Therapeutic Antibodies
20170137529 ยท 2017-05-18
Inventors
- Herman WALDMANN (Oxford, GB)
- Mark Raymond Frewin (Oxford, GB)
- Lisa Kim Gilliland (Balemo, GB)
- Luis Richardo Simoes Da Silva Graca (Oxford, GB)
Cpc classification
C07K2317/41
CHEMISTRY; METALLURGY
A61K47/64
HUMAN NECESSITIES
C07K2317/51
CHEMISTRY; METALLURGY
C07K2318/10
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
A61K47/65
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
A61K47/6849
HUMAN NECESSITIES
C07K2317/92
CHEMISTRY; METALLURGY
International classification
Abstract
A pharmaceutical comprising a therapeutic protein that binds to a therapeutic target, the protein being modified with a compound that inhibits binding of the protein to the therapeutic target, the modified protein being effective for reducing an immune response against the protein and for producing a therapeutic effect by binding to the therapeutic target. The therapeutic protein may be an antibody that includes an antibody combining site that binds to the therapeutic target.
Claims
1-34. (canceled)
35. A modified therapeutic antibody comprising a cell-binding antibody that includes an antibody combining site that binds to a cell-bound target antigen, said antibody being modified with a peptide that inhibits binding of the antibody to the target antigen, wherein the peptide comprises the target antigen or a domain or mimotope thereof which is reversibly bound to the antibody combining site of the antibody, said modified antibody being effective for reducing an immune response against the antibody and for producing a therapeutic effect by binding to the target antigen.
36. The modified therapeutic antibody of claim 35 wherein the peptide bound to the antibody combing site also is linked to the antibody.
37. The modified therapeutic antibody of claim 35 wherein the antibody includes a light chain and a heavy chain, and wherein only one of the chains of the antibody has a peptide linked thereto that binds to the antibody combining site.
38. The modified therapeutic antibody of claim 35 wherein the avidity of the modified antibody combined with the peptide for the target antigen is at least 4 fold less than the avidity of the unmodified antibody.
39. The modified therapeutic antibody of claim 38 wherein the modified antibody has an avidity for the target antigen that is at least 100 fold less than the avidity of the unmodified antibody for the target antigen.
40. The modified therapeutic antibody of claim 38 wherein the antibody is an aglycosylated antibody.
41. The modified therapeutic antibody of claim 36 wherein the Fc portion of the antibody is aglycosylated.
42. The modified therapeutic antibody of claim 36 wherein binding of the antibody to the Fc receptor is essentially eliminated.
43. The modified therapeutic antibody of claim 35 wherein the antibody is a non-human antibody.
44. The modified therapeutic antibody of claim 35 wherein the antibody is a chimeric antibody.
45. The modified therapeutic antibody of claim 35, wherein the antibody has a peptide reversibly bound to the antibody combining site whereby said target antigen competes for and displaces the peptide from the antibody combing site, said peptide inhibiting binding of the antibody to the target antigen, said modified antibody initially binding to the target antigen in an amount that is lower than the unmodified antibody, with said binding to the target antigen increasing as a result of peptide being displaced from the antibody combining site as the antibody becomes bound to the target antigen.
46. The modified therapeutic antibody of claim 36 wherein the antibody is a modified alemtuzumab (CAMPATH-1H) antibody.
47. The modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 mimotope having amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by a flexible Glycine4 Serine x2 Linker and (CAMPATH-1H) heavy chain with wild type human IgG1 constant region.
48. The modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 Mimotope having the amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by flexible Glycine4 Serine x2 Linker and (CAMPATH-1H) heavy chain with an aglycosyl human IgG1 constant region.
49. A modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 Mimotope having amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by flexible Glycine4 Serine x2 Linker and alemtuzumab (CAMPATH-1H) heavy chain with an FcR-mutated human IgG1 constant region.
50. The modified antibody of claim 47, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO 2.
51. The modified antibody of claim 48, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO. 2.
52. The modified antibody of claim 49, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO. 2.
53. A pharmaceutical composition comprising the modified therapeutic antibody of claim 35.
54. A method of treating a disease selected from the group consisting of cancer, rheumatoid arthritis, diabetes, psoriasis, multiple sclerosis, systemic lupus, asthma, myocardial infarction, stroke, and infectious diseases in an animal comprising: administering to said animal the modified therapeutic antibody of claim 35, wherein said modified therapeutic antibody is administered in an amount effective to treat said disease in said animal.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] The invention now will be described with respect to the drawings wherein:
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064] The following examples illustrate the invention.
EXAMPLES
Materials and Methods
[0065] The humanised anti-CD52 antibody CAMPATH-1H was used in the following experiments. Various constructs were made using the CAMPATH-1H antibody and the following methodology.
Generation of Non-Binding Variants of CAMPATH-1H:
[0066] The cloning of the V-regions of the humanised antibody CAMPATH-1H specific for the human CD52 antigen is performed as described in Gilliland et al (1999) The Journal of Immunology 162:33663-3671. The methodology is based on that of Orlandi et al., 1989, PNAS 86: 3833, using the polymerase chain reaction (PCR). The wild-type humanised CAMPATH-1 light chain was cloned into the vector pGEM 9 (Promega) and used as a PCR template for site-directed mutagenesis.
[0067] A flexible linker (Gly4Ser2) was added to the amino-terminal end of the light chain between the CAMPATH-1H leader sequence and CAMPATH-1H VL sequence using the oligonucleotide primers PUCSE2 and Link L-3+Link-L-5 and PUCSE REV. The resulting fragments were PCR assembled using primers PUCSE2+PUCSE REV to give full length Linker-CP-1H light chain which could be cloned into expression vector as Hind111/Hind 111 fragment.
[0068] The Linker-CP-1H light chain construct was then used as a PCR template to generate the CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) and P61 SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) peptide constructs. Primers PUCSE2 and MIM-3+CD52Mim-5 and PUCSE REV were used to give Mimotope-CP-1H light chain construct. Primers PUCSE2 and P61-3+HuP61-5 and PUCSE REV were used to give P61-CP-1H light chain construct.
[0069] Linker-CP-1H, Mimotope-CP-1H, P61-CP-1H mutants were transferred to pBAN-2, a derivative of the pNH316 mammalian expression vector containing neomycin selection (Page et al. 1991 Biotechnology 9:64-68). and PEE 12 a mammalian expression vector containing the Glutamine Synthetase gene for selection Bebbington et al. 1992 Biotechnology 10:169-175.
[0070] Subconfluent dhfr.sup. Chinese Hamster Ovary cells (Page et al. 1991 Biotechnology 9:64-68) or NSO mouse myeloma cells (ECACC cat no 8511503, Meth Enzymol 1981, 73B,3) were co-transfected with the light chain mutants and the CAMPATH-1H heavy chain construct with wild type human IgG1 constant region, aglycosyl human IgG1 constant region and Non FcR binding human IgG1 constant region.
[0071] CAMPATH 1H heavy chain constructs were expressed in pRDN-1 a variant of the pLD9 mammalian expression vector with a dhfr selectable marker (Page et al. 1991 Biotechnology 9:64-68) and PEE 12.
[0072] Transfection was carried out using LipofectAMINE PLUS reagent (Life Technologies) following the manufacturers recommendations.
[0073] Human IgG1 constant was derived from the wild type G1m (1,17) gene described by Takahashi et al., 1982 Cell 29, 671-679. Aglycosyl mutation at position 297 from asparagine to an alanine residue. Oligosaccharide at Asn-297 is a characteristic feature of all normal human IgG antibodies (Kabat et al, Sequence of proteins of immunological interest US Department of Health human services publication). Substitution of asparagine with alanine prevents the glycosylation of the antibody (Routledge and Waldman, Transplantation, 1995, 60). Non FcR binding mutation at position 235 from leucine to alanine and position 237 from glycine to alanine Xu et al,. 1993 J Immunology 150: 152A. Substitution of leucine and glycine at positions 235 and 237 prevents complement fixation and activation.
[0074] Heavy and Light chain transfectants are selected for in hypoxanthine free IMDM containing 1 mg G418+5% (v/v) dialysed foetal calf serum. Resulting selected cells are screen for antibody production by ELISA and for antigen binding to human T cell clone HUT 78 Gootenberg J E et al. 1981 J. Exp. Med. 154: 1403-1418 and CD52 transgenic mice.
[0075] Cells producing antibody were cloned by limiting dilution, and then expanded into roller bottles cultures. The immunoglobulin from approximately 15 litres of tissue culture supernatant from each cell line is purified on protein A, dialysed against PBS and quantified.
List of Primers Used
[0076]
TABLE-US-00001 PUCSE-2 5-CACAGATGCGTAAGGAGAAAATAC-3 PUCSEREV 5-GCAGTGAGCGCAACGCAAT-3 LINK-L3 5-GCTTCCGCCTCCACCGGATCCGCCACCTCCTTG GGAGTGGACACCTGTAGCTGTTGCTAC-3 LINK-L5 5-GGAGGTGGCGGATCCGGTGGAGGCGGAAGC GACATCCAGATGACCCAGAGCCCAAG-3 MIM-3 5-GTCTGCTGATGGGCTGCTGGTTTGGGAGTGGAC ACCTGTAGCTGTTGC-3 CD52Mim-5 5-CAAACCAGCAGCCCATCAGCAGACGGAGGT GGCGGATCCGGTGGAGGA-3 P61-3 5-CTCCACGATTGCTGGCAGCAGGCTTTGGGAGTG GACACCTGTAGCTGTTG-3 HuP61- 5AGCCTGCTGCCAGCAATCGTGGAGCTGGGAGGT GGCGGATCCGGTGGAG-3
[0077] A blocking ligand was based on a published sequence of antibody peptide mimotope (Hale G 1995 Immunotechnology 1,175-187) and was engineered into the wild-type CAMPATH-1H antibody as a cDNA sequence with a generic linker to attach the peptide product to the antibody light chain so as to enable the antibody to be secreted with its ligand bound in the antibody combining site. A similar antibody also had its Fe-region mutated so as to remove the glycosylation site at position 297.
Constructs/Cell Lines Produced
TF CHO/CP-1H IgG1/MIM and TF NSO/CP-1H IgG1/MIM (MIM IgG1)
[0078] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+Campath-1H heavy chain with wild type human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody and Wellcome pRDN-1 and pBAN-2 expression vectors for CHO produced antibody.
TF NSO/CP-1H AG IgG1/MIM (AG MIM IgG1)
[0079] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain Aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.
TF NSO/CP-1H FCR IgG1/MIM (FcRmutMIM IgG1)
[0080] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain FcR-MUTATED human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.
TF CHO/CP-1H IgG1/Link (Linker)
[0081] Flexible Glycine4 Serine x2 Linker only on CAMPATH-1H light chain V-region+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN-2 for CHO produced antibody.
TF CHO/CP-1H IgG1/P61 (P61-IgG1)
[0082] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) (Hunt et al Science 1992 255 1261-1263) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN for CHO produced antibody.
TF NSO/CP-1H AG IgG1/P61 (AGP61 IgG1)
[0083] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.
TF NSO/CP-1H FCR IgG1/P61 (FcRmut P61 IgG1)
[0084] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with no FCR human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.
TF CHO/CO-1H IgG1 (CAMPATH-1H)
[0085] Wild type CAMPATH-1H light chain V-region+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN-2 for CHO produced antibody.
TF NSO/CP-1H AG IgG1 (AG-IgG1)
[0086] Wild type Campath01H light chain V-region+CAMPATH-1H heavy chain with aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.
Results
[0087] A high dose of the purified, secreted products (CAMPATH-1H, MIM-IgG1, AG.MIM-IgG1) was injected into mice made transgenic for human CD52 (Gilliland et al). After one week the antibody could be found binding to cells in all 3 groups, whereas lymphocyte depletion could only be seen in the CAMPATH-1H and MIM-IgG1 groups.
[0088] Mice were then challenged with the wild-type antibody on multiple occasions and could mount only poor xenogenic humoral responses, unlike mice which had not received the tolerogen or mice that had, instead been treated with the wild-type CAMPATH-1H antibody from the outset. Mice tolerised with the aglycosylated form of MIM-IgG1 (AG.MIM-IgG1) were completely unable to mount a xenogenic response even after 10 challenge doses of the therapeutic CAMPATH-1H antibody.
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096] Numerous modifications and variations of the embodiments described herein are possible based on the teachings herein; therefore, the scope of the invention is not limited to such embodiments.