Cell strain having increased virus production ability and production method therefor
09650613 ยท 2017-05-16
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16634
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2710/16651
CHEMISTRY; METALLURGY
C12N2760/16151
CHEMISTRY; METALLURGY
International classification
A01N63/00
HUMAN NECESSITIES
C12N15/10
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a cell line having an increased ability to produce virus and a method for preparing thereof, and more particularly, to a cell line that has an increased ability to produce virus, due to the loss of the function of the Bst-2 (tetherin) gene, and to a production method thereof. According to the present invention, a cell line lacking the function of the Bst-2 gene has an excellent ability to produce virus, compared to a wild-type cell line. Thus, when the mutant cell line is used as a virus-producing cell line, the production yield of virus can be increased. In addition, the mutant cell line can be used for the production and research of vaccines for preventing and treating viral diseases.
Claims
1. A method for preparing a virus-producing mutant cell line, the method comprising mutating a Bst-2 gene to lack the function of the Bst-2 gene in a virus-producing cell line.
2. The method of claim 1, wherein the virus-producing mutant cell line is an animal cell line.
3. The method of claim 2, wherein the animal cell line is selected from the group consisting of MDCK, VERO and mouse fibroblasts.
4. The method of claim 1, wherein the virus is influenza virus.
5. The method of claim 1, wherein the virus is Herpes simplex virus.
6. The method of claim 4, wherein the influenza virus is selected from the group consisting of Pandemic/H1N1, A/H1N1, and A/H3N2.
7. The method of claim 1, wherein the mutation is an insertion, deletion, duplication, inversion, substitution or translocation of a portion of the exon 1 region of the Bst-2 gene, a deletion of the whole of the exon 1 region of the Bst-2 gene, or a silencing of the Bst-2 gene.
8. The method of claim 7, wherein the exon 1 region of the Bst-2 gene encodes the cytoplasmic domain of Bst-2 protein.
9. A virus-producing mutant cell line which lacked the function of Bst-2 gene in a cell line having an ability to produce virus, wherein the mutant cell line having an increased ability to produce virus by lacking the function of said Bst-2 gene.
10. The virus-producing mutant cell line of claim 9, wherein the mutant cell line has an insertion, deletion, duplication, inversion, substitution or translocation of a portion of the Bst-2 gene, a deletion of the whole of the Bst-2 gene, or a silencing of the Bst-2 gene.
11. The virus-producing mutant cell line of claim 10, wherein the mutant cell line has a deletion of 1-15 nucleotides from the exon 1 region of the Bst-2 gene or an insertion of 1-15 nucleotides in the exon 1 region.
12. The virus-producing mutant cell line of claim 11, wherein the mutant cell line has a deletion of 1-4 nucleotides from positions 45 to 50 of the exon 1 region of the Bst-2 gene or an insertion of 1-3 nucleotides in positions 45 to 50 of the exon 1 region.
13. The virus-producing mutant cell line of claim 11, wherein the mutant cell line has a deletion of 1-12 nucleotides from positions 116 to 130 of the exon 1 region of the Bst-2 gene.
14. The virus-producing mutant cell line of claim 11, wherein the mutant cell line has a deletion of nucleotides from positions 4 to 90 of the exon 1 region of the Bst-2 gene.
15. A virus-producing mutant cell line in which introduced a mutated Bst-2 gene in a virus-producing cell line that expresses no Bst-2, wherein the mutant cell line having an increased ability to produce virus by introducing the mutated Bst-2 gene.
16. The virus-producing mutant cell line of claim 15, wherein the Bst-2-mutated gene has an insertion, deletion, duplication, inversion, substitution or translocation of a portion of the exon 1 region of wild-type Bst-2 gene, a deletion of the whole of the exon 1 region of wild-type Bst-2 gene, or a silencing of the Bst-2 gene.
17. A method for producing a desired virus, the method comprising the steps of: (a) infecting the mutant cell line having an increased ability to produce virus of claim 9 with a desired virus; and (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus.
18. The method of claim 17, wherein the cell line is infected with 0.005-0.05 MOI of the desired virus.
19. A method for producing a vaccine against viral disease, the method comprising the steps of: (a) infecting the mutant cell line having an increased ability to produce virus of claim 9 with a desired virus; (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus; and (c) attenuating or inactivating the recovered virus.
20. A method for producing a desired virus, the method comprising the steps of: (a) infecting the mutant cell line having an increased ability to produce virus of claim 15 with a desired virus; and (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus.
21. A method for producing a vaccine against viral disease, the method comprising the steps of: (a) infecting the mutant cell line having an increased ability to produce virus of claim 15 with a desired virus; (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus; and (c) attenuating or inactivating the recovered virus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
BEST MODE FOR CARRYING OUT THE INVENTION
(14) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Generally, the nomenclature used herein and the experiment methods, which will be described below, are those well known and commonly employed in the art.
(15) In the present invention, it was found that a cell line having an increased ability to produce virus can be produced by lacking the function of Bst-2 gene in a cell so as to enable virus to be released from the host cell without being interfered with by the host cell and to enable the apoptosis of the cell to be reduced.
(16) As used herein, the term ability to produce means that a virus that proliferated in a virus-producing cell line during the survival of the cell is released into a culture medium to increase the viral titer of the culture medium.
(17) As used herein, the term lack of function means mutating one or more nucleotides of Bst-2 gene in a cell and releasing virus from the cell. Preferably, the term means a deletion or insertion of the exon 1 region of the Bst-2 gene, a knock-out, or a silencing of the Bst-2 gene.
(18) As used herein, the term virus means virus that can cause a disease in humans or animals. Preferably, the term means influenza virus. More preferably, it means one selected from the group consisting of P/H1N1, A/H1N1 and A/H3N2.
(19) In the present invention, virus is not limited to influenza virus, and may include other disease-causing viruses, preferably, Herpes simplex virus.
(20) As used herein, the term apoptosis means a process in which a cell actively consumes the bioenergy ATP, leading to death. A typical apoptotic process comprises the shrinkage of cells, the regular cleavage of DNA, and the fragmentation of the cell membrane. Apoptosis can be induced when cells cannot maintain their normal function due to abnormal cell division, radiation, UV light, bacterial infection or viral infection.
(21) In one aspect, the present invention is directed to a virus-producing mutant cell line which lacked the function of Bst-2 gene in a cell line having an ability to produce virus, wherein the mutant cell line having an increased ability to produce virus by lacking the function of said Bst-2 gene.
(22) As the cell line having virus production ability, any cell line that is used in the development of influenza vaccines may be used. Preferably, an animal cell line may be used, and more preferably, MDCK cells, VERO cells or fibroblasts may be used.
(23) The MDCK (Madin-Darby canine kidney) cells that are used in the present invention are epidermis-like cells obtained from the canine kidney, and the VERO cells are cells obtained from the monkey kidney. The two cell lines show sensitivity to hepatitis virus, vaccinia virus and influenza virus, and thus are most frequently used in viral research.
(24) The mutant cell line may have an insertion, deletion, duplication, inversion, substitution or translocation of a portion of the Bst-2 gene, a deletion of the whole of the Bst-2 gene, or a silencing of the Bst-2 gene.
(25) The mutant cell line may have a deletion of 1-15 nucleotides from the exon 1 region of the Bst-2 gene or an insertion of 1-15 nucleotides in the exon 1 region.
(26) The mutant cell line may have a deletion of 1-4 nucleotides from positions 45 to 50 of the exon 1 region of the Bst-2 gene or an insertion of 1-3 nucleotides in positions 45 to 50 of the exon 1 region.
(27) The mutant cell line may have a deletion of 1-12 nucleotides from positions 116 to 130 of the exon 1 region of the Bst-2 gene.
(28) The mutant cell line may have a deletion of nucleotides from positions 4 to 90 of the exon 1 region of the Bst-2 gene.
(29) In the present invention, 1-15 nucleotides were inserted into or deleted from the exon 1 region of a Bst-2 gene, represented by SEQ ID NO: 1 or 2, in order to produce a mutant cell line.
(30) In an example of the present invention, one or more nucleotides were inserted into or deleted from the exon 1 region of the MDCK Bst-2 gene, represented by SEQ ID NO: 1, to produce a mutant cell line that comprises a mutated allele and that has an increased ability to produce virus.
(31) TABLE-US-00001 SEQIDNO:1: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTG ACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGA GTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTG GCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGG ATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCT GGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATG GACCAGGCTACCACCTGCAACAAGACTGTG
(32) In another example of the present invention, mutant cell lines lacking the function of the Bst-2 gene were produced by deleting 1-4 nucleotides from or inserting 1-3 nucleotides into positions 45 to 50 of the exon 1 region of the Bst-2 gene. These mutant cell lines may include cell lines having any one of nucleotide sequences of SEQ ID NOS: 3 to 8, and preferably, may be K-E4, J-C10, J-D10, D-E2, K-G3, J-E2 and H-G5.
(33) TABLE-US-00002 SEQIDNO:3: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTG AAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGT GGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGC TCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGAT GGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGG AGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGA CCAGGCTACCACCTGCAACAAGACTGTG SEQIDNO:4: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACAC GAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGT GGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGC TCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGAT GGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGG AGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGA CCAGGCTACCACCTGCAACAAGACTGTG SEQIDNO:5: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTA GTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGG CTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTC TGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGG CCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAG CGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACC AGGCTACCACCTGCAACAAGACTGTG SEQIDNO:6: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTG AGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTG GCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCT CTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATG GCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGA GCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGAC CAGGCTACCACCTGCAACAAGACTGTG SEQIDNO:7: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACGA GTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGG CTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTC TGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGG CCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAG CGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACC AGGCTACCACCTGCAACAAGACTGTG SEQIDNO:8: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTG ACGACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCT GGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCT GTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCG GGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCT CCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACC ATGGACCAGGCTACCACCTGCAACAAGACTGTG
(34) In still another example of the present invention, a mutant cell line comprising a mutated allele and having an increased ability to produce virus was produced by deleting nucleotides from the exon 1 region of the VERO Bst-2 gene, represented by SEQ ID NO: 2.
(35) TABLE-US-00003 SEQIDNO:2: ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACA TTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAAT TCTGGGGCTCCTGGTCATAGTGCTTCTGGGGGTGCCCCTGATTTTC TTCATCATCAAGGCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGG CAGTGATGGAGTGTCACAATGTCACCTATCTCCTGCAACAAGAGCT GGCCGAGGCCCAGCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTC ACCTGCAACCAGACTGTG
(36) In still another example of the present invention, mutant cell lines lacking the function of the Bst-2 gene were produced by deleting 1-12 nucleotides from positions 116 to 130 of the exon 1 region of the Bst-2 gene. These mutant cell lines may include cell lines having any one of nucleotide sequences of SEQ ID NOS: 9 and 10, and preferably, may be D-D8 and G-D5.
(37) TABLE-US-00004 SEQIDNO:9: ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACA TTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAAT TCTGGGGCTCCTGGTCATAGTGCCCCTGATTTTCTTCATCATCAAG GCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGGCAGTGATGGAGT GTCACAATGTCACCTATCTCCTGCAACAAGAGCTGGCCGAGGCCCA GCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTCACCTGCAACCAG ACTGTG SEQIDNO:10: ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACA TTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAAT TCTGGGGCTCCTGGTCATAGTGCTTCTGGGGGTGCCCTGATTTTCT TCATCATCAAGGCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGGC AGTGATGGAGTGTCACAATGTCACCTATCTCCTGCAACAAGAGCTG GCCGAGGCCCAGCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTCA CCTGCAACCAGACTGTG
(38) The nucleotide sequences of the mutant cell lines produced in the present invention were analyzed, and as a result, it could be seen that a frameshift mutation in the alleles of the K-E4, J-C10 and J-D10 cell lines from MDCK cells occurred.
(39) As used herein, the term frameshift mutation means a deletion or insertion of 1, 2 or more nucleotides (other than a multiple of 3) that result in a change in a frameshift that can read a genetic code of three nucleotides.
(40) Among the mutant cell lines, J-D10 was deposited under the accession number KCLRF-BP-00285.
(41) In another aspect, the present invention is directed to a method for preparing a virus-producing mutant cell line that is reduced from virus-induced apoptosis, the method comprising mutating Bst-2 gene in a virus-producing cell line.
(42) In one example of the present invention, D-D8 and G-D5 cell lines were produced by deleting 1-12 nucleotides from the exon 1 region of the Bst-2 gene in the VERO cell line. It was shown that the apoptosis of the mutant cell lines upon infection with H1N1 or H3N2 virus was reduced.
(43) The virus-producing mutant cell line reduced from virus-induced apoptosis according to the present invention may be an animal cell line.
(44) The animal cell line may be any cell line that is used in the development of influenza vaccines. Preferably, it may be selected from the group consisting of MDCK, VERO and mouse fibroblasts.
(45) The mutation according to the present invention may be an insertion, deletion, duplication, inversion, substitution or translocation of a portion of the exon 1 region of the Bst-2 gene, a deletion of the whole of the exon 1 region of the Bst-2 gene, or a silencing of the Bst-2 gene.
(46) The exon 1 region of the Bst-2 gene may encode the cytoplasmic domain of Bst-2 protein.
(47) In another example of the present invention, it was found that, when wild-type Bst-2 gene was introduced into Bst-deleted mouse fibroblasts, apoptosis similar to that of the wild-type cell line appeared, but when a Bst-2 gene having a deletion of the cytoplasmic domain was introduced, apoptosis was reduced, like that of the Bst-2-deleted cell line.
(48) In another example of the present invention, it was shown that wild-type Vero cells underwent apoptosis after infection with influenza virus, and thus showed a low ability to produce virus, whereas Bst-2-mutated Vero cells were reduced from virus-induced apoptosis and showed an increase in virus production ability of 50 times or more after 3 days.
(49) In still another example of the present invention, a Bst-2 gene having a deletion of the cytoplasmic domain involved in apoptosis was additionally expressed in normal mouse fibroblasts to interfere with the function of a normal gene. As a result, it was observed that the ability of the cells to produce virus. In addition, it was observed that, when the Bst-2 gene having a deletion of the cytoplasmic domain was expressed in a Bst-2-deleted B2K cell line having an increased ability to virus, the ability of the cells to produce virus was maintained. This demonstrates that an increase in the ability of the cells to produce virus is attributable to the reduction of apoptosis of the cells.
(50) In still another aspect, the present invention is directed to a mutant cell line in which introduced a mutated Bst-2 gene in a virus-producing cell line that expresses no Bst-2, wherein the mutant cell line having an increased ability to produce virus by introducing the mutated Bst-2 gene.
(51) The Bst-2-mutated gene may have an insertion, deletion, duplication, inversion, substitution or translocation of one or more nucleotides in a portion of the exon 1 region of wild-type Bst-2 gene, or a deletion of the whole of the exon 1 region wild-type Bst-2 gene, or a silencing of the Bst-2 gene.
(52) In yet another aspect, the present invention is directed to a method for producing a desired virus, the method comprising the steps of: (a) infecting a mutant cell line, which has an increased ability to produce virus, with a desired virus; and (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus.
(53) In the present invention, cells having a frameshift mutation were plated on a 6-well plate, cultured for 24-48 hours, and then inoculated into a medium containing influenza virus.
(54) The number of the cells may be 110.sup.4 to 110.sup.7, preferably 510.sup.4 to 510.sup.6, and more preferably 110.sup.5 to 110.sup.6.
(55) The virus inoculated into the medium is preferably infected in a 5% CO.sub.2 incubator at 37 C. for 30 minutes to 2 hours.
(56) The infected virus may be incubated in a fresh medium for 50-70 hours, and then the medium may be collected and centrifuged under suitable conditions to collect the supernatant. Preferably, the supernatant may be collected by performing centrifugation at 1500-5000 rpm at a temperature of 4 C. to 15 C. for 5-15 minutes.
(57) In the present invention, a plaque that is formed upon viral infection of a mutant cell line expressing no Bst-2 gene was examined.
(58) The mutant cell line was diluted in a medium and infected with virus, followed by culture. As a result, it could be seen that the ability of the mutant cell line to produce virus increased.
(59) The mutant cell line having an increased ability to virus may be used for the production of a vaccine for preventing or treating a disease caused by influenza virus.
(60) In a further aspect, the present invention is directed to a method for producing a vaccine against viral disease, the method comprising the steps of: (a) infecting a mutant cell line, which has an increased ability to produce virus, with a desired virus; (b) culturing the cell line infected with the desired virus, and then centrifuging the supernatant of the culture to recover the desired virus; and (c) attenuating or inactivating the recovered virus.
(61) The vaccine composition may further comprise a pharmaceutically acceptable adjuvant or excipient. As the adjuvant, any adjuvant may be used, as long as it can promote antibody formation upon injection into the body to achieve the purpose of the present invention. Particularly, the adjuvant is preferably one or more selected from among aluminate (Al(OH).sub.3, ALPO.sub.4), squalene, sorbitane, polysorbate 80, CpG, liposome, cholesterol, MPL (monophosphoryl lipid A) and GLA (glucopyranosyl lipid A), but is not limited thereto.
EXAMPLES
(62) Hereinafter, the present invention will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are illustrative purposes only and are not to be construed to limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
Example 1: Production of Bst-2-Mutated MDCK Cell Line and Confirmation of Mutation Therein
(63) 510.sup.5 wild-type MDCK cells obtained from the laboratory of Professor Moon-Jung Song (Korea University, Korea) were cultured in DMEM complete (GIBCO, USA) medium (containing 10% FBS, 2 mM L-glutamine, 5 M -mercaptoethanol, 10 g/ml gentamicine, 50 U/ml penicillin, and 50 g/ml streptomycin) in a 100 culture dish for 24 hours. Then, 15 g of a mixture of a pair of TALEN vectors (ToolGen, Korea) capable of binding to the exon 1 region of the Bst-2 gene, represented by SEQ ID NO: 1, one reporter vector (ToolGen, Korea) and Turbofect reagent (Thermo, USA), was added to the cultured cells which were then incubated under the conditions of 37 C. and 5% CO.sub.2 for 48 hours.
(64) The cultured cells were sorted by FACS Aria (BD Bioscience, USA) to select 500 cells positive to both GFP and RFP, and the selected cells were seeded in a 96-well plate, thereby obtaining monoclonal cells.
(65) In order to confirm a mutation in the obtained monoclonal cells, lysis buffer (50 mM Tris-Cl, pH8.0, 50 mM EDTA, 1% SDS, 10 mM NaCl, 100 g/ml proteinase K) (300 l) was added to the monoclonal cells which were then incubated at 54 C. for 16 hours. Then, 300 l of a 1:1 mixture of phenol and chloroform was added to and mixed with the incubated cells, followed by centrifugation at 1700g for 10 minutes. The supernatant (300 l) was transferred into a fresh tube, and 100% ethanol (600 l) and 3M sodium acetate (90 l) were added thereto, followed by centrifugation at 1700g for 10 minutes. Then, the supernatant was removed, 1 ml of 70% ethanol was added to the remaining material, followed by centrifugation at 1700g for 2 minutes. Then, the supernatant was removed, and the genomic DNA remaining at the bottom was dried for 3 minutes, and then suspended in 50 l of deionized water (DW). The extracted genomic DNA was subjected to polymerase chain reaction (PCR) using a dBst-2-F primer represented by SEQ ID NO: 11 and a dBst-2-R primer represented by SEQ ID NO: 12 under the following conditions: 95 C. for 5 min, and then 25 cycles, each consisting of 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 1 min, followed by 72 C. for 10 min.
(66) The reaction product was diluted to 10.sup.3, and subjected to PCR using an NdBst-2-F primer represented by SEQ ID NO: 13 and an NdBst-2-F primer represented by SEQ ID NO: 14 under the following conditions: 95 C. for 5 min, and then 25 cycles, each consisting of 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 1 min, followed by 72 C. for 10 min.
(67) TABLE-US-00005 SEQIDNO:11: GGTCAGGATGGCTCCTATGC SEQIDNO:12: AACCTGACAGGGTCACCTGG SEQIDNO:13: GTAGCCCCAGCCAAAGGTTTC SEQIDNO:14: AGGCCTCCCCATGCCCAAAC
(68) In order to confirm a mutation in the target region of the reaction product, the reaction product was melted and annealed by PCR under the following conditions: keeping at 95 C. for 5 min, temperature lowering from 95 C. to 85 C. at a rate of 2 C./sec, temperature lowering from 85 C. to 25 C. at a rate of 0.3 C./sec, and stopping at 16 C. Then, the resulting reaction product was treated with T7E1 enzyme (ToolGen, Korea) and incubated at 37 C. for 15 minutes, after which the size of the reaction product was analyzed by electrophoresis. As a result, it was shown that the cell lines having a putative mutation in the exon 1 region represented by SEQ ID NO: 1 had a normal PCR reaction product size and two additional bands caused by cleavage with endonuclase, indicating that a mutation in the exon 1 region occurred (
(69) To analyze the nucleotide sequences of the cell lines confirmed to have a mutation, the PCR reaction product was digested with Bgl-Xba|, ligated with a pUC18 vector, and cultured in a medium containing ampicillin and X-gal-IPTG, thereby obtaining white colonies. Among the obtained white colonies, 6 colonies were selected for each clone and sequenced.
(70) As a result, it was shown that, among 7 mutant cell lines (K-E4, J-C10, J-D10, D-E2, K-G3, J-E2 and H-G5) having a deletion or insertion of nucleotides in the exon 1 region of Bst-2, 3 mutant cell lines (K-E4, J-C10, J-D10) had a frameshift mutation that occurred in a pair of alleles.
Example 2: Production of Bst-2-Mutated VERO Cell Line and Confirmation of Mutation Therein
(71) 510.sup.5 wild-type VERO cells obtained from the laboratory of Chengyu Liang (University of Southern California) were cultured in DMEM complete (GIBCO, USA) medium (containing 10% FBS, 2 mM L-glutamine, 5 M -mercaptoethanol, 10 g/ml gentamicine, 50 U/ml penicillin, and 50 g/ml streptomycin) in a 100 culture dish for 24 hours. Then, 15 g of a mixture of a pair of TALEN vectors (ToolGen, Korea) (L1-DAW and R1-RR) capable of binding to the exon 1 region of the Bst-2 gene, represented by SEQ ID NO: 1, one reporter vector (ToolGen, Korea) and Turbofect reagent (Thermo, USA), was added to the cultured cells which were then incubated under the conditions of 37 C. and 5% CO.sub.2 for 48 hours.
(72) The cultured cells were sorted by FACS Aria (BD Bioscience, USA) to select 500 cells positive to both GFP and RFP, and the selected cells were seeded in a 96-well plate, thereby obtaining monoclonal cells.
(73) In order to confirm a mutation in the obtained monoclonal cells, lysis buffer (50 mM Tris-Cl, pH8.0, 50 mM EDTA, 1% SDS, 10 mM NaCl, 100 g/ml proteinase K) (300 l) was added to the monoclonal cells which were then incubated at 54 C. for 16 hours. Then, 300 l of a 1:1 mixture of phenol and chloroform was added to and mixed with the incubated cells, followed by centrifugation at 1700g for 10 minutes. The supernatant (300 l) was transferred into a fresh tube, and 100% ethanol (600 l) and 3M sodium acetate (90 l) were added thereto, followed by centrifugation at 1700g for 10 minutes. Then, the supernatant was removed, 1 ml of 70% ethanol was added to the remaining material, followed by centrifugation at 1700g for 2 minutes. Then, the supernatant was removed, and the genomic DNA remaining at the bottom was dried for 3 minutes, and then suspended in 50 l of deionized water (DW). The extracted genomic DNA was subjected to polymerase chain reaction (PCR) using a dBst-2-F primer represented by SEQ ID NO: 11 and a AGM-R primer represented by SEQ ID NO: 16 under the following conditions: 95 C. for 5 min, and then 25 cycles, each consisting of 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 1 min, followed by 72 C. for 10 min.
(74) TABLE-US-00006 SEQIDNO:15: GAGGGGGAGATCTGGATGG SEQIDNO:16: CTTCTCTGCATCCAGGGAAG
(75) The reaction product was diluted with 10.sup.3, and subjected to PCR using an AGM-F primer represented by SEQ ID NO: 15 and an AGM-R primer represented by SEQ ID NO: 16 under the following conditions: 95 C. for 5 min, and then 25 cycles, each consisting of 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 1 min, followed by 72 C. for 10 min.
(76) In order to confirm a mutation in the target region of the reaction product, the reaction product was melted and annealed by PCR under the following conditions: keeping at 95 C. for 3 min, temperature lowering from 85 C. to 25 C. at a rate of 2 C./sec, and stopping at 16 C. Then, the resulting reaction product was treated with T7E1 enzyme (ToolGen, Korea) and incubated at 37 C. for 15 minutes, after which the size of the reaction product was analyzed by electrophoresis. As a result, it was shown that two cell lines having a putative mutation in the exon 1 region of SEQ ID NO: 2 had a normal PCR reaction product size and two additional bands caused by cleavage with endonuclase, indicating that a mutation in the exon 1 region occurred (
Example 3: Ability of Bst-2-Mutated MDCK Cell Line to Produce Virus
(77) In order to examine the virus production ability of the mutant cell line expressing no Bst-2 gene, the virus production ability of a wild-type MDCK cell line was compared with those of the cell lines K-E4, J-C10 and J-D10, which were obtained in Example 1 and had a frameshift mutation in the exon 1 region of the Bst-2 gene.
(78) Specifically, each of the wild-type MDCK cell line and the mutant cell lines produced in Example 1 was seeded in a E-well plate at a density of 510.sup.4 cells/well. After 48 hours, each of the cell lines was infected with 0.01 MOI of P/H1N1. After 72 hours, the supernatant was collected, and the titer of the supernatant was measured.
(79) As a result, as can be seen in
(80) In addition, each of the cell lines J-C10 and J-D10 was diluted to 10.sup.3, 10.sup.4 and 10.sup.5 and infected with P/H1N1 virus, followed by incubation for 48 hours. As a result, as shown in
(81) Thus, it could be seen that the mutant cell lines having a frameshift mutation silencing the Bst-2 gene had an increased ability to produce virus, compared to the wild-type cell line.
Example 4: Virus Production Ability of Bst-2-Mutated VERO Cell Line
(82) In order to examine the virus production ability of the mutant cell line expressing no Bst-2 gene, the virus production ability of a wild-type VERO cell line was compared with those of the cell lines D-D8 and G-D5, which were obtained in Example 2 and had a mutation in the exon 1 region of the Bst-2 gene.
(83) Specifically, each of the wild-type VERO cell line and the mutant cell lines produced in Example 2 was seeded in a 12-well plate at a density of 510.sup.5 cells/well. After 24 hours, each of the cell lines was infected with 0.01 MOI of H3N2. After 60 hours, the supernatant was collected, and the titer of the supernatant was measured.
(84) As a result, as can be seen in
(85) In addition, each of the cell lines D-D8 and G-D5 was diluted to 10.sup.3, 10.sup.4 and 10.sup.5 and infected with H3N2 virus, followed by incubation for 60 hours. As a result, as shown in
(86) Thus, it could be seen that the mutant cell lines having a mutation silencing the Bst-2 gene had an increased ability to produce virus, compared to the wild-type cell line.
Example 5: Effect of Bst-2 on Intracellular Signaling
(87) Bst-2 knockout mice (ISU Abxis, Korea) were mated with wild-type B6 mice (Orient Bio, Korea) to generate Bst-2 hetero mice. From the abdominal cavity of the Bst-2 hetero mice and the knockout mice, macrophages were obtained. Among the obtained cells, 110.sup.6 cells were added to each well of a 96-well flat bottom plate and treated with 0, 0.01, 0.1 and 1 g/ml of LPS (lipopolysaccharide), followed by culture for 24 hours. The concentration of nitrite in the culture medium was measured using a Griess technique. As a result, the macrophages obtained from the Bst-2 knockout mice showed a decrease in nitrite production of about 60% compared to that shown by the macrophages obtained from the Bst-2 hetero mice (
(88) Macrophages were obtained from the Bst-2 hetero mice and knockout mice. Among the obtained cells, 510.sup.6 cells were seeded in each well of a 6-well plate and allowed to stand for 2 hours to adhere to the culture dish. Then, the cells were treated with 100 ng/ml of LPS. After 30 minutes and 90 minutes, protein was obtained from the cells using M-PER buffer (Pierce Biotechnology, USA). For each sample, 30 g of total protein was separated according to size by SDS-PAGE electrophoresis and attached to a PVDF membrane. Anti-phosphorylation-NFB antibody (clone 93H1), anti-NFB antibody (clone C22B4) and anti-IB antibody (clone L35A5) used were purchased from Cell Signaling Technology (USA), and secondary antibody used was purchased from HRP-conjugated anti-rabbit IgG (Koma Biotech, Korea). After the antibody reactions, the signals were developed with ECL plus or ELC fempto (Pierce Biotechnology, USA), and then imaged with LAS 3000. As a result, it was shown that the ratio of phosphorylated NF-B to total NF-B decreased by about 90% (
Example 6: Delay of Apoptosis of Bst-2-Deleted Cell Line
(89) 6-1: Observation of Apoptosis of Cell Line Infected with Virus
(90) Each of a wild-type (WT) Vero cell line, a Bst-2 hetero (D-D8) Vero cell line and a Bst-2 knockout (G-D5) cell line was added to each well of a 6-well plate at a density of 110.sup.6 cells. After 20 hours, the cells were infected with 0.1 MOI of each of seasonal H1N1 influenza (
(91) At 48 hours and 72 hours after infection, the shape of the modified cells was analyzed. As a result, normal cells were mostly dead at 1 day or 2 days after infection with the virus, but in the case of the Bst-2-deleted cells, a significant number of the cells maintained the normal cell shape even at day 2 after viral infection. Specifically, the wild-type cells showed a typical apoptotic shape with the cell membrane distorted, whereas the Bst-2 knockout cells (G-D5) mostly maintained the normal cell shape at 48 hours and hours (
(92) 6-2: Observation of Expression of Phosphatidylserine in Cell Lines Infected with Virus
(93) As apoptosis progresses, phosphatidylserine (PS) present in the inner cell membrane migrates to the outer cell membrane, and thus can be detected by staining. Thus, in order to compare the degree of apoptosis, cells were stained with annexin-V that recognizes the indicator PS.
(94) Specifically, each of a wild-type (WT) Vero cell line, a Bst-2 hetero (D-D8) Vero cell line and a Bst-2 knockout (G-D5) cell line was attached to each well of a 6-well plate at a density of 110.sup.6 cells. After 20 hours, each of the cell lines was infected with 0.1 MOI of seasonal H1N1 or H3N2 influenza. At 48 hours or 72 hours after infection, the cells were detached, and PBS was added thereto, and the cell solution was centrifuged at 1250 rpm at room temperature for minutes to remove the supernatant. Then, a buffer containing Annexin V-FITC (BD Biosciences, USA) and Annexin V was added to the cells which were then stained in a dark place for 15 minutes.
(95) As a result, it was observed that the wild-type cells strongly expressed PS on the cell surface at 72 hours after infection with H1N1 virus, whereas the knockout cell line (G-D5) still maintained a low level of the expression of PS (
(96) Meanwhile, it was observed that the same patterns also appeared when the cells were infected with H3N2 virus (
(97) 6-3: Increase in Apoptosis of Bst-2-Reintroduced Cell Line
(98) To produce a mouse fibroblast cell line (B2K) lacking Bst-2, 100 g of MCA (3-methyl cholanthrene) was injected into the thigh of 24-week-old Bst-2 knockout mice (ISU Abxis, Korea). After about 4 months, a tumor formed in the thigh was detached and washed with 70% ethanol to remove bacteria, after which it transferred into a dish containing 10% FBS and RPMI medium and was cut into fine pieces using surgical scissors. The tumor pieces and 13 ml of digestion solution (500 unit/ml collagenase IV, 150 Unti/ml DNase I) were placed in a 50-ml conical tube and shaken in a shaker at 250 rpm 37 C. for 1 hour and 30 minutes. The shaken solution was pipetted 3-5 times with a 10-ml pipette to further disperse the pieces, and then filtered through a nylon mesh and placed in a 50-ml fresh conical tube. Then, the resulting solution was centrifuged at 1250 rpm for 5 minutes, and the supernatant was removed, after which the pellets were suspended in a fresh medium, filtered through a nylon mesh, and centrifuged under the above-described conditions. After removal of the supernatant, the pellets were dissociated, seeded at a density of 2.410.sup.7 cells per 10 cm dish, and cultured to obtain a knockout tumor cell line (B2K).
(99) Meanwhile, to produce a wild-type tumor cell line (MB19), 100 g of MCA (3-methyl cholanthrene) was injected into the thigh of 24-week-old B6 wild-type mice (Orient Bio, Korea). After about 4 months, a tumor formed in the thigh was detached and washed with 70% ethanol to remove bacteria, after which it transferred into a dish containing 10% FBS and RPMI medium and was cut into fine pieces using surgical scissors. The tumor pieces and 13 ml of digestion solution (500 unit/ml collagenase IV, 150 Unti/ml DNase I) were placed in a 50-ml conical tube and shaken in a shaker at 250 rpm 37 C. for 1 hour and 30 minutes. The shaken solution was pipetted 3-5 times with a 10-ml pipette to further disperse the pieces, and then filtered through a nylon mesh and placed in a 50-ml fresh conical tube. Then, the resulting solution was centrifuged at 1250 rpm for 5 minutes, and the supernatant was removed, after which the pellets were suspended in a fresh medium, filtered through a nylon mesh, and centrifuged under the above-described conditions. After removal of the supernatant, the pellets were dissociated, seeded at a density of 2.410.sup.7 cells per 10 cm dish, and cultured to obtain a wild-type tumor cell line (MB19).
(100) The MHC class (KbDb(R1.21.2)-APC, CD1d(1B1)-PE), LFA-1(207)-Cyc and Bst-2(e.Bio927)biotin+Streptavidin-PE of each of the Bst-2 knockout cell line (B2K) and the Bst-2 wild-type tumor cell line (MB19) were fluorescence-stained, and the expression levels thereof were compared. Specifically, B2K cells and MB19 cells were suspended in 50 l of FACS buffer at a density of 110.sup.6 cells, and 20 g/ml of 2.4G2 antibody was added to the cells which were then incubated on ice for 20 minutes to block the Fc receptor on the cell surface. Then, Bst-2 biotin (1 g/ml) was added to the cells which were then incubated on ice for 30 minutes. Next, 500 l of FACS buffer was added to the cells, and the cell solution was centrifuged at 1250 rpm at 4 C. for 4 minutes, and the supernatant was removed to remove the remaining antibody. In addition, another antibody, KbDb-APC (0.1 g/ml), CD1d-PE (1.5 g/ml), LFA-1 (1 g/ml) or Streptavidin-PE (0.5 g/ml), was added to the cells which were then incubated on ice under a light-shielded condition. After 30 minutes, in order to remove the remaining antibody, 500 l of FACS buffer was added to the cells, and the cell solution was centrifuged at 1250 rpm at 4 C. for 4 minutes. Analysis was performed using FACS caliber (Becton Dickinson, Germany). As a result, it was observed that MB19 normally expressed Bst-2, whereas the B2K tumor cell line did not express Bst-2. Thus, the B2K tumor cell line was used in the following Example.
(101) Into the established B2K cells (B2K empty), a Bst-2 wild-type gene (Flag WT; SEQ ID NO: 17), a gene (Flag CT: SEQ ID NO: 18) having a deletion of the cytoplasmic domain, or an empty vector was introduced.
(102) TABLE-US-00007 SEQIDNO:17: ATGGCGCCCTCTTTCTATCACTATCTGCCCGTGCCCATGGATGAGA TGGGGGGGAAGCAAGGATGGGGCAGCCACCGGCAGTGGCTGGGGTA CCGCGGGAGAAAGATAGTGATAGACGGGAACGGGTACCTACTCTAC CCCCCCTTCGTTCCTACCCCGTCGGTGGCCGTCACCGACCCC SEQIDNO:18: ATGTACCGCGGGAGAAAGATAGTGATAGACGGGAACGGGTACCTAC TCTACCCCCCCTTCGTTCCTACCCCGTCGGTGGCCGTCACCGACCC C
(103) These genes had the Flag or V5 protein attached to the N-terminus, and the expression thereof was analyzed using anti-Bst-2 antibody (PDCA-1, eBio927: Ebioscience, USA) (
(104) Each of the B2K empty, B2K-Flag WT and B2K-Flag V5 CT cell lines was added to each of a 6-well plate at a density of 210.sup.6 cells. After 20 hours, each of the cell lines was infected with 0.1 MOI of MHV-68 virus. After 1 day (24 hours) or 2 days (48 hours), the cell shape was photographed. As a result, as shown in
(105) In other words, through the Bst-2 reintroduction experiment, it was first demonstrated that the cytoplasmic domain plays an important role in signaling that induces the apoptosis of virus-infected cells. This fact indicates that, when the survival time of cells infected with any virus is extended, the production of the virus can be continued and the amount of virus produced can be increased.
(106) 6-4: Increase in Virus Production Ability of Bst-2-Mutated Cell Line
(107) In order to examine the virus production ability of the Bst-2 mutant cell line reduced from virus-induced apoptosis, the virus production ability of the wild-type VERO cell line was compared with those of the cell lines D-D8 and G-D5, which were produced in Example 2 and have a mutation in the exon 1 region of the Bst-2 gene.
(108) Specifically, each of the VERO wild-type cell line and the mutant cell line produced in Example 2 was seeded in a 6-well plate at a density of 110.sup.6 cells/well. After 24 hours, each of the cell lines was infected with 0.1 MOI of H3N2. After 48, 60 or 72 hours, the supernatant was collected, and the titer of the supernatant was measured.
(109) As a result, as shown in
(110) 6-5: Increase in the Ability of Bst-2-Mutated Cell Line to Produce Herpes Simplex Virus
(111) In the same manner as described in Example 6-3, the Bst-2 gene having a deletion of the cytoplasmic domain was introduced (CT) into fibroblasts (NIH/3T3) that normally express Bst-2. An empty vector containing no Bst-2 was introduced into control normal cells, and the virus production ability of the control cells was compared with that of the mutant cell line. As a result, as can be seen in
(112) In order to reproduce the same effect in other cell lines, according to the same method as described in Example 6-3, B2K cells were infected with Herpes simplex virus, and the virus production ability thereof was compared. As a result, the Bst-2-deleted B2K cells (empty) showed an increased ability to produce virus, whereas the virus production ability of the B2K cells (Flag-WT) reintroduced with the wild-type Bst-2 gene decreased by about 50%, and was similar to that of the wild-type cells. Meanwhile, the B2K cells (V5-CT) reintroduced with the wild-type Bst-2 gene having a deletion of the cytoplasmic domain showed no decrease in the virus production ability. This demonstrates that the reduction of virus-induced apoptosis is very important to increase the virus production ability of cells. In addition, it was proven that the cell line of the present invention, which has an increased ability to produce virus, is useful not only for the production of influenza virus as described in the examples above, but also for the production of other infectious viruses.
INDUSTRIAL APPLICABILITY
(113) As described above, according to the present invention, a cell line lacking the function of the Bst-2 gene has an excellent ability to produce virus, compared to a wild-type cell line. Thus, when the mutant cell line is used as a virus-producing cell line, the production yield of virus can be increased. In addition, the mutant cell line can be used for the production and research of vaccines for preventing and treating viral diseases.
(114) Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.