Therapeutic Antibodies

20170137529 ยท 2017-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    A pharmaceutical comprising a therapeutic protein that binds to a therapeutic target, the protein being modified with a compound that inhibits binding of the protein to the therapeutic target, the modified protein being effective for reducing an immune response against the protein and for producing a therapeutic effect by binding to the therapeutic target. The therapeutic protein may be an antibody that includes an antibody combining site that binds to the therapeutic target.

    Claims

    1-34. (canceled)

    35. A modified therapeutic antibody comprising a cell-binding antibody that includes an antibody combining site that binds to a cell-bound target antigen, said antibody being modified with a peptide that inhibits binding of the antibody to the target antigen, wherein the peptide comprises the target antigen or a domain or mimotope thereof which is reversibly bound to the antibody combining site of the antibody, said modified antibody being effective for reducing an immune response against the antibody and for producing a therapeutic effect by binding to the target antigen.

    36. The modified therapeutic antibody of claim 35 wherein the peptide bound to the antibody combing site also is linked to the antibody.

    37. The modified therapeutic antibody of claim 35 wherein the antibody includes a light chain and a heavy chain, and wherein only one of the chains of the antibody has a peptide linked thereto that binds to the antibody combining site.

    38. The modified therapeutic antibody of claim 35 wherein the avidity of the modified antibody combined with the peptide for the target antigen is at least 4 fold less than the avidity of the unmodified antibody.

    39. The modified therapeutic antibody of claim 38 wherein the modified antibody has an avidity for the target antigen that is at least 100 fold less than the avidity of the unmodified antibody for the target antigen.

    40. The modified therapeutic antibody of claim 38 wherein the antibody is an aglycosylated antibody.

    41. The modified therapeutic antibody of claim 36 wherein the Fc portion of the antibody is aglycosylated.

    42. The modified therapeutic antibody of claim 36 wherein binding of the antibody to the Fc receptor is essentially eliminated.

    43. The modified therapeutic antibody of claim 35 wherein the antibody is a non-human antibody.

    44. The modified therapeutic antibody of claim 35 wherein the antibody is a chimeric antibody.

    45. The modified therapeutic antibody of claim 35, wherein the antibody has a peptide reversibly bound to the antibody combining site whereby said target antigen competes for and displaces the peptide from the antibody combing site, said peptide inhibiting binding of the antibody to the target antigen, said modified antibody initially binding to the target antigen in an amount that is lower than the unmodified antibody, with said binding to the target antigen increasing as a result of peptide being displaced from the antibody combining site as the antibody becomes bound to the target antigen.

    46. The modified therapeutic antibody of claim 36 wherein the antibody is a modified alemtuzumab (CAMPATH-1H) antibody.

    47. The modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 mimotope having amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by a flexible Glycine4 Serine x2 Linker and (CAMPATH-1H) heavy chain with wild type human IgG1 constant region.

    48. The modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 Mimotope having the amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by flexible Glycine4 Serine x2 Linker and (CAMPATH-1H) heavy chain with an aglycosyl human IgG1 constant region.

    49. A modified therapeutic antibody of claim 35 wherein the antibody comprises the CD52 Mimotope having amino acid sequence QTSSPSAD tethered to alemtuzumab (CAMPATH-1H) light chain V-region by flexible Glycine4 Serine x2 Linker and alemtuzumab (CAMPATH-1H) heavy chain with an FcR-mutated human IgG1 constant region.

    50. The modified antibody of claim 47, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO 2.

    51. The modified antibody of claim 48, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO. 2.

    52. The modified antibody of claim 49, wherein the light chain of the antibody comprises the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO. 2.

    53. A pharmaceutical composition comprising the modified therapeutic antibody of claim 35.

    54. A method of treating a disease selected from the group consisting of cancer, rheumatoid arthritis, diabetes, psoriasis, multiple sclerosis, systemic lupus, asthma, myocardial infarction, stroke, and infectious diseases in an animal comprising: administering to said animal the modified therapeutic antibody of claim 35, wherein said modified therapeutic antibody is administered in an amount effective to treat said disease in said animal.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0053] The invention now will be described with respect to the drawings wherein:

    [0054] FIG. 1 shows the results of binding studies which show that the form of CAMPATH-1H, with the mimotope bound by a flexible linker, is not able to bind to human T-cell line HUT78 which carries CD52 by comparison with forms of CAMPATH-1H carrying the linker alone (linker), an irrelevant peptide linked in the same way (p61-IgG1), the linker with mimotope attached (MIM-IgG1), as well as aglycosylated (removal of asparagine at position 297 of the H-chain) forms of the various antibodies (AG etc). It should be noted that AG.MIM-IgG1 form is also non-cell binding, and that the mere insertion of the linker itself reduces binding of CAMPATH-1H by about 4 fold.

    [0055] FIG. 2 shows a Fluorescent Activated cell Sorter (FACS) dot-plot examining the binding of CAMPATH-1H antibody on the lymphocytes of CP-1-transgenic mice given various antibody constructs (0.5 mg) intraperitoneally (IP) 3 hours earlier. Peripheral blood and splenic lymphocytes were stained with an anti-human IgG1 to show up any accumulated antibody on their surface. In FIG. 2A we examined peripheral blood lymphocytes. Mice treated with the CAMPATH-1H and the AG-CAMPATH-1H form were very brightly stained, in fact saturated with antibody. Indeed some depletion of T-cells from the blood is seen at this stage with both constructs (4% and 32% of the lymphocytes being CD3+). The p61-IgG1 and AG-p61-IgG1 constructs also stain strongly, and achieve some depletion at this time (13.5% and 23% of the blood lymphocytes being CD3+). Mim-IgG1 stains the T-cells in the blood, albeit less effectively than the above constructs, and very little depletion is seen at this stage (65.7%) of the lymphocytes are CD3+). Finally, the AG-MIM-IgG1 binds very weakly to blood lymphocytes and that weak binding is not associated with any T-cell depletion at this stage. In FIG. 2B comparable data are presented on splenic lymphocytes. Here we can see that both MIM-IgG1 and AG-MIM-IgG1 are extremely inefficient at binding and depletion unlike the other constructs that have achieved around 50% depletion by this stage.

    [0056] FIG. 3 shows that even though the MIM-IgG1 and AG.MIM-IgG1 antibodies bind poorly to antigen in-vitro, they do bind to CD52+ cells (in CP-1 transgenic mice) in-vivo. 7 days after the administration of 500 g of each antibody spleen and blood lymphocytes were analysed by flow cytometry. This figure shows that AG.MIM-IgG1 has bound to the CD3+ cells of the animal, and that the intensity of staining is higher than in FIG. 2. MIM-IgG1 has done the same but clearly some depletion has taken place as the percentage of CD3+ cells in the animals is less (1.7% in spleen vs 36.6% for AG.MIM-IgG1; and 16.1% in blood vs 78.9% for AG.MIM-IgG1).

    [0057] FIG. 4 shows the effects, on peripheral blood lymphocyte counts, of treating mice transgenic for the CAMPATH-1 antigen (CP-1 mice) with different doses of CAMPATH-1H with (MIM-IgG1) or without the bound mimotope (CAMPATH-1H)). Peripheral blood lymphocytes (PBL) were analysed by flow cytometry. The left column shows the results of mice treated with 1 g to 50 g of antibody and the right column shows the results of the second experiment where animals were treated with 0.1 mg to 0.5 mg of antibody. The therapeutic antibody can kill host lymphocytes within 24 hours at doses down to 5 g/ml whereas the antibody with mimotope bound is not able to do so with doses up to 250 g/ml. In contrast at 21 days there are clear effects of depletion seen at the 250 g and 500 g doses of with mimotope while with the therapeutic antibody CAMPATH-1H lymphocytes are beginning to replenish the blood.

    [0058] FIG. 5 shows the immunogenicity of the various antibody constructs in CP-1 transgenic mice. Sera were taken from CP-1 mice treated with different doses of test antibodies. Sera were collected 21 days (expt. A) or 28 days (expt. B) after administration and assessed for the presence of anti-CAMPATH-1H Abs by ELISA. Serum samples were diluted 1:20 in PBS 1% BSA and subsequently in two-fold dilutions. All doses of the therapeutic antibody CAMPATH-1H were immunogenic, while responses to all other modified forms were much lower (including p61-IgG1). Remarkably, 500 g of the aglycosylated form with the mimotope (AG.MIM-IgG1) bound generated absolutely no response whatsoever. In Fig. B it can be seen that the failure of AG.MIM.IgG1 to immunise is not just the result of the mutation to remove the glycosylation of the FC region, as AG-CAMPATH-1H proved very immunogenic. The specificity of the effect for the mimotope was also clearly established as AG-p61-IgG1 was also quite immunogenic.

    [0059] FIG. 6A examines the tolerogenicity of the various antibody constructs in CP-1 transgenic mice and shows the results of sera from CP1 mice treated with different doses of Ab at day 0 which were collected 30 days after challenge with 5 daily intraperitoneal injections of 50 g of CAMPATH-1H and assessed for the presence of anti-CAMPATH-1H Abs by ELISA. Serum samples were diluted 1:20 in phosphate buffered saline (PBS) containing 1% BSA and subsequently titrated out in twofold dilutions. In the left hand figure mice were left 60 days before receiving the challenge CAMPATH-1H antibody, while in the right-hand figure they were left 21 days. The left figure (FIG. 5a) shows that animals pre-treated with any of 100, 250 or 500 g doses of the mimotope were very impaired in their humoral response to CAMPATH-1H. This indicates some level of tolerisation. However, the right hand figure shows that mice were completely tolerised with the aglycosylated form of the MIM-binding antibody, but only partially impaired with the antibody binding the irrelevant peptide.

    [0060] FIG. 6B examines the tolerogenic potential of the constructs are repeat boosting with the challenge antibody CAMPATH-1H. These are the results for the same animals seen in FIG. 5A, which had received a further challenge with 5 doses of 50 g CAMPATH-1H antibody at the time of the previous sera collection. Sera from these animals were then collected 30 days after the rechallenge and analysed as described in FIG. 5. The conclusions are similar to those in FIG. 6A.

    [0061] FIGS. 7 and 8A and 8B show the nucleotide and amino acid sequence for the construct MIM-IgG1 used in the following examples.

    [0062] FIGS. 9A and 9B and 10 show the nucleotide and amino acid sequence for the linker used in the following examples.

    [0063] FIGS. 11A and 11B and 12 show the nucleotide and amino acid sequence for P61-IgG1 used in the following examples.

    [0064] The following examples illustrate the invention.

    EXAMPLES

    Materials and Methods

    [0065] The humanised anti-CD52 antibody CAMPATH-1H was used in the following experiments. Various constructs were made using the CAMPATH-1H antibody and the following methodology.

    Generation of Non-Binding Variants of CAMPATH-1H:

    [0066] The cloning of the V-regions of the humanised antibody CAMPATH-1H specific for the human CD52 antigen is performed as described in Gilliland et al (1999) The Journal of Immunology 162:33663-3671. The methodology is based on that of Orlandi et al., 1989, PNAS 86: 3833, using the polymerase chain reaction (PCR). The wild-type humanised CAMPATH-1 light chain was cloned into the vector pGEM 9 (Promega) and used as a PCR template for site-directed mutagenesis.

    [0067] A flexible linker (Gly4Ser2) was added to the amino-terminal end of the light chain between the CAMPATH-1H leader sequence and CAMPATH-1H VL sequence using the oligonucleotide primers PUCSE2 and Link L-3+Link-L-5 and PUCSE REV. The resulting fragments were PCR assembled using primers PUCSE2+PUCSE REV to give full length Linker-CP-1H light chain which could be cloned into expression vector as Hind111/Hind 111 fragment.

    [0068] The Linker-CP-1H light chain construct was then used as a PCR template to generate the CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) and P61 SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) peptide constructs. Primers PUCSE2 and MIM-3+CD52Mim-5 and PUCSE REV were used to give Mimotope-CP-1H light chain construct. Primers PUCSE2 and P61-3+HuP61-5 and PUCSE REV were used to give P61-CP-1H light chain construct.

    [0069] Linker-CP-1H, Mimotope-CP-1H, P61-CP-1H mutants were transferred to pBAN-2, a derivative of the pNH316 mammalian expression vector containing neomycin selection (Page et al. 1991 Biotechnology 9:64-68). and PEE 12 a mammalian expression vector containing the Glutamine Synthetase gene for selection Bebbington et al. 1992 Biotechnology 10:169-175.

    [0070] Subconfluent dhfr.sup. Chinese Hamster Ovary cells (Page et al. 1991 Biotechnology 9:64-68) or NSO mouse myeloma cells (ECACC cat no 8511503, Meth Enzymol 1981, 73B,3) were co-transfected with the light chain mutants and the CAMPATH-1H heavy chain construct with wild type human IgG1 constant region, aglycosyl human IgG1 constant region and Non FcR binding human IgG1 constant region.

    [0071] CAMPATH 1H heavy chain constructs were expressed in pRDN-1 a variant of the pLD9 mammalian expression vector with a dhfr selectable marker (Page et al. 1991 Biotechnology 9:64-68) and PEE 12.

    [0072] Transfection was carried out using LipofectAMINE PLUS reagent (Life Technologies) following the manufacturers recommendations.

    [0073] Human IgG1 constant was derived from the wild type G1m (1,17) gene described by Takahashi et al., 1982 Cell 29, 671-679. Aglycosyl mutation at position 297 from asparagine to an alanine residue. Oligosaccharide at Asn-297 is a characteristic feature of all normal human IgG antibodies (Kabat et al, Sequence of proteins of immunological interest US Department of Health human services publication). Substitution of asparagine with alanine prevents the glycosylation of the antibody (Routledge and Waldman, Transplantation, 1995, 60). Non FcR binding mutation at position 235 from leucine to alanine and position 237 from glycine to alanine Xu et al,. 1993 J Immunology 150: 152A. Substitution of leucine and glycine at positions 235 and 237 prevents complement fixation and activation.

    [0074] Heavy and Light chain transfectants are selected for in hypoxanthine free IMDM containing 1 mg G418+5% (v/v) dialysed foetal calf serum. Resulting selected cells are screen for antibody production by ELISA and for antigen binding to human T cell clone HUT 78 Gootenberg J E et al. 1981 J. Exp. Med. 154: 1403-1418 and CD52 transgenic mice.

    [0075] Cells producing antibody were cloned by limiting dilution, and then expanded into roller bottles cultures. The immunoglobulin from approximately 15 litres of tissue culture supernatant from each cell line is purified on protein A, dialysed against PBS and quantified.

    List of Primers Used

    [0076]

    TABLE-US-00001 PUCSE-2 5-CACAGATGCGTAAGGAGAAAATAC-3 PUCSEREV 5-GCAGTGAGCGCAACGCAAT-3 LINK-L3 5-GCTTCCGCCTCCACCGGATCCGCCACCTCCTTG GGAGTGGACACCTGTAGCTGTTGCTAC-3 LINK-L5 5-GGAGGTGGCGGATCCGGTGGAGGCGGAAGC GACATCCAGATGACCCAGAGCCCAAG-3 MIM-3 5-GTCTGCTGATGGGCTGCTGGTTTGGGAGTGGAC ACCTGTAGCTGTTGC-3 CD52Mim-5 5-CAAACCAGCAGCCCATCAGCAGACGGAGGT GGCGGATCCGGTGGAGGA-3 P61-3 5-CTCCACGATTGCTGGCAGCAGGCTTTGGGAGTG GACACCTGTAGCTGTTG-3 HuP61- 5AGCCTGCTGCCAGCAATCGTGGAGCTGGGAGGT GGCGGATCCGGTGGAG-3

    [0077] A blocking ligand was based on a published sequence of antibody peptide mimotope (Hale G 1995 Immunotechnology 1,175-187) and was engineered into the wild-type CAMPATH-1H antibody as a cDNA sequence with a generic linker to attach the peptide product to the antibody light chain so as to enable the antibody to be secreted with its ligand bound in the antibody combining site. A similar antibody also had its Fe-region mutated so as to remove the glycosylation site at position 297.

    Constructs/Cell Lines Produced

    TF CHO/CP-1H IgG1/MIM and TF NSO/CP-1H IgG1/MIM (MIM IgG1)

    [0078] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+Campath-1H heavy chain with wild type human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody and Wellcome pRDN-1 and pBAN-2 expression vectors for CHO produced antibody.

    TF NSO/CP-1H AG IgG1/MIM (AG MIM IgG1)

    [0079] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain Aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.

    TF NSO/CP-1H FCR IgG1/MIM (FcRmutMIM IgG1)

    [0080] CD52 Mimotope QTSSPSAD (amino acid residues 33-40 of SEQ ID NO: 1) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain FcR-MUTATED human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.

    TF CHO/CP-1H IgG1/Link (Linker)

    [0081] Flexible Glycine4 Serine x2 Linker only on CAMPATH-1H light chain V-region+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN-2 for CHO produced antibody.

    TF CHO/CP-1H IgG1/P61 (P61-IgG1)

    [0082] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) (Hunt et al Science 1992 255 1261-1263) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN for CHO produced antibody.

    TF NSO/CP-1H AG IgG1/P61 (AGP61 IgG1)

    [0083] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.

    TF NSO/CP-1H FCR IgG1/P61 (FcRmut P61 IgG1)

    [0084] HLA P61 binding peptide SLLPAIVEL (amino acid residues 27-35 of SEQ ID NO: 6) tethered to CAMPATH-1H light chain V-region by flexible Glycine4 Serine x2 Linker+CAMPATH-1H heavy chain with no FCR human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.

    TF CHO/CO-1H IgG1 (CAMPATH-1H)

    [0085] Wild type CAMPATH-1H light chain V-region+CAMPATH-1H heavy chain with wild type human IgG1 constant region. Cloned into Wellcome expression vectors pRDN-1 and pBAN-2 for CHO produced antibody.

    TF NSO/CP-1H AG IgG1 (AG-IgG1)

    [0086] Wild type Campath01H light chain V-region+CAMPATH-1H heavy chain with aglycosyl human IgG1 constant region. Cloned into Celltech expression vector PEE12 for NSO produced antibody.

    Results

    [0087] A high dose of the purified, secreted products (CAMPATH-1H, MIM-IgG1, AG.MIM-IgG1) was injected into mice made transgenic for human CD52 (Gilliland et al). After one week the antibody could be found binding to cells in all 3 groups, whereas lymphocyte depletion could only be seen in the CAMPATH-1H and MIM-IgG1 groups.

    [0088] Mice were then challenged with the wild-type antibody on multiple occasions and could mount only poor xenogenic humoral responses, unlike mice which had not received the tolerogen or mice that had, instead been treated with the wild-type CAMPATH-1H antibody from the outset. Mice tolerised with the aglycosylated form of MIM-IgG1 (AG.MIM-IgG1) were completely unable to mount a xenogenic response even after 10 challenge doses of the therapeutic CAMPATH-1H antibody.

    [0089] FIG. 1 shows the binding abilities of the various antibody constructs to CD52-bearing HUT cells. CAMPATH-1H binds with an efficiency approximately 2000 times superior to MIM-IgG1, 5 times than CAMPATH-1H-p61 (both P61-IgG1 and AG.P61-IgG1), and >10,000 times better than AG.MIM-IgG1.

    [0090] FIG. 2 shows a Fluorescent Activated cell Sorter (FACS) dot-plot examining the binding of CAMPATH-1H antibody on the lymphocytes of CP-1-transgenic mice given various antibody constructs (0.5 mg) intraperitoneally (IP) 3 hours earlier. Peripheral blood and splenic lymphocytes were stained with an anti-human IgG1 to show up any accumulated antibody on their surface. In FIG. 2A we examined peripheral blood lymphocytes. Mice treated with the CAMPATH-1H and the AG-MIM-IgG1 form were very brightly stained, in fact saturated with antibody. Indeed some depletion of T-cells from the blood is seen at this stage with both constructs (4% and 32% of the lymphocytes being CD3+). The p61-IgG1 and AG-p61-IgG1 constructs also stain strongly, and achieve some depletion at this time (13.5% and 23% of the blood lymphocytes being CD3+). Mim-IgG1 stains the T-cells in the blood, albeit less effectively than the above constructs, and very little depletion is seen at this stage (65.7%) of the lymphocytes are CD3+). Finally, the AG-MIM-IgG1 binds very weakly to blood lymphocytes and that weak binding is not associated with any T-cell depletion at this stage. In FIG. 2B comparable data are presented on splenic lymphocytes. Here we can see that both MIM-IgG1 and AG-MIM-IgG1 are extremely inefficient at binding and depletion unlike the other constructs that have achieved around 50% depletion by this stage.

    [0091] FIG. 3 shows that even though the MIM-IgG1 and AG.MIM-IgG1 antibodies bind poorly to antigen in-vitro, they do bind well to CD52+ cells (in CP-1 transgenic mice) in-vivo. 7 days after the administration of 500 ug of each antibody spleen and blood lymphocytes were analysed by flow cytometry. The figure shows that AG.MIM-IgG1 has bound to the CD3+ cells of the animal. MIM-IgG1 has done the same but clearly some depletion has taken place as the percentage of CD3+ cells in the animals is less (1.7% in spleen vs 36.6% for AG.MIM-IgG1; and 16.1% in blood vs 78.9% for AG.MIM-IgG1).

    [0092] FIG. 4 shows that mimotope-binding form of CAMPATH-1H (MIM-IgG1) is lytic for blood lymphocytes. After the first 24 hrs there is only limited cell-depletion in the blood. However after 7 days it can see that the high doses of MIM-IgG1 antibody do eliminate a significant number of blood lymphocytes. By 1 month the lymphocyte counts in treated hosts are comparable between the two forms of antibody at the high doses (250 g and 500 g). The left column (FIG. 4A) shows the level of blood lymphocyte depletion achieved in mice treated with 1 g to 50 g of antibody. At these doses, the mimotope-binding form did not deplete while CAMPATH-1H treated animals showed a dose-dependent depletion of T-cells. In the right column (FIG. 4B) CAMPATH-1H shows a fast and efficient depletion of T-cells, whilst the form with bound mimotope achieved a slower depletion that at 7 days was not as complete as with CAMPATH-1H treatment, but was maintained for a longer period. The decrease of hCD52+ cells was not due to coating of the antigen with the injected antibody as the results were confirmed by an equivalent decrease of CD4+ and CD8+ cells.

    [0093] FIG. 5A shows that the mimotope-binding antibody (MIM-IgG1) is poorly immunogenic, and that the aglycosylated form of CAMPATH-1H mimotope is not immunogenic at all. Animals treated with CAMPATH-1H had high titres of anti-CAMPATH-1H Abs, while the titres of mice treated with MIMOTOPE-bound form are far lower. Animals that received the aglycosylated form of the mimotope antibody that is not depleting, had no detectable antiglobulin response. In FIG. 5B it can be seen that the failure of AG.MIM.IgG1 to immunise is not just the result of the mutation to remove the glycosylation of the FC region, as AG-CAMPATH-1H proved very immunogenic. The specificity of the effect for the mimotope was also clearly established as AG-p61-IgG1 was also quite immunogenic.

    [0094] FIG. 6A shows that agylcosylated form of the mimotope-binding CAMPATH-1H antibody (AG.MIM-IgG1) is profoundly tolerogenic. The animals treated at day 0 with CAMPATH-1H linked to the control peptide, or the ones that received no treatment also had high titres of antiglobulin. The mice treated with the mimotope-binding antibody (MIM-IgG1) had much lower titres of antiglobulin, while animals that received the aglycoslylated form of the mimotope-binding antibody (AG.MIM-IgG1) that is not depleting, had no detectable antiglobulin in the sera.

    [0095] FIG. 6B confirms further that the aglycosylated form of mimotope-binding CAMPATH-1H (AG.MIM-IgG1) is profoundly tolerogenic. The results from FIG. 6B are similar to FIG. 6A with a larger difference in the antiglobulin titres between the groups treated at day 0 with CAMPATH-1H, CAMPATH-1H-p61 or untreated and those groups treated with the mimotope-binding antibodies. Again there were no detectable anti-globulins in mice treated with aglycosyl-form (AG.MIM-IgG1)

    [0096] Numerous modifications and variations of the embodiments described herein are possible based on the teachings herein; therefore, the scope of the invention is not limited to such embodiments.