Molecular interaction between XA10 and AVRXA10

09650647 ยท 2017-05-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides nucleic acids and methods for conferring resistance to bacterial disease in plants. The present invention also provides promoters and promoter sequences useful for controlling expression in transgenic plants.

Claims

1. A nucleic acid construct comprising a heterologous chimeric plant operable promoter operatively linked to a nucleic acid encoding the transcription activator-like (TAL) effector-dependent Xa10 polypeptide having the amino acid sequence set forth in SEQ ID NO:37, wherein the promoter further comprises SEQ ID NO:23.

2. The nucleic acid construct of claim 1, wherein the nucleic acid encoding the Xa10 polypeptide has the nucleotide sequence set forth in SEQ ID NO:35 or the nucleotide sequence set forth in nucleotides 2423-3234 of SEQ ID NO:35 or the nucleotide sequence set forth in nucleotides 54-437 of SEQ ID NO:36.

3. The nucleic acid construct of claim 1, further operatively linked to a nucleic acid encoding a heterologous polypeptide.

4. A vector comprising the nucleic acid construct of claim 1.

5. The nucleic acid construct of claim 1, wherein the plant operable promoter is selected from the group consisting of a tissue-specific promoter, a constitutive promoter and an inducible promoter.

6. A plant cell comprising the nucleic acid construct of claim 1 or a vector comprising said nucleic acid construct.

7. A transgenic plant that is resistant to Xanthomonas comprising the cell of claim 6.

8. The transgenic plant of claim 7, wherein the plant is rice.

9. The transgenic plant of claim 7, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

10. A method of enhancing resistance to Xanthomonas in a plant having resistance to Xanthomonas comprising transfecting the nucleic acid construct of claim 1 or a vector comprising said nucleic acid construct into a plant cell or plant cells from the plant having resistance to Xanthomonas and growing a transfected plant from the transfected plant cell or transfected plant cells, wherein the nucleic acid is expressed in the transfected plant and wherein the enhanced resistance of the transfected plant is compared to a plant not having the nucleic acid construct or the vector.

11. A method of conferring resistance to Xanthomonas disease to a plant susceptible to Xanthomonas comprising transfecting the nucleic acid construct of claim 1 or a vector comprising said nucleic acid construct into a plant cell or plant cells from the plant susceptible to Xanthomonas and growing a transfected plant from the transfected plant cell or transfected plant cells, wherein the nucleic acid is expressed in the transfected plant and wherein the conferred resistance of the transfected plant is compared to a plant not having the nucleic acid construct or the vector.

12. The method of claim 10, wherein the plant is rice.

13. The method of claim 10, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

14. The nucleic acid construct of claim 2, further operatively linked to a nucleic acid encoding a heterologous polypeptide.

15. A vector comprising the nucleic acid construct of claim 2.

16. The nucleic acid construct of claim 15, wherein the plant operable promoter is selected from the group consisting of a tissue-specific promoter, a constitutive promoter and an inducible promoter.

17. A plant cell comprising the nucleic acid construct of claim 2 or a vector comprising said nucleic acid construct.

18. A transgenic plant that is resistant to Xanthomonas comprising the cell of claim 17.

19. The transgenic plant of claim 18, wherein the plant is rice.

20. The transgenic plant of claim 18, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

21. The method of claim 11, wherein the plant is rice.

22. The method of claim 11, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

23. A method of enhancing resistance to Xanthomonas in a plant having resistance to Xanthomonas comprising transfecting the nucleic acid construct of claim 2 or a vector comprising said nucleic acid construct into a plant cell or plant cells from the plant having resistance to Xanthomonas and growing a transfected plant from the transfected plant cell or transfected plant cells, wherein the nucleic acid is expressed in the transfected plant and wherein the enhanced resistance of the transfected plant is compared to a plant not having the nucleic acid construct or the vector.

24. The method of claim 23, wherein the plant is rice.

25. The method of claim 23, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

26. A method of conferring resistance to Xanthomonas disease to a plant susceptible to Xanthomonas comprising transfecting the nucleic acid construct of claim 2 or a vector comprising said nucleic acid construct into a plant cell or plant cells from the plant susceptible to Xanthomonas and growing a transfected plant from the transfected plant cell or transfected plant cells, wherein the nucleic acid is expressed in the transfected plant and wherein the conferred resistance of the transfected plant is compared to a plant not having the nucleic acid construct or the vector.

27. The method of claim 26, wherein the plant is rice.

28. The method of claim 26, wherein the plant is selected from the group consisting of barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean and rapeseed.

29. The method of claim 10, wherein the resistance is characterized by a lesion length of less than or equal to 6.0 cm in infected leaves.

30. The method of claim 11, wherein the susceptibility is characterized by a lesion length of greater than 6.0 cm in infected leaves.

31. The method of claim 23, wherein the resistance is characterized by a lesion length of less than or equal to 6.0 cm in infected leaves.

32. The method of claim 26, wherein the susceptibility is characterized by a lesion length of greater than 6.0 cm in infected leaves.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIGS. 1A-1D show map-based cloning of the Xa10 gene. FIG. 1A: Genetic and physical maps at the Xa10 locus. The upper part is the genetic map of the Xa10 locus resolved using molecular markers M491, S723 and M419 as presented previously by Gu et al. (2008). 44M10 is the BAC clone that was identified by markers M491 and S723. Subclones of 44M10 in binary vector pC1300 used for complementation test are shown below. Vertical lines link the genetic locations of M491 and the Xa10 locus to their positions at the physical map. Subclones that produced bacterial blight (BB)-resistant transgenic plants are indicated with +, otherwise, they are marked with . The position of the Xa10 gene is indicated with short bold line with arrowhead standing for the direction of transcription. FIG. 1B: Phenotypes of wild-type and transgenic plants at two weeks after inoculation with Xanthomonas oryzae pv oryzae (Xoo) strains. L1, IR24 inoculated with PXO99; L2, IR24 inoculated with PXO99(pHM1avrXa10); L3, IRBB10A inoculated with PXO99; L4, IRBB10A inoculated with PXO99(pHM1avrXa10); L5, Nipponbare inoculated with PXO99; L6, Nipponbare inoculated with PXO99(pHM1avrXa10); L7, Xa10 transgenic line L198 inoculated with PXO99; L8, L198 inoculated with PXO99(pHM1avrXa10). FIG. 1C: Gene structure of the Xa10 gene. The coding region (black bar), the position of 5 and 3 UTR (hatched box), translation start codon (ATG), translation stop codon (TGA), 5 and 3 splice junctions (ga and cg) are indicated. The numbers indicate the base pairs of each substructure. FIG. 1D: Predicted amino acid sequence of the Xa10 gene (SEQ ID NO:37). The predicted signal peptide is underlined.

(2) FIG. 2 shows detection of the Xa10 gene in different rice cultivars. About 5 g of rice genomic DNA was digested with HindIII and used for Southern blot analysis in each lane. The Southern filter was detected with a probe from Xa10 coding region using primers SP1F and SP1R. M, DNA marker of Lambda DNA digested with HindIII.

(3) FIGS. 3A and 3B show ectopic expression of Xa10 provided enhanced resistance to compatible Xanthomonas oryzae pv oryzae strains. FIG. 3A: Phenotypes of IRBB10A and transgenic plants at two weeks after inoculation with Xoo strains. L1, IRBB10A inoculated with PXO99; L2, IRBB10A inoculated with PXO99(pHM1avrXa10); L3, Nipponbare inoculated with PXO99; L4, Nipponbare inoculated with PXO99(pHM1avrXa10); L5, Transgenic line L198 inoculated with PXO99; L6, Transgenic line L198 inoculated with PXO99(pHM1avrXa10); L7, Transgenic line L162 inoculated with PXO99; L8, Transgenic line L162 inoculated with PXO99(pHM1avrXa10). FIG. 3B: Real-time PCR analysis of Xa10 in uninoculated and inoculated plants. The expression of rice Ubiquitin 1 gene was used as an internal control. Results are shown as the relative values normalized to IRBB10A inoculated with PXO99(pHM1avrXa10) at 12 hours after inoculation (HAI). The primers for Xa10 were 10RT F2 and 10RT R2, and the primers for rice Ubiquitin 1 gene were RBQ3 and RBQ4. UI, uninoculated plants; , plants infiltrated with PXO99 at 12 HAI; +, plants infiltrated with PXO99(pHM1avrXa10) at 12 HAI.

(4) FIGS. 4A and 4B show the prediction of transmembrane helices in XA10. FIG. 4A: Output of prediction of transmembrane regions in XA10 from DASTransmembrane Prediction server (http colon//www dot sbc dot su dot semiklos/DAS/). FIG. 4B: Output of prediction of transmembrane helices in XA10 from TMHMM Server v. 2.0 (http colon//www dot cbs dot dtu dot dk/services/TMHMM/).

(5) FIGS. 5A and 5B show the prediction of signal peptide at N-terminal region of XA10. Signal peptide in amino acid sequences of XA10 was predicted by both SignalP-NN prediction (FIG. 5A) and SignalP-HMM prediction (FIG. 5B). The cleavage site of signal peptide is located at position between 29 and 30. The full length amino acid sequence of XA10 was submitted to the SignalP 3.0 server (http colon//www dot cbs dot dtu dot dk/services/SignalP/) for the prediction of signal peptides of eukaryotes. Methods of both neural networks and hidden Markov models were used for prediction. Standard output format was selected. The amino acid sequence in FIGS. 5A and 5B consists of amino acids 1-70 of SEQ ID NO:37.

(6) FIGS. 6A-6C show specific induction of Xa10 by AvrXa10 from Xanthomonas oryzae pv. oryzae. FIG. 6A: Induction of Xa10 in IRBB10A at different hours after inoculation (HAI) with Xoo strain PXO99(pHM1avrXa10). The expression of rice Ubiquitin 1 gene in leaves was used as an internal control. FIG. 6B: Real-time PCR analysis of Xa10 transcripts in IRBB10A measured at different HAI after inoculation with Xoo strain PXO99(pHM1avrXa10). The expression of rice Ubiquitin 1 gene in leaves was used as an internal control. Results are shown as the relative values of expression of Xa10 over that of rice Ubiquitin 1 gene. The primers for Xa10 were 10RT F2 and 10RT R2, and the primers for rice Ubiquitin 1 gene were RBQ3 and RBQ4. FIG. 6C: Induction of Xa10 in IRBB10A at 12 HAI with Xoo strain PXO99 expressing AvrXa10 or its mutants. UI, uninoculated IRBB10A; PXO99, IRBB10A inoculated with PXO99; PXO99/AvrXa10, IRBB10A inoculated with PXO99(pHM1avrXa10); PXO99/AvrXa10NLS, IRBB10A inoculated with PXO99 (pHM1avrXa10NLS); PXO99/AvrXa10AD, IRBB10A inoculated with PXO99(pHM1avrXa10AD).

(7) FIGS. 7A-7D show that induction of Xa10 by AvrXa10 requires rice transcriptional factor OsTFIIA5. FIG. 7A: Phenotype of bacterial blight disease of rice lines at two weeks after inoculation with Xoo strain PXO99(pHM1avrXa10). L1, IRBB5; L2, IRBB10A; L3, double homozygote (Xa10Xa10xa5xa5) of IRBB5IRBB10A. FIG. 7B: Bacterial population in leaves of IRBB5, IRBB10A and double homozygote over 14 days by leaf-clipped inoculation with PXO99(pHM1avrXa10). FIG. 7C: Expression of Xa10 in IRBB5, IRBB10A and double homozygote. mRNA for northern blot analysis was isolated from uninoculated plants (0 hour after inoculation or 0 HAI) or plants infiltrated with PXO99(pHM1avrXa10) at 12 HAI (12 HAI). FIG. 7D: Transcript levels of Xa10 in IRBB5, IRBB10A and double homozygote. Transcript levels were measured by real-time PCR. Total RNA was isolated from uninoculated plants (0 HAI) or plants infiltrated with PXO99(pHM1avrXa10) at 12 HAI (12 HAI). The expression of rice Ubiquitin 1 gene was used as an internal control. Results are shown as the relative values of expression of Xa10 over that of rice Ubiquitin 1 gene. The primers for Xa10 were 10RT F2 and 10RT R2, and the primers for rice Ubiquitin 1 gene were RBQ3 and RBQ4.

(8) FIGS. 8A-8C show AvrXa10 box candidates in the promoter of Xa10 gene. FIG. 8A: AvrXa10 contain central tandem repeats, nuclear localization signals (NLSs), and an acidic transcriptional activation domain (AD). FIG. 8B: Hypervariable amino acids at position 12 and 13 of the 15.5 AvrXa10 repeats are shown. indicates that amino acid 13 is missing in this repeat. FIG. 8C: Nucleotide sequences of Xa10 promoter (220 to ATG) (SEQ ID NO:41) and AvrXa10 box candidates. AvrXa10 box candidates (Box 1 to Box 12) were predicted based on the model for DNA-target specificity of TAL effectors (Boch et al., 2009). In each candidate, nucleotides that match the model are indicated with capital letters; otherwise, they are displayed in lower letters. Transcriptional initiation site of Xa10 is marked with +1. The 5 untranslated region (5UTR) is shown in italics and the start codon of Xa10 is underlined. The Xa10 promoter sequence (220 to ATG) shown in the lines marked 220, 215, 177, 139, 110, 72, 36, +1 and +39 is SEQ ID NO:41. The remaining sequences are as follows: Box 1: SEQ ID NO:16; Box 4: SEQ ID NO:19; Box 7: SEQ ID NO:22; Box 10: SEQ ID NO:25; Box 2: SEQ ID NO:17; Box 5: SEQ ID NO:20; Box 8: SEQ ID NO:23; Box 11: SEQ ID NO:26; Box 3: SEQ ID NO:18; Box 6: SEQ ID NO:21; Box 9: SEQ ID NO:24; and Box 12: SEQ ID NO:27.

(9) FIGS. 9A and 9B shows GUS reporter constructs. FIG. 9A: Schematic map of GUS reporter constructs. FIG. 9B: DNA sequence between GATEWAY recombination sites in the GUS reporter constructs. AvrXa10 box candidates were inserted in the TAL effector box position at the 5 of the minimal tomato Bs4 promoter (pBs4; 50 to +25) sequence (Boch et al., 2009) and transferred by GATEWAY recombination into the A. tumefaciens T-DNA vector pCGWGUSint constructing a fusion to a promoterless intron-containing -glucuronidase (GUSPlus) gene. attB1 and attB2, GATEWAY recombination sites; promoterless GUSPlus-Tnos, coding sequence of GUSPlus (including intron) and terminator of nopaline synthase (nos) gene from pC1305.1; LB, left border; RB, right border. Upstream pENTER/D-TOPO sequence between attB1 and TAL effector-box is SEQ ID NO:42. The sequence between TAL effector-box and attB2 is SEQ ID NO:43.

(10) FIGS. 10A and 10B show identification and characterization of AvrXa10 box. FIG. 10A: AvrXa10 box and its derivatives. FIG. 10B: Specific inducibility of the AvrXa10 boxes by AvrXa10. GUS reporter constructs codelivered via A. tumefaciens into N. benthamiana leaf cells with 35S-driven avrXa10 (+), and empty T-DNA vector (), respectively (error bars indicate SD; n=3 samples). 35S::GUSPlus in pC1305.1 (p35S) served as control. For qualitative assays, leaf discs were stained with X-Gluc (5-bromo-4-chloro-3-indolyl--D-glucuronide). For quantitative assay, the GUS activity was detected using MUG (4-methyl-umbelliferyl--D-glucuronide) as substrate. 4-MU, 4-methyl-umbelliferone. The sequences are as follows: pXa10-220: SEQ ID NO:39; AvrXa10 box (Box 8): SEQ ID NO:23; Box 8 0dT: SEQ ID NO:40; Box 5: SEQ ID NO:20; Box 11: SEQ ID NO:26; Box 8 d15: SEQ ID NO:28; Box 8 d14: SEQ ID NO:30; Box 8 d13: SEQ ID NO:31; Box 8 d12: SEQ ID NO:32; and Box 8 d11: SEQ ID NO:33.

(11) FIGS. 11A and 11B show the recognition specificity of AvrXa10 box and AvrXa27 box by AvrXa10 and AvrXa27, respectively. FIG. 11A: Hypervariable amino acids 12 and 13 of AvrXa10 and AvrXa27 and their target DNA specificities. AvrXa10 box (SEQ ID NO:23) and AvrXa27 box (Boch et al., 2009; Romer et al., 2009a) (SEQ ID NO:44) were cloned in front of the minimal Bs4 promoter into a intron-containing GUS (GUSPlus) reporter vector. FIG. 11B: Specific inducibility of the AvrXa10 box and AvrXa27 box by AvrXa10 and AvrXa27. GUS reporter constructs codelivered via A. tumefaciens into N. benthamiana leaf cells with 35S-driven avrXa10 (AvrXa10), avrXa27 (AvrXa27), and empty T-DNA vector (), respectively (error bars indicate SD; n=3 samples). 35S::GUSPlus served as control. For qualitative assays, leaf discs were stained with X-Gluc (5-bromo-4-chloro-3-indolyl--D-glucuronide). For quantitative assay, the GUS activity was detected using MUG (4-methyl-umbelliferyl--D-glucuronide) as substrate. 4-MU, 4-methyl-umbelliferone.

(12) FIGS. 12A-12C show that AvrXa10 and AvrXa27 bind specifically to AvrXa10 box and AvrXa27 box in yeast, respectively. FIG. 12A: Yeast growth on selective medium for yeast one-hybrid assay. Four tandem copies of the AvrXa10 box and AvrXa27 box in sense (4 AvrXa10 box and 4 AvrXa27 box) were used as baits, respectively. AvrXa10 and AvrXa27 fused to SV40 NLS-GAL4 AD were used as prey, respectively. The GAL4-AD fusion of murine p53 protein and a bait containing its target sequence (p53DBS) served as controls. 50 l of serial dilutions of single transformants in SD liquid medium (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5) were dropped on SD medium containing either leucine (L) or 200 ng/ml aureobasidin A (AbA200). Two transformants per experiment were analyzed. The experiment was repeated twice with similar results. FIG. 12B: Yeast colony PCR using oligonucleotides pAbAi F2 and pAbAi R2 to verify the inserts of bait plasmids (AvrXa10 box: 1418 bp; AvrXa27 box: 1422 bp; p53 DBS: 1400 bp). FIG. 12C: Western blot showing GAL4-AD fusion prey proteins using an -GAL4 AD antibody. SV40 NLS-GAL4 AD-HA fusions to AvrXa10 (135 kDa), AvrXa27 (139 kDa) and p53 (61 kDa).

(13) FIG. 13 shows purified 6His-epitope tagged AvrXa10 and AvrXa27 proteins used in the electromobility shift assay (EMSA) experiments. Protein concentrations were determined by Bradford assay. 1.5 and 3 g purified 6His::AvrXa10 (117.5 kDa), 6His::AvrXa27 (121.0 kDa) and BSA were separated in an 8% SDS polyacrylamide gel and stained with Coomassie brilliant blue. Asterisk marks 6His::AvrXa10 and 6His::AvrXa27, respectively.

(14) FIGS. 14A-14D show that AvrXa10 binds specifically to AvrXa10 box but not to the AvrXa27 box in an electromobility shift assay (EMSA). FIG. 14A: DNA sequences of AvrXa10 box probe (SEQ ID NO:34) and AvrXa27 box probe (SEQ ID NO:45) used in EMSA. The AvrXa10 box and AvrXa27 box in the probes are in bold letters. FIG. 14B: AvrXa10 binds with high affinity to the AvrXa10 box probe, whereas AvrXa27 binds with high affinity to both AvrXa10 box and AvrXa27 box probes. EMSA with AvrXa10 or AvrXa27 and biotin-labeled AvrXa10 box or AvrXa27 box probes was separated in a 6% nondenaturing polyacrylamide gel. FIG. 14C: Binding of AvrXa10 to AvrXa10 box probe can be out-competed by cold AvrXa10 box probe but not by cold AvrXa27 box probe. Competition experiment between biotin-labeled AvrXa10 box probe and different amounts (in fmol) of nonlabeled competitor probes was separated in 6% nondenaturing polyacrylamide gel. FIG. 14D: Binding of AvrXa27 to AvrXa10 box or AvrXa27 box probes was highly out-competed by cold AvrXa27 box probe. Competition experiment between biotin-labeled AvrXa10 box or AvrXa27 box probes and different amounts (in finol) of nonlabeled competitor probes was separated in a 6% nondenaturing polyacrylamide gel. Positions of the bound and free probes are indicated on the left.

(15) FIGS. 15A-15C show the characterization of deletion mutants of AvrXa10 box in electromobility shift assay (EMSA). FIG. 15A: DNA sequences of probes of AvrXa10 box and its deletion mutants used in EMSA. FIG. 15B: Specific inducibility of AvrXa10 box and its deletion mutants by AvrXa10. GUS reporter constructs codelivered via A. tumefaciens into N. benthamiana leaf cells with 35S-driven avrXa10 (+), and empty T-DNA vector (), respectively (error bars indicate SD; n=3 samples). 35S::GUSPlus in pC1305.1 (p35S) served as control. The quantitative GUS activity was detected using MUG (4-methyl-umbelliferyl--D-glucuronide) as substrate. 4-MU, 4-methyl-umbelliferone. FIG. 15C: AvrXa10 binds with high affinity to some probes of the AvrXa10 box deletion mutants. EMSA with AvrXa10 and biotin-labeled probes of AvrXa10 box or its deletion mutants was separated in a 6% nondenaturing polyacrylamide gel. About 200 ng of AvrXa10 was used for EMSA. Positions of the bound (indicated with a dart) and free probes are shown on the left. The sequences are as follows: AvrXa10 box: SEQ ID NO:34; Box 8 0dT: SEQ ID NO:46; Box 8 1dA: SEQ ID NO:47; Box 8 2dT: SEQ ID NO:48; Box 8 3dA: SEQ ID NO:49; Box 8 4dT: SEQ ID NO:50; Box 8 5dA: SEQ ID NO:51; Box 8 6dC: SEQ ID NO:52; Box 8 7dA: SEQ ID NO:53; Box 8 8dC: SEQ ID NO:58; Box 8 9dA: SEQ ID NO:59; Box 8 10dC: SEQ ID NO:60; Box 8 11dG: SEQ ID NO:61; Box 8 12dT: SEQ ID NO:62; Box 8 13dT: SEQ ID NO:63; Box 8 14dC: SEQ ID NO:64; Box 8 15dA: SEQ ID NO:65; and Box 8 16dC: SEQ ID NO:66.

(16) FIGS. 16A and 16B show the recognition specificity of AvrXa10 box, Box 7 and their mutants by AvrXa10. FIG. 16A: DNA sequences of probes of AvrXa10 box, Box 7 and their mutants used in EMSA. The mutated bases are in bold letters. FIG. 16B: Specific inducibility of AvrXa10 box, Box 7 and their mutants by AvrXa10. GUS reporter constructs codelivered via A. tumefaciens into N. benthamiana leaf cells with 35S-driven avrXa10 (+) and empty T-DNA vector (), respectively (error bars indicate SD; n=3 samples). 35S::GUSPlus served as control. For qualitative assays, leaf discs were stained with X-Gluc (5-bromo-4-chloro-3-indolyl--D-glucuronide). The quantitative GUS activity was detected using MUG (4-methyl-umbelliferyl--D-glucuronide) as substrate. 4-MU, 4-methyl-umbelliferone. The sequences are as follows: AvrXa10 box: SEQ ID NO:23; Box 8M1: SEQ ID NO:67; Box 7: SEQ ID NO:22; Box 7M: SEQ ID NO:68; Box 7M1: SEQ ID NO:69; Box 7M2: SEQ ID NO:70; Box 7M3: SEQ ID NO:71; Box 7M4: SEQ ID NO:72; Box 7M5: SEQ ID NO:73; and Box 7M6: SEQ ID NO:74.

(17) FIGS. 17A-17D show AvrXa10 bind to AvrXa10 box, Box 7 and their mutants in electromobility shift assay (EMSA). FIG. 17A: DNA sequences of probes of AvrXa10 box, Box 7 and their mutants used in EMSA. FIG. 17B: AvrXa10 binds with high affinity to the probes of AvrXa10 box, Box 7 and their mutants. EMSA with AvrXa10 and biotin-labeled AvrXa10 box, Box 7 or their mutant probes was separated in a 6% nondenaturing polyacrylamide gel. FIG. 17C: Binding of AvrXa10 to AvrXa10 box probe is out-competed by cold probes of AvrXa10 box, Box 8M1, Box 7 or Box 7M. Competition experiment between AvrXa10 box and different amounts (in fmol) of nonlabeled competitor probes was separated in a 6% nondenaturing polyacrylamide gel. FIG. 17D: Binding of AvrXa10 to probes of Box 8M1, Box 7 or Box 7M is out-competed by cold AvrXa10 box probe. Competition experiment between Box 8M1, Box 7 or Box 7M and different amounts (in fmol) of nonlabeled competitor probes was separated in a 6% nondenaturing polyacrylamide gel. Positions of the bound and free probes are indicated on the left. The sequences are as follows: AvrXa10 box: SEQ ID NO:34; Box 8M1: SEQ ID NO:75; Box 7: SEQ ID NO:76; and Box 7M: SEQ ID NO:77.

(18) FIGS. 18A-18C show that AvrXa10 bind to Box 7, AvrXa10 box and their mutants in yeast. FIG. 18A: Yeast growth on selective medium for yeast one-hybrid assay. Four tandem copies of Box 7, AvrXa10 box or their mutants in sense (4 Box 7, 4 Box 7M, 4 AvrXa10 box and 4 Box 8M1) were used as baits. AvrXa10 fused to SV40 NLS-GAL4 AD was used as prey. The GAL4-AD fusion of murine p53 protein and a bait containing its target sequence (p53 DBS) served as controls. 50 l of serial dilutions of single transformants in SD liquid medium (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5) were dropped on SD medium containing either leucine (+L) or 200 ng/ml aureobasidin A (+AbA200). Two transformants per experiment were analyzed. The experiment was repeated twice with similar results. FIG. 18B: Yeast colony PCR using primers pAbAi F2 and pAbAi R2 to verify the inserts of bait plasmids (Box 7: 1418 bp; Box 7M: 1418 bp; AvrXa10 box: 1418 bp; Box 8M1: 1422 bp; p53 DBS: 1400 bp). FIG. 18C: Western blot showing GAL4-AD fusion prey proteins using an anti-GAL4 AD antibody. SV40 NLS-GAL4 AD-HA fusions to AvrXa10 (135 kDa) and p53 (61 kDa).

DETAILED DESCRIPTION OF THE INVENTION

(19) The present invention relates generally to plant molecular biology and genetics and to nucleic acids and methods for conferring resistance to bacterial disease in plants. The present invention also relates to promoters and promoter sequences useful for controlling expression in transgenic plants. In accordance with the present invention, the cloning and characterization of a gene encoding the resistance gene Xa10, which confers resistance to bacterial blight disease is described. In one embodiment, the resistance is to bacterial blight disease caused by Xanthomonas species. In another embodiment, the plant is rice. In a further embodiment, the plant is barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean or rapeseed.

(20) Transcription activator-like (TAL) type III effectors of Xanthomonas spp contribute to pathogenesis by targeting to host gene promoters and activating host gene expression. In accordance with the present invention, the isolation of rice bacterial blight resistance gene Xa10 and the characterization of the molecular recognition between Xa10 and TAL type III effector AvrXa10 from Xanthomonas oryzae pv. oiyzae (Xoo) is described. As described herein the Xa10 gene was isolated from Xa10-containing rice line by positional cloning strategy and genetic transformation. The Xa10 gene encodes an unknown transmembrane protein. Xa10 was specifically induced by Xoo strains that harbor the AvrXa10 gene. Mutation of the nuclear localization signal (NLS) motifs in AvrXa10 or deletion of the transcription activation domain (AD) at its C-terminal region abolished its function for Xa10 activation. The activation of Xa10 expression by AvrXa10 requires rice transcriptional factor OsTFIIA5. A 17-bp AvrXa10 box was identified in the Xa10 promoter by candidate approach. The AvrXa10 box was specifically recognized by AvrXa10 in Nicotiana benthamiana in transient assay and this recognition activated reporter gene expression. The specific interaction of AvrXa10 box and AvrXa10 was further confirmed in yeast by yeast-one-hybrid assay and in vitro by electromobility shift assay (EMSA). Deletion of any one of the nucleotides at the positions 0 to 11 impaired AvrXa10 box activity. Deletion of any one of the first four nucleotides (TATA) in the AvrXa10 box also abolished the binding of AvrXa10 to the mutant probes in EMSA, indicating that the first four nucleotides in the AvrXa10 box are essential for the binding of AvrXa10 to the Xa10 promoter. Deletion of any one of the nucleotides at positions 13 to 17 did not affect the AvrXa10 box activity, nor did the binding of AvrXa10 to the mutant probes in EMSA. Deletion of the last four nucleotides at positions 13 to 17 in AvrXa10 box also did not significantly affect AvrXa10 box activity for induction of reporter gene by AvrXa10. The nucleotides CAC at the positions from 9 to 11 in AvrXa10 box was essential for activation of transcription by AvrXa10. Mutation of the CAC to TCA completely abolished AvrXa10 box activity, whereas change of TCA in Box 7 to CAC gained AvrXa10 box activity for the mutated Box 7 (Box 7M). These results indicated that AvrXa10 box may have two functional centers: the first four nucleotides (TATA) as the AvrXa10 binding center and the transcription activation center at positions 9 to 11 (CAC). The identification of molecular interaction between Xa10 and AvrXa10, together with other host genes identified to be targeted by TAL type III effectors, enables the engineering of broad-spectrum and durable resistance to bacterial diseases caused by Xanthomonas spp.

(21) As used herein, the term plant cell is intended to encompass any cell derived from a plant including undifferentiated tissues such as callus and suspension cultures, as well as plant seeds, pollen or plant embryos. Plant tissues suitable transformation include leaf tissues, root tissues, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, immature embryo, pollen, and anther. Some non-limiting examples of methods that can be employed in transforming plants and plant cells are described herein. Examples of plants contemplated for the present invention include rice, barley, oats, wheat, corn, cabbage, broccoli, potato, tomato, pepper, chili, soybean, rapeseed and any other plant that is susceptible to Xanthomonas.

(22) A polynucleotide or nucleic acid is said to encode a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof.

(23) An isolated or substantially pure nucleic acid (e.g., an RNA, DNA or a mixed polymer) or polypeptide is one which is substantially separated from other cellular components which naturally accompany a native human sequence or protein, e.g., ribosomes, polymerases, many other human genome sequences and proteins. The term embraces a nucleic acid sequence or protein that has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.

(24) The polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. The polynucleotides of the invention may be isolated or substantially pure.

(25) The present invention provides recombinant nucleic acids. The recombinant construct may be capable of replicating autonomously in a host cell. Alternatively, the recombinant construct may become integrated into the chromosomal DNA of the host cell. Such a recombinant polynucleotide comprises a polynucleotide of genomic, cDNA, semi-synthetic, or synthetic origin which, by virtue of its origin or manipulation, 1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; 2) is linked to a polynucleotide other than that to which it is linked in nature; or 3) does not occur in nature. Therefore, recombinant nucleic acids comprising sequences otherwise not naturally occurring are provided by this invention. Although the described sequences may be employed, it will often be altered, e.g., by deletion, substitution or insertion.

(26) Protein modifications or fragments are provided by the present invention for wildtype and mutant polypeptides described herein or fragments thereof which are substantially homologous to primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by persons of ordinary skill in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known by persons of ordinary skill in the art, and include radioactive isotopes such as .sup.32P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation.

(27) Besides substantially full-length proteins, the present invention provides for biologically active fragments of the polypeptides. Significant biological activities include ligand-binding, immunological activity and other biological activities characteristic of proteins. The term polypeptide as used herein refers to both a full length protein and a portion of the protein as a polypeptide fragment. A polypeptide fragment, portion or segment is a stretch of amino acid residues eat least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids.

(28) The present invention also provides for fusion polypeptides, comprising the polypeptides described herein and fragments thereof and polypeptides or fragments of other proteins as known in the art. Homologous polypeptides may be fusions between two or more polypeptide sequences or between the sequences described herein and a related protein. Likewise, heterologous fusions may be constructed which would exhibit a combination of properties or activities of the derivative proteins. For example, ligand-binding or other domains may be swapped between different new fusion polypeptides or fragments. Such homologous or heterologous fusion polypeptides may display, for example, altered strength or specificity of binding and may include for example partners such as immunoglobulins, bacterial -galactosidase, trpE, protein A, -lactamase, alpha amylase, alcohol dehydrogenase and yeast alpha mating factor. Fusion proteins will typically be made by either recombinant nucleic acid methods, as described below, or may be chemically synthesized. Techniques for the synthesis of polypeptides are well known by persons of ordinary skill in the art.

(29) Other protein modifications include amino acid substitution. Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. Preferred substitutions are ones which are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known to persons of ordinary skill in the art and typically include, though not exclusively, substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and tyrosine, phenylalanine.

(30) Certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules or binding sites on proteins interacting with a polypeptide. Since it is the interactive capacity and nature of a protein which defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydrophobic amino acid index in conferring interactive biological function on a protein is generally understood in the art. Alternatively, the substitution of like amino acids can be made effectively on the basis of hydrophilicity. The importance of hydrophilicity in conferring interactive biological function of a protein is generally understood in the art (See e.g. U.S. Pat. No. 4,554,101). The use of the hydrophobic index or hydrophilicity in designing polypeptides is further discussed in U.S. Pat. No. 5,691,198.

(31) Recombinant nucleic acid is a nucleic acid which is not naturally occurring, or which is made by the artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by either chemical, synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. This phrase is also meant to encompass a gene which is removed from its normal regulatory expression constraints, as in the case where a gene product is overexpressed due to the presence of multiple copies of the gene or up regulated promoter or enhancer signals, increased mRNA or protein half life and the like.

(32) Large amounts of the polynucleotides of the present invention may be produced by a suitable host cell transformed with a nucleotide sequence encoding mutant or wildtype proteins described herein. Natural or synthetic polynucleotide fragments coding for the peptide or a desired fragment can be incorporated into recombinant polynucleotide constructs (vectors), usually DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell. Usually the vectors will be suitable for replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to (with and without integration within the genome) cultured mammalian or plant or other eukaryotic cell lines. The most commonly used prokaryotic hosts are strains of Escherichia coli, although other prokaryotes, such as Bacillus subtilis or Pseudomonas may also be used. Mammalian or other eukaryotic host cells, such as those of yeast, filamentous fungi, plant, insect, or amphibian or avian species, may also be useful for production of the proteins of the present invention. As is well known in the relevant art, regulating polynucleotide expression can result in regulation of polypeptides encoded by the polynucleotide.

(33) Vectors, such as cloning and expression vectors, will include an appropriate promoter and other necessary vector sequences that are functional in the selected host, such as those described herein. There may include, when appropriate, those naturally associated with the nucleic acids described herein and protein expression and may include alternative or additional regulatory sequences operably linked to the nucleic acid in order to control expression of the nucleic acid, as well known in the art. Many useful vectors are known in the art and may be obtained from vendors. Operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. The vectors may also include a selectable marker gene such as described herein.

(34) In a first aspect, the present invention provides an isolated nucleic acid encoding (i) the Xa10 polypeptide having the amino acid sequence set forth in SEQ ID NO:37 or (ii) a polypeptide having at least 50% identity to the Xa10 polypeptide in which the polypeptide of (ii) provides a plant with resistance to Xanthomonas when transfected into the plant. As described herein, the Xa10 polypeptide provides a plant expressing this protein with resistance to Xanthomonas. In one embodiment, the polypeptide of (ii) has at least 60% identity. In another embodiment, the polypeptide of (ii) has at least 70% identity. In an additional embodiment, the polypeptide of (ii) has at least 80% identity. In a further embodiment, the polypeptide of (ii) has at least 90% identity. In another embodiment, the polypeptide of (ii) has at least 95% identity. In an additional embodiment, the polypeptide of (ii) has at least 98% identity. In a further embodiment, the polypeptide of (ii) has at least 99% identity. In one embodiment, nucleic acid encoding the Xa10 polypeptide has the nucleotide sequence set forth in SEQ ID NO:35. In another embodiment, the nucleic acid encoding the Xa10 polypeptide has the nucleotide sequence set forth in SEQ ID NO:36. In an additional embodiment, the nucleic acid encoding the Xa10 polypeptide has the nucleotide sequence set forth in nucleotides 54-437 of SEQ ID NO:36. In a further embodiment, the nucleic acid encoding the Xa10 polypeptide has the nucleotide sequence set forth in nucleotides 2423-3234 of SEQ ID NO:35.

(35) In another embodiment, the isolated nucleic acid encoding (i) or (ii) may be operatively linked to a nucleic acid encoding a heterologous polypeptide. Heterologous polypeptides can include proteins of R genes or proteins of defense genes from rice or other plants as known to those of ordinary skill in the art. Non-limiting examples can include rice bacterial blight R proteins Xa1, Xa2, Xa5, Xa13, Xa21, Xa26, Xa27 or defense proteins such as, e.g., PR1 from rice.

(36) The present invention also provides Xa10 polypeptide described herein. In addition, the present invention provides a plant cell comprising the isolated nucleic acid and a transgenic plant resistant to Xanthomonas comprising the plant cell.

(37) In a second aspect, the present invention provides a vector comprising an isolated nucleic acid encoding (i) the Xa10 polypeptide having the amino acid sequence set forth in SEQ ID NO:37 or (ii) a polypeptide having at least 50% identity to the Xa10 polypeptide in which the polypeptide of (ii) provides a plant with resistance to Xanthomonas when transfected into the plant described herein. In one embodiment, the vector further comprises a plant promoter operably linked to the isolated nucleic acid. In another embodiment, the promoter is selected from the group consisting of a tissue-specific promoter, a constitutive promoter and an inducible promoter. In a further embodiment, the promoter is an Xa10 promoter or one derived from the Xa10 promoter or contains a part of the Xa10 promoter, including promoters described herein. In one embodiment, the vectors may also include other regulatory sequences such as described herein. In another embodiment, the isolated nucleic acid encoding (i) or (ii) in the vector may be operatively linked to a nucleic acid encoding a heterologous polypeptide, such as described herein.

(38) A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. That is, the nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in the host cell of interest. Such constitutive promoters include, for example, the core promoter of the Rsyn7 (WO 99/48338 and U.S. Pat. No. 6,072,050); the core CaMV35S promoter (Odell et al., 1985); rice actin (McElroy et al., 1990); ubiquitin (Christensen and Quail, 1989 and Christensen et al., 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, those disclosed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142.

(39) Other promoters include inducible promoters, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. Other promoters include those that are expressed locally at or near the site of pathogen infection. In further embodiments, the promoter may be a wound-inducible promoter. In other embodiments, chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. The promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. In addition, tissue-preferred promoters can be utilized to target enhanced expression of a polynucleotide of interest within a particular plant tissue. Each of these promoters are described in U.S. Pat. Nos. 6,506,962, 6,575,814, 6,972,349 and 7,301,069 and in U.S. Patent Application Publication Nos. 2007/0061917 and 2007/0143880.

(40) In an additional embodiment, promoter is selected from the group consisting of the Xa10 promoter having the nucleotide sequence set forth in SEQ ID NO:38, the Xa10 promoter having the nucleotide sequence set forth in nucleotides 1 through 2422 of SEQ ID NO:38 and the Xa10 promoter having the nucleotide sequence set forth in SEQ ID NO:39. In a further embodiment, promoter is selected from the group consisting of a promoter containing the AvrXa10 box having the nucleotide sequence set forth in SEQ ID NO:23 and promoters containing derivatives of the AvrXa10 box, wherein the derivatives of the AvrXa10 box are selected from the group consisting of a derivative having the nucleotide sequence set forth in SEQ ID NO:26, a derivative having the nucleotide sequence set forth in SEQ ID NO:28, a derivative having the nucleotide sequence set forth in SEQ ID NO:30, a derivative having the nucleotide sequence set forth in SEQ ID NO:31, a derivative having the nucleotide sequence set forth in SEQ ID NO:68, a derivative having the nucleotide sequence set forth in SEQ ID NO:72, a derivative having the nucleotide sequence set forth in SEQ ID NO:73, a derivative having the nucleotide sequence set forth in SEQ ID NO:74, a derivative having the nucleotide sequence set forth in SEQ ID NO:82, a derivative having the nucleotide sequence set forth in SEQ ID NO:83, a derivative having the nucleotide sequence set forth in SEQ ID NO:84 and a derivative having the nucleotide sequence set forth in SEQ ID NO:85. The present invention also provides a plant cell comprising the vector and a transgenic plant resistant to Xanthomonas comprising the plant cell. In a preferred embodiment, the nucleic acid of the present invention is stably integrated in the genome of the transgenic plant cell or transgenic plant.

(41) In a third aspect, the present invention provides methods of (i) making a plant resistant to Xanthomonas, (b) enhancing resistance to Xanthomonas in a plant and (c) conferring resistance to Xanthomonas disease to a plant. Each of these methods comprises transfecting the isolated nucleic acid described herein or the vector described herein into a plant cell or plant cells and growing a plant from the transfected plant cell or transfected plant cells such that the isolated nucleic acid is expressed in the plant. Transfecting the nucleic acid or vector into a plant cell or cells is also sometimes referred to herein as transforming a plant cell or cells with the nucleic acid or vector. In a preferred embodiment, the nucleic acid of the present invention is stably integrated in the genome of the transgenic plant cell or transgenic plant.

(42) In a fourth aspect, the present invention provides an isolated nucleic acid having promoter activity in a plant. In one embodiment, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO:38 or the nucleotide sequence set forth in nucleotides 1 to 2422 of SEQ ID NO:38. In another embodiment, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO:39. In a further embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:23. Suitable plant operable promoters for this embodiment and the following embodiments include those described herein and those well known to the skilled artisan. In another embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:26. In an additional embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:28. In a further embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:30. In another embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:31. In an additional embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:68. In a further embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:72. In another embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:73. In a further embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:74. In another embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:82. In an additional embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:83. In a further embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:84. In another embodiment, the nucleic acid comprising a plant operable promoter containing the nucleotide sequence set forth in SEQ ID NO:85. The present invention also provides a nucleic acid construct comprising the nucleic acid having promoter activity operably linked to a second nucleic acid encoding a nucleic acid of interest. In addition, the present invention provides a transgenic plant cell or a transgenic plant containing the nucleic acid construct in its genome. The present invention further provides a method of producing the transgenic plant cell or transgenic plant. The transgenic plant cell is produced by transfecting the nucleic acid construct into a plant cell or cells. The transgenic plant is produced by regenerating a plant from the transfected plant cell or cells.

(43) The promoters of the present invention are particularly useful for preparing transgenic plants, including those described herein, to contain a nucleic acid or DNA of interest. The nucleic acid or DNA that is inserted (the nucleic acid or DNA of interest) into plants is not critical to the transformation process. Generally the DNA that is introduced into a plant is part of a construct. The DNA may be a gene of interest, e.g., a coding sequence for a protein, or it may be a sequence that is capable of regulating expression of a gene, such as an antisense sequence, a sense suppression sequence, a post-transcriptional gene silencing sequence (an RNAi sequence such as an siRNA, shRNA or dsRNA) or a micro-RNA (miRNA) sequence. The construct typically includes regulatory regions operatively linked to the 5 side of the DNA of interest and/or to the 3 side of the DNA of interest. A cassette containing all of these elements is also referred to herein as an expression cassette. The expression cassettes may additionally contain 5 leader sequences in the expression cassette construct. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide encoding a signal anchor may be native/analogous to the host cell or to each other. The promoters identified herein are particularly useful for preparing constructions for the transformation of plant species described herein. Alternatively, the regulatory regions and/or the polynucleotide encoding a signal anchor may be heterologous to the host cell or to each other. See, U.S. Pat. No. 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670, 2006/0248616 and 20090100536, and the references cited therein. The expression cassettes may additionally contain 5 leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include those described in International Publication No. WO 2008/094127 and the references cited therein.

(44) The DNA of interest that is under control of a promoter, such as a promoter described herein, may be any DNA as described herein and may be used to alter any characteristic or trait of a plant species into which it is introduced. In one embodiment, the DNA of interest is introduced into a plant in order to enhance a trait of the plant. In another embodiment, an enhanced agronomic trait may be characterized by enhanced plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance. In some aspects, the enhanced trait is selected from group of enhanced traits consisting of enhanced water use efficiency, enhanced temperature tolerance, increased yield, enhanced nitrogen use efficiency, enhanced seed protein enhanced seed oil and enhanced biomass. Increase yield may include increased yield under non-stress conditions and increased yield under environmental stress conditions. Stress conditions may include, for example, drought, shade, fungal disease, viral disease, bacterial disease, insect infestation, nematode infestation, extreme temperature exposure (cold or hot), osmotic stress, reduced nitrogen nutrient availability, reduced phosphorus nutrient availability and high plant density. In some embodiments, the DNA of interest may be used to modify metabolic pathways, such as fatty acid biosynthesis or lipid biosynthesis pathways in seeds, or to modify resistance to pathogens, especially Xanthomonas, in plant species. The promoters of the present invention can be induced or activated by the AvrXa10 protein described herein or a nucleic acid encoding this protein as described herein.

(45) Generally, the expression cassette may additionally comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Usually, the plant selectable marker gene will encode antibiotic resistance, with suitable genes including at least one set of genes coding for resistance to the antibiotic spectinomycin, the streptomycin phosphotransferase (spt) gene coding for streptomycin resistance, the neomycin phosphotransferase (nptII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (hpt or aphiv) gene encoding resistance to hygromycin, acetolactate synthase (als) genes. Alternatively, the plant selectable marker gene will encode herbicide resistance such as resistance to the sulfonylurea-type herbicides, glufosinate, glyphosate, ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D), including genes coding for resistance to herbicides which act to inhibit the action of glutamine synthase such as phosphinothricin or basta (e.g., the bar gene). See generally, International Publication No. WO 02/36782, U.S. Pat. No. 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670, 2006/0248616, 2007/0143880 and 20090100536, and the references cited therein. This list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used. The selectable marker gene is also under control of a promoter operable in the plant species to be transformed. Such promoters include those described in International Publication No. WO 2008/094127 and the references cited therein.

(46) Where appropriate, the DNA of interest may be optimized for increased expression in the transformed plant. That is, the coding sequences can be synthesized using plant-preferred codons for improved expression. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831, 5,436,391, and 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670 and 2006/0248616.

(47) In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g. transitions and transversions may be involved.

(48) Once a nucleic acid has been cloned into an expression vector, it may be introduced into a plant cell using conventional transformation procedures. The term plant cell is intended to encompass any cell derived from a plant including undifferentiated tissues such as callus and suspension cultures, as well as plant seeds, pollen or plant embryos. Plant tissues suitable for transformation include leaf tissues, root tissues, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, immature embryo, pollen, and anther. Transformation means the directed modification of the genome of a cell by the external application of recombinant DNA from another cell of different genotype, leading to its uptake and integration into the subject cell's genome. In this manner, genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained.

(49) DNA constructs containing the promoters of the present invention can be used to transform any plant, including those described herein. The constructs may be introduced into the genome of the desired plant host by a variety of conventional techniques. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. Transformation protocols may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation, as is well known to the skilled artisan. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. Thus, any method, which provides for effective transformation/transfection may be employed. See, for example, U.S. Pat. Nos. 7,241,937, 7,273,966 and 7,291,765 and U.S. Patent Application Publication Nos. 2007/0231905 and 2008/0010704 and references cited therein. See also, International Published Application Nos. WO 2005/103271 and WO 2008/094127 and references cited therein.

(50) In one embodiment, the explant tissue can be co-cultured with an Agrobacterium strain harboring a DNA construct containing a gene or nucleic acid of interest using techniques well known in the art. Transformed tissue can be selected using conventional techniques well known in the art. In another embodiment, the embryogenic liquid suspension cultures can be co-cultured with an Agrobacterium strain harboring a DNA construct containing a gene or nucleic acid of interest using techniques well known in the art. Transformed tissue can be selected using conventional techniques well known in the art. In a further embodiment, the DNA can be introduced into the explant tissue or cells of the embryogenic liquid suspension culture using conventional techniques, such as particle bombardment. Transformed tissue can be selected using conventional techniques well known in the art. Transformed or transgenic plants can be regenerated using the methods well known in the art

(51) Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype, e.g., a transgenic plant. A transgenic plant is a plant into which foreign DNA has been introduced. A transgenic plant encompasses all descendants, hybrids, and crosses thereof, whether reproduced sexually or asexually, and which continue to harbor the foreign DNA. Regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. See for example, International Published Application No. WO 2008/094127 and references cited therein.

(52) The foregoing methods for transformation are typically used for producing a transgenic variety in which the expression cassette is stably incorporated. After the expression cassette is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing. In one embodiment, the transgenic variety could then be crossed, with another (non-transformed or transformed) variety, in order to produce a new transgenic variety. Alternatively, a genetic trait which has been engineered into a particular cotton line using the foregoing transformation techniques could be moved into another line using traditional backcrossing techniques that are well known in the plant breeding arts. For example, a backcrossing approach could be used to move an engineered trait from a public, non-elite variety into an elite variety, or from a variety containing a foreign gene in its genome into a variety or varieties which do not contain that gene. As used herein, crossing can refer to a simple X by Y cross, or the process of backcrossing, depending on the context. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

(53) Once transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedures. Transgenic seeds can, of course, be recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.

(54) In a fifth aspect, the present invention provides uses and methods to control gene expression in transgenic plants. In one embodiment, the isolated nucleic acid having promoter activity described herein is used to control gene expression in a transgenic plant. In another embodiment, a nucleic acid encoding the AvrXa10 polypeptide having the amino acid sequence set forth in SEQ ID NO:54 is used to control gene expression in a transgenic plant containing the isolated nucleic acid having promoter activity described herein. In a further embodiment, the AvrXa10 polypeptide having the amino acid sequence set forth in SEQ ID NO:54 is used to control gene expression in a transgenic plant containing the isolated nucleic acid having promoter activity described herein. In one embodiment, the nucleic acid encoding the AvrXa10 polypeptide has the nucleotide sequence set forth in SEQ ID NO:57. In another embodiment, the nucleic acid encoding the AvrXa10 polypeptide has the nucleotide sequence set forth in GenBank Accession No. U50552. The present invention further provides a method of producing transgenic plant cell or transgenic plant having a promoter of the present invention and having a nucleic acid encoding the AvrXa10 polypeptide. The transgenic plant cell is produced by transfecting a nucleic acid construct containing the promoter into a plant cell or cells. In one embodiment a nucleic acid encoding the AvrXa10 polypeptide operably linked to a promoter, such as described herein, is also transfected into the plant cell or cells. The transgenic plant is produced by regenerating a plant from the transfected plant cell or cells. In a second embodiment, first transgenic plants are produced containing a nucleic acid construct containing the promoter into a plant cell or cells and second transgenic plants are produced containing a nucleic acid encoding the AvrXa10 polypeptide operably linked to a promoter. The first and second transgenic plants are then crossed to produce transgenic plants containing both the nucleic acid construct containing the promoter and the nucleic acid encoding the AvrXa10 polypeptide operably linked to a promoter.

(55) The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, N.J., 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.

EXAMPLES

(56) The present invention is described by reference to the following Examples, which is offered by way of illustration and is not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized.

Example 1

Materials and Methods

(57) Rice lines and growth conditions: IRBB10 harbors bacterial blight resistance gene Xa10 in IR24 genetic background (Ogawa et al., 1988). IRBB10A is an improved near-isogenic line of Xa10 in IR24 genetic background (Gu et al., 2008). Nipponbare is a japonica rice variety, which is susceptible to most of the Xoo strains. IRBB5 harbors recessive bacterial blight resistance gene xa5 in the IR24 background (Ogawa et al., 1988). Rice plants were grown in greenhouse at a temperature of 32 for 12.5 h (light) and 25 for 11.5 h (dark).

(58) Bacterial blight inoculation: Xanthomonas oryzae pv oryzae strains were cultivated at 28 C. on peptone sucrose agar (PSA) plates supplemented with appropriate antibiotics. Bacterial blight inoculation was carried out according to leaf-clipping method (Kauffman et al., 1973; Gu et al., 2008). Disease scoring was measured as described previously (Gu et al., 2004; 2008).

(59) Rice transformation: Subclones of the Xa10 gene were cloned into binary vector pC1300 (CAMBIA, Can berra, Australia) and the binary constructs were transferred into Agrobacterium tumefaciens AGL1. Agrobacterium-mediated transformation of Nipponbare was carried out according to the method described as Yin et al. (2000).

(60) BAC library construction: Bacterial Artificial Chromosome (BAC) library of Xa10 was constructed according to the protocols described in details by D. G. Peterson et al. (http colon//www dot ncgr dot org/research/jag/paper300/indexpage300 dot html). Briefly, IRBB10 plants were grown in greenhouse for 7-10 days. High-molecular weight (HMW) nuclear DNA was isolated and embedded into low melting agarose plug for partial digestion by HindIII. Partially digested HMW DNA was then size-fractionated using a Pulse-Field Gel Electrophoresis (PFGE) device (CHEF Mapper II, Bio-Rad). Size-fractionated DNA (100-300 kb) was recovered by electroelution (Strong et al., 1997) from low-melting-point agarose gel and ligated to. HindII digested and dephosphorylated BAC vector pIndigoBAC-5 (EPICENTRE, Madison, Wis. 53713, USA). The ligation mix was electroporated into E. coli DH10B cells using the Cell-Porator system (GIBCO-BRL). BAC clones were picked up manually and arrayed in 384-well plates with 60 l freezing media in each well. BAC clones were cultured at 37 C. for 14-16 hours and stored at 80 C. The BAC library consisted of about 50,000 clones with inserts ranging in size from 30-60 kb with the average size at 40 kb. The coverage of this library is at least 3 times equivalent to the rice genome.

(61) Southern blot analysis: Southern blot analysis was carried out according to standard procedures (Sambrook et al. 1989). Approximately 2-5 g of rice genomic DNA was digested with appropriate restriction enzymes and separated in 0.8% Agarose gel. Southern blots were hybridized with DNA probes labeled with .sup.32P-dCTP (GE Healthcare, Little Chalfont, Buckinghamshire, UK).

(62) Northern blot analysis: Northern blot analysis was carried out according to standard procedures (Sambrook et al. 1989). Total RNA was isolated from leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). About 5 g messenger RNA (mRNA) used for each lane in northern blot analysis. RNA loading was assessed by hybridizing RNA blots to rice ubiquitin gene 1 (Ubi) probe. DNA probes for northern blot analysis were labeled with .sup.32P-dCTP (GE Healthcare, Little Chalfont, Buckinghamshire, UK).

(63) Real-time PCR analysis: Approximately 1 g of DNase I-treated total RNA was converted into single-stranded cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, USA). The quantitative reaction was performed on an IQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, USA) using the SsoFast EvaGreen supermix (Bio-Rad, USA). The reaction mixture (15 L) contained 2 SsoFast EvaGreen supermix, 0.9 M each of the forward and reverse primers, and 1 L of template cDNA. PCR amplification was performed under the following conditions: 95 C. for 30 sec, followed by 40 cycles of 95 C. for 5 sec, 60 C. for 10 sec. A melting-curve protocol immediately followed the amplification with heating for 10 sec, starting at 65 C. with 0.5 C. increments. Rice Ubiquitin 1 gene was used as an internal control. All primers used in this study are listed in Table 1.

(64) TABLE-US-00001 TABLE1 DNAOligos Name DNAsequence(5-3)(SEQIDNO:) Purpose 5-CDS TTTTTTTTTTTTTTTTTTTTTTTTT(G/A/C)(A/C/T/G)(1) 5RACE Xa10RT-F2 TAAGAAGGAGTAGCCAAGCTCA(2) 5RACE RGP6-F CCTCGTCGTCTTCACCAATGCA(3) 5RACE Xa10RT-F3 CCGGTTTCTCTTTATTAACCGT(4) 5RACE NUP AAGCAGTGGTATCAACGCAGAGTTTTTT(G/A/C)(5) 5RACE Oligo-dT-anchor GACCACGCGTATCGATGTCGACTTTTTTTTTTT(7) 3RACE GS4R1 GACGTGCTCATCATCTACCTC(8) 3RACE ANCHOR GACCACGCGTATCGATGTCGAC(9) 3RACE SP1F TGCCGTCCTCCTACTGATG(10) Xa10DNAprobe SP1R CCTCGTCGTCTTCACCAATG(11) Xa10DNAprobe RBQ3 CCAGTAAGTCCTCAGCCATG(12) Real-timePCRforUbi1 RBQ4 TTTCAGACACCATCAAACCAG(13) Real-timePCRforUbi1 10RTF2 GGCATCATCTTCTCCGGCG(14) Real-timePCRforXa10 10RTR2 GCAGCTATACGGGCATAAG(15) Real-timePCRforXa10 Box1 TACATCAATTACTTATT(16) AvrXa10boxcandidate Box2 TACACACGTTCACTCCT(17) AvrXa10boxcandidate Box3 TACAGCCAGAAAGCACT(18) AvrXa10boxcandidate Box4 TATACATCAATTACTTA(19) AvrXa10boxcandidate Box5 TATACACACGTTCACTC(20) AvrXa10boxcandidate Box6 TATACAGCCAGAAAGCA(21) AvrXa10boxcandidate Box7 TATATACATCAATTACT(22) AvrXa10boxcandidate Box8 TATATACACACGTTCAC(23) AvrXa10box Box9 TATATACAGCCAGAAAG(24) AvrXa10boxcandidate Box10 TATATATACATCAATTA(25) AvrXa10boxcandidate Box11 TATATATACACACGTTC(26) AvrXa10boxcandidate Box12 TATATATACAGCCAGAA(27) AvrXa10boxcandidate 8D15 TATATACACACGTTC(28) AvrXa10box3deletion 1D8 ATATACACACGTTC(29) AvrXa10box5 and3deletion 8D14 TATATACACACGTT(30) AvrXa10box3deletion 8D13 TATATACACACGT(31) AvrXa10box3deletion 8D12 TATATACACACG(32) AvrXa10box3deletion 8D11 TATATACACAC(33) AvrXa10box3deletion AvrXa27box TAGAAGAAGAGACCAATA(44) UPT.sub.AvrXa27box(Romeretal., 2009b AvrXa10box ACTCCTCTTATATATACACACGTTCACTCCTCT(34) EMSA probe AvrXa27box GTGCTATAAATAGAAGAAGAGACCAATAGAGAGC(45) EMSA probe Box80dTprobe ACTCCTCTTAATATACACACGTTCACTCCTCT(46) EMSA Box81dAprobe ACTCCTCTTATTATACACACGTTCACTCCTCT(47) EMSA Box82dTprobe ACTCCTCTTATAATACACACGTTCACTCCTCT(48) EMSA Box83dAprobe ACTCCTCTTATATTACACACGTTCACTCCTCT(49) EMSA Box84dTprobe ACTCCTCTTATATAACACACGTTCACTCCTCT(50) EMSA Box85dAprobe ACTCCTCTTATATATCACACGTTCACTCCTCT(51) EMSA Box86dCprobe ACTCCTCTTATATATAACACGTTCACTCCTCT(52) EMSA Box87dAprobe ACTCCTCTTATATATACCACGTTCACTCCTCT(53) EMSA Box88dCprobe ACTCCTCTTATATATACAACGTTCACTCCTCT(58) EMSA Box89dAprobe ACTCCTCTTATATATACACCGTTCACTCCTCT(59) EMSA Box810dCprobe ACTCCTCTTATATATACACAGTTCACTCCTCT(60) EMSA Box811dGprobe ACTCCTCTTATATATACACACTTCACTCCTCT(61) EMSA Box812dTprobe ACTCCTCTTATATATACACACGTCACTCCTCT(62) EMSA Box813dTprobe ACTCCTCTTATATATACACACGTCACTCCTCT(63) EMSA Box814dCprobe ACTCCTCTTATATATACACACGTTACTCCTCT(64) EMSA Box815dAprobe ACTCCTCTTATATATACACACGTTCCTCCTCT(65) EMSA Box816dCprobe ACTCCTCTTATATATACACACGTTCATCCTCT(66) EMSA Box8M1 TATATACATCAGTTCAC(67) AvrXa10boxmutant Box7M TATATACACACATTACT(68) AvrXa10boxmutant Box7M1 TATATACACCAATTACT(69) Box7mutant Box7M2 TATATACATAAATTACT(70) Box7mutant Box7M3 TATATACATCCATTACT(71) Box7mutant Box7M4 TATATACACAAATTACT(72) Box7mutant Box7M5 TATATACACCCATTACT(73) Box7mutant Box7M6 TATATACATACATTACT(74) Box7mutant Box8M1probe ACTCCTCTTATATATACATCAGTTCACTCCTCT(75) EMSA Box7probe TTCTCTTATATATACATCAATTACTTATTGATG(76) EMSA Box7Mprobe TTCTCTTATATATACACACATTACTTATTGATG(77) EMSA pAbAiF2 CCAAGAAGATGTAATGCACCC(6) YeastcolonyPCR pAbAiR2 CATTACGACCGAGATTCCCG(78) YeastcolonyPCR Box813dT TATATACACACGTCAC(82) Box8deletion Box814dC TATATACACACGTTAC(83) Box8deletion Box815dA TATATACACACGTTCC(84) Box8deletion Box816dC TATATACACACGTTCA(85) Box8deletion Box80dT ATATACACACGTTCAC(40) Box8deletion Box81dA TTATACACACGTTCAC(86) Box8deletion Box82dT TAATACACACGTTCAC(87) Box8deletion Box83dA TATTACACACGTTCAC(88) Box8deletion Box84dT TATAACACACGTTCAC(89) Box8deletion Box85dA TATATCACACGTTCAC(90) Box8deletion Box86dC TATATAACACGTTCAC(91) Box8deletion Box87dA TATATACCACGTTCAC(92) Box8deletion Box88dC TATATACAACGTTCAC(93) Box8deletion Box89dA TATATACACCGTTCAC(94) Box8deletion Box810dC TATATACACAGTTCAC(95) Box8deletion Box811dG TATATACACACTTCAC(96) Box8deletion Box812dT TATATACACACGTCAC(97) Box8deletion

(65) Rapid amplification of cDNA ends (RACE): Xa10 cDNA was isolated using a SMART RACE cDNA Amplification Kit (Clontech). Both 5 RACE and 3 RACE were conducted according to the manufacturer's instructions. The PCR products were cloned into pGEM T-easy vector (Promega) and sequenced. The primers used for first-strand cDNA synthesis for 5 and 3 RACE were 5-CDS and Oligo-dT-anchor, respectively (Table 1). The specific primers for 5 RACE were Xa10RT-F2, RGP6-F and Xa10RT-F3 (Table 1). The anchor primer for 5 RACE was NUP (Table 1). The specific primers for 3 RACE was GS4R1 (Table 1). The anchor primer for 3 RACE was ANCHOR (Table 1).

(66) GUS reporter constructs: GUS reporter constructs were based on pCAMBIA vector pC1305.1 (Wu et al., 2008) and pANDA vector pANDA35HK (Miki and Shimamoto, 2004) and minimal Bs4 promoter (Boch et al., 2009). Briefly, the 35S promoter in pC1305.1 was removed by digested with HindIII and NcoI and the vector fragment was filled in and self-ligated to produce pC1305.1 (35S). The 2151-bp XhoI-XbaI fragment in pC1305.1 (35S), which consists of the coding sequence of hygromycin resistance gene and another 35S promoter, was replaced with 1787-bp XhoI-SpeI fragment of attR element from pANDA35HK to generate pCGWGUSint. The minimal Bs4 promoter was amplified by PCR and inserted into pENTR/DTOPO (Invitrogen, Carlsbad, Calif., USA) with target DNA boxes at the 5 end (Boch et al., 2009). Promoter derivatives were cloned into pCGWGUSint containing a promoterless GUSPlus gene from pC1305.1.

(67) Agrobacterium infiltration and qualitative -glucuronidase (GUS) assay: Agrobacterium tumefaciens C58C1 (GV3101) strains harboring TAL effector constructs or GUS reporter constructs were grown at 28 C. in LB supplemented with appropriate antibiotics and 10 mM 2-(N-morpholino) ethanesulfonic acid (MES). The two strains were collected, resuspended and mixed 1:1 in infiltration medium (10 mM MgCl.sub.2, 5 mM MES, 150 M acetosyringone, pH 5.3). Bacterial solutions with an OD600 of 0.8 were inoculated into the abaxial surface of Nicotiana benthamiana leaves using a 1 ml needleless syringe as described previously (Kay et al., 2007). Inoculated plants were grown in a growth room at 25 C. with 16 h light. For qualitative GUS assays, leaf discs were sampled two days post infiltration (dpi), incubated in 5-bromo-4-chloro-3-indolyl--D-glucuronide (X-Gluc) staining solution, destained in ethanol, and dried. For quantitative assay, two leaf discs (1-cm diameter) from two different plants at 2 dpi were combined and ground in liquid nitrogen. Proteins were extracted with 300 ul GUS extraction buffer (50 mM sodium phosphate (pH7.0), 10 mM EDTA, 10 mM Beta-mercaptoethanol, 0.1% Triton-X100, 0.1% SDS). Supernatant was collected by centrifugation at 4 C. For the fluorometric assay, 10 l sample was mixed with 90 l assay buffer (GUS extraction buffer supplied with 10 mM 4-methyl-umbelliferyl--D-glucuronide (MUG)). The reaction samples were incubated at 37 C. for 5 min. The reaction was stopped by mixing 10 l of reaction sample with 90 l 0.2 M sodium carbonate (Na.sub.2CO.sub.3, pH 9.5). Measurements were done in a plate reader at 360 nm (excitation) and 465 nm (emission) with 4-methyl-umbelliferon (MU) dilutions as standard. The protein amounts were quantified by Bradford assay (BioRad, Hercules, Calif., U.S.A.). Experiments were performed at least twice.

(68) Yeast one-hybrid studies: For protein-DNA interaction studies, the Matchmaker Gold Yeast One-Hybrid Library Screening System (Takara Bio Asia Pacific/Clontech) was used and the experiments were carried out according to the manufacturer's protocol. One to four copies of bait DNA sequence were cloned into pAbAi vector in tandem to yield bait constructs. The AvrXa10 gene was cloned into pGADT7-Rec to create prey constructs, in which AvrXa10 is fused to SV40 NLS-GAL4 AD as prey. The GAL4-AD fusion of murine p53 protein and a bait containing its target sequence (p53DBS) served as controls. The bait constructs were digested with BstBI and transformed into yeast strain Y1HGold. The transformants were verified by using a colony PCR. The prey constructs were then transformed into the generated Y1HGold strains that harbored the cognate bait DNA sequences in their genomes. Transformants grown on selective SD medium at 30 C. were resuspended in 0.9% NaCl with an OD600 of 0.002 or approximately 2000 cells per 100 l. Serial dilutions in 0.9% NaCl were dropped on SD medium supplemented with Leucine or 200 ng/ml Aureobasidin A (AbA). Identical transformants were inspected for presence of the bait plasmid by colony PCR and for expression of GAL4-AD-fusion proteins by immunoblot.

(69) Yeast colony PCR: Single yeast colonies were resuspended in 20 lyticase buffer (1.2 M sorbitol, 0.1 M sodium phosphate pH7.4, 2.5 mg/ml lyticase (Sigma-Aldrich, INC., Saint Louis USA)), incubated 30 min at 37 C. and 10 min at 95 C. 5 l of a 1:5 dilution were used for PCR with oligonucleotides pAbA1-F2 and pAbA1-R2 (Table 1).

(70) Western blot analysis was carried out according to the method described by Kay et al., (2009). Single yeast colonies were resuspended in histidine-containing SD liquid medium to an OD.sub.600=0.15 and grown at 30 C. and 150 rpm to OD.sub.600=0.4 to 0.6. Cells of 3 ml culture were resuspended in 30 l cracking buffer (8 M urea, 5% (w/v) SDS, 40 mM Tris-HCl pH 6.8, 0.1 mM EDTA, 0.4 mg/ml bromophenol blue, 0.1% -ME). Samples were incubated together with glass beads (425-600 m; Sigma #G-8772) at 20 C. and 14000 rpm for 30 s, and set on ice for 30 s. This step was repeated three times. Samples were centrifuged at 14000 rpm and 4 C. for 10 min. The supernatant was denatured at 70 C. for 5 min. 25 l protein extract was separated on 8% SDS polyacrylamide gels and subjected to immunoblot analysis with Anti-GAL4 AD (Sigma-Aldrich) and Anti-rabbit IgG (Sigma-Aldrich) antibodies. Reactions were visualized by enhanced chemiluminescence as recommended (Amersham).

(71) Electromobility shift assay (EMSA): EMSA was carried out according to the method described by Kay et al (2007) with slight modification. Polyhistidine-tagged (6His) fusion proteins were purified from E. coli M15 as using a QIAexpressionist kit (Qiagen, Chats-worth, CA). Protein concentration was determined by Bradford assay (BioRad). Complementary pairs of nonlabeled or 3-biotin-labeled oligonucleotides (1.sup.st BASE, Singapore) were annealed to obtain double-stranded DNA. EMSA was performed with the Light Shift Chemiluminescent EMSA Kit (Pierce, Rockford, Ill., USA) according to the manufacturer's protocol. The binding reactions contained 12 mM Tris-HCl (pH 7.5), 60 mM KCl, 1 mM DTT, 2.5% Glycerol, 5 mM MgCl.sub.2, 50 ng/l poly(dIdC), 0.05% NP-40, 0.2 mM EDTA, 20 fmol biotin-labeled DNA, 0-10 pmol unlabeled DNA, 60-6000 fmol 6His fusion protein. The binding reactions were kept on ice for 10 min before biotin-labeled DNA was added. The binding reactions were incubated at room temperature for 20 minutes. Gel electrophoresis was performed on a 6% native polyacrylamide gel. After blotting on a positively charged nylon membrane (Amersham) the DNA was Cross-linked at 120 mJ/cm.sup.2 by UV-light cross-linker instrument equipped with 254 nm bulbs.

Example 2

Xa10 Ecodes a Novel Transmembrane Protein

(72) The Xa10 gene was isolated from Xa10 line IRBB10A by map-based cloning and genetic transformation. Xa10 flanking markers M491 and M419 (Gu et al. 2008), and Xa10 co-segregating marker S723 were used to screen a home-made Xa10 BAC library. BAC clone 44M10 was picked up by both M491 and S723 (FIG. 1A). The BAC insert in 44M10 was sequenced and its subclones were used for transformation of susceptible variety Nipponbare. Six of the nine 44M10 subclones produced independent transgenic plants that were resistant to Xa10-incompatible Xoo strain PXO99(pHM1AvrXa10) (Table 2; FIG. 1A). These resistant transgenic lines conferred race-specific resistance to Xa10-incompatible Xoo strains but not to Xa10-compatible strains (Tables 3 and 4, FIGS. 1A and 1B). A. 521-bp Xa10 cDNA clone (SEQ ID NO:36) was isolated by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of 5 complementary DNA ends (5 RACE). Comparison of the Xa10 cDNA with its genomic sequence (SEQ ID NO:35) identified an intron of 249 bp at its 3 untranslated region (3UTR) (FIG. 1C). The donor and acceptor at the splice sites of the intron are GA and CG, which does not follow the general GT-AG rule for intron splicing in higher plants (FIG. 1C). This comparison also identified the promoter region (SEQ ID NO:38) of the Xa10 gene. Southern blot analysis using a probe from Xa10 coding region indicated that the Xa10 gene is only present in Xa10 plants but not in susceptible rice lines (FIG. 2). The ectopic expression of the Xa10 coding sequence under the control of the rice PR1 promoter, which is not activated specifically by AvrXa10, provided non-specific resistance to both Xa10-compatible and Xa10-incompatible Xoo strains (Table 4; FIG. 3A). These results indicated that it is the Xa10 gene product that provides resistance to Xoo.

(73) TABLE-US-00002 TABLE 2 Summary of Disease Evaluation of Xa10 Transgenic Lines to Xoo Strain PXO99(pHM1avrXa10) Subclone.sup.1 Total lines Resistant lines S18901 109 38 A14799 88 50 ES11947 35 22 EA9295 65 45 SA4686 106 7 PX3834 35 3 SX10761 70 0 EN6879 95 0 B6804 98 0 .sup.1Subclones at the Xa10 locus used for Agrobacterium-mediated rice transformation. S18901, 18901-bp SpeI fragment; A14799, 14799-bp AvrII fragment; ES11947, 11947-bp EcoRI-SpeI fragment; EA9295, 9295-bp EcoRV- AvrII fragment; SA4686, 4686-bp SacI-AvrII fragment; PX3834, 3834-bp PmlI-XbaI fragment; SX10761, 10761-bp SpeI-XhoI fragment; EN6879, 6879-bp EcoRV-NruI fragment; B6804, 6804-bp BamHI fragment.

(74) TABLE-US-00003 TABLE 3 Disease Evaluation of Xa10 Transgenic Lines to Bacterial Blight.sup.1 Lesion length (cm) and Copy disease score.sup.3 Xa10 num- PXO99 Line subclone ber.sup.2 (pHM1AvrXa10) PXO99 IR24 wild-type N.A. 17.3 4.4 (S) 22.0 3.9 (S) IRBB10A wild-type N.A. 0.1 0.1 (R) 26.0 3.6 (S) Nipponbare wild-type N.A 10.7 4.8 (S) 10.9 3.1 (S) L673 A14799 1 0.1 0.0 (R) 6.1 2.4 (MS) L58 ES11947 1 0.5 0.5 (R) 11.1 2.9 (S) L74 EA9295 1 0.1 0.0 (R) 6.6 2.7 (MS) L142 SA4686 2 0.1 0.0 (R) 6.3 2.5 (MS) L186 SA4686 1 0.1 0.1 (R) N.D. L198 SA4686 1 0.1 0.0 (R) 7.8 2.9 (MS) L211 SA4686 1 0.1 0.1 (R) 7.2 3.5 (MS) L289 SA4686 N.D. 0.1 0.1 (R) N.D. L306 SA4686 2 0.1 0.1 (R) N.D. L635 SA4686 1 0.1 0.0 (R) 7.1 2.8 (MS) L203 PX3834 1 0.1 0.0 (R) 6.4 3.0 (MS) L297 PX3834 2 0.1 0.0 (R) 7.9 2.6 (MS) L313 PX3834 1 0.1 0.1 (R) 9.1 3.2 (MS) .sup.1Six-week-old Xa10 transgenic plants and wild-type plants were inoculated with Xanthomonas oryzae pv. oryzae strain PXO99(pHM1avrXa10). Lesion length and disease phenotype of the inoculated plants were scored at two weeks after inoculation. .sup.2Copy number of transgene in Nipponbare. N.A., not applicable. N.D., not detected. .sup.3The lesion length (L.L.) and the standard deviation of the mean were the average of 16 infected leaves. For score: R, resistant, 0 cm L.L. 3.0 cm; MR, moderately resistant, 3.0 cm < L.L. 6.0 cm; MS, moderately susceptible, 6.0 cm < L.L. 9.0 cm; S, susceptible, L.L. > 9.0 cm.

(75) TABLE-US-00004 TABLE 4 Disease Evaluation of Wild-Type Plants and Homozygous Transgenic Lines L198 and L162 to Different Xanthomonas oryzae pv. oryzae Strains.sup.1 Lesion length (cm) and resistance score.sup.2 Bacterial strain Origin IRBB10A Nipponbare L198 L162 PXO99 Philippines 29.6 3.4 (S) 14.9 3.1 (S) 13.6 2.2 (S) 1.4 1.4 (R) PXO99 Yang et al. (2000) 0.1 0.1(R) 11.8 2.6(S) 0.1 0.1 (R) 2.2 0.3 (R) (pHM1avrXa10) PXO86 (R2) Philippines 0.4 0.3 (R) 7.4 1.8 (MS) 0.2 0.1 (R) 4.5 2.1 (MR) PXO79 (R3) Philippines 25.2 2.9 (S) 10.5 1.8 (S) 6.3 2.7 (MS) 0.9 0.7 (R) PXO113 (R4) Philippines 26.8 3.5 (S) 14.3 1.5 (S) 12.9 5.0 (S) 1.1 1.4 (R) PXO112 (R5) Philippines 0.2 0.1 (R) 9.9 2.1 (S) 0.2 0.2 (R) 2.5 1.3 (R) IXO56 Indonesia 30.4 5.9 (S) 14.7 4.0 (S) 10.6 3.1 (S) 1.9 2.0 (R) K202 Korea 31.0 4.9 (S) 12.5 1.8 (S) 9.0 3.7 (S) 2.2 2.4 (R) T7174 Japan 26.5 3.4 (S) 15.1 2.0 (S) 10.7 3.4 (S) 1.1 0.9 (R) Zhe173 China 29.3 3.4 (S) 13.1 1.6 (S) 7.6 2.4 (MS) 1.8 1.3 (R) .sup.1Six-weeks-old plants were inoculated with Xoo. For each strain, at least 16 leaves from four individual plants were inoculated. Transgenic line L198 carries Xa10 subclone SA4686 whereas L162 carries P.sub.PR1:Xa10:T.sub.Nos gene. .sup.2The lesion length (L.L.) and the standard deviation of the mean were the average of 16 infected leaves. For score: R, resistant, 0 cm L.L. 3.0 cm; MR, moderately resistant, 3.0 cm < L.L. 6.0 cm; MS, moderately susceptible, 6.0 cm < L.L. 9.0 cm; S, susceptible, L.L. > 9.0 cm.

(76) The Xa10 gene encodes a small protein consisting of 126 amino acid residues (XA10; SEQ ID NO:37) (FIG. 1D). XA10 shows 50% identity (54/108) to rice hypothetical protein Os11g37620 (163 aa) and 34% identity (38/109) to another rice hypothetical protein Os11g37570 (134 aa). The two hypothetical proteins might be the paralogs of XA10 in rice genome. The genes encoding the two hypothetical proteins reside on the long arm of rice chromosome 10, but neither of them is allelic to the Xa10 locus. Four transmembrane helices were predicted in XA10 by servers of DAS (hap colon//www dot sbc dot su dot se/miklos/DAS/) or TMHMM (http colon//www dot cbs dot dtu dot dk/services/TMHMM/), which indicates that XA10 might be a transmembrane protein (FIG. 4). A cleavable signal peptide was also predicted at the N-terminal region of XA10 using SignalP 3.0 server (http colon//www dot cbs dot dtu dot dk/services/SignalP/) (FIG. 5).

Example 3

AvrXa10 Specifically Activates Xa10 Transcription

(77) Xa10 was specifically induced in the presence of AvrXa10 (SEQ ID NO:54). No Xa10 transcripts were detected in uninoculated IRBB10A plants or inoculated IRBB10A plants at 1.5 hour after inoculation (HAI) with PXO99(pHM1avrXa10) (FIGS. 6A and 6B). The Xa10 transcripts were slightly detected at 3 HAI, reached the maximum at 6-12 HAI and remained at high levels at 48 HAI (FIGS. 6A and 6B). Both the NLS motif and the AAD domain are essential for the function of TAL effectors. Indeed, either mutation of the three NLS motifs in AvrXa10 (mutant sequence is SEQ ID NO:56) or deletion of the AAD domain in AvrXa10 (mutant sequence is SEQ ID NO:55) abolished the induction of Xa10 in IRBB10A (FIG. 6C). The specific induction of Xa10 gene by AvrXa10 was also observed in transgenic line L198 that harbored the 4686-bp genomic clone of the Xa10 gene (FIG. 3B). The ectopic expression of the Xa10 coding region driven by rice PR1 promoter in line L162 was highly detected in un-inoculated plants (FIG. 3B). Although it was partially suppressed by bacterial blight inoculation with either Xa10-incompatible or Xa10-compatible strains, the Xa10 transcripts in the inoculated L162 plants were still comparable to that in L198 plants and provided broad-spectrum resistance to both PXO99(pHM1AvrXa10) and PXO99 (FIG. 3A; Table 4).

Example 4

AvrXa10 Depends on OsTFIIA5 for the Activation of Xa10 Transcription

(78) OsTFIIA5 is a general transcription factor in rice and its V39E substitution, encoded by the recessive resistance gene xa5 in rice, greatly attenuated the induction of the Xa27 gene in xa5 and Xa27 double homozygote upon inoculation with Xa27 incompatible strains (Gu et al., 2009). To check whether OsTFIIA5 is required for induction of the Xa10 gene by AvrXa10, we generated xa5 and Xa10 double homozygous plants from the cross between IRBB5 (xa5/xa5) and IRBB10A (Xa10Xa10). Bacterial blight inoculated with Xoo strain PXO99(pHM1avrXa10) indicated that the double homozygous plants showed partial resistant phenotype at 2 weeks after inoculation (WAI) (FIG. 7A). The average lesion length of the plants (Lesion length=3.11.6 cm) was longer than that of IRBB10A plants (Lesion length=0.80.4 cm) (FIG. 7A). The bacterial population in the double homozygous plants was 3- to 50-fold lower than that in the susceptible IRBB5 plants, whereas the bacterial population in the IRBB10A plants was 34- to 293-fold lower than that in susceptible IRBB5 plants (FIG. 7B). Compared to strong induction of the Xa10 gene in the inoculated IRBB10A plants, the gene was only weakly induced in the inoculated double homozygous plants (FIG. 7C). Quantitative real-time PCR analysis indicated that Xa10 transcripts in the inoculated double homozygous plants was only 17% of that in the inoculated IRBB10A plants (FIG. 7D). These results demonstrated that rice general transcription factor OsTFIIA5 is required for the activation of Xa10 transcription by AvrXa0. The identification of the suppression of xa5 on Xa10-mediated resistance to Xoo provides a guideline for breeding resistance to BB using xa5 and Xa10.

Example 5

Identification of AvrXa10 Binding Site in the Xa10 Promoter

(79) AvrXa10 target DNA sequence (AvrXa10 box) was identified by candidate approach. Based on the model for DNA-target specificity of TAL effectors, in which two hypervariable amino acid residues at positions 12 and 13 in each repeat of TAL effector recognize one base pair in the target DNA (Boch et al., 2009), twelve AvrXa10 box candidates were predicted in the 220-bp Xa10 promoter (FIG. 8). Overlapped boxes 1, 4, 7 and 10 were overlapped and duplicated one time in the 220-bp Xa10 promoter, whereas overlapped boxes 2, 5, 8 and 11 and boxes 3, 6, 9 and 12 formed other two box clusters, respectively (FIG. 8). Xa10 promoters and AvrXa10 box candidates were cloned in front of the minimal Bs4 promoter into an intron-containing GUS (GUSPlus) reporter vector (FIG. 9). Specific inducibility of the AvrXa10 box by AvrXa10 was investigated by transient expression of GUS reporter constructs codelivered via A. tumefaciens into N. benthamiana leaf cells with 35S-driven avrXa10 gene. Initial study indicated that a 220-bp Xa10 promoter (1 to 220) (SEQ ID NO:39) was AvrXa10-inducible and should harbor the AvrXa10 box (FIG. 10). Further studies demonstrated that Box 8 and Box 11 were AvrXa10-inducible (FIG. 10). Both candidates harbor the core sequence of the AvrXa10 box that comprises of 13 base pairs at positions 0 to 12 in Box 8 (FIG. 10). Box 8 was thereafter designated as the AvrXa10 box for the following studies.

Example 6

Specific Recognition of AvrXa10 Box by AvrXa10

(80) TAL effector AvrXa27 from Xoo strain PXO99 specifically activates expression of the Xa27 gene, another bacterial blight resistance gene in rice (Gu et al., 2005). The nucleotide sequence and the amino acid of the AvrXa27 gene are SEQ ID NO:79 (GenBank Accession No. AY986494) and SEQ ID NO:80 (GenBank Accession No. AAY54168), respectively. AvrXa27 could not activate the susceptible allele of the Xa27 gene (xa27), which shares identical product to that of Xa27 and only shows polymorphism at the promoter region (Gu et al., 2005). AvrXa27 target DNA (UPT.sub.AvrXa27 box or AvrXa27 box) was identified recently (Romer et al., 2009b). Since no susceptible allele of the Xa10 gene has been identified so far, we then compared the DNA-target specificity of AvrXa10 with that of AvrXa27. Transient expression assay in N. benthamiana leaf cells indicated that the AvrXa10 box was specifically recognized by AvrXa10 but not by AvrXa27, and vice versa (FIG. 11). The recognition of the AvrXa10 box by AvrXa10 or the AvrXa27 box by AvrXa27 also occurred in yeast as demonstrated by yeast one-hybrid assay (FIG. 12). The physical interaction between 6His::AvrXa10 (FIG. 13) and AvrXa10 box or 6His::AvrXa27 (FIG. 13) and AvrXa27 box was then tested via electromobility shift assay (EMSA) (FIG. 14). AvrXa10 binds with high affinity to AvrXa10 box probe but not to the AvrXa27 box probe (FIG. 14B). Importantly, binding of AvrXa10 to the AvrXa10 box probe could be readily out-competed by non-labeled AvrXa10 box probes, whereas even 1000-fold excess of nonlabeled AvrXa27 box probe could not out-compete the binding (FIG. 14C). Intricately, AvrXa27 binds to both AvrXa10 box probe and AvrXa27 box probe (FIG. 14B). The binding of AvrXa27 to AvrXa10 box probe or AvrXa27 box probe could be out-competed by 1000-fold excess of nonlabeled AvrXa27 box probe but not by the same amount of cold AvrXa10 box probe (FIG. 14D). These data demonstrate that AvrXa10 has a specific high affinity to the Xa10 promoter, whereas AvrXa27 binds with less specificity to DNA sequence, at least in EMSA. Further more, it might be an artifact for AvrXa27 to bind to AvrXa10 box probe in EMSA as AvrXa27 does not physically interact with AvrXa10 box in yeast demonstrated in yeast-one-hybrid assay (FIG. 12).

Example 7

Identification of Essential Nucleotides in AvrXa10 Box for AvrXa10 Binding and Transcription Activation

(81) To further investigate the contribution of each individual nucleotide of the AvrXa10 box to AvrXa10 binding, we made 17 AvrXa10 box deletion mutants with each having one nucleotide deletion (FIG. 15A). The first four nucleotides in the AvrXa10 box (positions 0 to 3) are essential for the binding of AvrXa10 to the AvrXa10 box or Xa10 promoter. Deletion at either one of the four nucleotides in the AvrXa10 box abolished AvrXa10 box activity and impaired or significantly affected the binding of AvrXa10 to the mutant probes in EMSA (FIGS. 15B and 15C). Deletion of either one of the nucleotides at positions 4 to 11 also abolished the AvrXa10 box activity but did not significantly affect the binding of AvrXa10 to the mutant probes in EMSA (FIGS. 15B and 15C). Previous deletion from the 3 of the AvrXa10 box indicated that nucleotide T at position 12 is required for AvrXa10 box activity (FIG. 10). Therefore, deletion of either one of the two nucleotides T at position 12 and 13 did not affect AvrXa10 box activity and the binding of AvrXa10 to the two mutant probes (FIGS. 15B and 15C). Finally, as anticipated, deletion of either one of the last three nucleotides in AvrXa10 box (positions 12 to 17) did not significantly affect AvrXa10 box activity of the mutants and the binding of AvrXa10 to the mutant probes (FIGS. 15B and 15C).

(82) The above deletion studies indicated that the core sequence of the AvrXa10 box comprises of 13 base pairs (TATATACACACGT; SEQ ID NO:81) at positions 0-12 (FIG. 15). Within the 13 base pairs, Box 7 and AvrXa10 box show polymorphism at positions 9-12 (FIG. 16A). Previous study also indicated that both A and G are functional at position 11 in predicted target DNA sequences for AvrXa10 (Boch et al., 2009; Dongsheng Tian and Zhongchao Yin, unpublished data). Therefore, nucleotides at positions 9-11 of AvrXa10 box (CAC) and Box 7 (TCA) may determine their specificities in activation of transcription. To confirm this hypothesis, we generated mutants for AvrXa10 box and Box 7 (FIG. 16A). Mutant Box 8M1 contained TCA at positions 9 to 11 in AvrXa10 box background, whereas mutant Box 7M harbored CAC at the same positions in Box 7 background (FIG. 16A). Transient expression assay for GUS activity in N. benthamiana leaf cells indicated Box 8M1 completely abolish AvrXa10 box activity, whereas Box 7M showed AvrXa10 box activity in induction of GUS reporter gene (FIG. 16B). Mutants with change of either one nucleotide of the TCA in Box 7 (Box 7M1, Box 7M2 and Box 7M3) to the corresponding nucleotide in the AvrXa10 box did not significantly increase their ability in induction of GUS reporter gene (FIG. 16B). However, mutants with change of either two nucleotides of the TCA in Box 7 (Box 7M4, Box 7M5 and Box 7M6) to the corresponding nucleotides in the AvrXa10 box partially increased their ability in induction of GUS reporter gene (FIG. 16B). Although neither Box 8M1 nor Box 7 has AvrXa10 box activity, EMSA demonstrated that AvrXa10 binds with similar high affinity to the probes of Box 8M1 and Box 7, as that to the probes of AvrXa10 box and Box 7M1 (FIG. 17). The physical interaction between AvrXa10 and AvrXa10 box, Box 8M1, Box 7, or Box 7M1 was also observed in yeast as demonstrated by yeast-one-hybrid assay (FIG. 18).

(83) These results indicated that AvrXa10 box may have two functional centers: the first four nucleotides (TATA) as AvrXa10 binding center and the three nucleotides at positions 9 to 11 (CAC) as the AvrXa10 transcription activation center. Both centers are essentially required for a functional AvrXa10 box. The binding of AvrXa10 to AvrXa10 box-like DNA elements without the transcription activation center is not sufficient to lead to activation of gene transcription. Other nucleotides in AvrXa10 box may provide a scaffold with minor contribution to AvrXa10 binding and/or activation of transcription.

(84) The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10-15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

(85) It will be appreciated that the methods and compositions of the instant invention can be incorporated in the form of a variety of embodiments, only a few of which are disclosed herein. Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

BIBLIOGRAPHY

(86) Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A, Bonas U. (2009). Breaking the code of DNA binding specificity of TAL-type III effectors. Science. 326:1509-1512.

(87) Christensen, A. H. and Quail, P. H, (1989). Sequence analysis and transcriptional regulation by heat shock of polyubiquitin transcripts from maize. Plant Mol Biol 12:619-632.

(88) Christensen, A. H. et al. (1992). Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18:675-689.

(89) Chu Z H, Yuan M, Yao J L, Ge X J, Yuan B, Xu C G, Li X H, Fu B Y, Li Z K, Bennetzen J L, Zhang Q F, Wang S P (2006). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev 20:1-5.

(90) Gu K, Tian D, Yang F, Wu L, Sreekala C, Wang D, Wang G L, Yin Z (2004). High-resolution genetic mapping of Xa27(t), a new bacterial blight resistance gene in rice, Oryza sativa L. Theor Appl Genet 108:800-807.

(91) Gu K, Yang B, Tian D, Wu L, Wang D, Sreekala C, Yang F, Chu Z, Wang G L, White F F, Yin Z (2005). R gene expression induced by a type-III effector triggers disease resistance in rice. Nature 435:1122-1125.

(92) Gu K, Singh J S, Li Y, Yin Z (2008). High-resolution genetic mapping of bacterial blight resistance gene Xa10. Theor Appl Genet 116: 155-163.

(93) Gu K, Tian D, Qiu C, Yin Z (2009). Transcription activator-like type III effector AvrXa27 depends on OsTFIIAgamma5 for the activation of Xa27 transcription in rice that triggers disease resistance to Xanthomonas oryzae pv. oryzae. Mol Plant Pathol. 10:829-835.

(94) He S Y, Nomura K, Whittam T S (2004). Type III protein secretion mechanism in mammalian and plant pathogens. Biochem. Biophys. Acta. 1694, 181-206.

(95) Heuer H, Yin Y-N, Xue Q-Y, Smalla K, Guo J-H (2007). Repeat domain diversity of avrBs3/pthA-like genes in Ralstonia solanacearum strains and association with host preferences in the field. Appl Environ Microbiol 73:4379-4384.

(96) Hopkins C M, White F F, Choi S H, Guo A and Leach J E (1992). Identification of a family of avirulence genes from Xanthomonas oryzae pv. oryzae. Mol Plant-Microbe Inter 5: 451-459.

(97) Iyer A S, McCouch S R (2004). The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol Plant-Microbe Inter 17:1348-1354.

(98) Kauffman H E, Reddy A P K, Hsieh S P Y, Merca S D (1973). An improved technique for evaluating resistance to rice varieties of Xanthomonas oryzae. Plant Dis Rep 57:537-541.

(99) Kay S, Hahn S, Marois E, Hause G, Bonas U. (2007). A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science. 318:648-651.

(100) Kay S, Hann S, Marois E, Wieduwild R, Bonas U (2009). Detailed analysis of the DNA recognition motifs of the Xanthomonas type III effectors AvrBs3 and AvrBs3Deltarep16. Plant J. 59:859-871.

(101) Last, D. I. et al. (1991). pEmu: an improved promoter for gene expression in cereal cells. Theor Appl Genet 81:581-588.

(102) McElroy, D. et al. (1990). Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2:163-171.

(103) Mew T W (1987). Current status and future prospects of research on bacterial blight of rice. Annu Rev Phytopathol 25: 359-382.

(104) Mew T W, Vera Cruz C M and Reyes R C (1982). Interaction of Xanthomonas campestris pv. oryzae and a resistant rice cultivar. Phytopathology 72:786-789.

(105) Miki D and Shimamoto K (2004). Simple RNAi Vectors for Stable and Transient Suppression of Gene Function in Rice. Plant and Cell Physiology. 45:490-495.

(106) Nino-Liu D O, Ronald P C and Bogdanove A J (2006). Xanthomonas oryzae pathovars: model pathogens of a model crop. Mol. Plant Pathol. 7:303-324.

(107) Odell, J. T. et al. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313:810-812.

(108) Ogawa T, Yamamoto T, Khush G S, Mew T W, Kaku H (1988). Near-isogenic lines as international differentials for resistance to bacterial blight of rice. Rice Genet Newsl 5:106-107.

(109) Romer P, Hahn S, Jordan T, Strauss T, Bonas U, Lahaye T (2007). Plant pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science. 318: 645-648.

(110) Romer P, Strauss T, Hahn S, Scholze H, Morbitzer R, Grau J, Bonas U, Lahaye T (2009a). Recognition of AvrBs3-like proteins is mediated by specific binding to promoters of matching pepper Bs3 alleles. Plant Physiol. 150:1697-1712.

(111) Romer P, Recht S, Lahaye T (2009b). A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens. Proc Natl Acad Sci USA. 106:20526-20531.

(112) Sambrook, J, Fritsch E F, Maniatis T (1989). Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

(113) Schornack S, Meyer A, Romer P, Jordan T, Lahaye T (2006). Gene-for-gene mediated recognition of nuclear-targeted AvrBs3-like bacterial effector proteins. J Plant Physiol 163:256-272.

(114) Song W Y, Wang G L, Chen L L, Kim H S, Pi L Y, Holsten T, Gardner J, Wang B, Zhai W X, Zhu L H, Fauquet C, Ronald P (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270:1804-1806.

(115) Strong S J, Ohta Y, Litman G W, Amemiya C T (1997). Marked improvement of PAC and BAC cloning is achieved using electroelution of pulse-field gel-separated partial digests of genomic DNA. Nucleic acids Res 25: 3959-3961.

(116) Sugio A, Yang B, Zhu T, White FF (2007). Two type III effector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFIIAgamma1 and OsTFX1 during bacterial blight of rice. Proc Natl Acad Sci USA 104(25):10720-10725.

(117) Sun X L, Cao Y L, Yang Z F, Xu C G, Li X H, Wang S P, Zhang Q F (2004). Xa26, a gene conferring resistance to Xanthomonas oryzae pv. Oryzae in rice, encoding an LRR receptor kinase-like protein. Plant J 37:517-527.

(118) Velten, J. et al. (1984). Isolation of a dual plant promoter fragment from the Ti plasmid of Agrobacterium tumefaciens. EMBO J 3:2723-2730.

(119) Wu L, Goh M L, Sreekala C, Yin Z. (2008). XA27 depends on an amino-terminal signal-anchor-like sequence to localize to the apoplast for resistance to Xanthomonas oryzae pv oryzae. Plant Physiol. 148:1497-1509.

(120) Yang B, Sugio A, White F F (2006). Os8N3 is a host disease-susceptibility gene for bacterial blight of rice. Proc Natl Acad Sci USA. 103:10503-10508.

(121) Yin Z, Wang G L (2000). Evidence of multiple complex patterns of T-DNA integration into the rice genome. Theor Appl Genet 100, 461-470.

(122) Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang Z X, Kono I, Kurata N, Yano M, Iwata N, Sasaki T (1998). Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci USA 95:1663-1668.

(123) Yoshimura A, Mew T W, Khush G S, Moura T (1983). Inheritance of resistance to bacterial blight in rice cultivar Cas 209. Phytopathology 73:1409-1412.

(124) Yoshimura 5, Yoshimura A, Iwata N, McCouch S R, Abenes M L, Baraoidan M R, Mew T W, Nelson R J (1995). Tagging and combining bacterial blight resistance genes in rice using RAPD and RFLP markers. Molecular Breeding 1:375-387.