Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Abstract

Provided in the embodiments of the present invention is a vaccine composition including an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain. The vaccine composition can effectively induce antibody generation, and prevent infections of virulent strains of the porcine pseudorabies virus, and provides effective protection for pigs.

Claims

1. A vaccine composition, comprising an immunogenic amount of inactivated vaccine of a porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO: 4, gB glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO: 5, wherein said pseudorabies virus strain is the HN1201 strain or culture thereof, of which the accession number is China Center for Type Culture Collection (CCTCC) NO. V 201311; said vaccine composition further comprising medium, adjuvants and excipient.

2. The vaccine composition as described in claim 1, wherein said vaccine composition comprises an inactivated vaccine of the PRV HN1201 strain of culture thereof, of which the concentration is not less than 10.sup.6.0TCID.sub.50/mL.

3. The vaccine composition as described in claim 1, wherein said vaccine composition comprises between 25 and 100 g/dose gD protein antigen of the PRV HN1201 strain or culture thereof.

Description

BRIEF DESCRIPTION OR THE DRAWINGS

(1) FIG. 1. Result of homology analysis between amino acid sequences of gC in HN1201 strain and SA215 strain.

(2) FIG. 2. Result of homology analysis between amino acid sequences of gD in HN1201 strain and SA215 strain.

SEQUENCE LISTING

(3) SEQ ID NO. 1 is the amino acid sequence of gD in the PRV HN1201 strain.

(4) SEQ ID NO. 2 is the amino acid sequence of gB in the PRV HN1201 strain.

(5) SEQ ID NO. 3 is the amino acid sequence of gC in the PRV HN1201 s train.

(6) SEQ ID NO. 4 is the nucleotide sequence of gD in the PRV HN1201 strain.

(7) SEQ ID NO. 5 is the nucleotide sequence of gB in the PRV HN1201 strain.

(8) SEQ ID NO.6 is the nucleotide sequence of gC in the PRV HN1201 strain.

(9) SEQ ID NO. 7 is the amino acid sequence of gC in the PRV SA215 strain.

(10) SEQ ID NO. 8 is the amino acid sequence of gD in the PRV SA215 strain.

(11) SEQ ID NO. 9 is the nucleotide sequence of an upstream primer for amplifying gB gene.

(12) SEQ ID NO. 10 is the nucleotide sequence of a downstream primer for amplifying gB gene.

(13) SEQ ID NO. 11 is the nucleotide sequence of an upstream primer for amplifying gC gene.

(14) SEQ ID NO.12 is the nucleotide sequence of a downstream primer for amplifying gC gene.

(15) SEQ ID NO.13 is the nucleotide sequence of an upstream primer for amplifying gD gene.

(16) SEQ ID NO.14 is the nucleotide sequence of a downstream primer for amplifying gD gene.

(17) SEQ ID NO.15 is the nucleotide sequence of an upstream PRV gD-specific primer.

(18) SEQ ID NO.16 is the nucleotide sequence of a downstream PRV gD-specific primer.

DETAILED DESCRIPTION

(19) The description of the present invention is further provided as follows with reference to the specific embodiments, and features and advantages of the present invention will become more apparent from the following description. However, these embodiments are only exemplary, but not forming any limitation to the scope of the present invention. It should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed, while those modification and alternatives should all fall within the scope of the present invention.

(20) In the invention, the term per pig refers to the amount of vaccine each pig injected.

(21) In the invention, the term TCID.sub.50 refers to 50% tissue culture infective dose, a way to represent viral infectivity.

(22) Minimum Essential Medium (MEM) liquid medium is prepared with MEM dry powdered medium purchased from Life Technologies, Corp. according to the instruction.

(23) Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.

(24) In the present invention, the term PBS is the abbreviation for Phosphate Buffer Saline, and 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3rd edition.

Example 1

Collection and Isolation of Viruses

(25) Porcine brain tissue was collected under aseptic conditions from samples isolated from samples from Henan province suspected of having pseudorabies infection, added in MEM liquid medium in a ratio of 1:10(V:V), and ground to prepare a tissue suspension. After 3 times of repeated freezing-thawing, the tissue suspension was centrifuged at 2000 r/min for 15 minutes. The supernatant was then collected, filtered through a 0.2 m pore filter, subcultured on PK-15 cells and incubated at 37 C. for 1 h, and then the medium was changed by adding MEM liquid medium supplemented with 2% fetal bovine serum, and incubated at 37 C. for 5 days. PRV was detected by PRV PCR detection kit (Beijing Anheal Laboratories Co., Ltd), and the result was positive; PCR kit was employed to detect the exotic virus contamination (porcine reproductive and respiratory syndrome virus RT-PCR detection kit kit, porcine parvovirus PCR detection kit and classical swine fever virus RT-PCR detection kit, all purchased from Beijing Anheal Laboratories Co., Ltd) for the isolated virus and the PCR detection result was negative, indicating a pure viral specie.

(26) The isolated PRV strain was deposited in the China Type Culture Collection on May 20, 2013 named HN1201 strain (Pseudorabies virus, strain HN1201) of which the accession number is CCTCC NO. V 201311 and the preservation address is Wuhan University, Wuhan City, Hubei Province.

Example 2

Genetic Characteristics of the Isolated Virus

(27) Genetic characteristics of the isolated virus in Example 1 were determined by means of gene analysis. Genomic DNA prepared from the pseudorabies virus isolated from PK-15 cells was used as template with primers shown in Table 1 for PCR amplification reactions. The Primer Primer 5.0 was used for designing the primer sequence for amplifying gB, gC and gD gene, respectively.

(28) The genomic DNA extracted was used as template to prepare the following PCR amplification system: 100 g template DNA, 0.5 L, PrimerSTAR HS DNA Polymerase (2.5 U/L), 250 L 2 PrimerSTAR GC Buffer, 1 L, of each upstream and downstream primer (10 pmol/L), 4 L dNTP Mix (2.5 mM each), adjusted to a final volume of 50 L, with distilled water. Two-step PCR reaction was carried out by an initial denaturation for 10 sec at 98 C. followed by annealing and extension at 68 C. (all the time is calculated by 1 kb/min) and there were 30 cycles in total. The PCR reactions were finalized at 4 C. The analysis of the amplification products was conducted by electrophoresis on 1% agarose gel containing ethidium bromide. The sequences of PCR products were determined. The sequence data was analyzed by Lasergene.

(29) TABLE-US-00001 TABLE1 PCRprimersequences Target Sizeof gene Primersequence(5.fwdarw.3) PCRproduct gB aagcgcatctttattgtttcccg 2957bp ggcttctaccgcttccagacgg gC accgtcgccatgtgcgccacta 1603bp cgggtcggactcgctgtcgtttatt gD ttcccatacactcacctgccagc 1250bp tcgacgccggtactgcggag

Example 3

Pathogenicity Test of the Virus

(30) 3.1 Pathogenicity of the Virus in Piglets at Different Days of Age

(31) 6 piglets at 3435 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, one with 4 piglets (experimental group) and the other with 2 piglets (control group), wherein the experimental group was inoculated with PRV HN1201 strain by intranasal instillation (challenge dosage is 210.sup.8.0TCID.sub.50/piglet) and the control group was inoculated with DMEM medium. Meanwhile 4 piglets at 49 days of age were inoculated with third passage of the virulent HN1201 strain after preservation (challenge dose was 210.sup.8.0TCID.sub.50/piglet), and the control is still piglets at 35 days of age. After inoculation of virus, the temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 2.

(32) TABLE-US-00002 TABLE 2 Pathogenicity of PRV HN1201 strain in piglets at different days of age Num- Inoculation Group ber Days Dose Clinical signs Death status 1 A1 35 2 10.sup.8.0TCID.sub.50/ Body Temper- Died on day piglet ature increased, 4 after viral depression, challenge A2 loss of appetite, Died on day onset of respi- 5 after viral ratory and/or challenge A3 neurological Died on day signs 5 after viral challenge A4 Died on day 6 after viral challenge 2 B1 49 2 10.sup.8.0TCID.sub.50/ Body Temper- Died on day piglet ature increased, 7 after viral depression, challenge B2 loss of appetite, Died on day onset of respi- 7 after viral ratory and/or challenge B3 neurological Died on day signs 5 after viral challenge B4 Survived 3 C1 35 DMEM control Normal Survived C2 Survived

(33) It showed in the results that inoculation with PRV HN1201 strain in piglets at different days of age could lead to onset of pseudorabies in piglets, as well as death of over of inoculated piglets.

(34) 3.2 Pathogenicity of the Virus at Different Doses in Piglets

(35) 8 piglets at 49 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, each with 4 piglets, in addition two more piglets were used as control. The experimental groups were inoculated with 210.sup.7.0TCID.sub.50/piglet PRV HN1201 strain or 210.sup.8.0TCID.sub.50/piglet PRV HN1201 strain by intranasal instillation, respectively, and the control group was inoculated with DMEM medium. After inoculation of virus, the body temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 3.

(36) TABLE-US-00003 TABLE 3 Pathogenicity of different doses of PRV HN1201 strain in piglets Group Number Inoculation Dose Clinical signs Death status 1 A1 2 Significant Died on day 5 10.sup.7.0TCID.sub.50/piglet clinical signs: after viral temperature challenge A2 increased, Died on day 6 depression, after viral loss of challenge A3 appetite Died on day 6 after viral challenge A4 Died on day 6 after viral challenge 2 B1 2 Significant Died on day 2 10.sup.8.0TCID.sub.50/piglet clinical signs: after viral temperature challenge B2 increased, Died on day 3 depression, after viral loss of challenge B3 appetite Died on day 4 after viral challenge B4 Died on day 4 after viral challenge 3 C1 DMEM control Normal Survived C2 Survived

(37) It showed in the results that inoculation with different doses of clinically isolated PRV HN1201 strain in piglets at 49 days of age could all lead to onset of pseudorabies in piglets, of which 4/4 died.

Example 4

Preparation of the Inactivated PRV Vaccine

(38) The culture of different passages of the isolated strain was inoculated, according to Table 4, onto PK-15 cell culture to form a seed lot which was then inoculated into a monolayer of PK cell culture at 1% (V/V) of the amount of the liquid virus medium, and placed in a rotary incubator at 37 C. The cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing and the virus titer was assessed. 10% (V/V) formaldehyde solution was added to different passages of virus solution respectively, with a final concentration of 0.2% (V/V). The virus solution was inactivated at 37 C. for 18 hours, being stirred for 10 min every 4 hours, and diluted with pH 7.4 phosphate-buffered saline (PBS) to the content of viruses as shown in Table 4, mixed with 206 adjuvant (SEPPIC, France) according to the volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30 C.

(39) TABLE-US-00004 TABLE 4 Preparation of each group of pseudorabies vaccines Ratio of vaccines (inactivated virus Passage number of Content of virus solution:206 Group HN1201 culture before inactivation adjuvant) A 5 10.sup.8.43TCID.sub.50/mL 54:46 B 35 .sup.10.sup.6.0TCID.sub.50/mL 54:46

Example 5

Immunogenicity Assay of Inactivated Vaccines

(40) 16 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 4 groups, each with 4 piglets, and injected with vaccines according to Table 5. Two groups injected with inactivated vaccines were injected with 2 ml/piglet of the inactivated vaccines against pseudorabies prepared in Example 4. As a control vaccine, the live vaccine SA215 strain prepared by using the method in CN101186902 was applied according to the method for determining immunogenicity in the specification of the patent. The control group was inoculated with 2 mL/piglet of DMEM medium.

(41) TABLE-US-00005 TABLE 5 Grouping of immunogenicity assay Group Vaccines injected Dose Group A injected with Group A vaccine 2 mL/piglet inactivated vaccine prepared in Example 4 Group B injected with Group B vaccine 2 mL/piglet inactivated vaccine prepared in Example 4 Group injected with Live Live PRV vaccine 10.sup.6.0TCID.sub.50/piglet vaccine SA215 Control group DMEM medium 2 mL/piglet

(42) After immunization with vaccines, neutralizing titers of antibodies of the inactivated vaccines groups were determined weekly according to the method of serum neutralization test from GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease. The results are shown in Table 6.

(43) TABLE-US-00006 TABLE 6 Nneutralizing titers of antibodies at different time in piglets after immunization with PRV inactivated vaccines Average value of neutralizing titers of antibodies at different time (weeks) Group 1 2 3 4 Group A injected 1:4.8 1:11.2 1:16.0 1:37.7 with inactivated vaccine Group B injected 1:4.0 1:6.3 1:13.5 1:22.4 with inactivated vaccine Group injected 1:3.7 1:4.0 1:10.0 1:16.0 with live vaccine Control group Negative Negative Negative Negative

(44) The result from Table 6 indicated that immunization with inactivated PRV vaccines in piglets can produce high neutralizing titers which increase with immunization time.

(45) The piglets were challenged with 210.sup.8.0TCID.sub.50/piglet of PRV HN1201 strain on day 28 after immunization, clinical signs and death status were observed as shown in Table 7. After challenge the body temperature of piglets was determined daily as shown in Table 8.

(46) TABLE-US-00007 TABLE 7 Viral challenge for piglets after immunization with PRV inactivated vaccines Rate of Group clinical signs and death status protection Group A injected with Body temperature increased 100% (4/4) inactivated vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group B injected with Body temperature increased 100% (4/4) inactivated vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group injected with live Body temperature increased 100% (4/4) vaccine for 7-10 days, loss of appetite, significant neurological signs, survived Control group Significant signs, two piglets 0% (0/4) died on day 2 after challenge, and all died within 3 days after challenge.

(47) TABLE-US-00008 TABLE 8 Body temperature change after challenge for piglets immunized with PRV vaccines Group A Group B Group injected with injected with injected inactivated inactivated with live Day vaccine vaccine vaccine day 1 after challenge 39.5 39.6 39.4 day 2 after challenge 41.2 41.6 41.8 day 3 after challenge 40.5 40.3 41.2 day 4 after challenge 40.2 39.7 41.6 day 5 after challenge 39.7 39.5 41.4 day 6 after challenge 39.6 39.4 41.3 day 7 after challenge 39.7 39.5 41.4 day 8 after challenge 39.5 39.7 41.2 day 9 after challenge 39.6 39.4 41.5 day 10 after challenge 39.2 39.5 40.6 day 11 after challenge 39.5 39.7 39.7 day 12 after challenge 39.4 39.5 39.8 day 13 after challenge 39.3 39.4 39.7 day 14 after challenge 39.2 39.1 39.4

(48) The results from Table 7 and 8 indicated that immunization of piglets with inactivated PRV vaccines could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all piglets in the control group died on day 4 after challenge, therefore the inactivated PRV vaccines can provide excellent protection. In addition, compared with the live vaccine as the control vaccine, it took less time for the body temperature of piglets immunized with the inactivated vaccines to increase, and also they kept a basically normal appetite with no clinical signs, indicating excellent immune protection.

Example 6

Preparation of the PRV gD Protein

(49) 1. Amplification of the PRV gD Gene

(50) The PK-15 cells which were in excellent health were inoculated with the PRV HN1201 strain or culture thereof of different passages (the PRV strain was HN1201 strain (Pseudorabies virus, strain HN1201), of which the accession number was CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address was Wuhan University, Wuhan City, Hubei Province), the culture of different passages was the culture within 535 passages. The PRV genomic DNA was extracted by using MiniBEST Viral RNA/DNA Extraction Kit Ver.3.0 (TAKARA) after harvesting viruses. PCR amplification was performed by using 1 L genomic DNA as template and gD-specific primers:

(51) TABLE-US-00009 gDSF:5 ATGCTGCTCGCAGCGCTATTGGC3 and gDSR:5 CTACGGACCGGGCTGCGCTTTTAG3.

(52) The high fidelity polymerase, Prime STAR HS DNA Polymerase with GC Buffer (TAKARA) was used in the PCR reaction. The amplification conditions were: 94 C. 3 min; 94 C. 30 s, 68 C. 90 s, 30 cycles; 72 C. 5 min. The PCR product was named gD, of which the nucleotide sequence is shown in SEQ No.4, and the amino acid sequence can be derived as shown in SEQ No.1.

(53) 2. Acquisition and Identification of Recombinant Bacmid

(54) The PCR product, gD obtained from amplification with the high fidelity polymerase was cloned into the pFastBac/HBM-TOPO vector (Invitrogen, A11339). The cloning system was as follows: 4 L PCR product, gD, 1 L salt solution, 1 L TOPO vector; 6 L in total. The mixture was mixed thoroughly and incubated at room temperature for 5 minutes, and then used to transform One Shot Mach1 T1R competent cells. The transformation mix was spread onto plates containing ampicillin. A single colony was picked to identify insert directionality of gD gene, and the plasmid with the correct insert directionality was delivered to Invitrogen for sequencing, in order to verify the correct sequence. The plasmid with the correct sequence was named pFastBac/HBM-TOPO-gD.

(55) After the pFastBac/HBM-TOPO-gD plasmid was transformed into DH10Bac competent cells, transposition occurred between the pFastBac/HBM-TOPO-gD plasmid and the shuttle plasmid Bacmid in the competent cells, and the resulting recombinant plasmid was extracted by using PureLink HiPure Plasmid DNA Miniprep Kit (Invitrogen), and the insertion of gD was identified with pUCM13 Forward/pUCM13 Reverse primer. The positive Bacmid was named Bacmid-gD.

(56) 3. Transfection for Obtaining Recombinant Baculovirus

(57) This step was carried out based on the method provided by the instruction of Bac-to-Bac HBM TOPO Secreted Expression System (Invitrogen). 810.sup.5 sf9 cells were layered in each well of a 6-well plate, transfection was performed according to the instruction of Cellfectin II transfection agent after adherence of the cells: 8 L Cellfectin II and 1 g Bacmid-gD DNA were diluted respectively with 100 L SF-900 II medium and mixed by vortex. The diluted DNA was combined with the diluted Cellfectin II (total volume 210 L), mixed thoroughly and incubated for 15-30 minutes at room temperature. The transfection mixture was then added dropwise onto the cells. The supernatant of cell culture, marked as P0 recombinant baculovirus vBac-gD, was collected 72 h after transfection or until the cytopathic effect was visible. The P0 recombinant baculovirus vBac-gD infected sf9 cells, and after three rounds of amplification the resulting P3 recombinant baculovirus vBac-gD was used for expressing the recombinant protein.

(58) 4. Infection of High-Five Cells with the Recombinant Baculovirus for Expression of the Recombinant Protein

(59) The P3 recombinant baculovirus vBac-gD was inoculated in High-five cells (Invitrogen, B85502). Suspension culture of High-five cells was performed in a 500 mL Erlenmeyer flask and the cells were inoculated with the virus with an MOI of 1 when the cell density reached to 7.010.sup.5 cell/mL. The supernatant of cell culture was collected 72 h after infection. A Tangential Flow Filtration System (Millipore) was employed to concentrate the volume into 1/10 of the original one. 1% (V %) of Triton X-100 (Sigma) was used to inactivate the baculovirus, and the content of protein determined by SD S-PAGE optical density method was 200 g/mL.

Example 7

Preparation of the PRV Subunit Vaccines

(60) The subunit antigens prepared in Example 6 were diluted with PBS (pH=7.4) to the contents of protein in Table 9, mixed with 206 adjuvant (SEPPIC, France) at a volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30 C.

(61) TABLE-US-00010 TABLE 9 Preparation of each group of the pseudorabies subunit vaccines Ratio of vaccines (inactivated virus Group Content of protein solution:206 adjuvant) A 25 g/mL 54:46 B 100 g/mL 54:46

Example 8

Immunogenicity Assay of the Vaccines in Pigs

(62) 12 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 3 groups, each with 4 piglets, and injected with 2 ml/piglet of the subunit vaccines against PRV prepared in Example 7 according to Table 10. The control group was inoculated with 2 mL/piglet of DMEM medium.

(63) TABLE-US-00011 TABLE 10 Grouping of immunogenicity assay Group Vaccines injected Dose Group A injected with Group A vaccine prepared 2 mL/piglet subunit vaccine in Example 7 Group B injected with Group B vaccine prepared 2 mL/piglet subunit vaccine in Example 7 Control group DMEM medium 2 mL/piglet

(64) The piglets were challenged with 210.sup.8.0TCID.sub.50/piglet of PRV HN1201 strain on day 28 after immunization, and clinical signs and death status were observed as shown in Table 11. After challenge the body temperature of piglets was determined daily as shown in Table 12.

(65) TABLE-US-00012 TABLE 11 Viral challenge for piglets after immunization with the PRV subunit vaccines Rate of Group Clinical signs and death status protection Group A injected with Body temperature increased 100% (4/4) subunit vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group B injected with Body temperature increased 100% (4/4) subunit vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Control group Significant signs, two died on 0% (0/4) day 2 after challenge, and all died within 3 days after challenge.

(66) TABLE-US-00013 TABLE 12 Body temperature change of piglets immunized with the PRV subunit vaccines after challenge Group A injected with Group B injected with Day subunit vaccine subunit vaccine day 1 after challenge 39.5 39.5 day 2 after challenge 41.2 41.6 day 3 after challenge 40.3 40.2 day 4 after challenge 40.1 39.7 day 5 after challenge 39.6 39.5 day 6 after challenge 39.6 39.3 day 7 after challenge 39.6 39.5 day 8 after challenge 39.5 39.4 day 9 after challenge 39.5 39.6 day 10 after challenge 39.2 39.3 day 11 after challenge 39.3 39.4 day 12 after challenge 39.4 39.4 day 13 after challenge 39.2 39.4 day 14 after challenge 39.2 39.1

(67) The results from Table 11 and 12 indicated that immunization with the PRV subunit vaccines for piglets could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all the control piglets died on day 4 after challenge, therefore the PRV subunit vaccines can provide excellent protection.

(68) Those are only preferred embodiments of the present invention as described above, which cannot be used to limit the present invention. Any change, substitution or modification etc., which are within the spirit and principle of the invention, should be included within the scope of protection of the present invention.