NUCLEIC ACID SEQUENCES THAT CAN BE USED AS PRIMERS AND PROBES IN THE AMPLIFICATION AND DETECTION OF ALL SUBTYPES OF HIV-1

20170137900 ยท 2017-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the AIDS causing Human Immuno-deficiency Virus (HIV). With the present invention nucleotide sequences are provided that can be used as primers and probes in the amplification and detection of HIV-1 nucleic acid. The oligonucleotide sequences provided with the present invention are located in the LTR part of the HIV viral genome. It has been found that, by using the sequences of the present invention in methods for the amplification and detection of nucleic acid a sensitive and specific detection of HIV-1 can be obtained. The benefit of the sequences of the present invention primarily resides in the fact that, with the aid of primers and probes comprising the sequences according to the invention the nucleic acid of all presently known subtypes of HIV-1 can be detected with high accuracy and sensitivity. So far no primer pairs or hybridization probes have been developed that would allow the detection of such a broad range of HIV-1 variants. The oligonucleotide sequences according to the present invention are especially useful in methods for the amplification of nucleic acid.

    Claims

    1. A pair of oligonucleotide primers, for use as a single primer set in the amplification of a target sequence located within the LTR region of the genome of HIV-1, said primer pair consisting of a first oligonucleotide being 10-50 nucleotides in length and comprising at least a fragment of 10 sequential nucleotides of a sequence selected from the group consisting of: TABLE-US-00012 SEQID1: GGGCGCCACTGCTAGAGA; SEQID2: GTTCGGGCGCCACTGCTAGA; and SEQID3: CGGGCGCCACTGCTA; and a second oligonucleotide being 10-50 nucleotides in length and comprising at least a fragment of 10 sequential nucleotides of a sequence selected from the group consisting of: TABLE-US-00013 SEQID4: CTGCTTAAAGCCTCAATAAA; and SEQID5: CTCAATAAAGCTTGCCTTGA.

    2. The pair of oligonucleotides of claim 1, consisting of a first oligonucleotide being 10-50 nucleotides in length and comprising at least a fragment of 10 sequential nucleotides of the sequence: SEQ ID 1: G GGC GCC ACT GCT AGA GA; and a second oligonucleotide being 10-50 nucleotides in length and comprising at least a fragment of 10 sequential nucleotides of the sequence SEQ ID 5: CTC AAT AAA GCT TGC CTT GA.

    3. The pair of oligonucleotides of claim 1, wherein the first oligonucleotide is operably linked to the T7 promoter sequence.

    4. The pair of oligonucleotides of claim 3, consisting of a first oligonucleotide comprising the sequence of SEQ ID 9: aat tct aat acg act cac tat agg gAG AGG GGC GCC ACT GCT AGA GA and a second oligonucleotide comprising the sequence of SEQ ID 5: CTC AAT AAA GCT TGC CTT GA.

    5. The pair of oligonucleotides of claim 1, wherein the first oligonucleotide is 10-26 nucleotides in length.

    6. The pair of oligonucleotides of claim 1, wherein the second oligonucleotide is 10-26 nucleotides in length.

    7. The pair of oligonucleotides of claim 1, wherein the first oligonucleotide is 15-50 nucleotides in length and comprises at least a fragment of 15 sequential nucleotides of a sequence selected from the group consisting of: TABLE-US-00014 SEQID1: GGGCGCCACTGCTAGAGA; SEQID2: GTTCGGGCGCCACTGCTAGA; and SEQID3: CGGGCGCCACTGCTA.

    8. The pair of oligonucleotides of claim 1, wherein the second oligonucleotide is 15-50 nucleotides in length and comprises at least a fragment of 15 sequential nucleotides of a sequence selected from the group consisting of: TABLE-US-00015 SEQID4: CTGCTTAAAGCCTCAATAAA; and SEQID5: CTCAATAAAGCTTGCCTTGA.

    9. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 1 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    10. The method of claim 9, wherein the amplified HIV-1 nucleic acid is detected by contacting products of the amplification reaction of step (a) with one or more oligonucleotide probes having a sequence selected from the group consisting of: TABLE-US-00016 SEQID6: TCTGGTAACTAGAGATCCCTC; SEQID7: TAGTGTGTGCCCGTCTGT; and SEQID8: AGTGTGTGCCCGTCTGTT, under conditions whereby a hybridization complex can form, and detecting the presence of the hybridization complex, thereby detecting HIV-1 nucleic acid in the sample.

    11. A test kit for the detection of HIV-1 in a sample comprising: a) the pair of oligonucleotides of claim 1; and b) one or more detectably labeled oligonucleotides comprising a nucleic acid sequence substantially complementary to at least part of the target sequence produced in an amplification reaction comprising the pair of oligonucleotides of (a).

    12. The test kit of claim 11, wherein the one or more detectably labeled oligonucleotides is selected from the group consisting of: TABLE-US-00017 SEQID6: TCTGGTAACTAGAGATCCCTC; SEQID7: TAGTGTGTGCCCGTCTGT; and SEQID8: AGTGTGTGCCCGTCTGTT.

    13. A method for amplifying HIV-1 nucleic acid in a sample, comprising contacting the sample with the pair of oligonucleotides of claim 1 under conditions whereby an amplification reaction can occur.

    14. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 2 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    15. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 3 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    16. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 4 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    17. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 5 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    18. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 6 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    19. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 7 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    20. A method for the detection of HIV-1 nucleic acid in a sample, comprising: a) contacting the sample with the pair of oligonucleotides of claim 8 under conditions whereby an amplification reaction can occur; and b) detecting the presence of amplified HIV-1 nucleic acid, thereby detecting HIV-1 nucleic acid in the sample.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0012] FIGS. 1A and 1B: Amplification products after blotting, and detection by enhanced chemiluminescence obtained after amplification in presence (FIG. 1A) or absence (FIG. 1B) of HIV-1 RNA using the following primer pairs. Lane 1: SEQ ID 9-SEQ ID 10, lane 2; SEQ ID 9-SEQ ID 5, lane 3: SEQ ID 10-SEQ ID 4, lane 4: SEQ ID 10-SEQ ID 5, lane 5: SEQ ID 3-SEQ ID 12.

    DETAILED DESCRIPTION

    [0013] The oligonucleotide sequences according to the present invention are especially useful in methods for the amplification of nucleic acid.

    [0014] Various techniques for amplifying nucleic acid are known in the art. One example of a technique for the amplification of a DNA target segment is the so-called polymerase chain reaction (PCR). With the PCR technique the copy number of a particular target segment is increased exponentially with a number of cycles. A pair of primers is used and in each cycle a DNA primer is annealed to the 3 side of each of the two strands of the double stranded DNA-target sequence. The primers are extended with a DNA polymerase in the presence of the various mononucleotides to generate double stranded DNA again. The strands of the double stranded DNA are separated from each other by thermal denaturation and each strand serves as a template for primer annealing and subsequent elongation in a following cycle. The PCR method has been described in Saiki et Science 230, 135, 1985 and in European Patents no. EP 200362 and EP 201184.

    [0015] Another technique for the amplification of nucleic acid is the so-called transcription based amplification system (TAS). The TAS method is described in International Patent Appl. no, WO 88/10315. Transcription based amplification techniques usually comprise treating target nucleic acid with two oligonucleotides one of which comprises a promoter sequence, to generate a template including a functional promoter. Multiple copies of RNA are transcribed from said template and can serve as a basis for further amplification.

    [0016] An isothermal continuous transcription based amplification method is the so-called NASBA process (NASBA) as described in European Patent no. EP 329822. NASBA includes the use of T7 RNA polymerase to transcribe multiple copies of RNA from a template including a T7 promoter. Other transcription based amplification techniques are described in EP 408295. EP 408295 is primarily concerned with a two-enzyme transcription based amplification method. Transcription based amplification methods, such as the NASBA method as described in EP 329822, are usually employed with a set of oligonucleotides, one of which is provided with a promoter sequence that is recognized by a DNA dependent RNA polymerase such as, for example, T7 polymerase. Several modifications of transcription based techniques are known in the art. These modifications comprise, for example, the use of blocked oligonucleotides (that may be provided with a promoter sequence). These oligos are, blocked so as to inhibit an extension reaction proceeding therefrom (U.S. Pat. No. 5,554,516). One or more promoter-primers (oligonucleotides provided with a promoter sequence) may be used in transcription based amplification techniques, optionally combined with the use of one or more oligonucleotides that are not provided with a promoter sequence. For RNA amplification, a transcription based amplification technique, is a preferred technology. Amplification using PCR can also be based on an RNA template. The actual PCR needs to be preceded by a reverse transcription step to copy the RNA into DNA (RT-PCR). However, if RT-PCR is used for the detection of viral transcripts differentiation of mRNA- and DNA-derived PCR products is necessary. DNAse treatment prior to RT-PCR can be employed (Bitsch, A. et al., J. Infect. Dis 167, 740-743, 1993; Meyer, T. et al Mol. Cell Probes. 8, 261-271, 1994), but sometimes fails to remove contaminating DNA sufficiently (Bitsch, A, et al., 1993).

    [0017] In contrast to RT-PCR, NASBA, which is based on RNA transcription by T7 RNA polymerase (Kievits et al., 1991; Compton, 1991), does not need differentiation between RNA- and DNA-derived amplification products since it uses RNA as its principal target. NASBA enables specific amplification of RNA targets even in a background of DNA.

    [0018] The use of the oligonucleotides according to the invention is not limited to any particular amplification technique or any particular modification thereof. It is evident that the oligonucleotides according to the invention find their use in many different nucleic acid amplification techniques and various methods for detecting the presence of (amplified) nucleic acid of HIV. The oligonucleotides of the present invention can likewise be used in quantitative amplification methods. An example if such quantitative method is described in EP 525882.

    [0019] The term oligonucleotide as used herein refers to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides. Such oligonucleotides may be used as primers and probes.

    [0020] Of course, based on the sequences of the oligonucleotides of the present invention, analogues of oligonucleotides can also be prepared. Such analogues may constitute alternative structures such as PNA (molecules with a peptide-like backbone instead of the phosphate sugar backbone of normal nucleic acid) or the like, it is evident that these alternative structures, representing the sequences of the present invention are likewise part of the present invention.

    [0021] The term primer as used herein refers to an oligonucleotide either naturally occurring (e.g. as a restriction fragment) or produced synthetically, which is capable of acting as, a point of initiation of synthesis of a primer extension product which is complementary to a nucleic acid strand (template or target sequence) when placed under suitable conditions (e.g. buffer, salt, temperature and pH) in the presence of nucleotides and an agent for nucleic acid polymerization, such as DNA dependent or RNA dependent polymerase. A primer must be, sufficiently long to prime the synthesis of extension products in the presence of an agent for polymerization. A typical primer contains at least about 10 nucleotides in length of a sequence substantially complementary or homologous to the target sequence, but somewhat longer primers are preferred. Usually primers contain about 15-26 nucleotides but longer primers may also be employed, especially when the primers contain additional sequences such as a promoter sequence for a particular polymerase.

    [0022] Normally a set of primers will consist of at least two primers, one upstream and one downstream primer which together define the amplificate (the sequence that will be amplified using said primers);

    [0023] Primarily for the use in transcription based amplification techniques, the oligonucleotides according to the invention may also be linked to a promoter sequence. The term promoter sequence defines a region of a nucleic acid sequence that is specifically recognized by an RNA polymerase that binds to a recognized sequence and initiates the process of transcription by which an RNA transcript is produced. In principle any promoter sequence may be employed for which there is a known and available polymerase that is capable of recognizing the initiation sequence. Known and useful promoters are those that are recognized by certain bacteriophage RNA polymerases such as bacteriophage T3, T7 or SP6. Oligonucleotides linked to a promoter sequence are commonly referred to as promoter primers. Their function as a primer, e.g. the starting point for an elongation reaction, however, may be blocked, as already mentioned above, or absent in, some embodiments of transcription based amplification reactions.

    [0024] An oligonucleotide according to the present invention is substantially complementary to a sequence of the LTR region of a nucleic acid sequence of a HIV genome, said oligonucleotide being 1050 nucleotides in length and comprising, at least a fragment of 10 nucleotides, of a sequence selected from the group consisting of:

    TABLE-US-00001 SEQID1: GGGCGCCACTGCTAGAGA SEQID2: GTTCGGGCGCCACTGCTAGA SEQID3: CGGGCGCCACTGCTA SEQID4: CTGCTTAAAGCCTCAATAAA SEQID5: CTCAATAAAGCTTeeCPTGA SEQID6: TCTGGTAACTAGAGATCCCTC SEQID7: TAGTGTGTGCCCGTCTOT SEQID8: AGTGTGTGCCCGTCTGTT SEQID12: GATGCATGCTCAATAAAGCTTGCCTTGAGT
    or the complementary sequence thereof.

    [0025] It is understood that oligonucleotides consisting of the sequences of the present invention may contain minor deletions, additions and/or substitutions of nucleic acid bases, to the extent that such alterations do not negatively affect the yield or product obtained to a significant degree. Where oligonucleotides according to the present invention are used as probes, the alterations should not result in lowering the hybridization efficiency of the probe. For example, in case of transcription based amplification techniques, wherein one or more of the primers may be provided with a promoter sequence, the introduction of a purine-rich (=G or A) hybridizing sequence, just after the promoter sequence may have positive effects on the transcription (when there are C's and T's abortive transcription may occur). If no such sequence is available in the target nucleic acid a purine-rich sequence can be inserted in the oligonucleotide just following the last three G residues of the promoter sequence.

    [0026] The sequences of the present invention are reflected as DNA sequences. The RNA equivalents of these sequences are likewise part of the present invention.

    [0027] Preferred oligonucleotides according to the invention are oligonucleotides consisting essentially of a sequence selected from the group consisting of:

    TABLE-US-00002 SEQID1: GGGCGCCACTGCTAGAGA SEQID2: GTTCGGGCCCCACTGCTAGA SEQID3: CGGGCGCCACTGCTA SEQID4: CTGCTTAAAGCCTCAATAAA SEQID5: CTCAATAAAGCTTGCCTTGA SEQID6: TCTGGTAACTAGAGATCCCTC SEQID7: TAGTGTGTGCCCGTCTGT. SEQID8: AGTGTGTGCCCGTCTGTT. SEQID9: aattctaatacgactcactatagggAGAGGGGCGCC ACTGCTAGAGA SEQID10: aattctaatacgactcactatagggAGAGGTTCGGG CGCCACTGCTAGA SEQID11: cattctcatacgactcactatagggCGGGCGCCACTGCTA SEQID12: GATGCATGCTCAATAAAGCTTGCCTTGAGT
    SEQ ID 9-11 actually comprise the sequence as, reflected by SEQ 1-3. In SEQ ID 9-11, the sequences of SEQ ID 1-3 are operably linked to a promoter sequence (the T7 promoter sequence). This makes the sequences especially suitable for use as upstream primer in a transcription based amplification technique such as NASBA.

    [0028] A preferred embodiment of the present invention is a combination of two oligonucleotides according to the invention, for use as a set in nucleic acid amplification.

    [0029] Such a pair of oligonucleotides, for use as a set in the amplification of a target sequence located within the LTR region of the genome HIV-1, consists of a first oligonucleotide being 10-50 nucleotides in length and comprising, at least a fragment of 10 nucleotides, of a sequence selected from the group consisting of:

    TABLE-US-00003 SEQID1: GGGCGCCACTGCTAGAGA SEQID2: GTTCGGGCGCCACTGCTAGA SEQID3: CGGGCGCCACTGCTA
    and, a second oligonucleotide being 10-50 nucleotides in length and comprising, at least a fragment of 10 nucleotides, of a sequence selected from the group consisting of:

    TABLE-US-00004 SEQID4: CTGCTTAAAGCCTCAATAAA SEQID5: CTCAATAAAGCTTGCCTTGA. SEQID12: GATGCATGCTCAATAAAGCTTGCCTTGAGT

    [0030] One of the oligonucleotides may serve as an upstream oligonucleotide, i.e., an upstream-primer, while the second oligonucleotide serves as a downstream oligonucleotide, i.e. downstream primer, in the amplification reaction. The location on the HIV-genome (or the sequence complementary thereto) to which both oligonucleotides comprised in such a pair according to the invention can anneal, will together define the sequence of the nucleic acid that is amplified. The amplified sequence is located between the primer-binding sites within the LTR region of the HIV-genome. It has been found that, by using a pair of oligonucleotides according to the invention in an amplification reaction, accurate and reliable amplification of nucleic acid derived from all presently know sub-types of HIV can be achieved.

    [0031] A most preferred pair of oligonucleotides according to the invention will consist of a first primer comprising the sequence of SEQ ID NO 1 and a second primer with the sequence of SEQ ID NO 5. For use in a transcription based amplification method, the oligonucleotide with SEQ ID NO 9 is preferred, in combination with an oligonucleotide with the sequence of SEQ ID NO

    [0032] Part of the oligonucleotides according to the invention are particularly suitable for use as a probe in the detection of nucleic acid amplified with a pair of oligonucleotides according to the invention. When used as a probe, said oligonucleotides may be provided with a detectable label. Oligonucleotides according to the invention that, are especially suitable as a probe consist essentially of the sequence

    TABLE-US-00005 SEQID6: TCTGGTAACTAGAGATCCCTC SEQID7: TAGTGTGTGCCCGTCTGT or SEQID8: AGTGTGTGCCCGTCTGTT
    provided with a detectable label. A most preferred oligonucleotide in this respect is an oligonucleotide with, a sequence as depicted in SEQ ID 6.

    [0033] Various labeling moieties are known in the art. Said moiety may, for example, either be a radioactive compound, a detectable enzyme (e.g. horse radish peroxidase (HRP)), a hapten like biotin, or any other moiety capable of generating a detectable signal such as a colorimetric, fluorescent, chemiluminescent or electrochemiluminescent signal.

    [0034] Hybrids between oligonucleotides according to the invention and (amplified) target nucleic acid may also be detected by other methods known to those skilled in the art.

    [0035] Evidently methods for amplification of nucleic acid, like the ones that have been mentioned above, using the oligonucleotides according to the present invention are also part of the invention.

    [0036] The present invention further provides test kits for the amplification and detection of HIV nucleic acid. The use of said test-kits enables accurate and sensitive screening of samples suspected of containing HIV derived nucleic acid. Such test-kits may contain a pair of oligonucleotides according to the invention and optionally also an oligonucleotide according to the invention that can be used as a probe for the detection of the amplified material. Furthermore the test-kit may contain suitable amplification reagents. These reagents are for example the suitable enzymes for carrying out the amplification reaction. A kit, adapted for use with NASBA, for example may contain suitable amounts of reverse transcriptase, RNase H and T7 RNA polymerase. Said enzymes may be present in the kit in a buffered solution but can likewise be provided as a lyophilized composition, for example, a lyophilized spherical particle. Such lyophilized particles have been disclosed in PCT appl. no. EP95101268. The kit may further be furnished with buffer compositions, suitable for carrying out an amplification reaction. Said buffers may be optimized for the particular amplification technique for which the kit is intended as well as for use with the particular oligonucleotides that are provided with the kit. In transcription based amplification techniques, such as NASBA, said buffers may contain, for example, DMSO, which enhances the amplification reaction (as is disclosed in PCT appl. no, US90/04733).

    [0037] Furthermore the kit may be provided with an internal control as a cheek on the amplification procedure and to prevent the occurrence of false negative test results due to failures in the amplification procedure. The use of internal controls in transcription based amplification techniques is described in PCT appl, no. EP 93/02248. An optimal control sequence is selected in such a way that it will not compete with the target nucleic acid in the amplification reaction. Kits may also contain reagents for the isolation of nucleic acid from biological specimen prior to amplification. A suitable method for the isolation of nucleic acid is disclosed in EP389063.

    EXAMPLES

    Example 1. Amplification and Detection of HIV-1 Genomic RNA

    [0038] The following procedures were applied to amplify and detect HIV-1 genomic RNA from samples as described in the following examples.

    Sample Preparation and Nucleic Acid Isolation.

    [0039] The isolation of the nucleic acids was performed according to Boom et al., 1990, Journal of Clinical Microbiology 28, 495-503 and European patent no, EP0389063. In short: A volume of 200 l of pooled plasma's from healthy donors (negative for HBsAg, anti-HIV and anti-HCV) was added to 900 l of lysis buffer (47 mM Tris-HCl pH 7.2, 20 mM EDTA, 1.2% Triton X-100, 4.7 M guanidine thiocyanate (GuSCN, Fluka, Buchs, Switzerland)). After vortexing and centrifugation (30 seconds, 13,000 rpm) a dilution series of HIV-1 RNA subtype B standard, characterized and described by Layne et al., 1992, Virology 189, 695-714 or HIV-1 positive specimens, was added. Upon addition of 50 l activated silicon (0.4 g/ml suspension in 0.1 N HCl), the suspension was incubated for 10 minutes at room temperature with regular vortexing. After centrifugation (30-60 seconds, 13,000 rpm) the silicon pellet was washed twice with 1 ml of wash buffer (5.25 M GuSCN, 50 mM Tris-HCl pH 6.4), followed by two 70% ethanol washes and one acetone wash step. Subsequently, the silicon pellets were dried during ten minutes in a 56 C. heating block. The nucleic acids were eluted from the silicon by adding 500 elution buffer (1.0 mM Tris-HCl, pH 8.5) and incubation at 56 C. for 10 minutes. Subsequently, 5 l of the eluate was taken of the pellet for further use in the amplification reaction. The remaining eluate was stored at 70 C.

    NASBA Amplification.

    [0040] Amplifications were carried out in a reaction volume of 20 l which is composed of 10 l primer mixture, 5 l (isolated) nucleic acids and 5 l enzyme mixture. The primer mixture was made by reconstitution of a lyophilized accusphere into 50 l accusphere diluent, 51.6 l water, 8.4 l 2 M KCl and 5 l of each primer (10 M). The mixture was thoroughly vortexed before use. From this primer mixture 10 l was added to 5 l of the (isolated) HIV-1 RNA (standard). This mixture was incubated for 5 minutes at 65 C. and subsequently incubated at 41 C. for another 5 minutes. After these incubations 5 l enzyme mixture was added and incubated for 5 minutes at 41 C. The tubes were transferred to the detection area and incubated for 90 minutes at 41 C. After the amplification reaction the tubes were stored at 20 C. until further use.

    Each amplification reaction contained the following reagents:

    40 mM Tris-HCl, pH 8.5

    12 mM MgCl.SUB.2

    70 mM KCl

    [0041] 15% v/v dimethyl sulfoxide
    5 mM dithiotreitol
    1 mM of each deoxynucleoside triphosphate
    2 mM of the nucleosides rATP, rCTP, rUTP
    1.5 uM rGTP

    0.5 mM ITP

    [0042] 0.105 g/l BSA
    0.08 units RNaseH
    0.32 units T.sub.7 RNA polymerase
    6.4 units avian myeloblastosis virus reverse transcriptase (Seikagaku, USA)
    0.2 M of each primer
    375 mM sorbitol
    45.6 mM sucrose
    28.5 mM mannitol
    0.13 mM dextran T40

    Detection of the Amplified Products.

    A. Gel Electrophoresis.

    [0043] The presence of amplified products was analyzed using an agarose gel (100 ml of 2% Pronarose and 0.5 g/ml ethidium bromide) and 1*TAE (40 mM Trisacetate, 1 mM EDTA pH 8.0) running buffer are used. Electrophoresis was carried out at 100 volts for approximately 30 minutes. The ethidium bromide-stained bands of the amplified products were visualized using UV irradiation. The blot was hybridized with biotin probe (3 M) hybridization mix (750 mM NaCl, 75 mM sodium citrate, 20 mM Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 (pH 6.7), 10*Denhardts) by incubating the blot for 4 hours at 50 C. After hybridization the blot was washed two times for 5 minutes at 50 C. with 450 mM NaCl, 45 mM sodium citrate pH 6.4 (2*SSPE) and 1% sodium dodecyl sulphate (SDS) solution and one time for 10 minutes with 20 mM Na.sub.2HPO.sub.4 pH 7.4, 360 mM NaCl, 2 mM EDTA and 0.1% SDS at room temperature. Subsequently, the blot was incubated for 30 minutes with 2 l streptavidin/horse radish peroxidase solution (500 U/ml from the enhanced chemiluminescence detection kit of Amersham Life Science) in 10 ml 50 mM Na.sub.2HPO.sub.4, 900 mM NaCl, 5 mM EDTA, pH 7.4 and 0.5% SDS. Following washes respectively two times for 5 minutes in 2*SSPE, 0.1% SDS and once for 10 minutes in 2*SSPE at room temperature the blot was dried, between tissues, developed and exposed to a film according to the Amersham kit protocol.

    Electrochemilumineseence (ECL) Probe Hybridization.

    [0044] The amplification products were diluted two times in detection diluent (1.0 mM Tris/HCl, pH 8.5 and 0.2 g/l 2-methylisothiazolone HCl). Subsequently, 5 l of the diluted amplification product was incubated for 30 minutes at 41 C. with 0.084 M of the HIV-1 specific biotin probe bound to 5 g streptavidin-coated magnetic beads (mean size 2.8 m.+-0.2 m, Dynal, Great Neck, N.Y., USA) and 2*10.sup.11 molecules of an ECL (Tris[2,2-bipyridine]ruthenium[II] complex)-labeled probe, in a total volume of 25 l 750 mM NaCl, 75 mM sodium citrate, pH 6.4 (5*SSC). As negative controls, detection diluent was also incubated with the bead-probe and Eat-probe mixtures. During incubation, tubes were agitated every 10 minutes to keep the beads in suspension. Subsequently, 300 l of assay buffer solution (100 mM tripropylamine, pH 7.5) was added and the tubes were placed in an ECL detection instrument (NASBA QR-system from Organon Teknika BV) for reading the emitted ECL signals.

    Example 2. Amplification and Detection of HIV-1 Genomic RNA

    [0045] The following primer pairs were tested on 10.sup.4 copies (as determined by spectrophotometry at 260 nm) of the HIV-1 RNA standard. The RNA was added directly into the amplification. The analysis of the amplified products was performed by gel electophoresis as described in example 1. The results are shown in the FIGS. 1A and 1B.

    [0046] All primer pairs and probes of the present invention were able to amplify and detect HIV-1 RNA from subtype B to a similar extent. Analytical sensitivity is shown for two, primer pairs (SEQ ID 9/SEQ ID 5 and SEQ ID 11/SEQ ID 5) using a dilution series of the HIV-1 RNA standard which has an initial concentration of 5.5*10.sup.9 copies/mi. The detection was done with probes having the sequences as depicted in SEQ ID 7 and SEQ ID 6. The amplification and detection was carried out as described in example 1. Table shows the results obtained with both primer pairs.

    TABLE-US-00006 TABLE 1 HIV-1 SEQ ID 3-SEQ ID 5 SEQ ID 9-SEQ ID 5 RNA copies No. detected % detected No. detected % detected 200 4:4 100% 4:4 100% 100 8:8 100% 8:8 100% 50 8:8 100% 8:8 100% 25 7:8 87.5% 7:8 87.5% 12 6:8 75% 4:8 50% 6 2:8 25% 4:7 57% 3 0:8 0% 2:7 28.5% 0 0:8 0% 0:7 0%
    Both primer pairs have approximately the same sensitivity for the HIV-1 RNA standard respectively a detection rate of 70% for the primer pair SEQ ID 9/SEQ ID 5 and a detection rate of 63% for the primer pair SEQ ID 3/SEQ ID 5.

    Example 3. Amplification and Detection of HIV-1 RNA in Presence of an Internal Control

    [0047] In this example the primer pair SEQ ID 9/SEQ ID 5 and probe with the sequence of SEQ ID 7 was tested on dilution series of the HIV-1 RNA standard in presence of an internal control (ic-) RNA. The ic-RNA is an in vitro transcript which contains part of the LTR sequence of HIV-1 HXB-2 and 10.sup.4 copies (as determined by spectrophotometry at 260 nm) are added prior to nucleic acids isolation. The isolation, amplification and ECL detection was performed as described in example 1. As a comparison, separate amplification and detection was performed sing a primer pair located in the HIV-1 gag region (P1/P2) previously described by Van Semen et al, 1993, Journal of Virological Methods 43, 177-188. The probes used to detect the amplification products generated by the gag based primer pair were:

    TABLE-US-00007 Biotinprobe: (SEQIDNO13) 5-TGTTAAAAGAGACCATCAATGAGGA ECLprobe: (SEQ1DNO14) 5-GAATGGGATAGAGTGCATCCAGTG.
    Results are shown in Table 2.

    TABLE-US-00008 TABLE 2 HIV-1 RNA LTR SEQ ID 9-SEQ ID 5 GAG P1/P2 copies/200 l No. detected % detected No. detected % detected 320 9:10 90% nt* nt* 160 5:10 50% 8:10 80% 80 5:10 50% 5:10 50% 40 3:8 38% 4:10 40% 20 3:10 32% 1:10 10% 10 1:10 10% 2:10 20% 0 0:5 0% 1:5 20%

    [0048] Both the LTR primer pair of this, example and the gag primer pair were able to detect a similar amount of HIV-1 RNA in an assay controlled by an in vitro produced RNA winch was added prior to the nucleic acids isolation.

    Example 4. Detection of HIV-1 RNA in HIV-1 Positive Samples

    [0049] In this example, 40 HIV-1 positive samples from various geographical locations were analyzed for presence of HIV-1 RNA. All samples were isolated by the nucleic acids isolation method described in example 1. Amplification and detection were carried out as described in example 1 using primer pair SEQ ID 9/SEQ ID 5 and probe with the sequence of SEQ ID 7 or probe with the sequence of SEQ ID 8.

    [0050] For comparison, separate amplification and detection was carried out using the gag primer pair and probes as described in example 3. Presence of amplified products was detected by ECL probe hybridization according to the method of example 1. Result are shown in Table 3.

    TABLE-US-00009 TABLE 3 Primer pair ECL Probe No. Detected % Detected SEQ ID 9/SEQ ID 5 SEQ ID 7 40/40 100% (LTR) SEQ ID 9/SEQ ID 5 SEQ 8 10/10 100% (LTR) P1/P2 (gag) 29/40 72.5%

    [0051] Both primer probe combinations derived from the LTR region of HIV-1 described in this example were able to detect HIV-1 from all the samples tested. In contrast, the primer probe combination of the gag assay failed to detect HIV-1 genomic RNA from a great number of samples.

    Example 5. Amplification and Detection of HIV-1 RNA with Defined Subtypes

    [0052] In this example, 33 samples harbouring HIV-1 RNA of known envelope-based subtypes were tested. The samples originate from subtyped viruses propagated in cell cultures. Samples of cell culture supernatants from both variants of group M subtypes A through H and variants of group O were spiked to HIV-1 negative human plasma and treated according to the method from example 1. Amplification and detection was performed essentially as example 4 Results are shown table 4 as the number of samples of each type from which HIV-1 RNA was detected out of the total number of each type tested.

    TABLE-US-00010 TABLE 4 HIV-1 Types Primer pair A B C D E F G H O Total SEQ ID 9/SEQ ID 5 5:5 2:2 2:2 5:5 7:7 1:1 1:1 1:1 9:9 33:33 (LTR) 4:5 2:2 2:2 5:5 6:7 1:1 1:1 1:1 0:9 22:33

    [0053] HIV-1 RNA was detected from all 33 HIV-1 samples using LTR primer pair SEQ ID 9/SEQ ID 5 and probe with sequence of SEQ ID 7. In contrast, the assay using the gag primers probes combination as described in example 3 failed to detect subtype A and subtype E each from one of the samples and all samples containing HIV-1 RNA from group O members.

    Example 6. Amplification and Detection of HIV-1 Clinical Samples

    [0054] In this example, 7 samples obtained from seropositive patients originating from Africa, South America and Asia were assayed for the presence of HIV-1 genomic RNA. Despite the fact that blood samples from these patients are both anti-p24 antibody (Abbott Laboratories, Abbott Park, Ill.) and western blot (Genelabs) positive, all specimens were scored negative by the NASBA HIV-1 RNA QL assay (Organon Teknika BV) which uses the gag primer pair and probe combination from example 3 and only a single sample (R9612222) was detected and quantitated (29,500 RNA copies/MI) by the Quantiplex HIV-1 RNA 2.0 (Chiron) assay using a sample volume of 50 .mu.l. In contrast, using an equal sample volume the primer pair SEQ ID 9/SEQ ID 5 and the probe with sequence of SEQ ID 7 detected four out of seven samples (Table 5).

    TABLE-US-00011 TABLE 5 SEQ ID 9/SEQ ID 5 Sample code Country (LTR) R9610155 Thailand positive R9612222 Ghana positive R9700062 Brazil negative R9612218 Zaire negative R9611710 Liberia positive R9610718 Antilles positive R9607884 Rwanda negative

    [0055] The samples missed by the LTR primer probe combination are not detected due to a low viral load below the detection level since by using a sample volume of one ml the Quantiplex HIV-1 RNA 2.0 (Chiron) assay quantitated HIV-1 RNA levels of 30 or below 30 HIV-1 RNA copies per 50 l of these samples.