LAT adapter molecule for enhanced T-cell signaling and method of use

Abstract

LAT (Linker for Activation of T-cells) is a protein involved in signaling through the T-cell receptor (TCR). The invention provides a LAT protein including mutations at ubiquitylation sites that result in an increase in stability of LAT in stimulated and unstimulated cells, and enhanced signaling through the TCR. The invention further provides use for a LAT protein including mutations at ubiquitylation sites for therapeutic and laboratory methods.

Claims

1. A therapeutic composition comprising a therapeutically effective amount of a T-cell with anticancer activity comprising a ubiquitin-deficient LAT (linker for activation of T cells) or an effective fragment thereof, wherein the ubiquitin-deficient LAT or effective fragment thereof comprises the polypeptide of SEQ ID NO: 1 or an effective fragment thereof, each having at least one amino acid substitution at a site selected from the group consisting of amino acid 52 and amino acid 204 of SEQ ID NO: 1, and wherein the ubiquitin-deficient LAT or effective fragment thereof has increased signaling through the T-cell receptor of the T-cell.

2. The therapeutic composition of claim 1, wherein the amino acid substitution at amino acids 52 and 204 are amino acids not capable of being ubiquitylated.

3. The therapeutic composition of claim 1, wherein the amino acid substitution at amino acids 52 and 204 are each arginine (R).

4. The therapeutic composition of claim 1, wherein the T-cell further comprises an expression construct encoding the ubiquitin-deficient LAT or effective fragment thereof.

5. The therapeutic composition of claim 4, wherein the expression construct comprises a nucleic acid molecule encoding the polypeptide of SEQ ID NO: 1 or the effective fragment thereof, each having at least one amino acid substitution at a site selected from the group consisting of amino acid 52 and amino acid 204.

6. The therapeutic composition of claim 5, wherein the expression construct includes a T-cell specific promoter for expression of the ubiquitin-deficient LAT.

7. The therapeutic composition of claim 6, wherein the promoter is selected from the group consisting of human CD2, distal Lck, and proximal Lck.

8. The therapeutic composition of claim 1, wherein the T-cell is an autologous T-cell with anti-tumor activity.

9. The therapeutic composition of claim 1, wherein the T-cell is an allogenic T-cell with anti-tumor activity.

10. A therapeutic composition comprising a therapeutically effective amount of a tumor-reactive T-cell for Adoptive Cell Therapy (ACT) for the treatment of cancer, wherein said tumor-reactive T-cell expresses a ubiquitin-deficient LAT (linker for activation of T cells) or an effective fragment thereof, wherein the ubiquitin-deficient LAT or effective fragment thereof comprises (a) the polypeptide of SEQ ID NO: 1 or an effective fragment thereof, each having at least one amino acid substitution at a site selected from the group consisting of amino acid 52 and amino acid 204 of SEQ ID NO: 1, or (b) the polypeptide of SEQ ID NO: 2 or an effective fragment thereof, each having an amino acid substitution at amino acid 121 of SEQ ID NO: 2, wherein the ubiquitin-deficient LAT comprises a mutated ubiquitylation site, and wherein the ubiquitin-deficient LAT or effective fragment thereof has increased signaling through the T-cell receptor of the T-cell.

11. The therapeutic composition of claim 10, wherein the amino acid substitution at amino acids 52, 121, and 204 are amino acids not capable of being ubiquitylated.

12. The therapeutic composition of claim 10, wherein the amino acid substitution at amino acids 52, 121, and 204 are each arginine (R).

13. The therapeutic composition of claim 10, wherein the T-cell further comprises an expression construct encoding the ubiquitin-deficient LAT.

14. The therapeutic composition of claim 13, wherein the expression construct comprises a nucleic acid molecule encoding (a) the polypeptide of SEQ ID NO: 1 or an effective fragment thereof, each having at least one amino acid substitution at a site selected from the group consisting of amino acid 52 and amino acid 204 of SEQ ID NO: 1, or (b) the polypeptide of SEQ ID NO: 2 or an effective fragment thereof, each having an amino acid substitution at amino acid 121.

15. The therapeutic composition of claim 13, wherein the expression construct includes a T-cell specific promoter for expression of the ubiquitin-deficient LAT.

16. The therapeutic composition of claim 15, wherein the promoter is selected from the group consisting of human CD2, distal Lck, and proximal Lck.

17. The therapeutic composition of claim 10, wherein the T-cell is an autologous T-cell with anti-tumor activity.

18. The therapeutic composition of claim 10, wherein the T-cell is an allogenic T-cell with anti-tumor activity.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1ASimplified schematic of proximal signaling in a T-cell.

(2) FIG. 2ASchematic of human LAT protein. FIG. 2BWestern blot of immunoprecipitates from cells transfected with expression vectors encoding an HA-tagged ubiquitin and a wild-type or mutated version of LAT as indicated.

(3) FIG. 3Graph of the time that LAT containing clusters persisted in cells after TCR stimulation in cells expressing wild-type LAT, mutant 2KR LAT, or cells co-expressing 70ZCbl with wild-type or mutant 2KR LAT.

(4) FIG. 4AMean YFP levels of cells expressing wild-type LAT-YFP or 2KR LAT-YFP 24 hours after transfection pre-sort, post-sort and post-sort 24 hrs in culture. FIG. 4BQuantitative, real-time PCR results of endogenous LAT, transfected LAT and beta-actin.

(5) FIG. 5AAn autoradiograph of LAT protein lifetime in Jurkat JCam2.5 cells expressing a wild-type or mutated version (2KRLAT) of LAT is resistant to ubiquitylation. FIG. 5BPulse chase analysis of cells treated with proteasomal inhibitor MG-132, the lysosomal inhibitor leupeptin or a combination of the two. FIG. 5CQuanatification of the autoradiographs shown in FIG. 5A. FIG. 5DQuantification of the autoradiographs shown in FIG. 5B. FIG. 5EMean YFP levels in cells expressing wild-type or 2KR LAT-YFP incubated with proteasomal inhibitor MG-132.

(6) FIG. 6AWestern blot analysis of whole cell lysates of LAT-deficient Jurkat JCam2.5 cells stably expressing wild-type or 2KR LAT. FIG. 6BCells were stimulated with CD3 antibody and calcium influx was monitored using a fluorescent dye INDO-1. FIG. 6CCells were stimulated with 10 g/ml CD3 and CD69 levels were evaluated 16 hours post-stimulation.

(7) FIG. 7AJurkat E6.1 cells were transiently transfected with LAT targeting siRNA or control siRNA and control YFP plasmid, wild-type LAT-YFP or 2KR LAT-YFP plasmids as indicated. Whole cell lysates were prepared from the above-described transfected cells 48 hours after transfection. The levels of endogenous LAT, transfected LAT-YFP (upper panel) and -actin (lower panel) were assessed by immunoblotting. FIG. 7BHistogram showing wild-type LAT-YFP and 2KR LAT-YFP expression. For functional assays described in C and D, cells falling within Gate B expressing equivalent levels of LAT-YFP protein were analyzed. FIG. 7CTransfected cells were stimulated with CD3 and cytosolic Ca.sup.++ influx was measured. FIG. 7DCD69 upregulation was measured in transfected cells 18 hrs after CD3 activation. FIG. 7ENFAT luciferase activity was measured in cells stimulated with various doses of CD3.

(8) FIG. 8APrimary human CD4+ cells were transiently transfected with LAT targeting siRNA or control siRNA and control YFP plasmid, wild-type LAT-YFP or 2KR LAT-YFP plasmids as indicated. Whole cell lysates were prepared from the above-described transfected cells 48 hours after transfection. The levels of endogenous LAT, transfected LAT-YFP (upper panel) and -actin (lower panel) were assessed by immunoblotting. FIG. 8BCD69 upregulation was measured in transfected cells 18 hrs after CD3 activation. FIG. 8CHistogram showing wild-type LAT-YFP and 2KR LAT-YFP expression.

(9) FIG. 9A shows calcium fluxes in response to CD3 stimulation in cells transfected with siRNA targeted to LAT. FIG. 9B and FIG. 9C show calcium fluxes in response to CD3 stimulation in cells transfected with a construct simultaneously expressing an shRNA targeted to LAT and GFP.

DETAILED DESCRIPTION

(10) The engagement of the multi-subunit T-cell receptor (TCR) is rapidly followed by the activation of protein tyrosine kinases (PTKs) that phosphorylate a number of downstream substrates, of which a prominent example is LAT, a transmembrane adapter protein. Phosphorylated tyrosines on LAT serve as docking sites for multiple proteins containing Src homology 2 domains, including adapters such as Gads and Grb2, which in turn are associated with other signaling proteins. For example, SLP-76 is recruited to LAT through association with Gads. The LAT-Gads-SLP-76 complex creates a platform for the recruitment of numerous other signaling molecules, including phospholipase C-1 (PLC-1), the Rho family GTPase exchange factor Vav, and the ubiquitin ligase Cbl. Thus, TCR engagement induces the formation of LAT-based signaling complexes that initiate intracellular signals required for T-cell activation.

(11) To ensure an appropriate immune response to antigenic challenge, without generating an autoimmune response, it is crucial that T-cell activation be tightly regulated. TCR engagement activates several mechanisms that have been described to attenuate TCR-mediated signaling, including ligand-induced internalization and degradation of activated signaling molecules. For example, c-Cbl mediated ubiquitin conjugation to the TCR chain has been correlated with TCR internalization into endosomal compartments and the subsequent degradation of the receptor in activated T cells. In addition, Cbl proteins downregulate PTKs such as Lck, Fyn, and ZAP-70, as well as non-PTK molecules such as the p85 subunit of phosphatidylinositol 3-kinase and the guanine nucleotide exchange factor Vav.

(12) This tightly controlled, short lived response is advantageous during an endogenous immune response, however, when T-cells are administered for a chronic disease such as cancer or a viral infection, persistence of T-cells and a T-cell response is advantageous.

(13) As demonstrated herein, expression of an ubiquitin-deficient LAT in T-cells results in increased signaling through the T-cell receptor as compared to a cell expressing wild-type LAT. This increased signaling could result in an increase in T-cell viability by increased cell proliferation or decreased or delayed apoptosis, increased cytokine release, or in the case of cytotoxic T cells, enhanced lytic activity on appropriate targets. Increased signaling through the TCR could also allow for the use of TCRs having a lower avidity for the target antigen.

(14) While most studies on internalization as a means of signal downregulation in T cells have focused on the fate of the TCR, results from studies tracking individual components of TCR-induced microclusters in real time suggest that the fates of the TCR and signaling proteins diverge during T-cell activation. In systems using either stimulatory antibodies or lipid bilayers to model T-cell activation, whereas microclusters contain both the TCR and signaling molecules initially, signaling molecules dissociate from the receptor soon thereafter. Upon TCR activation, LAT-containing signaling clusters are internalized into various distinct intracellular compartments prior to dissipating rapidly. Expression of versions of c-Cbl defective in the RING finger domain, which mediates ubiquitin ligase activity, resulted in severely decreased internalization of LAT and SLP-76 clusters, decreased ubiquitylation of LAT, and an increase in basal LAT levels, as well as elevated basal and TCR-induced phosphorylated LAT (pLAT) levels. The inhibition of LAT internalization was also observed in T cells from mice lacking c-Cbl. These data are consistent with a model in which TCR-mediated activation first leads to the rapid formation of signaling complexes, after which c-Cbl activity is involved in the internalization and possible downregulation of a subset of activated signaling molecules. Given the essential scaffolding role of the adapter protein LAT in T-cell activation, the regulated internalization of activated LAT signaling complexes may be one efficient strategy by which to control the duration and localization of signaling from microclusters and, thus, regulate the kinetics, intensity, and specificity of T-cell signaling.

(15) To further analyze the role of LAT ubiquitylation in TCR signaling, lysines identified as potential ubiquitylation sites in LAT were mutated (K52R, K204R and 2KR which contains both lysine mutations) and the ability of LAT to act as a substrate for ubiquitylation was assayed in tissue culture cells. Using the immunoprecipitation-western blot methods described below in the Examples, it was determined that LAT was ubiquitylated primarily on amino acid K52 (see, e.g., FIG. 2B). As expected, the 2KR LAT construct in which both K52 and K204 are mutated to arginines also showed severely decreased ubiquitylation. Ubiquitylation sites in mouse are at amino acids 53 and 121.

(16) It is expected that mutation at the equivalent amino acids in mouse would have the same effect on T cell signaling in mouse cells as the mutations in human cells. Further, it is expected that mutation of the lysines to any amino acid that could not be ubiquitylated, i.e., any amino acid other than cysteine, that did not disrupt protein folding would have a similar effect on T cell signaling. Preferably, the substitution is a conservative substitution, wherein the basic lysine amino acid is replaced with another basic amino acid, i.e., arginine or histidine. The K to R substitution is prevents ubiquitination because the alpha-carboxyl group of the terminal glycine on ubiquitin forms an isopeptide bond with an (epsilon) amino group in the side chain of a lysine residue of the target protein. Thus K is mutated to R to preserve the basic residue which may be important for protein structure, but this substitution prevents ubiquitylation. Generation of coding sequence for proteins including point mutations is well within the ability of those of skill in the art (see, e.g., Alberts et al., Molecular Biology of the Cell, 2.sup.nd Edition, c. 1989, Garland Publishing Inc.). Moreover, methods of testing such proteins for activity using any of the methods provided herein is routine and well within the ability of those of skill in the art.

(17) Using the 2KR LAT mutant, time to formation and internalization of LAT containing clusters was determined using established methods (see Balagopalan et al., c-Cbl-mediated regulation of LAT-nucleated signaling in complexes. Mol. Cell. Bio. 2007; 27:8622-8636, incorporated herein by reference). Briefly, T-cells expressing fluorescently tagged proteins, e.g., LAT-YFP (yellow fluorescent protein) were dropped onto an antibody-coated coverslip maintained in media at 37 C. Receptor-initiated signaling is triggered by the settling of the cells on the coverslip surface. Images were captured using high resolution microscopy.

(18) The results from an experiment using cells expressing either wild-type LAT-YFP or the 2KR LAT-YFP either alone or in conjunction with 70Z Cbl, a ubiquitin deficient Cbl mutant, are shown in FIG. 3. Expression of the wild-type or mutant LAT-YFP had no effect on the amount of time that LAT containing clusters could be observed in the cells. This is in contrast to cells expressing a 70Z Cbl in conjunction with each of the LAT-YFPs in which LAT containing clusters were demonstrated to be visible for about twice as long. These data indicate that the variation in persistence of LAT containing clusters in response to stimulation of the TCR is not dependent upon ubiquitylation of LAT.

(19) However, 2KR LAT-YFP was found to be more stable in cells than wild-type LAT-YFP (see FIG. 4A and FIG. 4B). Jurkat E6.1 cells transfected with expression constructs encoding either mutant or wild-type LAT-YFP were sorted to provide populations with equivalent LAT-YFP levels. Cells were cultured for 24 hours and then total YFP was analyzed. Cells expressing the 2KR mutant LAT were found to have significantly higher mean YFP levels. These results demonstrate that LAT lacking ubiquitylation sites is more stable than wild-type LAT.

(20) To test whether higher protein levels of 2KR LAT-YFP reflected increased transcription of this construct, transcript levels were measured by quantitative RT-PCR. Jurkat E6.1 cells were transiently transfected with wild-type LAT-YFP or 2KR LAT-YFP and were evaluated for chimeric LAT-YFP and endogenous LAT-YFP transcript expression. Transcript levels of the -actin gene were used as a reference. Transcript levels of wild-type LAT-YFP and 2KR LAT-YFP were not significantly different.

(21) The rate of degradation of wild-type and 2KR-LAT proteins were assayed by pulse chase analysis (FIG. 5A and FIG. 5B). Jurkat JCam2.5 cells that do not express endogenous LAT were stably transfected with expression constructs encoding either 2KR mutant or wild-type LAT. Cells were incubated or pulsed with S.sup.35 labeled methionine and cysteine. Whole cell lysates were prepared at various time-points after the initial pulse and LAT immunoprecipitations were performed. Autoradiograph analysis revealed that the half-life of 2KR LAT was found to be greater than 120 minutes, whereas the half-life of wild-type LAT was found to be 70 minutes. The availability of more LAT for longer periods of time suggests a method to provide increased and/or prolonged signaling in T cells. Treatment of cells with the proteosome inhibitor MG-132 also inhibited degradation of LAT, but no inhibition was observed as a result of treatment of cells with the lysosome protease inhibitor leupeptin (FIG. 5C, FIG. 5D and FIG. 5E), further demonstrating that LAT degradation was ubiquitin and proteosome mediated.

(22) To determine if the persistence of the non-ubiquitylated LAT did in fact correspond to an increase in persistence of LAT signaling, Jurkat JCam2.5 cells lacking endogenous LAT (FIG. 6A, FIG. 6B and FIG. 6C) were transfected with expression constructs encoding either 2KR mutant or wild-type LAT. Cells were stimulated with CD3 antibody and calcium influx was monitored using a fluorescent dye. The level and persistence of T-cell signaling was increased in the cells transfected with the 2KR LAT relative to cells expressing only wild-type LAT. No signaling was detected in cells not expressing LAT.

(23) To further confirm an increase in TCR signaling in cells expressing the 2KR-LAT, Jurkat JCam2.5 cells transfected with expression constructs encoding either 2KR mutant or wild-type LAT were stimulated with CD3 and assayed for production of CD69, the earliest identified inducible cell surface glycoproteins as a way to measure T-cell activation through another signaling pathway (FIG. 6C). Expression of CD69 was comparable in unstimulated cells expressing either wild-type or 2KR LAT, however, after stimulation with CD3, expression of CD69 was substantially higher in cells expressing 2KR LAT. These results further demonstrate an increase in TCR signaling in cells expressing a ubiquitin deficient LAT.

(24) To further elucidate the role of LAT ubiquitylation in T cell signaling, endogenous LAT expression was knocked-down in Jurkat E6.1 cells and wild-type or 2KR LAT-YFP were re-expressed in these cells. Western blotting experiments revealed that endogenous LAT expression was dramatically reduced in cells transfected with LAT-targeting siRNA. Furthermore, 2KR LAT-YFP was expressed at higher levels than wild-type LAT-YFP as expected (from results in FIG. 4A AND FIG. 4B). TCR-induced signaling outputs such as Ca++ influx, NFAT activation and CD69 upregulation were elevated in cells reconstituted with 2KR LAT-YFP as compared with cells expressing wild-type LAT-YFP (FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D and FIG. 7E). Importantly, comparison of signaling in cells expressing equivalent levels of wild-type and 2KR LAT-YFP revealed that 2KR LAT-YFP caused more effective T cell signaling on a per molecule basis as compared with wild-type LAT. Furthermore, the LAT ubiquitin mutant shifted the dose response, so that a lower stimulation was required to trigger a response of the same magnitude. This may be of benefit in physiological settings of limited ligand concentrations.

(25) The effects of 2KR expression was tested in non-transformed primary human CD4+ T cells. Endogenous LAT expression was reduced using siRNA targeting LAT and simultaneously plasmids expressing wild-type LAT-YFP or 2KR LAT-YFP were re-expressed. Transfected cells were stimulated with various doses of CD3 and CD28 and evaluated for CD69 upregulation 16 hours post-stimulation. Consistent with results obtained in Jurkat cells, enhanced CD69 upregulation was observed in cells expressing 2KR LAT at all doses tested (FIG. 8A, FIG. 8B AND FIG. 8C). Taken together, these results demonstrate a critical role for LAT ubiquitylation in maintaining normal T cell signaling. In all cell types tested, cells bearing ubiquitin-deficient LAT were hyperresponsive to stimulation through the TCR.

(26) To further analyze the role of LAT expression in T-cell signaling, siRNAs and shRNAs targeted to LAT were designed and transfected into cells. Cells were tested for calcium influx in response to stimulation with CD3 antibody (FIG. 9A, FIG. 9B and FIG. 9C). All three of the siRNAs targeted to LAT were able to decrease calcium flux to background level in cells (FIG. 9A). shRNA-GFP fusion constructs allowed for the gating of cells based on the expression of GFP in the cells, which presumably correlates with the level of shRNA present in the cell and inversely correlates with LAT protein levels. The greater the expression of GFP, the more substantial the dampening of the calcium influx into the cells in response to stimulation with CD3 (FIG. 9B and FIG. 9C). These data demonstrate that LAT expression has a dose dependent effect on signaling through the TCR.

(27) The 2KR LAT protein can be used as a therapeutic agent for the treatment of various diseases and conditions for which a temporally extended immune response, beyond that in cells expressing wild-type LAT is desired. The 2KR LAT protein can be expressed in cells expressing a TCR directed to the antigen of interest, e.g., a cancer antigen, or a pathogenic antigen, e.g., a viral antigen, a parasitic antigen, a bacterial antigen, etc. In certain embodiments of the invention, a nucleic acid sequence encoding the 2KR protein, or an effective fragment thereof, is delivered to the T cell, typically in conjunction with the TCR targeted to the antigen of interest. However, in certain embodiments, T cells expressing the TCR of interest can be selected and expanded.

(28) In an exemplary method, T cells are collected from the subject to be treated and expanded ex vivo under conditions appropriate to allow re-administration of the cells to the subject after transfer of the desired coding sequences. Methods such as transfection by electroporation or transduction by adenoviral, adeno-associated viral, retroviral, or lentiviral systems; or other methods and systems that include the use of reagents acceptable for administration to humans are preferred.

(29) In an alternative embodiment, a nucleic acid encoding a protein for administration can be administered systemically. Larger doses of nucleic acid would be used for administration systemically as compared to dosages for ex vivo administration. Such considerations are well understood by those of skill in the art.

(30) In certain embodiments, cell specific promoters for expression of LAT proteins in T-cells would be used. Such promoters include, but are not limited to, human CD2, distal Lck, and proximal Lck. In other embodiments, non-tissue specific promoters such as non-tissue specific promoters including viral promoters such as cytomegalovirus (CMV) promoter, -actin promoter including the chicken -actin promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin promoter including hybrid ubiquitin promoter, and EF-1 promoter can be used.

(31) Other regulatory sequences for inclusion in expression constructs include poly-A signal sequences, for example SV40 polyA signal sequences. The inclusion of a splice site (i.e., exon flanked by two introns) has been demonstrated to be useful to increase gene expression of proteins from expression constructs.

(32) Enhancers can also be used in the constructs of the invention. Enhancers include, but are not limited to enhancer is selected from the group consisting of cytomegalovirus (CMV) enhancer, an elongation factor 1-alpha enhancer, and liver-specific enhancers.

(33) For viral sequences, the use of viral sequences including inverted terminal repeats, for example in AAV viral vectors can be useful. Certain viral genes can also be useful to assist the virus in evading the immune response after administration to the subject.

(34) In certain embodiments of the invention, the viral vectors used are replication deficient, but contain some of the viral coding sequences to allow for replication of the virus in appropriate cell lines. The specific viral genes to be partially or fully deleted from the viral coding sequence is a matter of choice, as is the specific cell line in which the virus is propagated. Such considerations are well known to those of skill in the art.

(35) Further, viruses with specific tropisms that will cause them to go to efficiently infect liver cells can be selected for use in the method of the invention. For example, the AAV8 serotype is known to be preferentially hepatotrophic (Nakai et al., 2005. J. Virol. 79:214-224).

(36) Compositions and methods for gene delivery to various organs and cell types in the body are known to those of skill in the art. Such compositions and methods are provided, for example in U.S. Pat. Nos. 7,459,153; 7,282,199; 7,259,151; 7,041,284; 6,849,454; 6,410,011; 6,027,721; and 5,705,151, all of which are incorporated herein by reference. Expression constructs provided in the listed patents and any other known expression constructs for gene delivery can be used in the compositions and methods of the invention.

(37) Methods of viral vector design and generation are well known to those of skill in the art, and methods of preparation of viral vectors can be performed by any of a number of companies or using routine laboratory methods. Expression constructs provided herein can be inserted into any of the exemplary viral vectors listed below.

(38) Gene transfer and nucleic acid therapeutics have been demonstrated to typically be more effective when delivered to the desired site of action rather than systemically, e.g., by delivering the viral vector ex vivo, both increasing delivery and transduction efficiency and reducing undesirable systemic effects.

(39) Gene transfer to the liver using AAV vectors for the treatment of hemophilia B is currently being tested in a phase 1 trial, see, e.g., clinicaltrials.gov identifier NCT00515710. The study includes intra-hepatic administration of AAV2-hFIX (Factor IX) and secondary outcomes for analysis include determining the potential efficacy in each dose group by measuring biological and physiological activity of the transgene product. This human trial follows a large number of animal experiments in which AAV vectors were efficiently delivered to the liver using AAV2 and AAV8 viral vectors (e.g., Mount et al. Blood. 2002; 99:2670-2676; Cardone et al., Hum Mol Genet. 2006; 15:1225-1236; Daly et al., Gene Ther. 2001; 8:1291-1298; McEachern et al. J Gene Med. 2006; 8:719-729; Koeberl et al., Gene Ther. 2006; 13:1281-1289; Moscioni et al., Mol Ther. 2006; 14:25-33; Park et al., Exp Mol Med. 2006; 38:652-661; Scallan et al. Blood. 2003; 102:2031-2037; Seppen et al. Mol Ther. 2006; 13:1085-1092; each of which is incorporated by reference)

(40) Many studies have demonstrated that local administration to the eye provides efficient transduction of cells with viral vectors. In the Bainbridge study (NEJM, 358:2231-2239, 2008, incorporated herein by reference), the tgAAG76 vector, a recombinant adeno-associated virus vector of serotype 2 was used for gene delivery. The vector contains the human RPE65 coding sequence driven by a 1400-bp fragment of the human RPE65 promoter and terminated by the bovine growth hormone polyadenylation site, as described elsewhere.

(41) Additional AAV vectors are provided in the review by Rolling 2004 (Gene Therapy 11: S26-S32, incorporated herein by reference). Hybrid AAV viral vectors, including AAV 2/4 and AAV2/5 vectors are provided, for example, by U.S. Pat. No. 7,172,893 (incorporated herein by reference). Such hybrid virus particles include a parvovirus capsid and a nucleic acid having at least one adeno-associated virus (AAV) serotype 2 inverted terminal repeat packaged in the parvovirus capsid. However, the serotypes of the AAV capsid and said at least one of the AAV inverted terminal repeat are different. For example, a hybrid AAV2/5 virus in which a recombinant AAV2 genome (with AAV2 ITRs) is packaged within a AAV Type 5 capsid.

(42) Self-complementary AAV (scAAV) vectors have been developed to circumvent rate-limiting second-strand synthesis in single-stranded AAV vector genomes and to facilitate robust transgene expression at a minimal dose (Yokoi, 2007. IOVS. 48:3324-3328, incorporated herein by reference). Self-complementary AAV-vectors were demonstrated to provide almost immediate and robust expression of the reporter gene inserted in the vector. Subretinal injection of 510.sup.8 viral particles (vp) of scAAV.CMV-GFP resulted in green fluorescent protein (GFP) expression in almost all retinal pigment epithelial (RPE) cells within the area of the small detachment caused by the injection by 3 days and strong, diffuse expression by 7 days. Expression was strong in all retinal cell layers by days 14 and 28. In contrast, 3 days after subretinal injection of 510.sup.8 vp of single stranded (ss)AAV.CMV-GFP, GFP expression was detectable in few RPE cells. Moreover, the ssAAV vector required 14 days for the attainment of expression levels comparable to those observed using scAAV at day 3. Expression in photoreceptors was not detectable until day 28 using the ssAAV vector. The use of the scAAV vector in the gene delivery methods of the invention can allow for prompt and robust expression from the expression construct. Moreover, the higher level of expression from the scAAV viral vectors can allow for delivery to of the viral particles intravitreally rather than subretinally.

(43) Various recombinant AAV viral vectors have been designed including one or more mutations in capsid proteins or other viral proteins. It is understood that the use of such modified AAV viral vectors falls within the scope of the instant invention.

(44) Kota et al. (Cell, 137: 1005-1017, 2009, incorporated herein by reference) demonstrated efficient delivery of an AAV expression vector containing an shRNA targeted to miR-26a in vivo in a model of rat hepatocellular carcinoma.

(45) Adenoviral vectors have also been demonstrated to be useful for gene delivery. For example, Mori et al (2002. IOVS, 43:1610-1615, incorporated herein by reference) discloses the use of an adenoviral vector that is an E-1 deleted, partially E-3 deleted type 5 Ad in which the transgene (green fluorescent protein) is driven by a CMV promoter. Peak expression levels were demonstrated upon injection of 10.sup.7 to 10.sup.8 viral particles, with subretinal injection providing higher levels of expression than intravitreal injection.

(46) Efficient non-viral ocular gene transfer was demonstrated by Farjo et al. (2006, PLoS 1:e38, incorporated herein by reference) who used compacted DNA nanoparticles as a system for non-viral gene transfer to ocular tissues. As a proof of concept, the pZEEGFP5.1 (5,147 bp) expression construct that encodes the enhanced green fluorescent protein (GFP) cDNA transcriptionally-controlled by the CMV immediate-early promoter and enhancer was used. DNA nanoparticles were formulated by mixing plasmid DNA with CK30PEG10K, a 30-mer lysine peptide with an N-terminal cysteine that is conjugated via a maleimide linkage to 10 kDa polyethylene glycol using known methods. Nanoparticles were concentrated up to 4 mg/ml of DNA in saline. The compacted DNA was delivered at a 0.6 g dose to the vitreal cavity. GFP expression was observed in the lens, retina, and pigment epithelium/choroid/sclera by PCR and microscopy.

(47) Further, a number of patents have been issued for methods of ocular gene transfer including, but not limited to, U.S. Pat. No. 7,144,870 which provides methods of hyaluronic acid mediated adenoviral transduction; U.S. Pat. Nos. 7,122,181 and 6,555,107 which provide lentiviral vectors and their use to mediate ocular gene delivery; U.S. Pat. No. 6,106,826 which provides herpes simplex viral vectors and their use to mediate ocular gene delivery; and U.S. Pat. No. 5,770,580 which provides DNA expression vectors and their use to mediate ocular gene delivery. Each of these patents is incorporated herein by reference.

(48) Hepatic gene delivery has also been demonstrated in a number of studies. For example, self-complementary adeno-associated virus vectors containing a novel liver-specific human factor IX expression cassette were found to enable highly efficient transduction of murine and nonhuman primate liver (Nathwani et al. Blood. 2006 Apr. 1; 107:2653-61). An AAV-2 genome encoding the hflX gene was cross-packaged into capsids of AAV types 1 to 6 using efficient, large-scale technology for particle production and purification. In immunocompetent mice, the resultant vector particles expressed high hFIX levels ranging from 36% (AAV-4) to more than 2000% of normal (AAV-1, -2, and -6), which would exceed curative levels in patients with hemophilia. (Grimm et al., Blood. 2003 Oct. 1; 102:2412-9).

(49) Further, a number of patents have been issued for methods of hepatic gene or nucleic acid transfer including, but not limited to U.S. Pat. Nos. 7,615,537 and 7,351,813 which provide methods for expression of clotting factor in the liver; U.S. Pat. No. 7,528,118 which provides methods for delivery of siRNA to liver to reduce expression of ApoB; U.S. Pat. No. 7,498,017 provides a cationic poly cyclic imidazolinium-containing compound for condensing nucleic acid for delivery to a cell, including a liver cell; and U.S. Pat. No. 6,967,018 for delivery of AAV-1, 2, or 5 vectors for the expression of adiponectin. Each of these patents related to hepatic gene or nucleic acid transfer is incorporated herein by reference.

(50) Such viral vectors and methods can be used for the delivery of nucleic acids encoding modified LAT proteins to T cells.

(51) Self-complementary Adenoviral Vectors

(52) Under normal circumstances, AAV packages a single-stranded DNA molecule of up to 4800 nucleotides in length. Following infection of cells by the virus, the intrinsic molecular machinery of the cell is required for conversion of single-stranded DNA into double stranded form. The double-stranded form is then capable of being transcribed, thereby allowing expression of the delivered gene to commence. It has been shown in a number of cell and tissue types that second strand synthesis of DNA by the host cell is the rate-limiting step in expression. By virtue of already being packaged as a double stranded DNA molecule, self-complementary AAV (scAAV) bypasses this step, thereby greatly reducing the time to onset of gene expression.

(53) Self-complementary AAV is generated through the use of vector plasmid with a mutation in one of the terminal resolution sequences of the AAV virus. This mutation leads to the packaging of a self-complementary, double-stranded DNA molecule covalently linked at one end. Vector genomes are required to be approximately half genome size (2.4 KB) in order to package effectively in the normal AAV capsid. Because of this size limitation, large promoters are unsuitable for use with scAAV. Most broad applications to date have used the cytomegalovirus immediate early promoter (CMV) alone for driving transgene expression. A long acting, ubiquitous promoter of small size is useful in a scAAV system.

(54) Xu et al (Mol. Ther. 11: 523-530, 2005, incorporated herein by reference) have demonstrated efficient shRNA expression in mammalian cancer cells after delivery using an scAAV vector. U.S. Pat. No. 7,465,583 teaches delivery of nucleic acid to various cell types using scAAV vectors (incorporated herein by reference).

(55) Gene Transfer Using Plasmid DNA

(56) Delivery of plasmid DNA has been demonstrated to be an efficient method of gene transfer in vivo (Yoshino et al., 2006, and Budker et al, 1996; Zhang et al., 1997; each incorporated herein by reference). The methods provided herein include gene transfer ex vivo. In the methods, the nucleic acid is delivered directly to the tissue. Therefore, the nucleic acid need not be packaged or modified to direct it to the appropriate tissue. Moreover, as the nucleic acid is delivered to the cells over a short time period, the nucleic acid is far less susceptible to the effects of nucleases than a nucleic acid delivered systemically. The invention provides expression of a coding sequence in naked DNA which includes DNA not enclosed in a viral capsid, but can include other compounds to promote cellular uptake and/or to increase the stability of the DNA. Such compounds are preferably safe for use in humans and such considerations are well known to those of skill in the art. Typically, naked DNA is in the form of plasmid DNA, such as supercoiled plasmid DNA to provide some protection against nucleases that may be present. Gene transfer using plasmid DNA can also include the use of plasmid DNA that has been cut, for example, with a restriction enzyme, to provide a linear DNA molecule. Gene transfer using plasmid DNA may be beneficial as it may overcome the obstacle of immune response to viral capsid proteins.

Example 1

Materials and Methods

(57) Reagents:

(58) Human anti-CD3 (UCHT or HIT3a) monoclonal antibodies were purchased from Pharmingen and were used to coat coverslips. The following antibodies were used for western blotting and immunoprecipitation: Anti-HA-HRP (Roche), mouse anti-LAT (Upstate), mouse anti- actin (SIGMA), rabbit anti-pLAT191 (Invitrogen), mouse anti-pY clone 4G10 (Millipore). APC-conjugated CD69 antibody was from BD Pharmingen. Indo-1 AM was from Invitrogen. OKT3 binding the human CD3- chain was used to trigger T cell activation.

(59) COS-7 Cell Transfection, Immunoprecipitation and Immunoblotting:

(60) COS-7 cells were transfected using Lipofectamine Plus reagent as recommended by the manufacturer (SIGMA). Briefly, 60 mm dishes were seeded with cells and 70% confluent cell cultures were used for transfection. Cells were co-transfected with WT, K52, K204 or 2KR LAT (0.5 g) and HA-Ub (0.5 g). 24 hours post-transfection, cells were lysed in ice-cold Nonidet-40 lysis buffer (50 mM Tris pH 7.4; 150 mM NaCl; 5 mM EDTA; 5 mM EGTA; 50 mM NaF; 1% NP-40), and cellular lysates were subjected to immunoprecipitation using mouse anti-LAT monoclonal antibody (Upstate). Protein A/G Plus-Agarose beads (Santa Cruz Biotechnology) were used for immunoprecipitation. Protein samples were resolved by sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membrane and immunoblotted with appropriate primary antibodies followed by enhanced chemiluminescence (Upstate).

(61) Cell Culture and Transfection of Jurkat Cells:

(62) Jurkat E6.1 cells and LAT-deficient, Jurkat cells have been described previously (Zhang et al., 2000, incorporated herein by reference). All Jurkat cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics. For protein expression, Jurkat cells were transfected with 5-25 g plasmid DNA using the electroporation system, solution T, and program H-10 from LONZA. Transiently transfected cells were harvested or analyzed 24-48 hrs. post-transfection.

(63) Confocal Microscopy and Image Processing to Calculate Lifetime of LAT Clusters:

(64) Spreading assays were performed as described previously (Bunnell et al., 2002). Briefly chambered coverslips (LabTek) were coated overnight at 4 C. with the stimulatory antibody human anti-CD3 (HIT3a or UCHT at 10 g/ml). Jurkat E6.1 cells transfected with YFP- and CFP-tagged constructs were plated onto coated coverslips containing imaging buffer (RPMI 1640 without phenol red, 10% fetal calf serum, 20 mM Hepes). Movement of fluorescent proteins in live cells were observed with a Zeiss Axiovert 200 microscope equipped with a Perkin-Elmer Ultraview spinning disc confocal system (Perkin Elmer). Images were captured with an Orca-ERII CCD camera (Hamamatsu). A hot air blower and an objective warmer were used to maintain live samples at 37 C.

(65) IPLab 3.6 (Scanalytics Inc.) was used for most image processing. Movies were prepared from z-stacks by making a maximum intensity projection of a given time point and then making a sequence of all the projections. Kymographs were made from regions of interest (ROI) drawn around moving clusters of interest and the movement of clusters was analyzed using IPLab3.6. Graphs were prepared with Microsoft Excel (Microsoft).

(66) Pulse-Chase Analysis:

(67) Jurkat Jcam2.5 cells reconstituted with wild-type or 2KR LAT (110.sup.7) were washed once with PBS and incubated for 30 min at 37 C. under 5% CO.sub.2 in methionine-deficient RPMI 1640 medium (Sigma). The cells were pulse-labeled with [.sup.35S]methionine-[.sup.35S]cysteine mix (GE Healthcare for 20 min at 37 C. under 5% CO.sub.2 and washed twice in PBS. Equal portions were added to 500 ml of RPMI-FBS for each time point of the chase period and incubated at 37 C. At the indicated time points, cells were harvested and lysed in ice-cold lysis buffer containing 1% Brij, 1% n-Octyl-D-glucoside, 50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 5 mM ethylenediaminetetraacetic acid, 1 mM Na.sub.3VO.sub.4 and complete protease inhibitor tablets (Roche). Protein A/G Plus-Agarose beads (Santa Cruz Biotechnology) were used for immunoprecipitation. Protein samples were resolved on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membrane, and placed on a phosphor imager for detection of labeled protein.

(68) Measurement of Ca.sup.++ Influx:

(69) Cells were incubated with 5 M Indo-1-AM (Molecular Probes) and 0.5 mM probenecid (Sigma) in RPMI 1640 medium at 37 C. for 45 min. The cells were washed with RPMI 1640, resuspended in imaging buffer containing 0.5 mM probenecid, and kept at room temperature for 30-45 min. The cells were incubated at 37 C. for 5 min before measurements, stimulated with 50 ng/ml OKT3 antibody and analyzed using the LSR II (BD Biosciences). The data were processed using Tree Star FlowJo software.

(70) siRNA and shRNA Mediated Depletion of LAT Levels:

(71) The small interfering RNA (siRNA) corresponding to human LAT and the control nontargeting siRNA pool were purchased from Dharmacon Inc. The SMARTpool duplexes for human LAT were designed to target the following mRNA sequences: SMARTpool duplex 1, GCACAUCCUCAGAUAGUUU (SEQ ID NO: 5) which targets nucleotides 113-131 (from +1 at the ATG); duplex 2, CAAACGGCCUCACACGGUU (SEQ ID NO: 6) which targets nucleotides 153-171; duplex 3, GGACGACUAUCACAACCCA (SEQ ID NO: 7) which targets nucleotides 372-390; and duplex 4, CCAACAGUGUGGCGAGCUA (SEQ ID NO: 8) which targets nucleotides 311-329. Briefly, Jurkat E6.1 cells were transfected with control siRNA or siRNA for LAT (100 m/510.sup.6 cells) by using a LONZA electroporator, solution T, and program H-10.pSUPER.neo.GFP was obtained from OligoEngine.

(72) The shRNA for LAT were designed to target the following mRNA sequences (sh1: CCAACAGUGUGGCGAGCUA (SEQ ID NO: 8) that corresponds to nucleotides 311-329 in the LAT coding sequence with ATG as +1, sh5: CGUGUAGGAGUCUAUCAAA (SEQ ID NO: 9) that corresponds to nucleotides 118-136 in LAT 5 UTR). Briefly, Jurkat E6.1 cells were transfected with control shRNA or shRNA for LAT (25 g/1010.sup.6 cells) by using a LONZA electroporator, solution T, and program H-10. Cells were analyzed 48 hrs. post-transfection.

(73) QPCR

(74) Total RNA was prepared on transfected cells using Trizol (Invitrogen, Carlsbad, Calif.). For each sample, 1 g RNA was reverse transcribed into cDNA with oligo d(T) and the AffinityScript QPCR cDNA Synthesis Kit (Agilent, Santa Clara, Calif.). For real-time, quantitative PCR, the same sense primer was used for both endogenous and transfected LAT: 5 GGCAGCCGGGAGTATGTGAATGTGTCCCAG 3 (SEQ ID NO: 10). Endogenous LAT was detected by adding an antisense primer from the 3 UTR not present in the transfected construct: 5 GGCGTCCTGCCCTTGCTCCAGCC 3 (SEQ ID NO: 11). Transfected LAT was detected by adding an antisense primer from the YFP coding sequence: 5 GTGGTGCCCATCCTGGTCGAGCTGGACGGC 3 (SEQ ID NO: 12). The primers and cDNA were combined with Brilliant II QRT-PCR AffinityScript Master Mix containing SYBR green (Agilent, Santa Clara, Calif.), and qper reactions were run and analyzed on the Mx3000P (Agilent, Santa Clara, Calif.). -actin was used for normalization: Sense: 5 CCACTGGCATCGTGATGGAC 3 (SEQ ID NO: 13) Antisense: 5 GCGGATGTCCACGTCACACT 3 (SEQ ID NO: 14). Relative levels were quantitated using the DDCT method.

(75) Flow Cytometry Assays:

(76) E6.1 Jurkat cells were transfected with wild-type or 2KR LAT-YFP constructs. Twenty four hours following transfection cells were analyzed and sorted for similar levels of expression using a Beckton-Dickinson FACS Vantage SE flow cytometer (Beckton-Dickinson Inc.). Sorted cells were cultured for 24 hrs. and analyzed again for expression levels. The data were analyzed in Tree Star FlowJo software. Mean LAT-YFP levels (+s.e.m.) were measured.

(77) Functional Assays:

(78) For measurement of Ca.sup.++ influx, cells were incubated with 5 M Indo-1-AM (Molecular Probes) and 0.5 mM probenecid (Sigma) in RPMI 1640 medium at 37 C. for 45 min. The cells were washed with RPMI 1640, resuspended in imaging buffer containing 0.5 mM probenecid, and kept at room temperature for 30-45 min. The cells were incubated at 37 C. for 5 min before measurements, stimulated with various doses of soluble OKT3 antibody and analyzed using the LSR II (BD Biosciences). The data were processed using Tree Star FlowJo software.

(79) For measurement of surface CD69 levels in Jurkat E6.1 or JCam2.5 cells, 110.sup.6 cells were stimulated in solution with various doses of CD3 (OKT3). Isolated CD4+ PBMCs were stimulated on various doses of platebound CD3 (OKT3) and CD28 in a 96 well round bottom plate. Sixteen hours post-stimulation, cells were stained with APC-conjugated CD69 (BD Pharmingen), and surface expression was analyzed on a FACSCalibur cytometer (BD Biosciences). The data were processed using Tree Star FlowJo software.

(80) For luciferase assays, cells were simultaneously transfected with siRNA targeting LAT or control siRNA and YFP, LAT-YFP or 2KR LAT-YFP along with 4 g of a NF-AT luciferase reporter plasmid and 1 g/ml of a control -galactosidase expression vector. 48 hours post-transfection, cells were stimulated with various dilutions of OKT3 in solution. After 6 h at 37 C., cells were washed with PBS and lysed in 50 l reporter lysis buffer from the Luciferase assay system kit (Promega) and clarified by centrifugation. The supernatant was then analyzed in the reporter assay according to the manufacturer's protocol and read on an EG and G Berthold Microplate Luminometer LB96V (EG and G Berthold). For -galactosidase activity, plates were read on Versamax microplate reader (Molecular Devices) 30 min after the addition of the relevant reagent. Luciferase activity was normalized to internal -galactosidase controls.

(81) siRNA Mediated Depletion of LAT Levels and Re-Expression of LAT:

(82) The small interfering RNA (siRNA) corresponding to human LAT and the control nontargeting siRNA pool were purchased from Dharmacon Inc. The SMARTpool duplexes for human LAT were designed to target the following mRNA sequences: SMARTpool duplex 4, CCAACAGUGUGGCGAGCUA which targets nucleotides 311-329. Briefly, Jurkat E6.1 cells were transfected with control siRNA or siRNA for LAT (100 m/510.sup.6 cells) by using an LONZA electroporator, solution T, and program II-10. Cells were analyzed 48 hrs. post-transfection. For re-expression LAT sequences corresponding to 311-329 were altered by site-directed mutagenesis to render re-expressed LAT resistant to targeting siRNA.

(83) Primary human PBMCs culture and transfection PBMCs from healthy donors were isolated by Ficoll-Hypaque density gradient centrifugation. Human T helper cells (i.e. CD4+) were negatively isolated from fresh PBMCs using the CD4+ T cells negative purification kit according to manufacturer's instructions (Stem Cell Technologies). After isolation, CD4+ T cells were cultured in complete RPMI medium containing 10% fetal bovine serum in the presence of 5 g/ml PHA (Sigma) and 20 units/ml of recombinant human IL-2 for 24 hrs. at 37 C. under a 5% CO.sub.2 atmosphere. After 2 washes, the cells were then maintained for 5-6 days in exponential growth phase on RPMI complete medium containing 20 units/ml human IL-2. After washing and IL-2 starvation for 24 hrs., the above described siRNAs and plasmid DNAs were introduced into cells by electroporation using the LONZA nucleofector 96-well shuttle system for human T cells and program E0-115. Cells were evaluated 24 hrs after transfection.

Example 2

Human LAT is Ubiquitylated at Amino Acid 52

(84) LAT contains a small extracellular domain, a single transmembrane spanning region and a long intracellular region with no apparent intrinsic enzyme activity or commonly described protein-protein interaction domains (FIG. 2A). The intracellular domain of LAT contains nine tyrosines of which five are phosphorylated (Y127, Y132, Y171, Y191, Y226) (Zhu, Jansen, Zhang J I 2003, Paz 2001), and two membrane proximal cysteine residues (C26 and C29) that are subject to posttranslational palmitoylation (Zhang 1998). LAT amino acid sequence also reveals two lysines (K52 and K204 in human LAT) that might serve as potential sites for ubiquitylation. Both LAT lysines were mutated either individually or in combination, and the potential ubiquitylation of these LAT proteins was evaluated. COS-7 cells were transfected with HA-tagged ubiquitin and wild-type (WT) LAT or LAT mutated on lysines, followed by immunoprecipitation of LAT and anti-HA western blotting. Consistent with previously published studies that presented evidence for LAT ubiquitylation (Brignatz 2005, Balagopalan 2007), immunoprecipitation of LAT resulted in the co-precipitation of ubiquitylated bands (FIG. 2B). Strikingly, while the LAT K204R mutant displayed ubiquitylation levels similar to wild-type LAT (FIG. 2B, compare lanes 2 and 4), the LAT K52R mutant immunoprecipitates showed greatly decreased anti-HA reactivity (FIG. 2B, lane 3). Not surprisingly, the LAT 2KR mutant in which both LAT K52 and K204 are mutated also showed decreased ubiquitylation. The decreased HA reactivity is not due to a decrease in levels of expression since the LAT K52R and LAT 2KR mutants were consistently expressed at levels equal to or higher than the wild-type and K204R constructs (FIG. 2B, lower panel). These data indicate that LAT is predominantly ubiquitylated on K52. For the remainder of the experiments in this study we used the LAT 2KR mutant in which both lysines 52 and 204 were mutated.

Example 3

Ubiquitin-Defective LAT is Internalized at Rates Comparable to Wild-Type LAT

(85) To evaluate whether LAT ubiquitylation is required for LAT internalization, we assessed dynamics of wild-type and 2KR LAT. To this end, we tagged wild-type and 2KR LAT with a YFP tag at the carboxy terminus. Jurkat E6.1 cell lines were transfected with either wild-type LAT-YFP or 2KR LAT-YFP and trafficking of the fluorescent LAT constructs was evaluated. Both wild-type and 2KR LAT-YFP were recruited rapidly to signaling clusters in Jurkat E6.1 cells. High-speed microscopic analysis of activated cells in real time revealed that both wild-type LAT-YFP and 2KR LAT-YFP clusters dissipated soon after cluster formation in Jurkat E6.1 cells (FIG. 3). Similar dynamics of LAT-YFP clusters were observed in Jukat JCam2.5 cells that lack endogenous LAT. These data indicate that under conditions of severely reduced ubiquitylation, LAT internalization proceeds at regular rates, suggesting that ubiquitylation of LAT is not required for LAT internalization. Alternatively, the residual ubiquitylation of the 2KR LAT mutant in the absence of major ubiquitylation sites may be sufficient for LAT internalization. We have previously demonstrated that c-Cbl activity is required for movement of LAT clusters (Balagopalan et al., 2007).

(86) To examine the effect of c-Cbl expression on 2KR LAT dynamics in living cells, we transfected Jurkat E6.1 cells expressing wild-type or 2KR LAT-YFP, with 70Z/3 Cbl-CFP, an oncogenic, dominant negative version of c-Cbl with a 17 amino acid internal deletion into the RING finger domain that abrogates ubiquitin ligase activity (Andoniou, C. E., et al, 2000. Mol. Cell. Biol. 20:851-867). As shown in FIG. 3, in cells expressing 70Z/3 Cbl-CFP, both wild-type and 2KR LAT clusters persisted for extended periods of time. Thus movement of ubiquitin-defective LAT is regulated by c-Cbl activity. Taken together, these results suggest that 70Z/3 Cbl causes persistence of LAT complexes due to defective ubiquitylation of proteins beside LAT. These proteins could potentially be other signaling molecules in the LAT-nucleated signaling complex. Alternatively, endocytic adapter proteins may be the targets of ubiquitylation.

Example 4

2KR LAT Levels are Higher than Wild-Type LAT Levels in Transiently Transfected Cells

(87) Initially, ubiquitylation was described as the process that labels proteins for degradation (Hershko and Ciechanover, 1998). To test whether LAT was regulated in a similar manner, equal amounts wild-type and 2KR LAT-YFP DNA were transiently transfected into E6.1 Jurkat T cells and YFP levels monitored by flow cytometry. 24 hours after transfection, levels of 2KR LAT-YFP were significantly higher than wild-type LAT-YFP. To control for differences in transfection efficiency, cells expressing similar levels of YFP-tagged proteins were sorted. Flow analysis on cells cultured for 24 hours post-sorting revealed that mean 2KR LAT-YFP levels were increased to nearly two-fold higher than wild-type LAT-YFP (FIG. 4A). Higher intracellular protein levels of LAT containing the lysine mutations could reflect increased transcription of the 2KR LAT-YFP construct or increased stability of 2KR LAT-YFP protein. To test the first possibility, relative transcript abundance was evaluated by quantitative RT-PCR. cDNA was prepared from E6.1 cells transiently transfected with wild-type LAT-YFP or 2KR LAT-YFP. Real-time quantitative PCR was performed on both samples for chimeric LAT-YFP and endogenous LAT transcript expression. Transcript levels of the -actin gene were used as a reference. In these samples, the relative quantification of the wild-type versus the chimeric 2KR LAT-YFP transcripts revealed no significant differences (FIG. 4B). The lack of correlation between transcript and protein levels is suggested to be the consequence of the involvement of post-transcriptional regulations such as protein degradation.

Example 5

Mutation of LAT Lysines Delays LAT Degradation

(88) The data in FIG. 4A and FIG. 4B indicate that 2KR LAT is more stable and resistant to degradation than wild-type LAT. To test this hypothesis directly, pulse-chase analysis was performed on Jurkat JCam2.5 cells that lack endogenous LAT, but stably express either wild-type or 2KR LAT. Briefly, cells were incubated in medium that contained .sup.35S-labeled methionine and cysteine. Whole cell lysates were prepared at various time-points after the initial pulse and LAT immunoprecipitations were performed. Immunoadsorbed proteins were subjected to SDS-PAGE and analyzed by autoradiography (FIG. 5A). The band above the 36 kDa standard is LAT. The band is absent in LAT-deficient JCam2.5 cells. To quantitate the amount of labeled LAT recovered at each time-point in the chase, the density of the LAT band on autoradiographs was measured by scanning densitometry. The density of the LAT band decreased with time, indicating that the amount of LAT recovered from the lysates decreased during the chase, and likely represents intracellular LAT degradation. Recovery of labeled LAT at 30 minutes, 1 hour and 2 hours was quantified in 4 separate experiments. Based on these data the intracellular half-life of LAT appears to be 70 minutes. In contrast, even at the 120-minute time-point, more than half of 2KR LAT persisted, demonstrating a delay in the degradation of the mutant protein (FIG. 5C). Of note, the lysine mutations did not completely block steady state degradation indicating that other mechanisms of protein degradation may exist for LAT or alternatively, residual ubiquitylation of the lysine mutant drives degradation. Nonetheless, the 2KR mutation afforded LAT significant protection from degradation.

(89) Protein degradation occurs through two main cellular routes: the ubiquitin-proteasome and the autophagy-lysosome pathways (Knecht, Aguado, Saez Cell. Mol Life Sci 2009). As an initial approach to determine which pathway mediates steady state degradation of LAT, cells were preincubated with proteasome (MG-132) or lysosome (leupeptin) inhibitors and subsequently followed by pulse-chase. While degradation of LAT was observed without proteasome inhibitors, its turnover was significantly halted in their presence, revealing that LAT steady state degradation is regulated by the proteasome. In contrast lysosomal inhibition did not have an effect on LAT degradation kinetics FIG. 5B and FIG. 5D.

(90) Given these results, we reasoned that proteasomal degradation of wild-type LAT in unstimulated cells could explain the differences in expression levels seen between wild-type and 2KR LAT in FIG. 4A and FIG. 4B. To test this hypothesis, wild-type and 2KR LAT-YFP expressing cells were treated with the proteasomal inhibitor MG-132. Indeed, MG-132 treatment shifted wild-type LAT-YFP expression to levels closer to that of 2KR LAT-YFP expression (FIG. 5E). However, the presence of the proteasome inhibitor also increased the amount of the 2KR mutant observed, consistent with the observation that the lysine mutations do not completely block steady state LAT degradation.

Example 6

Ubiquitylation Defective LAT Mutant Exhibits Enhanced Signaling Downstream of the TCR

(91) Addition of ubiquitin moieties on signaling proteins may serve as a means to regulate the degree and duration of cell activation (Haglund, K. & Dikic, I. EMBO J. 24, 2005). To investigate whether increased stability of the LAT 2KR mutant in cells correlates with increased or prolonged signaling by this mutant, signaling assays were performed in cells expressing wild-type or 2KR LAT. JCam2.5 cells lacking endogenous LAT were reconstituted with wild-type or 2KR LAT expressed at various levels (FIG. 6A). First, CD3-dependent cytosolic Ca.sup.++ flux was evaluated. As reported previously, Jurkat JCam2.5 cells do not display an increase in cytosolic Ca.sup.++ levels upon CD3 stimulation (Finco 1998, FIG. 6B). Reconstitution of these cells with wild-type LAT led to measurable Ca.sup.++ flux in all cell lines tested. In comparison, all JCam2.5 cell lines reconstituted with 2KR LAT displayed considerably higher levels of cytosolic Ca.sup.++ levels in response to stimulation with anti-CD3 antibodies.

(92) To identify other indicators of TCR signaling in these cells, CD69 levels were measured. CD69 is the one of the first glycoproteins upregulated on the surface of T cells upon TCR stimulation and is known to be dependent on Ras activation. JCam2.5 cells stably transfected with wild-type or 2KR LAT were stimulated with anti-CD3 antibodies. Sixteen hours post-stimulation, surface CD69 levels were measured by flow cytometry. Prior to stimulation, CD69 levels appeared to be marginally higher in cells containing 2KR LAT. However, upon CD3 stimulation, more profound differences in CD69 expression were observed. Cells expressing 2KR LAT had significantly higher levels of CD69 as compared with cells expressing wild-type LAT (FIG. 6C). Together, these data demonstrate that signaling pathways downstream of the TCR are enhanced in cells that express ubiquitin-defective 2KR LAT.

(93) An observation apparent from the data in FIG. 6A is that in JCam2.5 cell lines stably expressing wild-type or mutant LAT, 2KR levels were higher in all cell lines examined. This is probably due to enhanced stability of the lysine mutant protein as demonstrated in FIG. 4A and FIG. 4B. Therefore it was not possible to determine whether the increased biologic signaling by LAT mutated on lysines was due to higher protein levels in the 2KR reconstituted JCam2.5 cells or due to increased signaling properties of the 2KR LAT mutant per se. To address this issue, JCam2.5 cells were transfected with expression constructs for the expression of YFP-tagged wild-type or 2KR LAT. We reasoned that gating on equivalent levels of expression of YFP tagged proteins would enable us to evaluate signaling in cells expressing equal levels of wild-type or mutant LAT. However, transient expression of YFP-tagged proteins in JCam2.5 cells, at levels no more than two-fold higher than endogenous LAT expression in E6.1 cells, did not reconstitute CD3-stimulated signaling. To circumvent these issues, a knock-down re-expression system was employed in Jurkat E6.1 cells as described below.

Example 7

CD69 Level Upregulation Mediated by TCR Activation is Higher in Cells Expressing Ubiquitin-Defective LAT

(94) RNA-mediated interference was employed to genetically silence endogenous LAT expression in Jurkat E6.1 cells. Simultaneously, either YFP, wild-type or 2KR LAT-YFP was re-expressed in these cells. 48 hours after transfection, whole cell lysates were prepared and subject to electropheresis and immunoblotting for LAT. As shown in FIG. 7A, expression of siRNA targeting LAT dramatically reduced endogenous LAT expression, in comparison to LAT expression in Jurkat E6.1 cells or control siRNA transfected cells. Fluorescence activated cell sorting (FACS) analysis of the YFP-tagged proteins at 48 hours showed higher levels of 2KR LAT-YFP expression as expected (FIG. 7B). However, the YFP tag enabled us to gate on cells expressing equal amounts of the YFP tag (Gate B), corresponding to equivalent levels of LAT. To test the consequence of disruption of LAT ubiquitylation for signaling events, TCR-induced Ca.sup.++ influx was examined at three different concentrations of CD3 stimulation (FIG. 7C). Transfection of LAT targeting siRNA showed reduced Ca.sup.++ flux as compared with control siRNA at all three concentrations. At 0.025 ug/ml and 0.012 ug/ml anti-CD3 a slight Ca.sup.++ flux remained, but no detectable Ca.sup.++ flux occurred at 0.006 ug/ml, indicating that endogenous LAT no longer contributed to cytosolic Ca.sup.++ flux at this stimulation dose. In comparison, expression of wild-type LAT-YFP showed similar levels of Ca.sup.++ flux as control siRNA transfected cells at all concentrations tested. Strikingly, LAT depleted cells reconstituted with 2KR LAT-YFP showed increased cytosolic flux at all CD3 doses. Notably, the effect of mutations of LAT lysines was greater at the lower abundance of soluble anti-CD3 than at the higher concentrations. This suggests that LAT ubiquitylation has a more prominent role in regulation of TCR-mediated signaling under limiting stimulatory conditions.

(95) Increases in intracellular Ca.sup.++ concentrations upon TCR engagement controls various signaling pathways, importantly including activation of the transcription factor NFAT. Therefore the LAT expressing cells were subjected to NFAT luciferase assays. Under all stimulation conditions tested, LAT-depleted cells reconstituted with 2KR LAT showed elevated signaling compared with cells reconstituted with its wild-type counterpart (FIG. 7D). We also checked for other indicators of TCR signaling such as CD69 upregulation. Anti-CD3 induced CD69 upregulation was also enhanced at all doses of anti-CD3 antibody in cells reconstituted with 2KR LAT (FIG. 7E). Importantly, we evaluated signaling output on cells expressing equivalent levels of wild-type and 2KR LAT-YFP in the above-described functional assays evaluating Ca.sup.++ influx and CD69 upregulation. These data allow us to conclude that 2KR LAT possesses more potent signaling properties and can cause T cell activation more effectively on a per molecule basis as compared with wild-type LAT.

Example 8

Evaluation of TCR Signaling in LAT Knockdown Cells Reconstituted with Wild-Type or 2KR Mutant LAT

(96) To confirm that the effects of 2KR expression occurred in non-transformed cells, we performed experiments in primary human T cells. CD4.sup.+ T cells were isolated from freshly isolated PBMCs of healthy donors. CD4.sup.+ cells were transfected with control siRNA or LAT targeting siRNA and simultaneously with plasmids expressing YFP, wild-type LAT-YFP or 2KR LAT-YFP as indicated. Similar to the experiments performed in Jurkat cells, 2KR LAT expression levels were consistently higher than wild-type LAT (FIG. 8C). Western blot analysis of lysates from sorted YFP-positive cells was performed to assess both the efficiency of the siRNA knockdown and levels of re-expressed wild-type and 2KR LAT-YFP. As shown in FIG. 8A, a knockdown of 35% of endogenous LAT was achieved in these cells.

(97) Although not as efficient as LAT knockdown in Jurkat E6.1 cells, the functional effects of 2KR LAT expression were tested by gating on YFP expressing cells. Transfected cells were incubated with various concentrations of anti-CD3 and anti-CD28 antibodies and evaluated for CD69 upregulation at 16 hours post-stimulation. Of note, the doses of CD3 had to be increased to see robust CD69 upregulation in primary cells, as compared with the doses used in Jurkat cells. Nevertheless, consistent with observations made in Jurkat cells, we saw enhanced CD69 upregulation in cells expressing 2KR LAT at all concentrations tested (FIG. 8B). Interestingly, the differences between 2KR LAT, wild-type LAT and cells in which LAT was depleted was most apparent at lower doses of stimulation, in agreement with our conclusion that LAT ubiquitylation plays a more significant role in TCR activation under limiting stimulatory conditions. Taken together, these data support the conclusion that LAT is targeted by ubiquitylation within lysines and that these events coordinately downregulate LAT-dependent TCR signaling events.

Example 9

Knockdown of LAT Levels Using ShRNAs

(98) To further analyze the role of LAT levels in signaling downstream of the TCR, siRNAs and shRNAs targeted to LAT were designed and transfected in Jurkat E6.1 cells. As shown in FIG. 9A, cells transfected with a non-targeting siRNA showed a robust influx of cytosolic Ca.sup.++ upon CD3 stimulation. In contrast, transfection with either a pool of 4 siRNAs targeting LAT (siPool) or a single LAT targeting siRNA (si2 and si4) effectively abrogated cytosolic Ca.sup.++ flux. Of note, siRNA targeting of LAT caused a 80-90% decrease in LAT levels as evaluated by western blot.

(99) To enable us to evaluate the effect of decreasing LAT levels in a controlled manner, we generated plasmids in which shRNA to LAT and GFP were expressed simultaneously. This expression system allowed for cell sorting with gating based on GFP expression in the cell. Higher GFP levels correlates with higher shRNA expression and thus, inversely correlates with LAT protein levels. Of note, LAT protein level in cells included in gate C (GC) in FIG. 9B and FIG. 9C corresponds to background levels of LAT expression in LAT deficient Jurkat JCam2.5 cells. Jurkat E6.1 cells were transfected with shRNA GFP plasmids and cytosolic Ca.sup.++ influx was measured in cells gated into three groups based on increasing GFP expression: gate A (GA), gate B (GB) and gate C (GC). Of interest, higher levels of GFP in the cell corresponded with decreased Ca.sup.++ influx in response to CD3 stimulation (FIG. 8B and FIG. 8C). These data demonstrate that LAT expression has a dose-dependent effect on proximal signaling downstream of the TCR. This result is consistent with increased signaling observed in cells expressing LAT 2KR mutant that has a degradation defect and accumulates to higher levels in cells.

(100) Jurkat E6.1 cells in which LAT has been knocked down by the shRNA GFP expression system described are reconstituted with wild-type or 2KR LAT tagged with a fluorescent protein. This knockdown re-expression system enables us to evaluate the effects of increasing levels of LAT knockdown by gating on GFP levels and at the same time evaluate the effect of reconstitution of different levels of wild-type and mutant LAT in the knockdown cells. This experiment gives us an entire matrix of information from which we can evaluate the effects of reconstitution of particular doses of wild-type and 2KR LAT at a given dose of LAT knockdown. Thus, by gating on equal levels of reconstituted wild-type or mutant protein at a given level of knockdown, we are able to investigate whether the 2KR LAT is a more potent signaling molecule, or whether the increased signaling in the 2KR cells is due to increased levels of LAT expression, or a combination of the two. Various readouts are used for evaluating TCR signaling such as cytosolic Ca.sup.++ influx, CD69 levels, CD25 levels, NFAT and NF-KB luciferase assays, intracellular IL-2 levels and levels of phosphorylated signaling proteins.

Example 10

Evaluation of TCR Signaling in Primary Human T Cells with LAT Knocked Down and Reconstituted with Wild-Type or 2KR Mutant LAT

(101) Primary human PBLs are transfected with LAT knockdown constructs and wild-type or 2KR LAT as described above for expression in Jurkat cells. Results from Jurkat E6.1 cells are confirmed in primary T cells. It is expected that the expression of wild-type or ubiquitin defective LAT, or inhibition of expression of LAT, has the same effect on T-cell signaling in primary cells as in Jurkat cells.

Example 11

Evaluation of TCR Signaling in Peripheral T Cells in 2KR LAT Transgenic Mice

(102) To investigate the role of LAT ubiquitylation in vivo, we have generated transgenic mice expressing wild-type and ubiquitin-defective LAT. Methods to generate transgenic mice are well known in the art, see, e.g., Manipulating the Mouse Embryo: A Laboratory Manual (Andras Nagy et al., Cold Spring Harbor Laboratory Press; 3 edition, 2002). The transgenic mice and cells from the transgenic mice are used to investigate signaling in various T cell populations and compared to mice expressing wild-type LAT. Wild-type and ubiquitin defective LAT was expressed at various levels under the control of the distal Lck promoter, which is expressed late in thymic development, to get expression in mature T cells, thus enabling us to avoid thymic selection which might eliminate more potent T cells. Expression in mature T cells bypasses this developmental process.

(103) Analysis of 2KR LAT transgenic mice demonstrate that mature 2KR LAT containing T cells have enhanced TCR-dependent signaling compared with their wild-type counterparts.

Example 12

Evaluation of T Cell Development in 2KR LAT Transgenic Mice

(104) Transgenic mice expressing a ubiquitin-defective LAT protein, e.g., 2KR LAT are generated using routine methods. To investigate the role of LAT ubiquitylation in T cell development, wild-type and 2KR LAT are expressed under the control of the human CD2 promoter that expresses early in development. T cell development is evaluated by assessment of various cell surface markers such as CD4 and CD8. If the numbers as assessed by these markers are different from those seen in wild type mice at various stages of development, we conclude that T cell development is affected by the LAT 2KR mutation. However, if the numbers of cells at various stages of development are the same, it is still possible that development is affected, but the effects on positive and negative selection cancel each other out. Therefore, positive and negative selection is also evaluated by crossing wild-type and 2KR transgenic mice onto the histocompatibility Y antigen (HY)-TCR transgenic background in which the female mice exhibit positive selection of T cells bearing the Tg TCR, while the male mice show negative selection of such T cells.

Example 13

Evaluation of Anti-Viral and Anti-Tumor Function of 2KR LAT T Cells in Mouse Models

(105) Wild-type and 2KR LAT transgenic mice are exposed to viral challenge, carcinogenic insult, and/or implanted with a xenograft tumor. The ability of T cells in these mice to effectively respond to these challenges is evaluated. Normal mice are used for controls in these experiments. In addition mice bearing only transgenic T cell receptors are crossed to the LAT transgenic animal and these mice bearing transgenic TCRs as well as wild-type or 2KR LAT are used for both cancer and viral infection models. These transgenic antigen receptors are specific for known cancer or viruses. It is expected that the presence of the 2KR LAT mutation will enhance clearance of tumor and/or viruses and thus results in a superior response both in the setting of the normal immune response in the case of normal animals and the response of specific TCRs in the case of the transgenic mice.

(106) Various mouse models of viral infection are used. For LCMV acute infection experiments, wild-type and 2KR transgenic mice are infected with various doses of virus (2105 pfu of LCMV Armstrong strain i.p.). Viral titers are determined by standard plaque assay at various times after initial infection. In addition, response to viral infections are measured by evaluating numbers of virus-specific CD8+ T cells in spleen over time, levels of IFN- produced and cytolytic activity of CD8+ T cells.

(107) Various tumor models are used. For lung cancer model, TC1 cells are injected into mice sub-cutaneously. For tumor clearance experiments, tumor diameters are measured 1-4 weeks after implantation, tumor volumes are calculated, and mouse viability is tracked. Numbers of tumor-specific CD8+ cells are measured using specific reagents (tetramers), levels of IFN- produced and cytolytic activity of these T cells are measured. In addition, melanoma, prostrate, breast and other tumor models are tested.

(108) It is expected that 2KR transgenic mice will have better viral and tumor clearance than wild-type LAT expressing mice.

(109) In addition, mice bearing only transgenic T cell receptors are crossed to LAT transgenic animals and mice bearing transgenic TCRs as well as wild-type or 2KR LAT are used for both cancer and viral infection models. These transgenic antigen receptors are specific for known cancer or viruses and have been reported to have moderate effects on tumor or viral clearance. It is expected that the presence of the 2KR LAT mutation will enhance clearance of tumor and/or viruses as assessed above. In some cases, RAG KO mice are exposed to viral or tumor challenge. This allows comparison of antitumor or antiviral effects of pure populations of CD4 and CD8 cells against the same tumor antigen in the absence of other T cells. One day after challenge, mice receive cells from freshly isolated spleens or lymph nodes of the TCR transgenic mice specific for the tumor or viral antigen and containing various doses of wild-type or 2KR LAT. Viral and tumor clearance are evaluated as described above.

Example 14

Evaluation of Ability of 2KR LAT to More Effectively Cause Cancer Regression in Subjects with Metastatic Melanoma

(110) Highly selected tumor-reactive T cells directed against overexpressed self-derived differentiation antigens are used for adoptive transfer approaches to combat metastatic melanoma are transfected/transduced with 2KR LAT. Transferred cells are monitored in vivo for their ability to proliferate, traffic to tumor sites and display functional activity. Regression rates of the subjects' metastatic melanoma are evaluated.

Example 15

Evaluation of Signaling, Anti-Viral and Anti-Tumor Function of 2KR LAT in Genetically Engineered T Cells

(111) Adoptive immunotherapy is a promising approach for the treatment of melanoma and some other cancers. This approach overcomes the difficulties associated with the isolation and expansion of tumor-reactive T cells in cancer patients. Instead, peripheral blood T cells are retargeted to any chosen tumor antigen by the genetic transfer of an antigen-specific receptor. The transduced receptors may be chimeric antigen receptors (CARs), designed to ligate tumor-associated antigens using antibody fragments fused to a component of the TCR complex, or human leukocyte antigen-restricted, heterodimeric T-cell antigen receptor (TCRs).

(112) Wild-type and 2KR constructs have been cloned into RNA transcription and lentiviral expression vectors. Chimeric Antigen Receptor (CAR) expressing T cells are transduced with wild-type or 2KR LAT and various signaling outputs such as CD69 upregulation and IL-2 production are evaluated upon stimulation via CD3 or surrogate antigen. Wild-type and 2KR LAT are also tested in the context of CAR or MHCI restricted TCRs in vivo in mouse tumor models to evaluate anti-tumor efficacy. The presence of the 2KR LAT mutation enhances the clearance of tumors, reducing tumor burden and extending life.

(113) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

REFERENCES

(114) All references, patents, patent publications, and sequence reference numbers cited herein are incorporated herein by reference. Aguilar, R. C., and B. Wendland. 2003. Ubiquitin: not just for proteasomes anymore. Curr. Opin. Cell Biol. 15:184-190. Alarcon, B., and M. Fresno. 1998. Transferrin receptor (CD71), p. 2389-2392. In P. J. Delves and I. M. Roitt (ed.), Encyclopedia of immunology, 2.sup.nd ed. Academic Press, London, United Kingdom. Andoniou, C. E., N. L. Lill, C. B. Thien, M. L. Lupher, Jr., S. Ota, D. D. Bowtell, R. M. Scaife, W. Y. Langdon, and H. Band. 2000. The Cbl protooncogene product negatively regulates the Src-family tyrosine kinase Fyn by enhancing its degradation. Mol. Cell. Biol. 20:851-867. Andoniou, C. E., C. B. Thien, and W. Y. Langdon. 1994. Tumour induction by activated abl involves tyrosine phosphorylation of the product of the cbl oncogene. EMBO J. 13:4515-4523. Barda-Saad, M., A. Braiman, R. Titerence, S. C. Bunnell, V. A. Barr, and L. E. Samelson. 2005. Dynamic molecular interactions linking the T cell antigen receptor to the actin cytoskeleton. Nat. Immunol. 6:80-89. Barr, V. A., L. Balagopalan, M. Barda-Saad, R. Polishchuk, H. Boukari, S. C. Bunnell, K. M. Bernot, Y. Toda, R. Nossal, and L. E. Samelson. 2006. T-cell antigen receptor-induced signaling complexes: internalization via a cholesterol-dependent endocytic pathway. Traffic 7:1143-1162. Bonello, G., N. Blanchard, M. C. Montoya, E. Aguado, C. Langlet, H. T. He, S. Nunez-Cruz, M. Malissen, F. Sanchez-Madrid, D. Olive, C. Hivroz, and Y. Collette. 2004. Dynamic recruitment of the adaptor protein LAT: LAT exists in two distinct intracellular pools and controls its own recruitment. J. Cell Sci. 117:1009-1016. Braiman, A., M. Barda-Saad, C. L. Sommers, and L. E. Samelson. 2006. Recruitment and activation of PLC1 in T cells: a new insight into old domains. EMBO J. 25:774-784. Brignatz, C., A. Restouin, G. Bonello, D. Olive, and Y. Collette. 2005. Evidences for ubiquitination and intracellular trafficking of LAT, the linker of activated T cells. Biochim. Biophys. Acta 1746:108-115. Bunnell, S. C., D. I. Hong, J. R. Kardon, T. Yamazaki, C. J. McGlade, V. A. Barr, and L. E. Samelson. 2002. T cell receptor ligation induces the formation of dynamically regulated signaling assemblies. J. Cell Biol. 158:1263-1275. Campi, G., R. Varma, and M. L. Dustin. 2005. Actin and agonist MHC peptide complex-dependent T cell receptor microclusters as scaffolds for signaling. J. Exp. Med. 202:1031-1036. Douglass, A. D., and R. D. Vale. 2005. Single-molecule microscopy reveals plasma membrane microdomains created by protein-protein networks that exclude or trap signaling molecules in T cells. Cell 121:937-950. Duan, L., A. L. Reddi, A. Ghosh, M. Dimri, and H. Band. 2004. The Cbl family and other ubiquitin ligases: destructive forces in control of antigen receptor signaling. Immunity 21:7-17. Dunn, R., and L. Hicke. 2001. Multiple roles for Rsp5p-dependent ubiquitination at the internalization step of endocytosis. J. Biol. Chem. 276:25974-25981. Ehrlich, L. I., P. J. Ebert, M. F. Krummel, A. Weiss, and M. M. Davis. 2002. Dynamics of p561ck translocation to the T cell immunological synapse following agonist and antagonist stimulation. Immunity 17:809-822. Fang, D., and Y. C. Liu. 2001. Proteolysis-independent regulation of PI3K by Cbl-b-mediated ubiquitination in T cells. Nat. Immunol. 2:870-875. Geisler, C. 2004. TCR trafficking in resting and stimulated T cells. Crit. Rev. Immunol. 24:67-86. Govers, R., T. ten Broeke, P. van Kerkhof, A. L. Schwartz, and G. J. Strous. 1999. Identification of a novel ubiquitin conjugation motif, required for ligand-induced internalization of the growth hormone receptor. EMBO J. 18:28-36. Haglund, K., P. P. Di Fiore, and I. Dikic. 2003. Distinct monoubiquitin signals in receptor endocytosis. Trends Biochem. Sci. 28:598-603. Hartgroves, L. C., J. Lin, H. Langen, T. Zech, A. Weiss, and T. Harder. 2003. Synergistic assembly of linker for activation of T cells signaling protein complexes in T cell plasma membrane domains. J. Biol. Chem. 278:20389-20394. Heissmeyer, V., F. Macian, S. H. Im, R. Varma, S. Feske, K. Venuprasad, H. Gu, Y. C. Liu, M. L. Dustin, and A. Rao. 2004. Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins. Nat. Immunol. 5:255-265. Hicke, L., and R. Dunn. 2003. Regulation of membrane protein transport by ubiquitin and ubiquitin-binding proteins. Annu. Rev. Cell Dev. Biol. 19:141-172. Houtman, J. C., R. A. Houghtling, M. Barda-Saad, Y. Toda, and L. E. Samelson. 2005. Early phosphorylation kinetics of proteins involved in proximal TCR-mediated signaling pathways. J. Immunol. 175:2449-2458. Houtman, J. C., H. Yamaguchi, M. Barda-Saad, A. Braiman, B. Bowden, E. Appella, P. Schuck, and L. E. Samelson. 2006. Oligomerization of signaling complexes by the multipoint binding of GRB2 to both LAT and SOS1. Nat. Struct. Mol. Biol. 13:798-805. Jang, I. K., and H. Gu. 2003. Negative regulation of TCR signaling and T-cell activation by selective protein degradation. Curr. Opin. Immunol. 15:315-320. Jeon, M. S., A. Atfield, K. Venuprasad, C. Krawczyk, R. Sarao, C. Elly, C. Yang, S. Arya, K. Bachmaier, L. Su, D. Bouchard, R. Jones, M. Gronski, P. Ohashi, T. Wada, D. Bloom, C. G. Fathman, Y. C. Liu, and J. M. Penninger. 2004. Essential role of the E3 ubiquitin ligase Cbl-b in T cell anergy induction. Immunity 21:167-177. Keane, M. M., S. A. Ettenberg, M. M. Nau, P. Banerjee, M. Cuello, J. Penninger, and S. Lipkowitz. 1999. cbl-3: a new mammalian cbl family protein. Oncogene 18:3365-3375. Lee, K. H., A. R. Dinner, C. Tu, G. Campi, S. Raychaudhuri, R. Varma, T. N. Sims, W. R. Burack, H. Wu, J. Wang, O., Kanagawa, M. Markiewicz, P. M. Allen, M. L. Dustin, A. K. Chakraborty, and A. S. Shaw. 2003. The immunological synapse balances T cell receptor signaling and degradation. Science 302:1218-1222. Lupher, M. L., Jr., Z. Song yang, S. E. Samelson, L. C. Cantle, and H. Band. 1997. The Cbl phosphotyrosine-binding domain selects a D(N/D)XP motif and binds to the Try292 negative regulatory phosphorylation site of ZAP-70. J. Biol. Chem. 272:33140-33144. Miura-Shimmer, Y., L. Duan, N. L. Rao, A. L. Reddi, H. Shimmer, R. Rotatable, B. J. Druker, A. Tsygankov, V. Band, and H. Band. 2003. Cbl-mediated ubiquitylation and negative regulation of Vay. J. Biol. Chem. 278:38495-38504. Montages, R., J. Both, A. Robert, and L. Orca. 1982. Non-coated membrane imaginations are involved in binding and internalization of cholera and tetanus toxins. Nature 296:651-653. Naramura, M., H. K. Hole, R.-J. Hu, and H. Gu. 1998. Altered thymic positive selection and intracellular signals in Cbl-deficient mice. Proc. Natl. Aced. Sci. USA 95:15547-15552. Rao, N., I. Dodge, and H. Band. 2002. The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J. Leukoc. Biol. 71:753-763. Rao, N., S. Miyake, A. L. Reddi, P. Douillard, A. K. Ghosh, I. L. Dodge, P. Zhou, N. D. Fernandes, and H. Band. 2002. Negative regulation of Lck by Cbl ubiquitin ligase. Proc. Natl. Aced. Sci. USA 99:3794-3799. Roose, J. P., M. Diehn, M. G. Tomlinson, J. Lin, A. A. Alizadeh, D. Botstein, P. O. Brown, and A. Weiss. 2003. T cell receptor-independent basal signaling via Erk and Abl kinases suppresses RAG gene expression. PLoS Biol. 1:E53. Samelson, L. E. 2002. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. Annu. Rev. Immunol. 20:371-394. Sommers, C. L., J. Lee, K. L. Steiner, J. M. Gurson, C. L. Depersis, D. El-Khoury, C. L. Fuller, E. W. Shores, P. E. Love, and L. E. Samelson. 2005. Mutation of the phospholipase C-1-binding site of LAT affects both positive and negative thymocyte selection. J. Exp. Med. 201:1125-1134. Tanimura, N., M. Nagafuku, Y. Minaki, Y. Umeda, F. Hayashi, J. Sakakura, A. Kato, D. R. Liddicoat, M. Ogata, T. Hamaoka, and A. Kosugi. 2003. Dynamic changes in the mobility of LAT in aggregated lipid rafts upon T cell activation. J. Cell Biol. 160:125-135. Thien, C. B., F. D. Blystad, Y. Zhan, A. M. Lew, V. Voigt, C. E. Andoniou, and W. Y. Langdon. 2005. Loss of c-Cbl RING finger function results in high intensity TCR signaling and thymic deletion. EMBO J. 24:3807-3819. Thien, C. B., D. D. Bowtell, and W. Y. Langdon. 1999. Perturbed regulation of ZAP-70 and sustained tyrosine phosphorylation of LAT and SLP-76 in c-Cbl-deficient thymocytes. J. Immunol. 162:7133-7139. Thien, C. B., and W. Y. Langdon. 2005. c-Cbl and Cbl-b ubiquitin ligases: substrate diversity and the negative regulation of signalling responses. Biochem. J. 391:153-166. Thien, C. B., and W. Y. Langdon. 2005. Negative regulation of PTK signaling by Cbl proteins. Growth Factors 23:161-167. van Leeuwen, J. E., P. K. Paik, and L. E. Samelson. 1999. Activation of nuclear factor of activated T cells-(NFAT) and activating protein 1 (AP-1) by oncogenic 70Z Cbl requires an intact phosphotyrosine binding domain but not Crk(L) or p85 phosphatidylinositol 3-kinase association. J. Biol. Chem. 274:5153-5162. van Leeuwen, J. E., P. K. Paik, and L. E. Samelson. 1999. The oncogenic 70Z Cbl mutation blocks the phosphotyrosine binding domain-dependent negative regulation of ZAP-70 by c-Cbl in Jurkat T cells. Mol. Cell. Biol. 19: 6652-6664. Varma, R., G. Campi, T. Yokosuka, T. Saito, and M. L. Dustin. 2006. T cell receptor-proximal signals are sustained in peripheral microclusters and terminated in the central supramolecular activation cluster. Immunity 25:117-127. Veillette, A., S. Latour, and D. Davidson. 2002. Negative regulation of immunoreceptor signaling. Annu. Rev. Immunol. 20:669-707. Wilson, B. S., J. R. Pfeiffer, Z. Surviladze, E. A. Gaudet, and J. M. Oliver. 2001. High resolution mapping of mast cell membranes reveals primary and secondary domains of Fc(epsilon)RI and LAT. J. Cell Biol. 154:645-658. Wu, J. N., and G. A. Koretzky. 2004. The SLP-76 family of adapter proteins. Semin. Immunol. 16:379-393. Yokosuka, T., K. Sakata-Sogawa, W. Kobayashi, M. Hiroshima, A. Hashimoto-Tane, M. Tokunaga, M. L. Dustin, and T. Saito. 2005. Newly generated T cell receptor microclusters initiate and sustain T cell activation by recruitment of Zap70 and SLP-76. Nat. Immunol. 6:1253-1262. Yokouchi, M., T. Kondo, A. Houghton, M. Bartkiewicz, W. C. Home, H. Zhang, A. Yoshimura, and R. Baron. 1999. Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J. Biol. Chem. 274:31707-31712. Zhang, W., J. Sloan-Lancaster, J. Kitchen, R. P. Trible, and L. E. Samelson. 1998. LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92:83-92. Zhang, W., R. P. Trible, and L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9:239-246. Zhang, W., R. P. Trible, M. Zhu, S. K. Liu, C. J. McGlade, and L. E. Samelson. 2000. Association of Grb2, Gads, and phospholipase C-1 with phosphorylated LAT tyrosine residues. Effect of LAT tyrosine mutations on T cell antigen receptor-mediated signaling. J. Biol. Chem. 275:23355-23361. Hershko A, and Ciechanover A. 1998. The ubiquitin system. Annu Rev Biochem. 1998; 67:425-79. Balagopalan L, Barr V A, Sommers C L, Barda-Saad M, Goyal A, Isakowitz M S, and Samelson L E. 2007. c-Cbl-mediated regulation of LAT-nucleated signaling complexes. Mol Cell Biol. 2007 December; 27(24):8622-36. Hogquist Ka, Baldwin Ta, Jameson Sc. 2005. Central Tolerance: Learning Self-Control In The Thymus. Nat Rev Immunol. October; 5(10):772-82.