sup.+. The free base (50.0 mg, 0.12 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.6 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder 1H NMR (400 MHz, DMSO-d.sub.6) 11.82 (bs, 1H), 10.72 (bs, 1H), 9.92 (bs, 2H), 7.74-7.50 (m, 4H), 7.43 (s, 1H), 7.34-7.20 (m, 1H), 6.97 (d, J=8.4 Hz, 1H), 4.38-3.98 (m, 2H), 3.78-3.50 (m, 8H), 3.51-3.22 (m, 2H), 2.81 (s, 3H), 2.47-2.30 (m, 4H), 2.01-1.78 (m, 2H), 1.64-1.40 (m, 2H).
Preparation of 4-[[[1-(4-Fluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 23)
[0326] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 20 (46.0 mg, 0.19 mmol), INTERMEDIATE 8 (35.0 mg, 0.19 mmol) and NaBH(OAc).sub.3 (80.0 mg, 0.38 mmol) in DCM (2.5 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 95:5 to 50:50] to afford the free base of the title compound as a colorless oil, (53.0 mg, 69%). UPLC-MS (method generic A): Rt 1.66 min, MS (ES) C.sub.24H.sub.32FN.sub.3O requires m/z 397. found m/z 398 [M+H].sup.+. The free base (53.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.65 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.85 (bs, 1H), 10.71 (bs, 1H), 9.85 (s, 2H), 7.83 (dd, J=8.7, 5.2 Hz, 2H), 7.41 (s, 1H), 7.33 (t, J=8.7 Hz, 2H), 7.29-7.20 (m, 1H), 6.98 (d, J=8.4 Hz, 1H), 4.50-3.97 (m, 2H), 3.79-3.50 (m, 10H), 2.81 (s, 3H), 2.48-2.29 (m, 4H), 1.94-1.78 (m, 2H), 1.57-1.41 (m, 2H).
Preparation of 1-(2-Fluorophenyl)-N-[[3-[(4-ethylcyclohexyl)methyl]phenyl]methyl]cyclopentanamine hydrochloride (1:1 cis:trans ratio) (Example 24)
[0327] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (25.0 mg, 0.11 mmol), INTERMEDIATE 28 (20.0 mg, 0.11 mmol) and NaBH(OAc).sub.3 (50.0 mg, 0.22 mmol) in DCM (2.5 mL). The crude was purified by column chromatography (Cy/EtOAc from 100:0 to 30:70) to afford the free base as mixture of 1:1 cis:trans stereoisomers, as colorless oil (31.0 mg, 75%). UPLC-MS (method generic B): Rt 3.05 min, MS (ES) C.sub.26H.sub.34FN requires m/z 379. found m/z 380 [M+H].sup.+. The free base (31.0 mg, 0.08 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.05 mL, 0.16 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.44 (bs, 4H), 7.64-7.56 (m, 2H), 7.56-7.47 (m, 2H), 7.35-7.28 (m, 4H), 7.28-7.20 (m, 2H), 7.16-7.10 (m, 4H), 7.07 (d, J=7.3 Hz, 2H), 3.82 (dd, J=7.2, 4.7 Hz, 4H), 2.52-2.29 (m, 12H), 2.01-1.82 (m, 4H), 1.73-1.51 (m, 10H), 1.49-1.20 (m, 10H), 1.04-0.64 (m, 10H).
Preparation of 2-[(4-Methylpiperazin-1-yl)methyl]-4-[[[1-(2-thienyl) cyclopentyl]amino]methyl]phenol trihydrochloride (Example 25)
[0328] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 21 (35.0 mg, 0.15 mmol), INTERMEDIATE 8 (25.0 mg, 0.15 mmol) and NaBH(OAc).sub.3 (64.0 mg, 0.30 mmol) in DCM (2.5 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (36.0 mg, 60%). UPLC-MS (method generic A): Rt 1.44 min, MS (ES) C.sub.22H.sub.31N.sub.3OS requires m/z 385. found m/z 386 [M+H].sup.+. The free base (36.0 mg, 0.10 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.50 mL, 2.0 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.68 (bs, 1H), 9.91 (bs, 2H), 7.71 (dd, J=5.1, 1.1 Hz, 1H), 7.55 (dd, J=3.7, 1.2 Hz, 1H), 7.52-7.38 (m, 1H), 7.38-7.26 (m, 1H), 7.19 (dd, J=5.1, 3.6 Hz, 1H), 7.08-6.85 (m, 1H), 4.46-3.97 (m, 2H), 3.86-3.67 (m, 2H), 3.67-3.53 (m, 2H), 3.52-3.12 (m, 6H), 2.81 (s, 3H), 2.49-2.26 (m, 4H), 2.02-1.74 (m, 2H), 1.70-1.41 (m, 2H).
Preparation of 4-[[[1-(2,4-Difluorophenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 26)
[0329] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 22 (46.0 mg, 0.19 mmol), INTERMEDIATE 8 (36.0 mg, 0.19 mmol) and NaBH(OAc).sub.3 (80.0 mg, 0.38 mmol) in DCM (2.5 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (50.0 mg, 67%). UPLC-MS (method generic A): Rt 2.30 min, MS (ES) C.sub.24H.sub.31F.sub.2N.sub.3O requires m/z 415. found m/z 416 [M+H].sup.+. The free base (50.0 mg, 0.12 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.60 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.86-11.30 (m, 1H), 10.73 (bs, 1H), 9.32 (bs, 2H), 7.55 (ddd, J=14.6, 8.4, 6.1 Hz, 1H), 7.48 (s, 1H), 7.33-7.07 (m, 3H), 6.93 (d, J=8.4 Hz, 1H), 4.57-3.97 (m, 2H), 3.95-3.79 (m, 2H), 3.78-3.58 (m, 2H), 3.41 (s, 6H), 2.81 (s, 3H), 2.75-2.57 (m, 2H), 2.42-2.18 (m, 2H), 2.10-1.85 (m, 2H), 1.81-1.52 (m, 2H).
Preparation of 4-[[[1-(3-Methoxyphenyl)cyclopentyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 27)
[0330] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 23 (42.0 mg, 0.18 mmol), INTERMEDIATE 8 (35.0 mg, 0.18 mmol) and NaBH(OAc).sub.3 (76.0 mg, 0.36 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (50.0 mg, 68%). UPLC-MS (method generic A): Rt 1.63 min, MS (ES) C.sub.25H.sub.35N.sub.3O.sub.2 requires m/z 409. found m/z 410 [M+H].sup.+. The free base (50.0 mg, 0.12 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.60 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.74 (s, 1H), 10.76 (s, 1H), 9.76 (m, 2H), 7.47-7.34 (m, 3H), 7.26 (m, 2H), 7.05-6.93 (m, 2H), 4.46-3.99 (m, 2H), 3.82 (s, 3H), 3.61 (m, 8H), 3.50-3.25 (m, 2H), 2.82 (s, 3H), 2.44-2.25 (m, 4H), 1.85 (m, 2H), 1.52 (m, 2H).
Preparation of 1-(2-Fluorophenyl)-N-[[4-[(4-methyl piperazin-1-yl)methyl]phenyl]methyl]cyclopentanamine trihydrochloride (Example 28)
[0331] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (35.0 mg, 0.19 mmol), INTERMEDIATE 26 (43.0 mg, 0.19 mmol) and NaBH(OAc).sub.3 (80.0 mg, 0.38 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (52.0 mg, 72%). UPLC-MS (method generic A): Rt 2.06 min, MS (ES) C.sub.24H.sub.32FN.sub.3 requires m/z 381. found m/z 382 [M+H].sup.+. The free base (50.0 mg, 0.12 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.60 mL, 2.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 12.07 (bs, 1H), 9.69 (bs, 2H), 7.67-7.53 (m, 3H), 7.48 (tdd, J=7.3, 5.0, 1.6 Hz, 1H), 7.40 (d, J=7.8 Hz, 2H), 7.34-7.19 (m, 2H), 4.28 (s, 2H), 3.88 (t, J=5.7 Hz, 2H), 3.65-3.55 (m, 2H), 3.54-3.20 (m, 6H), 2.77 (s, 3H), 2.60-2.55 (m, 2H), 2.40-2.32 (m, 2H), 2.04-1.79 (m, 2H), 1.71-1.47 (m, 2H).
Preparation of 1-(2-Fluorophenyl)-N-[[2-[(4-methyl piperazin-1-yl)methyl]phenyl]methyl]cyclopentanamine trihydrochloride (Example 29)
[0332] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (46.0 mg, 0.26 mmol), INTERMEDIATE 27 (56.0 mg, 0.26 mmol) and NaBH(OAc).sub.3 (110.0 mg, 0.52 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (52.0 mg, 55%). UPLC-MS (method generic A): Rt 2.05 min, MS (ES) C.sub.24H.sub.32FN.sub.3 requires m/z 381. found m/z 382 [M+H].sup.+. The free base (52.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.65 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.86-11.06 (bs, 1H), 10.17-9.24 (bs, 2H), 7.70 (t, J=8.1 Hz, 1H), 7.60-7.43 (m, 2H), 7.37 (q, J=7.0 Hz, 2H), 7.33-7.20 (m, 2H), 7.07 (d, J=7.6 Hz, 1H), 4.07 (s, 2H), 3.87-3.25 (m, 8H), 3.36-3.00 (m, 2H), 2.77 (s, 3H), 2.62-2.36 (m, 4H), 2.11-1.80 (m, 2H), 1.75-1.42 (m, 2H).
Preparation of 4-(2-Fluorophenyl)-N-[[3-[(1-methyl-4-piperidyl)methyl]phenyl]methyl]tetrahydropyran-4-amine dihydrochloride (Example 30)
[0333] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 4 (61.0 mg, 0.31 mmol), INTERMEDIATE 18 (68.0 mg, 0.31 mmol) and NaBH(OAc).sub.3 (131.0 mg, 0.52 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (52.0 mg, 43%). UPLC-MS (method generic A): Rt 2.16 min, MS (ES) C.sub.25H.sub.33FN.sub.2O requires m/z 396. found m/z 397 [M+H].sup.+. The free base (52.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.65 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.55 (bs, 1H), 9.83 (bs, 2H), 7.87-7.73 (m, 1H), 7.66-7.44 (m, 1H), 7.44-7.31 (m, 2H), 7.31-7.22 (m, 1H), 7.22-7.09 (m, 3H), 4.01-3.88 (m, 2H), 3.76 (t, J=6.1 Hz, 2H), 3.38-3.27 (m, 2H), 3.25-3.08 (m, 2H), 2.93-2.70 (m, 4H), 2.66 (d, J=4.7 Hz, 3H), 2.52-2.32 (m, 4H), 1.83-1.62 (m, 3H), 1.49 (d, J=2.0 Hz, 2H).
Preparation of 4-[[3-[[[1-(2-Fluorophenyl)cyclopentyl]amino]methyl]phenyl]methyl]cyclohexanol hydrochloride (Example 31)
[0334] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 1 (24.0 mg, 0.13 mmol), INTERMEDIATE 29 (30.0 mg, 0.13 mmol) and NaBH(OAc).sub.3 (55.0 mg, 0.26 mmol) in DCM (2.5 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (26.0 mg, 53%). UPLC-MS (method generic A): Rt 2.92 min, MS (ES) C.sub.25H.sub.32FNO requires m/z 381. found m/z 382 [M+H].sup.+. The free base (26.0 mg, 0.07 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.34 mL, 1.4 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.27 (bs, 2H), 7.64-7.47 (m, 2H), 7.35-7.10 (m, 3H), 7.15-7.10 (m, 3H), 3.81 (t, J=5.8 Hz, 2H), 2.46-2.32 (m, 7H), 1.95-1.85 (m, 2H), 1.82-1.73 (m, 2H), 1.65-1.52 (m, 4H), 1.46-1.28 (m, 2H), 1.15-0.79 (m, 4H).
Preparation of 1-(4-Fluorophenyl)-N-[[3-[(1-methyl-4-piperidyl)methyl]phenyl]methyl]cyclopentanamine dihydrochloride (Example 32)
[0335] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 20 (41.0 mg, 0.23 mmol), INTERMEDIATE 18 (50.0 mg, 0.23 mmol) and NaBH(OAc).sub.3 (97.0 mg, 0.46 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (45.0 mg, 52%). UPLC-MS (method generic A): Rt 2.31 min, MS (ES) C.sub.25H.sub.33FN.sub.2 requires m/z 380. found m/z 381 [M+H].sup.+. The free base (40.0 mg, 0.11 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.55 mL, 2.2 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 10.35 (bs, 1H), 9.88 (bs, 2H), 7.81 (ddd, J=8.7, 5.2, 2.5 Hz, 2H), 7.41-7.26 (m, 3H), 7.24-7.13 (m, 3H), 3.73-3.62 (m, 2H), 3.42-3.25 (m, 2H), 2.93-2.72 (m, 2H), 2.68 (d, J=4.6 Hz, 3H), 2.50-2.46 (m, 1H), 2.44-2.28 (m, 4H), 1.96-1.79 (m, 2H), 1.83-1.63 (m, 3H), 1.65-1.35 (m, 4H), 1.32-1.17 (m, 1H).
Preparation of 4-[[[1-(2-Fluorophenyl)cyclobutyl]amino]methyl]-2-[(4-methylpiperazin-1-yl)methyl]phenol trihydrochloride (Example 33)
[0336] The title compound was prepared according to the general procedure for the synthesis of compounds of Formula Ia, starting from INTERMEDIATE 24 (45.0 mg, 0.26 mmol), INTERMEDIATE 8 (61.0 mg, 0.26 mmol) and NaBH(OAc).sub.3 (110.0 mg, 0.52 mmol) in DCM (3.0 mL). The crude was purified by column chromatography [DCM/MeOH (20% in DCM), from 100:0 to 0:100] to afford the free base of the title compound as a colorless oil, (60.0 mg, 60%). UPLC-MS (method generic A): Rt 1.70 min, MS (ES) C.sub.23H.sub.30FN.sub.3O requires m/z 383. found m/z 384 [M+H].sup.+. The free base (50.0 mg, 0.13 mmol) was then dissolved in 0.5 mL of dioxane and 4.0 M HCl solution in dioxane (0.65 mL, 2.6 mmol, 20.0 equiv.) was added. Evaporation of solvents afforded the title compound as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 11.95 (bs, 1H), 10.80 (bs, 1H), 9.95 (bs, 2H), 7.71-7.61 (m, 1H), 7.57-7.44 (m, 2H), 7.38-7.23 (m, 3H), 6.97 (d, J=8.4 Hz, 1H), 4.37-4.07 (m, 2H), 3.80-3.65 (m, 2H), 3.65-3.53 (m, 2H), 3.53-3.19 (m, 6H), 2.99-2.84 (m, 2H), 2.80 (s, 3H), 2.76-2.61 (m, 2H), 2.41-2.21 (m, 1H), 1.90-1.67 (m, 1H).
[0337] Biological Methods to Assess the Activity of the Compounds According to the Invention
[0338] Luciferase-Base Assay to Assess the Activity of the Compounds on REV-ERB Mediated Transcriptional Regulation
[0339] In order to assess the effect of the compounds of the invention on REV-ERB activity the inventors exploited the ability of REV-ERB to repress gene transcription of a specific DNA cis-element. In fact, the DNA binding domain (DBD) of REV-ERB recognizes specific DNA sequences (called RevREs=Rev-erb Responsive Elements) which contains an AGGTCA motif linked in 5 to an A/T rich sequence harboring the following consensus: A/T A A/T N T (Harding et al., Mol Cell Biol., 1993; 13:3113).
[0340] Therefore, two repetitions of the RevRE consensus AGAATGTAGGTCA (SEQ ID NO: 13) upstream a SV40 promoter driving the expression of a reporter gene were cloned. As reported, the luciferase enzyme from the ostracod Cypridina noctiluca was adopted. This luciferase does not require ATP and catalyzes the oxidation of its luciferin substrate in a photochemical reaction that can be measured by a luminometer. Cypridina luciferase (CLuc) is secreted from cells by virtue of its natural signal peptide and its luminescence can be measured from the supernatant of transfected cells. Therefore, cell lysis is not necessary. Secreted CLuc is a very stable protein. Because of this property, the activity measured from the supernatant reflects the amount of protein accumulated up to the time of sampling. Multiple samples can therefore be obtained from the same transfected cells, allowing an easy set-up of time-course experiments. In addition, the direct use of the supernatant makes the system easily prone to automation for High Throughput Screening.
[0341] In order to normalize the experiment for the transfection efficiency, it was used a plasmid containing a SV40 promoter driving the expression of a secreted form of human alkaline phosphatase (SEAP), which enzymatic activity in the supernatant can be measured with chemiluminescence substrates.
[0342] To be able to rule out false-positive, for example due to the interference of the compounds to be tested with the fluorescence and/or chemiluminescence reactions, it was used as control a mutated version of the RevRE (GAGCCCGTAGGTCA) (SEQ ID NO: 14) that is no longer able to bind REV-ERB DBD (Harding et al., Mol Cell Biol., 1993; 13:3113).
[0343] Agonists or antagonists of REV-ERB modify the expression of the CLuc reporter driven by the wild-type RevRE/SV40 promoter, but produce negligible effects on the CLuc reporter driven by the mutated RevRE/SV40 promoter.
[0344] The person skilled in the art will appreciate that an agonist will improve the ability of REV-ERB to repress the transcription, reducing the luminescence signal, while an antagonist will produce the opposite effect.
[0345] For the assay, HEK-293 cells were transfected with the reporter vectors and a plasmid expressing the REV-ERB and/or protein. After 6 h from transfection, the medium was replaced with fresh medium containing different doses of the compounds or vehicle (DMSO). After 24 h post-transfection, the supernatant was analyzed for the secreted luciferase and AP activity according to the manufacture instruction. Data normalized as fold activation versus vehicle (DMSO) were fitted using a four-parameter dose-response curve to calculate the EC.sub.50 of the different compounds.
[0346] Growth Inhibition Assay
[0347] Given that REV-ERB target genes include several metabolic regulators, such as Pgc-1 and Nampt, it was decided to test the cell proliferation with a method that is independent from the metabolic state of the cell.
[0348] The CyQUANT Cell Proliferation Assay Kit (Invitrogen) was used, an assay that has a linear detection range extending from 50 or fewer to at least 250,000 cells. The CyQUANT method is rapid, does not rely on cellular metabolic activity, and uses a proprietary green fluorescent dye, CyQUANT GR dye, which exhibits strong fluorescence enhancement when bound to cellular nucleic acids.
[0349] Frozen cells are simply thawed and lysed by addition of a buffer containing the CyQUANT.
[0350] For the assay, tumorigenic breast cancer cells BT-474 cells were seeded at 2500 cells per well in a 96-well plate and incubated over-night at 37 C. Then, fresh medium containing different concentration of the compounds or vehicle (DMSO) was added and cells were growth 48 h at 37 C. Finally, cells were frozen at 80 C. and then processed according to the manufacture instructions. A minimum of triplicate data for each dose was used for the analysis.
[0351] Data were collected and analyzed with Prism 5 software to calculate the growth inhibition curve.
[0352] In particular, values obtained from the DMSO treated cells was set at 100% of growth. Data from treatment of cells with serial dilutions of the compounds were normalized versus the DMSO group and fitted using a four-parameter dose-response curve.
[0353] GI.sub.50 was calculated as the concentration of compound that gives a response half way between bottom and top plateaus of the fitted curve.
[0354] The bottom plateaus of the fitted curve was used to calculate the Growth Inhibition max (GI max), defined as the percentage of the reduction of cells after 48 h upon a saturating dose of compound. The results obtained are reported in Table 28 below.
[0355] Biological Activities of the Compounds of the Examples
[0356] The different compounds were tested for their ability to inhibit the growth of the tumorigenic breast cancer cells BT-474 and for their antagonistic activity toward REV-ERB transcriptional repression, as described in the biological method section. The results are illustrated in Table 28.
TABLE-US-00001 TABLE 28 Cell Growth REV-ERB Inibition antagonism Example GI.sub.50 (M) GI.sub.max (%) EC.sub.50 (M) 1 18 72% 25 2 30 55% 45 3 14 95% 20 4 30 73% 47 5 26 75% 43 7 18 70% 24 9 30 50% 50 10 15 70% 25 11 24 70% 40 12 23 77% 40 14 19 82% 23 17 18 90% 21 18 2 95% 8 19 5 90% 11 20 11 92% 12 21 50 76% 35 22 14 80% 15 23 10 90% 10 25 18 70% 29 27 12 70% 16 30 3 95% 6 32 1 97% 2 33 30 70% 38
[0357] For the cell growth inhibition (GI) the growth inhibition 50 (GI.sub.50) and the growth inhibition max (GI.sub.max) are reported. GI.sub.50 corresponds to the concentration of compound that gives a response half between the Top (no inhibition=percentage of cells equal to DMSO group) and Bottom (percentage of cells after 48 h treatment) plateaus of the fitted curves. The bottom plateaus of the curve was used to calculate the Growth Inhibition max (GI.sub.max), defined as the percentage of the reduction of cells after 48 h upon a saturating dose of the administered compound. Compounds with a GI.sub.50<100 M were also tested for their antagonistic activity toward REV-ERB. For these compounds, the EC.sub.50 value is provided, calculated as the concentration of compound that gives a response half between the bottom (expression of the reporter in absence of compound) and the top (expression of the reporter at saturating doses of compound) plateaus of the fitted curves (see biological method section for a description of the reported assay). n.d.=not determined; n.t.=not tested.
[0358] Gene Expression Analysis of Endogenous REV-ERB Target Genes after Treatment with the Compound of Example 1
[0359] In order to test the effect of the compound of example 1 on the endogenous REV-ERB mediated transcription, BT-474 cells were treated 24 h with different doses of the compound of the example 1 and then processed for RNA extraction.
[0360] Total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacture instruction. One microgram of RNA was retro-transcribed with VILO retrotranscription mix (Invitrogen) and subsequently analyzed by qPCR as described in Grimaldi et al., Cell Metab., 2010; 12:509-520.
[0361] The REV-ERB targets Per1, Bmal1, Nampt, and p21 were analyzed. Gapdh gene was used to normalize the data, while Hprt1 gene was used as independent REV-ERB gene (negative control).
[0362] Primers used for analysis are listed in Table 29.
TABLE-US-00002 TABLE29 Gene name Alias Leftprimer Rightprimer Per1 Per1 CAGTGCTCCTGTTCCTGCATC CCCGCCAACTGCAGAATCT (SEQIDNO:1) (SEQIDNO:2) Arnt1 Bmal1 CCAGAGGCCCCTAACTCCTC TGGTCTGCCATTGGATGATCT (SEQIDNO:3) (SEQIDNO:4) Nampt Visfatin/ GAGTTCAACATCCTCCTGGC TCACGGCATTCAAAGTAGGA Pebf (SEQIDNO:5) (SEQIDNO:6) Gapdh Gapdh AAGGTGAAGGTCGGAGTCAA AATGAAGGGGTCATTGATGG (SEQIDNO:7) (SEQIDNO:8) Hprt1 Hprt1 GTTATGGCGACCCGCAG ACCCTTTCCAAATCCTCAGC (SEQIDNO:9) (SEQIDNO:10) Cdkn1a p21 AGTCAGTTCCTTGTGGAGCC CATGGGTTCTGACGGACAT (SEQIDNO:11) (SEQIDNO:12)
[0363] Indeed, example 1 induced in a dose-dependent manner the expression of REV-ERBs endogenous targets involved in circadian regulation (Per1 and Bmal1), metabolism (Nampt) and cell cycle (p21), while it showed negligible effects on the REV-ERB independent gene Hprt1. The results obtained are illustrated in
[0364] Growth Inhibition of Different Tumor Cell Lines after Treatment with the Compound of Example 1
[0365] To test if the growth inhibition activity of the compound of example 1 was limited to breast cancer BT-474 cells, or if it could be generalized in other tumor cells from different tissues, the GI50 of compound of example 1 was tested in several cell lines. In addition, because biological data suggested a p53-independent activity of the compound of example 1, cells with a different status of the tumor suppressor p53 protein were exploited.
[0366] The results are illustrated in Table 30.
TABLE-US-00003 TABLE 30 Cell line Origin p53 status GI50 (M) HCT116 Colorectal Wild-Type 19 carcinoma HCT116-E6 Colorectal No protein 20 carcinoma expression CaCO2 Colorectal No protein 18 adenocarcinoma expression WiDr Colon Mutant 12 adenocarcinoma protein Colo-205 Colon Mutant 30 metastatic protein site: ascites HepG2 Liver Wild-Type 10 hepatocellular carcinoma SK-Hep1 Liver Wild-Type 50 adenocarcinoma Hep3B Liver No protein 10 hepatocellular expression carcinoma HuH7 Liver Mutant 8 hepatocellular protein carcinoma
[0367] Indeed, the compound of example 1 displayed growth inhibition activity in different tumor cell lines, independently from the expression (status) of the tumor suppressor p53 (i.e. cells expressing a wild-type or mutated p53 protein, and cells in which p53 expression is ablated).
TABLE-US-00004 TABLE 1 Example Molecular Structure Molecular Formula MW Name 1 CAS number: 1287451- 26-6
TABLE-US-00005 TABLE 2 UPLC/MS [m/z, Molecular Molecular rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00006 TABLE 3 Molecular Molecular Structure Formula MW Name .sup.1H-NMR
TABLE-US-00007 TABLE 4 UPLC/MS Amine Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 1
TABLE-US-00008 TABLE 5 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00009 TABLE 6 UPLC/MS Amine Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 4
TABLE-US-00010 TABLE 7 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00011 TABLE 8 UPLC/MS Amine Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 7
TABLE-US-00012 TABLE 9 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00013 TABLE 10 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00014 TABLE 11 UPLC/MS Aldehyde Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 16
TABLE-US-00015 TABLE 12 Molecular Molecular UPLC/MS Structure Formula MW Name .sup.1H-NMR [m/z, rt (min)]
TABLE-US-00016 TABLE 13 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00017 TABLE 14 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00018 TABLE 15 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00019 TABLE 16 UPLC/MS Aldehyde Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 18
TABLE-US-00020 TABLE 17 Example Molecular Structure Molecular Formula MW Name 21
TABLE-US-00021 TABLE 18 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00022 TABLE 19 Molecular Molecular Structure Formula MW Name .sup.1H-NMR
TABLE-US-00023 TABLE 20 UPLC/MS Amine Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 19
TABLE-US-00024 TABLE 21 UPLC/MS [m/z Molecular Molecular rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00025 TABLE 22 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00026 TABLE 23 UPLC/MS Aldehyde Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 25
TABLE-US-00027 TABLE 24 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00028 TABLE 25 UPLC/MS Molecular Molecular [m/z, rt Structure Formula MW Name .sup.1H-NMR (min)]
TABLE-US-00029 TABLE 26 Molecular Molecular Structure Formula MW Name .sup.1H-NMR
TABLE-US-00030 TABLE 27 UPLC/MS Aldehyde Molecular Molecular [m/z, rt Intermediate Structure Formula MW Name .sup.1H-NMR (min)] 28