TRANSGENIC MOUSE EXPRESSING KIDNEY-SPECIFIC HUMAN TGF-BETA1, AND BIOMARKER FOR TISSUE FIBROSIS MOUSE MODEL
20170135328 ยท 2017-05-18
Inventors
Cpc classification
G01N33/6863
PHYSICS
G01N33/53
PHYSICS
C12N2830/008
CHEMISTRY; METALLURGY
A01K67/0278
HUMAN NECESSITIES
International classification
Abstract
A transgenic mouse has a genome that includes the entire gene region of human transforming growth factor beta-1 (human TGF1) located downstream of a mouse Podocin promoter such that expression of the human TGF1 is controlled by the mouse Podocin promoter. The human TGF1 contains 7 exons and 6 introns, the human TGF1 is expressed in a kidney of the mouse as non-active TGF1 and becomes active TGF1 extracellularly, and the transgenic mouse spontaneously develops renal fibrosis.
Claims
1. A transgenic mouse having a genome comprising: a mouse Podocin promoter, and the entire gene region of human transforming growth factor beta-1 (human TGF1) located downstream of the mouse Podocin promoter, wherein expression of the human TGF1 is controlled by the mouse Podocin promoter, the human TGF1 contains 7 exons and 6 introns, the human TGF1 is expressed in a kidney of the mouse as non-active TGF1 and becomes active TGF1 extracellularly, and the transgenic mouse spontaneously develops renal fibrosis.
2.-4. (canceled)
5. The transgenic mouse according to claim 1, wherein the transgenic mouse starts to develop renal fibrosis spontaneously from the age of 15 weeks.
6. The transgenic mouse according to claim 5, wherein the transgenic mouse is derived from the mouse line C57BL/6J.
7. A method for producing the transgenic mouse according to claim 1, comprising: (1) preparing a gene for selection by incorporating a selection cassette in an intron of the human TGF1 gene in a Bacterial Artificial Chromosome (BAC) containing the human TGF1 gene, (2) creating a modified human TGF1 gene fragment by introducing a sequence that is homologous to the sequence downstream of the mouse Podocin promoter to the 5-side and 3-side of the human TGF1 gene obtained in step (1), (3) preparing a Podocin-human TGF1 gene fragment for selection in which, in the BAC containing the entire mouse Podocin coding sequence having the flanking sequence on the 5-side and 3-side, the modified human TGF1 gene fragment is transferred to the downstream side of the mouse Podocin promoter, (4) preparing a Podocin-TGF1 BAC transgenic construct by removing the human TGF1 gene fragment for selection, and (5) obtaining a transgenic mouse by purifying the Podocin-TGF1 gene from the Podocin-TGF1 BAC transgenic construct and microinjecting the purified Podocin-TGF1 gene into a mouse embryo.
8. The method mouse according to claim 7, wherein the number of base pairs of primers for a PCR reaction used for preparing the modified human TGF1 gene fragment is 54 to 58 nucleotides.
9. A method for evaluating the pathology of a human TGF1-expressing transgenic mouse, comprising: (1) obtaining a cut-off value, at which the transgenic mouse develops fibrosis, from the fact that the human TGF1 concentrations in plasma and urine are significantly higher than those in wild-type mice, and a graph showing a correlation between the human TGF1 concentration in plasma and the CT fibrosis score, (2) measuring the concentration of human TGF1 in the plasma after collecting blood from the transgenic mouse, and (3) comparing the cut-off value and the measured TGF1 concentration in the plasma of the transgenic mouse, and deciding that the transgenic mouse has developed fibrosis when the concentration of human TGF1 in the bodily fluid is equal to or greater than the cut-off value.
10.-11. (canceled)
12. A method for inducing diabetes in the transgenic mouse according to claim 1, comprising: waiting for the transgenic mouse to spontaneously develop renal dysfunction and renal fibrosis; and thereafter administering streptozotocin (STZ) to the transgenic mouse.
13. The method according to claim 12, wherein: the transgenic mouse spontaneously develops renal dysfunction and renal fibrosis after 15 weeks of age; and administration of the streptozotocin (STZ) is initiated after 16 weeks of age.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0032]
[0033]
[0034]
[0035]
[0036]
[0037] [32 P] labeled Podocin-human TGF RecBAC by random prime method was hybridized by incubating with the Southern blot transferred fragments of genomic DNA from candidates of transgenic mouse founder individuals. Nylon membrane was washed to remove nonspecifically bound radioactive probes and specifically bound fragments were detected by autoradiography. The markers in the figure are M1: NEB and 1 KB ladder.
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
MODES FOR CARRYING OUT THE INVENTION
[0052] Next, embodiments of the present invention will be explained with reference to the Figures and table. The technical scope of the present invention is not limited by these embodiments and can be carried out in various forms without changing the gist of the invention.
<Preparation of Human TGF Beta 1-BAC Transgenic Mouse>
[0053] 1. Data of Human TGF Beta 1 Gene and Mouse Podocin Gene, and Search for Genomic Clones
[0054] As a result of searching for mouse genomic DNA sequences based on the mouse Podocin cDNA sequence and NM_130456, mouse Podocin gene was present in a region of chromosome 1. When the cDNA sequence of the mouse Podocin gene and the mouse genomic sequence were aligned, it became clear that the coding region of the mouse Podocin gene includes eight exons in the genomic sequence in 17 kb region.
[0055] After searching for a BAC clone encoding mouse Podocin locus, the genomic DNA sequence of mouse Podocin locus was contained in RP23-5701. The BAC clone contained a 225 kb of chromosome 1 with mouse Podocin locus, 5 genomic sequence upstream of the 69 kb, and 3 genomic sequence downstream of the 139 kb (
[0056] As a result of searching for human genomic DNA sequences based on the cDNA sequence of human TGF1 gene, NM_000660, human TGF gene was found in the 19q13.1 region of chromosome 19. Comparing the cDNA sequence of human TGF with human genome sequence, the coding region of the human TGF1 gene was shown to encode seven exons in the genomic sequence spanning 23 kb.
[0057] After searching for BAC clones encoding the human TGF gene locus, RP11-638N16 size of 194.7 kb was found to contain all of the genomic DNA sequence of the human TGF1 gene locus (
[0058] 2. Construction of Recombinant BAC Clone of Mouse Podocin Gene and Human TGF1 Gene
[0059] Using the active homologous recombination reaction in the construction of E. coli, Red/ET Recombination Technology (Non-Patent Document 3), we constructed a recombinant BAC clone of Podocin-human TGF1 RecBAC from BAC clone containing Podocin gene and TGF gene.
[0060] As shown in Table 1, the sequence of intron 1 of the human TGF1 gene, the sequences of both ends of the genomic DNA sequences from the translation initiation codon to the stop codon of human TGF gene, and the DNA sequences of 3-side and 5 side of genomic translation initiation codon to the stop codon of Podocin genes of mouse BAC clone were used as the key sequence for the active homologous recombination reaction in E. coli.
TABLE-US-00001 TABLE1 Key Sequence Position GenomicSequence(SequenceNo.1,toNo.6) TGF1-H1 StartcdorcfhumanTGFbeta-gene [5]ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCT[3] TGF1-H2 StopcodonofhumanTGFbeta-gene [5]CAACATGATCGTGCGCTCCTGCAAGTGCAGCTGA[3] TGF1-H3 Rpsl-kaninsertionsite,5-side [5]aggcgctggagaaagttgacccagagcttg[3] TGF1-H4 Rpsl-kaninsertionsite,3-side [5]ccttcttgaatctttccacctcaggacccc[3] Podocin-H5 5UTRofmousePodocin-gene [5]gctGGGGCTGCGACTCTGCCAGCAGCTGGCTCCGGGGTTGCACCGCT GCATTGAGA[3] Podocin-H6 3UTRofmousePodocin-gene [5]GCGAATGGGCAAAGGCTGTGTGAATCTGCCATATAAAGCCACATCCC TGAGAGAGG[3]
[0061] The DNA fragment contained TGF1-113 sequence, Rpsl-kan and TGF1-114 in tandem arrays was constructed by PCR using LA-Taq (Takara Bio) (TGF1 Rpsl-Kan break-fragment), in order to insert the positive/negative selection marker cassette (Rpsl-kan corresponding to the selected cassette of the present invention) in intron 1 of TGF1 gene of human BAC clone (
[0062] With using human TGF1 Intermediate, in order to subclone the genomic DNA sequence of the human TGF1 gene into which the Rpsl-kan cassette was inserted to a plasmid vector, a DNA cassette in which H2-H6-SacBp and Bluescript-H5-H1 were tandemly connected was constructed (human TGF1 transfer plasmid) (
[0063] Then, after the human TGF1 transfer plasmid was reacted with restriction enzymes, the genomic DNA sequences of the human TGF1 gene which has an 115 sequence and H6 sequences derived from the mouse genome sequence at 5 and 3 both ends and has Rpsl-kan cassette were isolated (human TGF1 transfer fragment: Creating and modification step of modified human TGF1 gene fragment) (
[0064] Both H5 and H6 are DNA primers having a length of each of 56 bases. The lengths of H5 and H6 are longer than those of commonly used DNA primers for PCR reaction. To create a transgenic mouse of the embodiment, the base number of the H5 and H6 is one of the important constituent requirements. If the number of bases of H5 and H6 is short, hTGF 1-expressing transgenic mouse could not be prepared. Therefore, the number of bases of the H5 and H6 are from 50 bases to 60 bases, preferably from 52 bases to 60 bases, more preferably from 54 bases to 58 bases.
[0065] Finally, DNA fragments having the intron 1 sequence of the human TGF1 gene locus were amplified by PCR, and they were used by negative selection for removing Rpsl-Kan, which was inserted into intron 1 of the human TGF1 gene (human TGF1 repair fragment) (
[0066] 3. Purification of Mouse Podocin-Human TGF1 RecBAC Recombinant Expression Construct
[0067] DH10B cells transformed by recombinant BAC clone which contained mouse Podocin-human TGF1 RecBAC recombinant expression construct were cloned on LB agar medium containing chloramphenicol. The single colony of DH10B was picked up and shaking cultured overnight in liquid culture medium. The mouse Podocin-human TGF1 RecBAC recombination BAC clone was purified according to modified Abe et al, method (Non-Patent Document 4) with a plasmid extraction kit (Macchi Lee Nagel Inc., Nucleobond BAC100 kit) and was reacted with PI-SceI at 37 C. for 16 hours.
[0068] To obtain an expression construct for a transgenic mouse, the genomic BAC clone was digested with PI-SceI and separated by pulsed-field electrophoresis. Long DNA fragments containing the expression construct with 150 kb to 200 kb were detected. These DNA fragments were cut out from the gel avoiding damage by UV irradiation, electro-eluted and purified by dialysis. The purified expression construct was examined for the purity and concentration by 1% agarose gel electrophoresis for analysis. It was confirmed that the long expression construct had been recovered with enough purity. The DNA concentration was 181.2 ng/l. It was sufficient to provide a transgenic mouse (
[0069] 4. Injection of Mouse Podocin-Human TGF1 RecBAC Expression Construct into Mouse Embryo
[0070] Pregnant male serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) were administered to female C57BL/6J mice to induce superovulation. The mice were crossed with the same strain of male mice, and taken fertilized eggs. The male nucleus of pronuclear stage embryos of C57BL /6J mice were injected with purified mouse Podocin-human TGF1 RecBAC expression construct directly using the micromanipulator. The DNA-injected embryo was transplanted into the oviduct of an embryo female mouse induced pseudopregnancy (a step for obtaining a transgenic mouse).
[0071] As described before, fertilized eggs were collected from the superovalated female mice administered PMSG and hCG. The mouse Podocin-human TGF1 RecBAC expression construct was introduced into the fertilized eggs by a microinjection method. The fertilized eggs introduced expression constructs were transplanted into the oviducts of pseudopregnant treated mice. A total of 407 fertilized eggs were collected from C57BL/6J female mice that underwent superovulation induction and mated. A total of 392 fertilized eggs were injected with the mouse Podocin-human TGF1 RecBAC expression construct by microinjection method. The mouse-fertilized-eggs received microinjection were observed by microscope. The damage by the injection operation was small. A total of 360 fertilized eggs remained stable even after microinjection. Of these fertilized eggs, 344 of fertilized eggs injected by the expression construct without damage were transplanted into pseudopregnant treated mice.
[0072] 5. Southern Screening of Mouse Podocin-Human TGF RecBAC Transgenic Mouse Founder
[0073] Founder candidates of the transgenic mice were obtained from fertilized eggs of C57BL/6J mice into which the mouse Podocin-human TGF1 RecBAC expression construct was introduced by a microinjection method. Southern analysis was performed to identify founder individuals. Expression constructs were injected into a total of 392 fertilized eggs, and a total of 344 injected embryos were transplanted into pseudopregnant mice and spontaneously delivered. A total of 52 mouse origins were obtained. All 52 mice were grown until weaning. The number of progeny and weaning from the early embryo into which the mouse Podocin-human TGF1 RecBAC expression construct was introduced was good. From these data, we confirmed that there was no adverse effect on the development and differentiation of mouse embryos by injecting expression constructs. Eight animals which had been transfected with the mouse Podocin-human TGF1 RecBAC expression construct were identified as a transgenic mouse founder by the hybridization of the genomic DNA fragments extracted from the offspring of the founder candidate transgenic mice with [32P] labeled probe identified. The copy number of the expression construct introduced into the transgenic mouse founder was 1 copy to 3 copies (
[0074] 6. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
[0075] Reverse transcriptase PCR (RT-PCR) was performed to examine the expression level of human TGF1 gene in each tissue of human TGF1 TG mice. Total RNAs were extracted from each tissue with TRIZOL (Invitrogen, Carlsbad, Calif.). Sequences of the primers used for RT-PCR were as follows;
[0076] Human TGF1, forward 5-AAG ACT ATC GAC ATG GAG CTG G-3 (SEQ ID NO: 7) and, reverse 5-GTA TCG CCA GGA ATT GTT GCT G-3 (SEQ ID NO: 8); human GAPDH, forward 5-CCA CCC ATG GCA AAT TCC ATG GCA-3 (SEQ ID NO: 9) and reverse 5-TCT AGA CGG CAG GTC AGG TCC ACC-3 (SEQ ID NO: 10); mouse GAPDH, forward 5-CCC TTA TTG ACC TCA ACT ACA TGG T-3 (SEQ ID NO: 11) and reverse 5-GAG GGG CCA TCC ACA GTC TTC TG-3 (SEQ ID NO: 12). All PCRs were performed in a state before plateau. PCR products were electrophoresed on a 2% agarose gel, and observed by ultraviolet light after staining the bands with ethidium bromide. Expression of mouse TGF1 was observed in almost all organs. Meanwhile, expression of human TGF1 was observed only in the kidney (
[0077] 7. Histological Examination of Kidney
[0078] After mice were sacrificed, the renal circulation was washed with saline. Kidneys were removed from the mouse. The kidney was perfused with formalin (10% neutral buffer), inflated with gas, fixed in formalin for 24 hours, and embedded in paraffin. Sections for tissue examination with a thickness of Sum were prepared, paraffin was removed, and washed several times with saline-phosphate buffer. Tissue sections were treated with hematoxylin/eosin staining method. Histological examination of the kidneys was performed using an Olympus BX50 microscope equipped with a Olympus DP70 digital camera. Glomerular of wild-type mice showed normal findings. Glomerular degeneration, glomerular fibrosis and renal interstitial fibrosis were observed in the kidney of mouse Podocin-human/TGF1 RecBAC-TG mice (
[0079] To examine the extent of collagen deposition in the kidney tissue, tissue sections were treated with Masson trichrome staining method. As a result, collagen deposition in renal tissue was normal range in wild-type mice (A, B, C), but was high in Podocin-human TGF1 RecBAC-TG mice (D, E, F) (
[0080] <Test to Confirm that the Mouse is Susceptible to Diabetes>
[0081] As a result of measuring BUN and creatinine in the blood plasma, for plasma concentrations of mouse Podocin-human/TGF1 RecBAC-TG mice (transgenic mice) were all increased, it wad found that renal dysfunction had occurred from 16 weeks of age (
[0082] 1. Test Method
[0083] (i) Streptozotocin (STZ:40 mg/kg) was administered to wild-type mice (n=4) and mouse Podocin-human/TGF1 RecBAC-TG mice (n=5) once a day for 4 days to induce diabetes. As a control, saline (saline) was administered to wild-type mice (n=3) and mouse Podocin-person/TGF1 RecBAC-TG mice (n=5).
[0084] Blood samples were collected from each mouse before the start of the test (day0), the 7th day (day7), the 14th day (day14), the 21th day (day21), the 28th day (day28) and the 35th day (day35) after the start of the test, and the blood sugar levels were examined.
[0085] (ii) Glucose tolerance test was conducted using mice on the 28th day after the start of the test. One g/kg of glucose was administered intraperitoneally to mice, blood glucose levels were measured after 15, 30, 60 and 120 minutes from the glucose administration.
[0086] (iii) After the test, each mouse was performed CT examination to examine the degree of renal disorder. In addition, the status of kidney tissue was examined using a microscope.
[0087] (iv) HOMA-IR (homeostasis model assessment) was examined for each group of mice using the data of fasting blood glucose level (i) and (ii).
[0088] 2. Results
[0089] Mice blood glucose levels of each group were shown in
[0090] The results of glucose tolerance test were shown in
[0091] In
[0092]
[0093] Thus, mouse Podocin-human/TGF1 RecBAC-TG mice were found to be prone to diabetes than wild-type mice by administration of streptozotocin (STZ).
[0094] HOMA-IR in four groups (wild type mice/saline-treated group, transgenic mice/saline-treated group, wild-type mice/STZ administration group, and transgenic mice/STZ administration group) were shown in
[0095] HOMA-IR=fasting blood insulin concentration (U/mL)fasting blood glucose level (mg/dL)1/405
[0096] In the transgenic mice/STZ administration group, HOMA-IR was significantly increased. The data showed that TGF1 was highly expressed in the transgenic mice, the mice acquired insulin resistance, and easily suffer from type II diabetes mellitus.
[0097] <Importance of TGF1 Measurement as a Biomarker>
[0098] By the way, TGF1 is known to play an important role for the pathogenesis of organ fibrosis such as pulmonary fibrosis, glomerular sclerosis and liver cirrhosis. Among such fibrosis patients, some patterns of examples have been reported showing the varying clinical outcomes. This is called a clinical phenotype of fibrosis (phenotype).
[0099] However, it has not been fully elucidated association between TGF1 concentrations in plasma and TGF1 type of fibrosis. Therefore, in this embodiment, we can indicate the patterns of TGF1 type of fibrosis by measuring the TGF1 in plasma.
[0100] 1. Study of TGF1 Concentrations in Mouse Podocin-Human TGF1 Rec BAC TG Mice
[0101] TGF1 concentrations were measured using commercially available ELISA kits (BD Biosciences Pharmingen, San Diego, Calif.) according to the manual. The concentrations of human TGF1 in the blood and urine in mouse Podocin-human TGF1 Rec BAC TG mice showed significantly higher compared to those in wild-type mice (
[0102] 2. Study of TGF1 Concentrations of Mouse Surfactant Protein C/Human TGF1 Rec BAC TG Mice
[0103] The present inventors have established transgenic mice expressing TGF1 in a specific organ with incorporating various ideas. In established transgenic mice by the present inventors, there is a transgenic mouse (mouse Surfactant protein C/human TGF1 Rec BAC TG mice) specifically expressing human TGF1 in the lung.
[0104] Therefore, we examined the relationship between plasma TGF1 concentrations and pulmonary fibrosis using the transgenic mice. In mouse Surfactant protein C/human TGF1 Rec BAC TG mouse, human TGF1 concentrations in plasma showed significantly higher compared to those in wild-type mice (
[0105] 3. Relationship TGF1 Concentrations and Micro CT (Computed Tomography) in Mouse Surfactant Protein C/Human TGF1 Rec BAC TG Mice
[0106] Evaluation of pulmonary fibrosis in the mouse model was performed using micro CT. CT data were obtained using mice under anesthesia which were suppressed respiration by inhalation of isoflurane. CT findings of pulmonary fibrosis were scored from 1 to 8 and evaluated. There was a significant positive correlation between CT lung fibrosis score and plasma TGF1 concentrations. Mice with higher plasma concentrations of TGF1 than 3000 pg/ml (cut-off value) were observed 3.5 or more CT score (
[0107] 4. Study of Plasma TGF1 Concentrations in Fibrosis Patients
[0108] Next, we examined the relationship between the human lung fibrosis patients and plasma TGF1 concentrations. TGF1 concentrations in plasma were measured in patients with lung fibrosis (38 patients) and healthy subjects (3 subjects). TGF1 concentrations in patients with pulmonary fibrosis were significantly higher than those in normal subjects (
[0109] As shown in
[0110] Since TGF1 expression was increased in the renal glomerulus fibrosis, TGF1 was excreted in the urine from an early stage, so it reflected early fibrosis and may be useful as a marker for early diagnosis of fibrosis. Meanwhile, glomeruli were impaired by fibrosis, when the number of nephrons were reduced to decrease the TGF1 excretion in the urine, as a result, it was considered that the TGF1 concentrations in the blood would increase. Therefore, elevation of TGF1 in the blood may reflect the severity of fibrosis. In particular, in breeding mouse Podocin-human TGF1 RecBAC-TG mice, it is a model mouse that spontaneously develops kidney fibrosis, unlike wild type mouse diagnosis, so it can be an extremely effective index for confirming the timing of the onset of renal fibrosis. This makes it possible to efficiently confirm the onset of breeding mice, so it is easy to provide the mice to research institutions on renal fibrosis diseases. Similarly, in the breeding of mouse Surfactant protein C/human TGF1 Rec BAC TG mice, TGF1 concentrations in the blood are useful in the development confirmation of pulmonary fibrosis.
[0111] Depending on the organ to cause fibrosis, the effect on TGF1 in the blood may be different. Therefore, by specifically expressing human TGF1 in each organ, detailed analysis becomes possible and the usefulness of TGF1 as a marker can be studied.
[0112] In
[0113] According to
[0114] In
[0115] As shown in
[0116] In mice, when determining the cut-off value of TGF1 concentrations, from the same train group, and can either be determined a cut-off value by accumulating data, separate or development groups were determined statistically from the past stored data, it is also possible to use a cut-off value. When determining the cut-off value of TGF1 concentrations in mice, it is possible to set up the cut-off value by accumulating data from the same breeding group, or by statistically determined from another breeding group or past accumulated data.
[0117] <Kit for Assessing the Condition of Transgenic Mice>
[0118] Next, we will explain the contents of a kit for assessing the condition of transgenic mice expressing human TGF1.
[0119] The kit contains at least (1) an instrument for collecting a bodily fluid from a transgenic mouse, (2) a tube to separate a component including human TGF1 from the collected bodily fluid, and (3) a measuring thing for human TGF1.
[0120] (1) When collecting blood as a bodily fluid, as the instrument, a small glass tube for collecting blood from the fundus, or a razor and a small glass tube for collecting blood from the tail vein, or a syringe for collecting blood from tarsal, carotid artery, jugular vein, heart, abdominal aorta, abdominal aorta and the like is used. When using the blood, it is preferable to attach an anticoagulant (heparin, EDTA, and citric acid) in order to separate the plasma. In the case of using a micro glass tube, it is preferable to use heparin on the inner wall surface. Also, it is possible, if necessary, chemicals for anesthesia (pentobarbital, thiopental, ketamine, ether, isoflurane, sevoflurane, etc.) can be combined. Also, in the case of collecting urine as bodily fluid, a watch glass or a metabolic cage is used.
[0121] (2) In the case of using blood as bodily fluid, a tube (a centrifuge tube) having a capacity of about 30 L to 1 mL can be used.
[0122] (3) For ELISA, a plate with an appropriate number of wells (for example, 96-wells, 192-wells or 384 wells), the first antibody solution (not recognizing the mouse TGF1) that specifically recognizes the human TGF1, the second antibody solution specifically recognizing the human TGF1 which is used for the sandwich method, an antibody for color development which recognizes the second antibody, and a reagent for color development can be provided.
[0123] A procedure for measuring human TGF1 concentrations in the blood of transgenic mice using the kit will be briefly described.
[0124] First, after placing the transgenic mouse into a preservative, gently warm the tail to dilate the blood vessel (at this time, the animal itself can be expanded by keeping it for several minutes). Scald the tail with a scalpel so that the incision is opened and blood is allowed to drip and is collected using a micro glass tube (hematocrit tube). This method can be carried without killing the mouse, it is preferable to see the changes over time. It is also possible to be bled from the outer tarsal vein. Further, if the mouse may be killed, it is possible to collect a large amount of blood (about several hundred L to 1 mL) from heart, abdominal aorta, abdominal vena cava using a syringe with a needle under anesthesia.
[0125] The collected blood is transferred to a tube and centrifuged at 1000 to 1500g for 15 to 30 minutes at 4 C. to separate and collect plasma component containing human TGF1. When diluting the plasma component in order to improve the measurement accuracy, the dilution ratio is reflected in the measurement result.
[0126] The concentration of TGF1 in plasma is measured by an ELISA system. When a sandwich method is used, the first antibody is coated on the solid phase of the ELISA plate, the solid phase is blocked with BSA or the like, and the sample plasma (or diluted appropriately) is added. After binding the first antibody with human TGF1, the solution in the well is removed and the well is washed several times with PBS. Then, a second antibody is added to the well, after binding the second antibody with the first antibody bound to human TGF1, the solution in the well is removed and the well is washed several times with PBS. Next, a labeled antibody that recognizes the second antibody is added to the well and reacted, and then the solution in the well is removed. After that, the well is washed several times with PBS, and color development reagent is added to the well. After an appropriate time, the degree of color development is measured using a plate reader. The human TGF1 concentrations in samples are determined based on the calibration curve which are measured at the same time.
[0127] By comparing the concentration of human TGF1 in the blood of the transgenic mouse in this way with the cut-off value, the pathogenesis of the transgenic mouse can be evaluated.
[0128] <Kit for Diagnosing Fibrosis in Human>
[0129] Next, we will explain the contents of a kit for diagnosing fibrosis in human.
[0130] The kit contains at least (1) an instrument for collecting a bodily fluid from a subject, (2) a tube to separate a component including human TGF1 from the collected bodily fluid, and (3) an ELISA system for measuring human TGF1.
[0131] (1) When collecting blood as a bodily fluid, a syringe with a needle is preferably used as the instrument. When using the blood, it is preferable to attach an anticoagulant (heparin, EDTA, and citric acid) in order to separate the plasma. When collecting urine as bodily fluid, a catheter is used.
[0132] (2) In the case of using blood as bodily fluid, a tube (a centrifuge tube) having a capacity of about 1 ml to 30 mL can be used.
[0133] (3) For ELISA, a plate with an appropriate number of wells (for example, 96-wells, 192-wells or 384 wells), the first antibody solution that specifically recognizes the human TGF1, the second antibody solution specifically recognizing the human TGF1 which is used for the sandwich method, an antibody for color development which recognizes the second antibody, and a reagent for color development can be provided.
[0134] A procedure for measuring human TGF1 concentrations in the blood of transgenic mice using the kit will be briefly described.
[0135] First, blood is collected using a syringe with a needle. The collected blood is transferred to a tube and centrifuged at 1000 to 1500g for 15 to 30 minutes at 4 C. to separate and collect plasma component containing human TGF1.
[0136] The method of determining the TGF1 concentrations in plasma by the ELISA system follows the method described in above <Kit for assessing the condition of transgenic mice>.
[0137] By comparing the concentration of human TGF1 in the blood in this way with the cut-off value, a data for assessing the degree progression of human fibrosis can be obtained. Finally, an expert such as a medical doctor will judge it.
[0138] As mentioned above, based on the present embodiments, a TG mouse specifically expressing human TGF1 in the kidney and developing spontaneous renal fibrosis was provides. The transgenic mouse naturally develops renal fibrosis and renal failure at 15 weeks of age, and begins to die at 20 to 26 weeks of age. By using the TG mouse that develops the disease in early life stage and lives relatively long, research on kidney related diseases (including glomerulosclerosis, renal failure, diabetic nephropathy, hypertension-related renal disorders, kidney cancer, peritoneal fibrosis, etc.) can be dramatically developed.