Compositions and methods for detecting and treating diabetes

11471462 · 2022-10-18

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention features compositions and methods that are useful for increasing the level or activity of SLC16A11 in a subject, there by treating or preventing type 2 diabetes in the subject.

Claims

1. A method for increasing the expression of a SLC16A11 polypeptide or a polynucleotide encoding said polypeptide in a cell of a subject selected as a carrier of a SLC16A11 risk haplotype, the method comprising: contacting a cell of a subject who is selected as a carrier of a SLC16A11 risk haplotype with a small molecule chemical compound that inhibits mechanistic target of rapamycin (mTOR), or a small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase; wherein the small molecule mTOR inhibitor is selected from the group consisting of [5-[2-(2,6-dimethylmorpholin-4-yl)-4-morpholin-4-ylpyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (KU-0063794), [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (AZD-8055), 2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-ylimidazo[4,5-c]quinolin-1-yl)phenyl]propanenitrile (NVP-BEZ235), 3-(6-morpholin-4-yl-8-oxa-3,5,10-triazatricyclo[7.4.0.0.sup.2,7]trideca-1(9),2(7)3,5,10,12-hexaen-4-yl)phenol (PI-103), methyl 4-[6-[4-(methoxycarbonylamino)phenyl]-4-morpholin-4-ylpyrazolo[3,4-d]pyrimidin-1-yl]piperidine-1-carboxylate (WYE-354), trans-4-[4-amino-5-(7-methoxy-1H-indol-2-yl)imidazo[5,1-f][1,2,4]triazin-7-yl]-cyclohexanecarboxylic acid (OSI-027), and deforolimus; and the small molecule checkpoint 1 or 2 kinase inhibitor is selected from the group consisting of 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762), 4-[(3S)-1-azabicyclo[2.2.2]oct-3-ylamino]-3-(1H-benzimidazol-2-yl)-6-chloro-2(1H)-quinolinone (CHIR-124), N-[5-Bromo-4-methyl-2-[(2S)-2-morpholinylmethoxy)phenyl]-N′-(5-methyl-2-pyrazinyl)urea (LY2603618), 6-bromo-3-(1-methyl-1H-pyrazol-4-yl)5-(3R)-3-piperidinyl-pyrazolo[1,5-a]pyrimidin-7-amine (MK-8776/SCH 900776), or (R)-α-Amino-N-[5,6-dihydro-2-(1-methyl-1H-pyrazol-4-yl]-6-oxo-1H-pyrrolo[4,3,2-ef[2,3]benzodiazepin-8-yl]-cyclohexaneacetamide (PF-477736): wherein the small molecule chemical compound increases SLC16A11 transcript levels by at least about 2-fold or 3-fold in the contacted cell; and wherein the SLC16A11 risk haplotype comprises a SLC16A11 polynucleotide variant encoding a polypeptide comprising an amino acid alteration selected from the group consisting of V113I, D127G, L187L, G340S, P443T, and a combination thereof, thereby increasing the expression of the SLC16A11 polypeptide or the polynucleotide encoding said polypeptide in the subject's cell.

2. A method for increasing the expression of a SLC16A11 polypeptide or a polynucleotide encoding said polypeptide, the method comprising: contacting an adipocyte or hepatocyte of a subject who is selected as a carrier of a SLC16A11 risk haplotype with an agent selected from the group consisting of [5-[2-(2,6-dimethylmorpholin-4-yl)-4-morpholin-4-ylpyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (KU-0063794), [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (AZD-8055), 2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-ylimidazo[4,5-c]quinolin-1-yl)phenyl]propanenitrile (NVP-BEZ235), 3-(6-morpholin-4-yl-8-oxa-3,5,10-triazatricyclo[7.4.0.0.sup.2,7]trideca-1(9),2(7),3,5,10,12-hexaen-4-yl)phenol (PI-103), methyl 4-[6-[4-(methoxycarbonylamino)phenyl]-4-morpholin-4-ylpyrazolo[3,4-d]pyrimidin-1-yl]piperidine-1-carboxylate (WYE-354), trans-4-[4-amino-5-(7-methoxy-1H-indol-2-yl)imidazo[5,1-f][1,2,4]triazin-7-yl]-cyclohexanecarboxylic acid (OSI-027), and deforolimus; wherein the agent increases SLC16A11 transcript levels by at least about 2-fold or 3-fold in the contacted cell; and wherein the SLC16A11 risk haplotype comprises a SLC16A11 polynucleotide variant encoding a polypeptide comprising an amino acid alteration selected from the group consisting of V113I, D127G, L187L, G340S, P443T, and a combination thereof, thereby increasing the expression of the SLC16A11 polypeptide or the polynucleotide encoding said polypeptide in the subject's cell.

3. The method of claim 1, wherein the small molecule chemical compound that inhibits mTOR is KU-0063794 or AZD-8055.

4. The method of claim 2, wherein the method inhibits mTOR in a cell.

5. The method of claim 1, wherein the cell is a hepatocyte, adipocyte, thyroid cell, or salivary gland cell.

6. The method of claim 1, wherein the cell is in vitro or in vivo.

7. The method of claim 6, wherein the cell is present in a diabetic subject.

8. The method of claim 7, wherein the small molecule chemical compound inhibits mTOR in the diabetic subject.

9. The method of claim 7, wherein the method treats or prevents type 2 diabetes in the subject.

10. The method of claim 1, wherein the small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase is 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762).

11. The method of claim 1, wherein the small molecule chemical compound increases SLC16A11 transcript levels by at least about 4-fold or 5-fold in the contacted cell.

12. The method of claim 1, wherein the subject is identified as having a SCL16A11 protein comprising V113I, D127G, L187L, G340S, and P443T amino acid alterations.

13. A method for increasing the expression of a SLC16A11 polypeptide or a polynucleotide encoding said polypeptide in a cell having a SLC16A11 risk haplotype, the method comprising: identifying a cell as having a SLC16A11 risk haplotype; and contacting the cell identified as having a SLC16A11 risk haplotype with a small molecule chemical compound that inhibits mechanistic target of rapamycin (mTOR); or a small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase; wherein the small molecule chemical compound mTOR inhibitor is selected from the group consisting of [5-[2-(2,6-dimethylmorpholin-4-yl)-4-morpholin-4-ylpyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (KU-0063794), [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol (AZD-8055), 2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-ylimidazo[4,5-c]quinolin-1-yl)phenyl]propanenitrile (NVP-BEZ235), 3-(6-morpholin-4-yl-8-oxa-3,5,10-triazatricyclo[7.4.0.0.sup.2,7]trideca-1(9),2(7)3,5,10,12-hexaen-4-yl)phenol (PI-103), methyl 4-[6-[4-(methoxycarbonylamino)phenyl]-4-morpholin-4-ylpyrazolo[3,4-d]pyrimidin-1-yl]piperidine-1-carboxylate (WYE-354), trans-4-[4-amino-5-(7-methoxy-1H-indol-2-yl)imidazo[5,1-f][1,2,4]triazin-7-yl]-cyclohexanecarboxylic acid (OSI-027), and deforolimus; and the small molecule checkpoint 1 or 2 kinase inhibitor is selected from the group consisting of 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762), 4-[(3S)-1-azabicyclo[2.2.2]oct-3-ylamino]-3-(1H-benzimidazol-2-yl)-6-chloro-2(1H)-quinolinone (CHIR-124), N-[5-Bromo-4-methyl-2-[(2S)-2-morpholinylmethoxy)phenyl]-N′-(5-methyl-2-pyrazinyl)urea (LY2603618), 6-bromo-3-(1-methyl-1H-pyrazol-4-yl)5-(3R)-3-piperidinyl-pyrazolo[1,5-a]pyrimidin-7-amine (MK-8776/SCH 900776), or (R)-α-Amino-N-[5,6-dihydro-2-(1-methyl-1H-pyrazol-4-yl]-6-oxo-1H-pyrrolo[4,3,2-ef[2,3]benzodiazepin-8-yl]-cyclohexaneacetamide (PF-477736); wherein the SLC16A11 risk haplotype comprises a SLC16A11 polynucleotide variant encoding a polypeptide comprising an amino acid alteration selected from the group consisting of V113I, D127G, L187L, G340S, P443T, and a combination thereof, thereby increasing the expression of the SLC16A11 polypeptide or the polynucleotide encoding said polypeptide in the cell.

14. The method of claim 13, further wherein the small molecule chemical compound that inhibits mTOR is selected from the group consisting of N-[4-[1-(1,4-dioxaspiro[4.5]dec-8-yl)-4-(8-oxa-3-azabicyclo[3.2.1]oct-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-6-yl]phenyl]-N′-methyl-urea (WYE-125132); 9-(6-Amino-3-pyridinyl)-1-[3-(trifluoromethyl)phenyl]-benzo[h]-1,6-naphthyridin-2(1H)-one (torin-2), 1-(4-(4-propionylpiperazin-1-yl)-3-(trifluoromethyl)phenyl)-9-(quinolin-3-yl)benzo[h][1,6]naphthyridin-2(1H)-one (torin-1), and sirolimus.

15. The method of claim 13, wherein the small molecule chemical compound increases SLC16A11 transcript levels by at least about 2-fold or 3-fold in the contacted cell.

16. The method of claim 13, wherein the cell is identified as having a SCL16A11 protein comprising one or more amino acid alterations selected from the group consisting of V113I, D127G, L187L, G340S and P443T.

17. The method of claim 13, wherein the cell has a SCL16A11 risk haplotype SNP selected from the group consisting of rs77086571, rs74577409 and rs2292351.

18. The method of claim 13, wherein the cell is a cell of a subject having or at risk of developing type 2 diabetes (T2D).

19. The method of claim 13, wherein the cell is selected from the group consisting of a hepatocyte, an adipocyte, a thyroid cell and a salivary gland cell.

20. The method of claim 13, wherein the small molecule chemical compound increases SLC16A11 transcript levels by at least about 4-fold or 5-fold in the contacted cell.

21. The method of claim 2, wherein the cell is a hepatocyte, adipocyte, thyroid cell, or salivary gland cell.

22. The method of claim 2, wherein the cell is in vitro or in vivo.

23. The method of claim 2, wherein the cell is present in a diabetic subject and/or wherein the method treats or prevents type 2 diabetes in the subject.

24. The method of claim 2, wherein the small molecule chemical compound increases SLC16A11 transcript levels by at least about 4-fold or 5-fold in the contacted cell.

25. The method of claim 2, wherein the subject is identified as having a SCL16A11 protein comprising V113I, D127G, L187L, G340S, and P443T amino acid alterations.

26. The method of claim 1, further wherein the small molecule chemical compound that inhibits mTOR is selected from the group consisting of N-[4-[1-(1,4-dioxaspiro[4.5]dec-8-yl)-4-(8-oxa-3-azabicyclo[3.2.1]oct-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-6-yl]phenyl]-N′-methyl-urea (WYE-125132); 9-(6-Amino-3-pyridinyl)-1-[3-(trifluoromethyl)phenyl]-benzo[h]-1,6-naphthyridin-2(1H)-one (torin-2), 1-(4-(4-propionylpiperazin-1-yl)-3-(trifluoromethyl)phenyl)-9-(quinolin-3-yl)benzo[h][1,6]naphthyridin-2(1H)-one (torin-1), and sirolimus.

27. The method of claim 1, wherein the cell has a SCL16A11 risk haplotype SNP selected from the group consisting of rs77086571, rs74577409 and rs2292351.

28. The method of claim 1, further wherein the cell identified as having a SLC16A11 risk haplotype is contacted with a small molecule compound that is an inhibitor of mTOR selected from the group consisting of tipifarnib-P2, calpeptin, MEK1-2-inhibitor, Fostamatinib, PP-30, PD-0325901, PIK-90, BMS-536924, PI-828, PI-103, KIN001-244, serdemetan, PP-2, WYE-354, methotrexate, U0126, U-0126, NU-7026, Selumetinib, PAC-1, Apitolisib (GDC-0980, RG7422), BGT226 (NVP-BGT226), CC-223, Chrysophanic acid, CH5132799, CZ415, Everolimus (RAD001), ETP-46464, GDC-0349, Gedatolisib (PF-05212384, PKI-587), GSK1059615, INK 128 (MLN0128), Omipalisib (GSK2126458, GSK458), Palomid 529 (P529), PF-04691502, PI-103, PP121, Tacrolimus (FK506), Temsirolimus (CCI-779, NSC 683864), Torkinib (PP242), Vistusertib (AZD-2014), Voxtalisib (XL765, SAR245409), WAY-600, WYE-687, XL388, and Zotarolimus (ABT-578).

29. The method of claim 2, wherein the cell has a SCL16A11 risk haplotype SNP selected from the group consisting of rs77086571, rs74577409 and rs2292351.

30. The method of claim 13, further wherein the cell identified as having a SLC16A11 risk haplotype is contacted with a small molecule compound that is an inhibitor of mTOR selected from the group consisting of tipifarnib-P2, calpeptin, MEK1-2-inhibitor, Fostamatinib, PP-30, PD-0325901, PIK-90, BMS-536924, PI-828, PI-103, KIN001-244, serdemetan, PP-2, WYE-354, methotrexate, U0126, U-0126, NU-7026, Selumetinib, PAC-1, Apitolisib (GDC-0980, RG7422), BGT226 (NVP-BGT226), CC-223, Chrysophanic acid, CH5132799, CZ415, Everolimus (RAD001), ETP-46464, GDC-0349, Gedatolisib (PF-05212384, PKI-587), GSK1059615, INK 128 (MLN0128), Omipalisib (GSK2126458, GSK458), Palomid 529 (P529), PF-04691502, PI-103, PP121, Tacrolimus (FK506), Temsirolimus (CCI-779, NSC 683864), Torkinib (PP242), Vistusertib (AZD-2014), Voxtalisib (XL765, SAR245409), WAY-600, WYE-687, XL388, and Zotarolimus (ABT-578).

31. The method of claim 2, wherein the adipocyte or N-[4-[1-(1,4-dioxaspiro[4.5]dec-8-yl)-4-(8-oxa-3-azabicyclo[3.2.1]oct-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-6-yl]phenyl]-N′-methyl- urea (WYE-125132); 9-(6-Amino-3-pyridinyl)-1-[3-(trifluoromethyl)phenyl]-benzo[h]-1,6-naphthyridin-2(1H)-one (torin-2), 1-(4-(4-propionylpiperazin-1-yl)-3-(trifluoromethyl)phenyl)-9-(quinolin-3-yl)benzo[h][1,6]naphthyridin-2(1H)-one (torin-1), and sirolimus.

32. The method of claim 2, wherein the adipocyte or hepatocyte of the subject is contacted with a small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase and is selected from one or more of 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762), 4-[(3S)-1-azabicyclo[2.2.2]oct-3-ylamino]-3-(1H-benzimidazol-2-yl)-6-chloro-2(1H)-quinolinone (CHIR-124), N-[5-Bromo-4-methyl-2-[(2S)-2-morpholinylmethoxy)phenyl]-N′-(5-methyl-2-pyrazinyl)urea (LY2603618), 6-bromo-3-(1-methyl-1H-pyrazol-4-yl)-5-(3R)-3-piperidinyl-pyrazolo[1,5-a]pyrimidin-7-amine (MK-8776/SCH 900776), or (R)-α-Amino-N-[5,6-dihydro-2-(1-methyl-1H-pyrazol-4-yl)-6-oxo-1H-pyrrolo[4,3,2-ef][2,3]benzodiazepin-8-yl]-cyclohexaneacetamide (PF-477736).

33. The method of claim 32, wherein the small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase is 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762).

34. The method of claim 2, wherein the small molecule chemical compound that inhibits mTOR is KU-0063794 or AZD-8055.

35. The method of claim 13, wherein the small molecule chemical compound that inhibits mTOR is KU-0063794 or AZD-8055.

36. The method of claim 13, wherein the small molecule chemical compound that inhibits a checkpoint 1 or 2 kinase is 3-[(aminocarbonyl) amino]-5-(3-fluorophenyl)-N-(3S)-3-piperidinyl-2-thiophenecarboxamide (AZD-7762).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B present schematics related to credible sets according to the invention. FIG. 1A provides a schematic depicting the steps of the analysis undertaken to generate the credible set. FIG. 1B provides a schematic depicting the fine mapping of type 2 diabetes (T2D) association at 17p13 within the credible set.

(2) FIGS. 2A-2E provide data showing that the T2D risk haplotype contains a cis expression quantitative trait loci (eQTL) for SLC16A11 in liver. FIG. 2A (top panel) provides a box plot. For the liver biopsies, 21 samples were homozygous for the reference allele at rs1334692 (REF), 16 were heterozygous (HET), and 10 samples were homozygous for the risk allele (RISK). Gene expression values for BCL6B, SLC16A11, SLC16A13, and CLEC10A were measured with digital PCR (dPCR) and normalized to the housekeeping gene TBP, log 2 of relative values were then plotted. FIG. 2A (bottom panel) provides a box plot showing liver expression quantitative trait loci (eQTL) detected using a second droplet digital (dd) PCR gene expression assay. FIG. 2B (top panel) provides a graph showing eQTL analyses in liver using HPRT1 for normalization. FIG. 2B (bottom panel) provides a graph showing SLC16A11 transcript expression. For the 16 heterozygous samples, allele specific ddPCR probes were used to measure the percent of SLC16A11 transcript originating from the chromosome carrying the reference haplotype with respect to the chromosome carrying the T2D risk haplotype. rs1334692 was used to tag the T2D risk haplotype.

(3) FIG. 2C (top panel) provides a box plot depicting visceral adipose expression quantitative trait loci (eQTL) detection. FIG. 2C (bottom panel) and FIG. 2D provide graphs showing that primary human hepatocytes from donors who were heterozygous for the T2D risk haplotype had a similar skew in SLC16A11 expression as observed in liver biopsies.

(4) FIG. 2E (top panel) provides a series of graphs and ChIP-sequencing tracks. ChIP-sequencing was carried out to identify histone modifications in primary human hepatocytes from three individuals heterozygous for the T2D risk haplotype. ChIP-sequencing identified H3K27ac, H3K4me1, and H3K4me3 histone modifications in primary human hepatocytes from three individuals heterozygous for the T2D risk haplotype. Tracks overlapping variants in the T2D risk credible set are shown. Bar plots depict allelic proportions±SEM at rs13342692 and rs2292351. Asterisks indicate significance after Bonferroni correction for multiple hypotheses testing: *P<0.05, **P<1×10.sup.−3, ***P<1×10.sup.−5. FIG. 2E (bottom panel) shows ChIP-sequencing tracks in current study compared to previously published studies.

(5) FIG. 2F and FIG. 2G provide graphs showing SLC16A11 transcript expression in heterozygous T2D risk carriers and in African haplotype carriers.

(6) FIG. 2H provides a series of graphs and ChIP sequencing tracks. FIG. 2H shows ChIP-sequencing for H3K27ac, H3K4me1, and H3K4me3 histone modifications in primary human hepatocytes from three individuals heterozygous for the T2D risk haplotype (lots ACB, DSX, and QSK). ChIP-sequencing peaks overlapping variants in the T2D risk credible set are shown. FIG. 2H provides graphs that depict allelic proportions±SEM at indicated credible set SNPs. Asterisk indicates significance after Bonferroni correction for multiple hypothesis testing: ***P<1×10.sup.−5.

(7) FIG. 2I provides graphs showing the allelic ratios by PCR amplification for H3K4me3 in primary human hepatocytes from three individuals heterozygous for the T2D risk haplotype. H3K4me3 is skewed in favor of the reference haplotype over the T2D risk haplotype at the variants encoding V113I, D127G, and L187L. Error bars depict standard deviations.

(8) FIG. 2J (top panel) provides a series of box plots showing quantitative traits associated with donors for liver eQTL analysis. Box plots depict quantitative trait associated with donors for liver (top panel) and visceral adipose (bottome panel) eQTL analyses. No significant changes in quantitative traits between genotype groups after correcting for multiple hypotheses testing. FIG. 2J (bottom panel) provides a series of box plots that depict quantitative traits associated with donors for liver RNA-sequencing. No significant changes in quantitative traits between genotype groups after correcting for multiple hypotheses testing.

(9) FIGS. 3A-3N show data indicating that SLC16A11 is a proton (H.sup.+)-coupled monocarboxylate transporter. FIG. 3A (top panel) provides a bioinformatic analysis showing amino acid sequences indicating that SLC16A11 is a Category I family member. In FIG. 3A, (top panel), the SEQ ID NOs: of the SLC16A family members containig a “TMD 1” region as shown in the figure are as follows: SLC16A11: (SEQ ID NO.: 11); SLC16A1: (SEQ ID NO.: 12); SLC16A3: (SEQ ID NO.: 13); SLC16A7: (SEQ ID NO.: 14); SLC16A8: (SEQ ID NO.: 15); SLC16A2: (SEQ ID NO.: 16); SLC16A10: (SEQ ID NO.: 17); SLC16A13: (SEQ ID NO.: 18); SLC16A6: (SEQ ID NO.: 19); SLC16A12: (SEQ ID NO.: 20); SLC16A4: (SEQ ID NO.: 21); SLC16A5: (SEQ ID NO.: 22); SLC16A9: (SEQ ID NO.: 23); and SLC16A14 (SEQ ID NO.: 24). In FIG. 3A, (top panel), the SEQ ID NOs: of the “TMD-8” regions of the SLC16A family members as shown in the figure are as follows: SLC16A11: (SEQ ID NO.: 95); SLC16A1: (SEQ ID NO.: 96); SLC16A3: (SEQ ID NO.: 97); SLC16A7: (SEQ ID NO.: 98); SLC16A8: (SEQ ID NO.: 99); SLC16A2: (SEQ ID NO.: 100); SLC16A10: (SEQ ID NO.: 101); SLC16A13: (SEQ ID NO.: 102); SLC16A6: (SEQ ID NO.: 103); SLC16A12: (SEQ ID NO.: 104); SLC16A4: (SEQ ID NO.: 105); SLC16A5: (SEQ ID NO.: 106); SLC16A9: (SEQ ID NO.: 107); and SLC16A14 (SEQ ID NO.: 108). FIG. 3A (bottom panel) shows coverage of the SLC16A11T2D protein (SEQ ID NO.: 25) by mass spectrometry. The experimental steps are depicted at the top. The protein sequence of SLC16A11.sup.T2D is shown. Residues that were covered by mass spectrometry and assessed for phosphorylation are shown in gray. The T2D risk coding variants are shown in larger font. No phosphorylated residues were detected. FIG. 3B provides a ribbon diagram of SLC16A11 showing the position of particular residues of interest (e.g., R57, R294, D290). FIG. 3C provides a Western blot analysis showing that SLC16A11 localizes to the plasma membrane. FIG. 3D provides a graph showing results of a pyronic Fluorescence Resonance Energy Transfer (FRET) assay, which indicates that SLC16A11 transports pyruvate. FIG. 3E provides a graph showing quantification of reduced rate of pyruvate transport. FIG. 3F provides a graph showing that SLC16A11 transport is proton-coupled (pH sensor). FIG. 3G provides a graph showing a quantification of rate of acidification. FIG. 3H provides a graph showing pyronic validation with an SLC16 family inhibitor. FIG. 3I provides data corresponding to Luciferase reporter assays with a fragment containing the SLC16A11 promoter and 5′ UTR. FIG. 3I, top panel shows UCSC genome browser view of −425+342RISK. Note that rs77086571, rs74577409, and rs2292351 are shown by the lower peaks within the black brackets. FIG. 3I, middle panel, provides a series of graphs showing the results of the luciferase reporter assay in a panel of human cell lines; the x-axis denotes relative luminescence. Firefly luminescence is normalized by renilla luminescence. Data are from a single experiment and error bars are standard deviations. FIG. 3I, bottom panel, provides a graph showing the results of the luciferase reporter assay in HEK293T cells. Data are from four experiments (n=4) and error bars are standard deviations. Asterisks indicate significance after Bonferroni correction for multiple hypothesis testing: *P<0.05, **P<1×10.sup.−3, ***P<1×10.sup.−5. FIG. 3J provides a schematic showing the location of SNPs. FIG. 3J provides a schematic the location of SNPs. FIG. 3K provides a plot showing the results of a metabolomics analysis of HuH7 cells expressing SLC16A11.sup.REF. Volcano plot of SLC16A11.sup.REF versus CNTRL with metabolites having p-values<10.sup.−5 highlighted in the upper left and upper right quandrants (triangle data points). FIG. 3L provides three graphs showing phenotype microarray analysis of HepG2 cells expressing SLC16A11.sup.REF. Utilization rates of pyruvate (left panel), lactate (middle panel), and acetate (right panel) in HepG2 cells are depicted. Data are from one experiment and error bars are standard deviations. *P<0.05. FIG. 3M shows a bar graph illustrating that in 293T cells co-transfected with pyronic and SLC16A11-V5, SLC16A11 levels are increased without affecting other category I family members. FIG. 3N shows a graph illustrating that a difference in pyruvate transport between SLC16A11-expressing cells and control cells was only observed at neutral pH, likely due to activation of other endogenous SLC16 family members at acidic pH.

(10) FIGS. 4A-4G show that T2D risk-associated coding variants abrogate SLC16A11 activity. FIG. 4A provides a graph showing the results of a FRET assay, which indicates that T2D risk SLC16A11 has a reduced rate of pyruvate transport (FRET assay). FIG. 4B provides a graph that shows a quantification of reduced rate of pyruvate transport. FIG. 4C provides a graph that provides pH traces for control, T2D risk and wild-type (WT). FIG. 4D (top panel) provides a graph showing a quantification of reduced rate of both acidification and alkalization. FIG. 4D (bottom panel) provides an image of a Western blot showing that SLC16A11 runs as a doublet under reducing SDS-PAGE conditions. Western blot images are of SLC16A11.sup.REF-V5 and SLC16A11.sup.T2D-V5 expressed in HuH7 (A) and HEK293T (B) cells. Note that SLC16A11 runs as a doublet and the top band of the doublet is more pronounced for SLC16A11.sup.T2D than SLC16A11.sup.REF. Glycerol resolves the SLC16A11 doublet. Increasing the percentage of glycerol is sufficient to resolve the SLC16A11 doublet. This suggests that an alterative structural conformation likely underlies the doublet rather than a post-translational modification. Some membrane proteins do not fully denature under reducing SDS-PAGE conditions. FIG. 4E provides a box plot showing that cellular pyruvate levels in HuH7 hepatocarcinoma cells are altered by SLC16A11. FIG. 4F provides a box plot showing that cellular lactate levels in HuH7 hepatocarcinoma cells are altered by SLC16A11. FIG. 4G provides a schematic diagram and a chart showing SLC16A11 haplotypes and the frequency at which they occur in certain populations.

(11) FIGS. 5A-5G provide data showing that T2D risk coding variants reduce plasma membrane localization by disrupting an interaction between SLC16A11 and BSG. FIG. 5A (top panel) provides a homology model of SLC16A11 with T2D risk-associated coding variants indicated.

(12) FIG. 5A (bottom panel) provides an autoradiograph showing that SLC16A11 protein expression is low compared to expression of SLC16A1 and SLC16A13 in HuH7 a human hepatocellular carcinoma cell line. FIG. 5B (top panel, left) provides a Western blot showing that the presence of a proline to aspartic acid substitution (P2D) increases SLC16A11 protein levels.

(13) FIG. 5B (top panel, right) provides a plot depicting proteins that were identified by quantitative mass spectrometry to be enriched in a proline to aspartic acid substitution (P2D) WT SLC16A11 immunoprecipitation (IP) versus control IP. Enriched proteins are shown in the upper right hand quadrant. SLC16A11 is shown in gray (labeled SLC16A11). Basigin (BSG) and Embigin (EMB), ancillary proteins for SLC16 type I category members, are shown along with other strongly enriched proteins in dark gray (labeled BSG and EMB). Biological replicates from two independent experiments are plotted. FIG. 5B (bottom panel) provides a Western blot showing that SLC16A11 is part of a larger molecular complex. Co-immunoprecip-itation of SLC16A11-HA and SLC16A11-V5 indicates that SLC16A11 might be part of a larger molecular complex that consists of at least two SLC16A11 molecules.

(14) FIG. 5C (top panel) provides a plot showing that SLC16A11 protein levels are comparable in the P2D T2D risk SLC16A11 IP versus P2D WT SLC16A11 IP. BSG is significantly depleted in the P2D T2D risk SLC16A11 IP with respect to the P2D WT SLC16A11 IP indicating that the T2D risk coding variants disrupt the interaction between SLC16A11 and BSG. FIG. 5C (bottom panel) provides a schematic diagram illustrating GeNETs network analysis of WT/control interactome zoomed in on components of the proteosome.

(15) FIG. 5D (top panel) provides two Western blots showing that SLC16A11 is degraded by the proteasome and has a short half-life relative to other SLC16 family members. FIG. 5D-A shows that SLC16A11 protein is rapidly degraded. HEK293T cells expressing V5-tagged SLC16A11.sup.REF, SLC16A13, or SLC16A1 were treated with cycloheximide (10 μg/mL) for the indicated times. Note that the SLC16A11, SLC16A13, and SLC16A1 images are from different exposure times. FIG. 5D-B shows that SLC16A11 protein levels are increased by proteasome inhibition. HuH7 cells stably expressing SLC16A11.sup.REF-V5 were treated with MG132 (5 μM) or cyclohexamide for 3 hrs. FIG. 5D (bottom panel) provides Western blot showing SLC16A11 and BSG co-immunoprecipitations. (5D-A-5D-C): Co-immunoprecipitation of SLC16A11 and BSG confirms the reduced interaction between SLC16A11.sup.T2D and BSG in HEK293T cells. BSG is glycosylated and runs as multiple bands by reducing SDS-PAGE. Molecular weight markers (kDa) are indicated. (5D-A): Interaction of BSG-V5 with immunoprecipitated SLC16A11-HA. (5D B): Interaction of SLC16A11-HA with immunoprecipitated BSG-V5. (C) Interaction of endogenous BSG with immunoprecipitated SLC16A11-HA.

(16) FIG. 5E (top panel) provides a Western blot co-immunprecipitation with SLC16A11-HA and endogenous BSG to confirm reduced SLC16A11 and BSG interaction conferred by the T2D risk coding variants. FIG. 5E (bottom panel) provides a Western blot showing the effects of MG132 on SLC16A11 protein levels, with vinculin shown as a loading control. In the presence of MG132, total SLC16A11 levels are increased, indicating that over-expressed SLC16A11 is degraded by the proteosome. Also shown in the bottom panel of FIG. 5E are cycloheximide time-course experiments. These experiments indicate that no substantial difference exists between SLC16A11.sup.REF and SLC16A11.sup.T2D half-lives.

(17) FIG. 5F (top panel) provides a Western blot showing that WT SLC16A11-V5 plasma membrane localization is reduced in BSG knock-out (KO) HEK293-T cells. Two different BSG knock-out cell lines were generated using CRISPR/Cas9 and a plasma membrane fraction were biochemically separated from intracellular membranes. FIG. 5F (bottom panel) provides a diagram and a Western blot relating to input for SLC16A11 proteomic studies. Experimental setup is depicted at the top. Input for immunoprecipitations was run by SDS-PAGE and shows comparable protein levels of SLC16A11.sup.REF and SLC16A11.sup.T2D.

(18) FIG. 5G (top panel) provides a Western blot showing WT SLC16A11-V5 and T2D risk SLC16A11-V5 expressed in HEK293-T cells. Markers show that a clean separation was achieved between intracellular membranes and plasma membrane. Intracellular membrane WT and T2D risk SLC16A11 levels are comparable while T2D risk SLC16A11 levels at the plasma membrane are reduced with respect to WT SLC16A11. FIG. 5G (bottom panel) provides a bar plot showing the relative fraction of SLC16A11 at the plasma membrane±SD (n=15, P=4×10.sup.−8). ***P<1×10.sup.−5. The PathHunter® assay was performed in U2OS cells transfected with SLC16A11 variants. Bar plots depict the relative amount of SLC16A11 at the plasma membrane±SD (n=5). *P<0.05, **P<1×10.sup.−3.

(19) FIG. 5H provides a schematic diagram of SLC16A11 and a Western blot. The Western blot (blotted for the V5 epitope) analyzes the effect of various mutations on SLC16A11 protein levels in transiently transfected 293T cells and treatment with MG132 (5 μM for 4 hours), (right side of blot). WT-V5: SLC16A11 with V5 at the carboxy terminus; T2D risk-V5: type 2 diabetes risk-V5; K7A-V5 and P2D-V5: mutations at designated positions of SLC16A11; AltM-V5: removal of the N-terminal 24 amino acids of SLC16A11; V5-WT: SLC16A11 with V5 at the N-terminus; a SLC16A11 variant where the V5 epitope is moved from the C terminus to the N terminus. Note that the P2D variant increases SLC16A11 protein levels.

(20) FIG. 5I (FIGS. 5I-A, 5I-B and 5I-C) show a Western blot and graphs illustrating that SLC16A11 cell surface localization is BSG-dependent and reduced by the T2D risk coding variants. FIG. 5I-A presents a Western blot analysis of BSG levels in wild-type and BSG-knockout U2OS MEM-EA cells. Two different BSG knockout lines were generated using two different sgRNAs and CRISPR/Cas9. Approximate locations of molecular weight markers (kDa) are indicated. FIG. 5I-B shows the results of a split β-galactosidase reporter assay in WT and BSG-knockout U2OS MEM-EA cells (DiscoveRx) and demonstrates that SLC16A11.sup.REF plasma membrane localization is reduced in BSG-knockout cells. Bar plots depict the relative amount of SLC16A11.sup.REF at plasma membrane±SD (n=4 for WT; n=8 for BSG knockout (4 each per BSG-knockout U2OS MEM-EA cell line); P=4×10.sup.−5). FIG. 5I-C shows the results of a split β-galactosidase reporter assay in U2OS MEM-EA cells demonstrates a reduction in SLC16A11.sup.T2D at the cell surface relative to SLC16A11.sup.REF. Bar plots depict the relative amount of SLC16A11 at the cell surface±SD (n=5; P=1×10.sup.−5).**P<1×10.sup.−3.

(21) FIGS. 6A-6C-1 provide plots depicting results from RNA-sequencing of liver from carriers and non-carriers of T2D risk haplotype indicating that carriers of the T2D risk haplotype have altered liver metabolism. FIG. 6A provides a plot showing the comparison of gene expression in liver of T2D risk carrier/non-carriers demonstrating that SLC16A11 is the most significantly altered gene within 100 Kb of top SNP. FIG. 6B provides a plot showing the comparison of gene expression in liver of T2D risk carrier/non-carriers demonstrating that SLC16A11 is only SLC16 family member altered by the variant haplotype. FIGS. 6C and 6C-1 provide a series of box plots showing the effects of T2D risk or the reference allele (REF) (top panel) or type 2 diabetes (T2D) versus control on a variety of clinical parameters.

(22) FIGS. 7A-7C provide graphs depicting gene expression results upon transcript expression of SLC16A11, SLC16A1 and SLC16A13 transiently expressed in HeLa cells following overexpression from a CMV-driven promoter. Despite being expressed from the same plasmid with the same promoter, SLC16A11 levels are an order of magnitude lower than SLC16A13 and SLC16A1, indicating SLC16A11 is being regulated at the mRNA level by a mechanism involving sequencings within the SLC16A11 open reading frame.

(23) FIG. 8A provides data showing pyruvate uptake in Xenopus Oocytes overexpressing SLC16A11. FIG. 8A provides a western blot data. SLC16A1 is used as a positive control. FIG. 8A also provides a graph showing the uptake of radiolabelled pyruvate in oocytes expressing SLC16A11 versus controls. (x axis: .sup.14C-pyruvate (mM); y-axis: picomol pyruvate/oocyte per minute).

(24) FIG. 8B provides a schematic including a graph and table showing an analysis of SLC16A11 affinity for pyruvate transport parameters, in comparison to SLC16A1. Note, SLC16A11 has higher affinity and greater transport efficiency.

(25) FIG. 9A provides data showing the overexpression of SLC16A11 in primary human hepatocytes transduced with SLC16A11 lentivirus or controls. Bar plots depict relative gene expression±SD using TATA binding protein (TBP) for normalization (FIG. 9A-A). Fold-changes of TCA cycle metabolites in cells expressing SLC16A11.sup.REF compared to cells expressing controls are presented in FIG. 9A-B. FIG. 9B (top panel) provides a series of graphs showing SLC16A11, SLC16A13, and SLC16A1 gene expression in primary human hepatocytes treated with siRNAs targeting SLC16A11. Bar plots depict relative gene expression±SD using TBP for normalization.

(26) FIG. 9B (top and bottom panels) provide bar graphs showing transcript levels of relevant genes and fold-changes of glycolysis metabolites in cells treated with SLC16A11 siRNAs compared to cells treated with negative control siRNAs. FIG. 9B (bottom panel) indicates metabolites with fold-changes less than 0.9 or greater than 1.1.

(27) FIG. 9C shows germline transmission in Slc16a11 and Slc16a13 CRISPR-Cas9 mouse models. The mosaic mice born from the microinjection of genome editing reagents were mated with wild-type C57BL/6 mice and resulted in the pups described. Genotypes were assessed by sequencing and are with respect to the wild-type sequence. For example, a deletion of 2 bp Slc16a11 KO model means that 2 bp were deleted in the wild-type Slc16a11 open reading frame resulting in a premature stop codon. Mutations that were not of interest are shown in gray. Mutations for which colonies were expanded are indicated with arrows. Ultimately, the deletion of 19 bp Slc16a11 KO mouse model was selected as a starting model for in-depth investigation of the role of Slc16a11 in organismal physiology.

(28) FIG. 9D (top panel) provides a schematic diagram showing the endogenous Slc16a11 locus in both the Slc16a11* and Slc16a11-.sup.Neo knockout mouse models.

(29) FIG. 9D (middle panel) provides a series of graphs showing gene expression data in Slc16a11* and Slc16a11-Neo knock out mice demonstrating altered Slc16a13 levels in Slc16a11* mice. Bar plots depict relative gene expression±SD using Tbp for normalization. Data are from 22 mice. FIG. 9D (bottom panel) provides a schematic diagram of the endogenous Slc16a11 and Slc16a13 loci in the CRISPR mouse models.

(30) FIG. 9E (top and bottom panels) provides plots showing knock-out (SLC16A A11del19 CRISPIR) vs. wild-type gene expression changes. FIG. 9E (top panel) shows SLC16A11 and genes at locus. FIG. 9E (bottom panel) shows SLC16A11 family.

(31) FIG. 9F provides two plots showing that lactate levels are increased in liver (Left panel) and plasma (Right panel) of SLC16A11 knock-out (KO) mice.

(32) FIG. 9G provides two plots showing that malondialdehyde levels are increased in liver (Left panel) and plasma (Right panel) of SLC16A11 knock-out (KO) mice.

(33) FIG. 9H provides two box plots showing that lipids are altered in liver (Left panel) and plasma (Right panel) of SLC16A11 knock-out (KO) mice.

(34) FIG. 9I provides three bar graphs showing Slc16a11, Slc16a13, and Bcl6b levels in Slc16a11 del19 mice. Digital droplet PCR (ddPCR) results in mouse liver samples that were used for RNA-sequencing. Error bars depict standard deviations. Asterisk indicates significance: ***P<1×10.sup.−5. FIG. 9I shows a gene set enrichment analysis of down-regulated genes in human carriers of the T2D risk haplotype in Slc16a11 knockout mice.

(35) FIG. 9J illustrates genes down-regulated in human carriers.

(36) FIG. 9K-1 presents bar plots illustrating the expression of SLC16A11, SLC16A13, SLC16A1, SLC16A3, SLC16A7, SLC16A8, and BSG in primary human hepatocytes treated with siRNAs targeting SLC16A11 or negative control siRNAs. The bar plots depict relative gene expression±SD using TBP for normalization. (*P≈4.8×10.sup.−3).

(37) FIGS. 9K-2 and 9K-3 illustrate pathway enrichment analyses of intracellular (FIG. 9K-2) and extracellular (FIG. 9K-3) metabolic pathway changes following SLC16A11 knockdown compared to control primary human hepatocytes. Normalized enrichment scores quantify the concordance of individual metabolite fold-changes within a given metabolic pathway or class, with a positive score indicating enrichment and a negative score corresponding to depletion. Each dot represents a different metabolic pathway or metabolite class. P values are indicated by dot size. Significantly altered pathways (false discovery rate [FDR]<0.05) are labeled, with non-significant pathways (FDR>0.05) shown in gray. LPCs, lysophosphatidylcholines; PCs, phosphatidylcholines; PE, phosphatidylethanolamine; DAGs, diacylglycerols; TAGs, triacylglycerols.

(38) FIG. 9K-4 provides a schematic depiction which summarizes the effects of T2D-associated variants at 17p13 on T2D risk. The T2D disease association at 17p13 is driven by variants that disrupt SLC16A11 function, which leads to changes in fatty acid and lipid metabolism that are associated with increased risk of T2D. The causality of the associations between increased acylcarnitines, diacylglycerols and triacylglycerols and disease is uncertain.

(39) FIGS. 9L, 9M, 9N, and 9O illustrate foldchange in metabolites SLC16A11siRNA/control. FIG. 9M shows an enlargement of the right side of FIG. 9L.

(40) FIG. 10 provides a schematic diagram showing the impact of a reduction in SLC16A11 function.

(41) FIG. 11 provides a schematic depicting a strategy for increasing SLC16A11 activity from the reference allele (REF) in heterozygote carriers of the T2D risk haplotype. The rs77086571 nucleotide sequence (ACAACCCCCAGGCCCGGGGGAGG) presented in FIG. 11 is set forth in SEQ ID NO: 26. The rs74577409 nucleotide sequence (TCTCCCCTGCGCGCAGCAGGCGG) presented in FIG. 11 is set forth in SEQ ID NO: 27.

(42) FIG. 12 provides a series of graphs showing the effects of transactivators on SLC16A11 transcript levels. Transactivators were targeted to genomic regions overlapping or immediately next to 18 non-coding variants (v1-v18) either in the credible set or in strong linkage disequilibrium with credible set variants. Gene expression assays were used in order to identify transactivators that increased SLC16A11 transcript levels. SLC16A13 expression was not affected by any transactivators targeted to variants in the credible set.

(43) FIG. 13A provides a series of graphs showing that mTOR inhibitors increase SLC16A11 expression. SNU761 (Left panel) and NCIH716 (Right panel) cells were treated with KU-0063794, AZD-8055, and methotrexate at the indicated concentrations and times. SLC16A11 expression was then assessed using droplet digital PCR (ddPCR). Bar plots depict relative fold-changes with respect to DMSO and error bars are standard deviations.

(44) FIG. 13B shows the chemical structure of AZD-8055 (left panel) and KU 0063794 (right panel).

(45) FIGS. 14A-14D provide graphs showing that mTOR inhibitors increase SLC16A11, but not SLC16A1 transcript levels. SNU761 cells (FIGS. 14A and 14C) and NCIH716 cells (FIGS. 14B and 14D) were treated with KU-0063794 (denoted as Ku) or AZD-8055 (denoted as AZD) at 10 μM for 24 hours. SLC16A11 (FIGS. 14A and 14B) and SLC16A1 (FIGS. 14C and 14D) expression was then assessed using droplet digital PCR (ddPCR). Bar plots depict relative fold-changes with respect to DMSO and error bars and standard deviations. Expression is normalized to housekeeping genes TBP or HPRT1.

(46) FIGS. 15A-15C provide a series of graphs and a heat map showing the effect of compound treatments on SLC16A11 expression. FIG. 15A provides a graph showing the distribution of the average connectivity scores across all 2837 compound signatures queried from the LINCS dataset. The top compounds, those generating signatures most resembling the query signature, are in the black box. The middle compounds that did not resemble the query signature are shown in the gray box. FIG. 15B provides a graph showing the distribution of fold-changes induced in SLC16A11 expression by compound treatments. DMSO is shown in black and is tightly centered on 1 (SLC16A11) with a density of approximately 2.5. FIG. 15C provides a heat map showing hierarchical clustering of the SLC16 expression profiles generated by the compound treatments. The color light gray corresponds to fold-changes greater than 1 and dark gray to black corresponds to fold-changes less than 1. The labels corresponding to the SLC16 expression profiles are as follows: A1 for SLC16A1; A13 for SLC16A13; A11.sub.1, A11.sub.2, and A11.sub.3 correspond to SLC16A11 expression normalized by TBP from three biological replicates and A11.sub.avg is their average; A11* corresponds to SLC16A11 expression normalized by HPRT1.

(47) FIG. 16 (top panel) provides a graph showing a dose response curve for the mTOR inhibitor AZD-8055 in SNU761 cells. AZD-8055 treatment results in the increase of SLC16A11 (A11) transcript levels. FIG. 16 (bottom panel) provides a graph indicating AZD-8055 increases SLC16A11 transcript levels in primary human hepatocytes. SLC16A11 (denoted by A11 when normalized by TBP and A11* for HPRT1), SLC16A13 (A13), and SLC16A1 (A1) in comparison with DMSO treated cells.

(48) FIG. 17A provides a schematic showing a separation band, and data variability bands, with assay signal plotted along the x axis and frequency along the y axis.

(49) FIG. 17B provides a simplified schematic showing the partitioning of a PCR sample for droplet digital PCR (ddPCR).

(50) FIG. 17C provides a series of graphs showing QuantaSoft ddPCR analysis. Each point represents a single droplet. Points in light gray had the gene of interest and were scored as positive. SLC16A11 (A11) was scored in the top graph.

(51) FIG. 17D provides a graph quantifying the relative increase in SLC16A11 (A11) gene expression in response to inhibitor treatment.

(52) FIG. 18 provides Western blots of V5-tagged SLC16A11 and SLC16A11 variants, transiently expressed in HEK293T cells and blotted for V5. HEK293T cells expressing V5-tagged SLC16A11 with V5 at the C-terminus (WT-V5), or the K7A, AltM, T2Drisk, PD2 and SLC16A11 with V5 at the N-terminus (V5-WT) variants were treated with cycloheximide for the indicated times. Cell lysates were used in the analysis. Note that the images are from different exposure times. As observed, the half-lives of the variant (mutant) forms of the SLC16A11 protein were not significantly altered.

(53) FIG. 19 provides Western blots and experimental protocol steps involved in the analysis of SLC16A11 protein levels after culture of HuH7 cells stably expressing SLC16A11 in the presence or absence of various metabolites, namely, pyruvate, lactate and glucose. Cell lysates were used in the analysis. The left blot shows SLC16A11 blotted for V5 following culture of cells with or without glucose at different concentrations for 24 hr. The right blot shows SLC16A11 blotted for V5 following culture of cells with or without pyruvate and lactate and with or without glucose at different concentrations for 24 hr. Tubulin is shown as a reference. As shown, glucose, pyruvate and lactose are metabolites that affect SLC16A11 protein levels.

(54) FIG. 20 provides Western blots of V5-tagged SLC16A11 (WT) and the V5-tagged SLC16A11 variant, T2D risk, stably expressed in HuH7 cells that had been glucose-starved for the times indicated. Cell lysates were used in the analysis. As observed, glucose deprivation resulted in a rapid decrease (starting at 2 hrs) in SLC16A11 protein levels in the SLC16A11-expressing cells. A similar finding is observed in the left blot of FIG. 19, above, in which no SLC16A11 protein was detected in cell lysates cultured for 24 hrs without glucose compared with detectable levels of SLC16A11 protein found in lysates from cultures containing 1-5 g/L of glucose.

(55) FIG. 21 provides Western blots of V5-tagged SLC16A11 (WT) and the V5-tagged SLC16A11 variant, T2D risk, stably expressed in HuH7 cells that been cultured for 24 hours with or without glucose and with either low (L) or high (H) concentrations of pyruvate and lactate as indicated. Cell lysates were used in the analysis. As observed in FIG. 21, both low and high concentrations of pyruvate and lactate altered the levels of the SLC16A11 (WT) and the T2D risk variant proteins.

(56) FIG. 22 provides bar graphs showing the effects of low and high concentrations of metabolic effectors (oleic acid (OA), insulin and glucagon) on expression levels of SLC16A11 and SLC16A13 transcripts in SNU761 cells cultured for 24 hours in the presence of low/high concentrations of OA (0.3 mM/1.5 mM); insulin (100 nM/500 nM); or glucagon (100 nM/500 nM). Relative transcipt levels of SLC16A11 and SLC16A13 are shown, with 2-FBS (2% Fetal Bovine Serum) used as control.

(57) FIG. 23 provides bar graphs showing the effects of low and high concentrations of pyruvate or lactate on expression levels of SLC16A11 and SLC16A13 transcripts in SNU761 cells cultured for 24 hours in the presence of 2 mM pyruvate (low), 10 mM pyruvate (high), 20 mM lactate (low), or 100 mM lactate (high). Relative transcipt levels of SLC16A11 and SLC16A13 are shown, compared with transcript levels in cell cultured in increasing concentrations of glucose. Altered levels of transcripts at 17p13 were seen at both low and high concentrations of pyruvate and lactate.

(58) FIG. 24 provides a listing of SLC16A11 T2D risk haplotype sequences.

DETAILED DESCRIPTION OF THE INVENTION

(59) The invention features compositions and methods that are useful for increasing the level or activity of SLC16A11 in subjects having or at risk of developing type 2 diabetes (T2D). In one embodiment, the invention features compositions and methods useful for increasing the level or activity of SLC16A11 in carriers of the SLC16A11 risk haplotype, there by treating or preventing type 2 diabetes in those carriers.

(60) The invention is based, at least in part, on the discovery of a variant haplotype in SLC16A11 that explains ˜20% of the increased T2D prevalence in Mexico. Type 2 Diabetes affects Latinos at twice the rate seen in populations of European descent. Genetic fine-mapping defined a reduced set of tightly linked common variants likely to contain the causal allele. As described herein, a cis-eQTL was identified for SLC16A11 in human liver, associated with decreased SLC16A11 expression in risk allele carriers. Furthermore, T2D-associated coding variants in SLC16A11 were shown to attenuate activity by disrupting a key interaction with Basigin (BSG), thereby reducing plasma membrane localization. Both independent mechanisms indicate that SLC16A11 is the causal gene, and reduced SLC16A11 function is the T2D-relevant direction-of-effect. SLC16A11 was also shown to function as a H.sup.+-coupled monocarboxylate transporter. Lower SLC16A11 expression in human carriers was accompanied by altered hepatic metabolism. Additionally, Slc16a11 knockout mouse models exhibit metabolic changes associated with insulin resistance and type 2 diabetes. Based on these findings, it is likely that increasing SLC16A11 function could be therapeutically beneficial for T2D.

(61) The invention is also based, at least in part, on the discovery that agents that inhibit mTOR (e.g., tipifarnib-P2, calpeptin, KU-0063794, MEK1-2-inhibitor, Fostamatinib, AZD-8055, NVP-BEZ235, PP-30, PD-0325901, PIK-90, BMS-536924, PI-828 PI-103, KIN001-244, serdemetan, PP-2, WYE-354, methotrexate, U0126, U-0126, NU-7026, OSI-027, Selumetinib, deforolimus, PAC-1 and other such mTOR inhibitors) beneficially increase the expression of SLC16A11.

(62) Accordingly, the invention provides compositions and methods for increasing SLC16A11 function and/or expression, as well as methods of using such compositions for the treatment of type 2 diabetes.

(63) SLC16A11

(64) Type 2 Diabetes (T2D) afflicts more than 415 million people and is a leading cause of morbidity and mortality worldwide. While T2D is influenced by environmental factors, it is also a highly heritable disorder, with genetic variation contributing to a disparity in T2D prevalence across populations. An example of this disparity is observed within American populations, where the prevalence of diabetes in individuals of Mexican or Latin American descent is approximately twice that of US non-Hispanic whites. Understanding the genetic influences on disease biology can help identify at-risk individuals, guide more effective personalized treatment approaches, and illuminate new targets and pathways for therapeutic development and intervention. To date, large-scale genetic studies in diverse populations have identified >100 genetic loci containing common variants associated with altered risk of T2D. However, few of these genetic findings have been translated into knowledge of the causal variant(s) or gene(s). Furthermore, most of the implicated genes are of unknown function and the molecular mechanisms by which the causal variant(s) alter gene regulation or protein function and ultimately contribute to disease biology remain elusive.

(65) One T2D signal for which mechanistic insight has potential for meaningful impact is the risk association at 17p13. This factor was first identified through a genome-wide association study (GWAS) investigating genetic influences on diabetes risk in Mexico (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101). The T2D risk haplotype at this locus is common among individuals of Mexican or Latin American descent (with an allele frequency of ˜30%) yet rare among individuals of European (<2%) and African (0%) descent. Notably, this genetic association results in a 25% increase in T2D risk per copy of the risk haplotype carried and explains up to 20% of the increased T2D prevalence in Mexico (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101). Variants contained in the T2D risk haplotype at 17p13 span two protein coding genes, SLC16A11 and SLC16A13. Interestingly, while most disease-associated common variants are in non-coding regions (Maurano et al., 2012, Science 337, 1190-1195), the T2D risk haplotype at 17p13 contains five coding variants in SLC16A11, including four missense mutations and one synonymous change. Of note, another haplotype carrying two of the five coding variants in SLC16A11 is found at high frequency (˜38%) in Africa, but is rare in other populations (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101), allowing for trans-ethnic fine-mapping to delineate the causal variant(s) underlying risk in the Latino population.

(66) Both SLC16A11 and SLC16A13 are members of the SLC16 (or monocarboxylate transporter, MCT) family, a group of 14 solute carriers that are defined by two highly conserved sequences, and are all predicted to have 12 transmembrane domains with both N- and C-termini facing the cytoplasm. Despite these structural similarities, different members of this family have been shown to mediate transport of distinct substrates, utilizing two different mechanisms. SLC16A1, SLC16A3, SLC16A7, and SLC16A8 are known as Category I members of the SLC16 family and transport simple monocarboxylic acids, such as lactate, pyruvate and ketone bodies, via a proton (H.sup.+)-coupled mechanism (Halestrap et al., Pflugers Arch. 2004 February; 447(5):619-28). Of these, SLC16A1 is the most extensively studied and has been shown to transport a wide range of monocarboxylic acids. In addition, these family members have been shown to interact with basigin (BSG) and embigin (EMB), two chaperone proteins important for plasma membrane localization of the transporters. In contrast, a second class of SLC16 transporters, known as Category II transporters, include SLC16A2 and SLC16A10 as members. SLC16A2 and SLC16A10 do not transport monocarboxylic acids, nor do they use a H.sup.+-coupled mechanism; instead, these proteins transport larger hydrophobic molecules, such as triiodothyronine (T.sub.3) and thyroxine (T.sub.4) and aromatic amino acids, through facilitated diffusion (Halestrap, A. P. et al., 2004, Pflugers Arch, 447, 619-628). Furthermore, SLC16A2 does not interact with BSG or EMB. Studies of two other family members, SLC16A6 and SLC16A9, show that SLC16A6 transports ketone bodies (Hugo, S. E. et al., 2012, Genes Dev., 26, 282-293), suggesting that it may belong to Category I, and SLC16A9 transports carnitine via a H.sup.+-independent mechanism (Suhre, K. et al., 2011, Nature, 477, 54-60), suggesting that it may belong to Category II. The members of the SLC16 family have distinct but overlapping expression patterns (Halestrap, A. et al., 2013, Mol. Aspects Med, 34:337-349). SLC16A11 is expressed in relatively few tissues, with the highest levels detected in thyroid, liver, and salivary gland, while SLC16A13 is more broadly expressed, with the highest levels in liver (SIGMA T2D Consortium et al., 2014, Nature, 506:97-101). To date, the roles of SLC16A11 and SLC16A13 in these tissues have not been characterized.

(67) The results described herein support the genetic association at the 17p13 locus, using genetic fine-mapping and functional studies to delineate mechanisms underlying T2D risk at this locus. This provides evidence for two independent mechanisms by which variants on the T2D risk haplotype impact SLC16A11 action. Genetic variants at this locus have two distinct actions on SLC16A11, a category I SLC16 transporter. Variants, such as non-coding regulatory, on the T2D-risk haplotype lead to decreased gene expression of SLC16A11 in liver, while coding variants affect the interaction of the SLC16A11 protein with BSG, which leads to reduced levels of the transporter at the cell surface. In addition, disruption of SLC16A11 in primary human hepatocytes leads to T2D-relevant changes in fatty acid and lipid metabolism. Together, these studies implicate reduced SLC16A11 function in liver as a causal factor for T2D, and indicate that agents and methods that increase SLC16A11 would be therapeutically beneficial.

(68) Type 2 Diabetes Therapy

(69) The present invention provides methods of treating or preventing type 2 diabetes in subjects having or at risk of developing type 2 diabetes. In one embodiment, the subject is identified as having an alteration in the sequence of a SLC16A11 polypeptide or polynucleotide (e.g., any one or more of V113I, D127G, L187L, G340S, P443T). In one embodiment, a subject has a coding variant or a non-coding variant. Because the variants are tightly linked, a subject may carry none of the alterations, two alteration (e.g., L187L, D127G), or all 5 of these variants. The haplotype with all 5 coding variants and the non-coding variants have been definitively associated with T2D risk. In another embodiment, a subject carrying L187L and D127G also carries V113I, G340S, and/or P443T. In one embodiment, this sequence alteration affects the level or activity of a SLC16A11 polypeptide. In particular, the invention provides compositions and methods for increasing the level and/or activity of SLC16A11 in a subject.

(70) As described herein, agents that inhibit mTOR have been identified as useful for increasing SLC16A11 expression for the treatment of diabetes. The mechanistic target of rapamycin (mTOR), (formerly mammalian target of rapamycin) is a member of the phosphatidylinositol 3-kinase-related kinase family of protein kinases. mTOR is present in two protein complexes, mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2). mTOR functions as a serine/threonine protein kinase that regulates cell growth, cell proliferation, and other cellular activities, and also functions as a tyrosine kinase when present in mTORC2.

(71) In one embodiment, a subject having type 2 diabetes is treated with one or more agents that inhibit mTOR. In one embodiment, the agent is tipifarnib-P2, calpeptin, KU-0063794, MEK1-2-inhibitor, Fostamatinib, AZD-8055, NVP-BEZ235, PP-30, PD-0325901, PIK-90, BMS-536924, PI-828, PI-103, KIN001-244, serdemetan, PP-2, WYE-354, methotrexate, U0126, U-0126, NU-7026, OSI-027, selumetinib, deforolimus, or PAC-1. In one embodiment, the agent is KU-0063794 or AZD-8055.

(72) AZD-8055 is an ATP-competitive inhibitor of mTOR kinase activity, with an IC50 of 0.8 nmol/L (Chresta et al., Cancer Res. 2010 Jan. 1; 70(1):288-98). In studies by Chresta et al., AZD8055 showed selectivity (approximately 1,000-fold) against all class I phosphatidylinositol 3-kinase (PI3K) isoforms and other members of the PI3K-like kinase family. Furthermore, there was no significant activity against a panel of 260 kinases at concentrations up to 10 μmol/L. Interestingly, AZD-8055 can be orally administered.

(73) Checkpoint kinase (e.g., Checkpoint kinase 1 and 2) is a Serine/threonine protein kinase. Checkpoint kinase (Chk) coordinates the DNA damage response (DDR) and cell cycle checkpoint response. Activation of Chk1 results in the initiation of cell cycle checkpoints, cell cycle arrest, DNA repair and cell death to prevent damaged cells from progressing through the cell cycle. Chk1 is also known to facilitate diverse cellular processes including gene transcription, embryo development, cellular responses to HIV infection and somatic cell viability. In embodiments of the present invention CHK is inhibited to prevent or treat type 2 diabetes.

(74) In particular embodiments, the present invention features compositions comprising one or more agents that inhibit Checkpoint 1 kinase (CHK) or the mechanistic target of rapamycin (mTOR) signaling pathways. Such agents include small molecules described herein.

(75) Small molecules capable of inhibiting mTOR include are known in the art, and include, for example, AZD-8055, KU-0063794, Apitolisib (GDC-0980, RG7422), BEZ235 (e.g., NVP-BEZ235, Dactolisib), BGT226 (NVP-BGT226), CC-223, Chrysophanic acid, CH5132799, CZ415, Deforolimus (AP23573, MK-8669, Ridaforolimus), Everolimus (RAD001), ETP-46464, GDC-0349, Gedatolisib (PF-05212384, PKI-587), GSK1059615, INK 128 (MLN0128), Omipalisib (GSK2126458, GSK458), OSI-027, Palomid 529 (P529), PF-04691502, PI-103, PP121, Sirolimus, Tacrolimus (FK506), Temsirolimus (CCI-779, NSC 683864), Torin 1, Torin 2, Torkinib (PP242), Vistusertib (AZD-2014), Voxtalisib (XL765, SAR245409), WAY-600, WYE-125132 (WYE-132), WYE-354, WYE-687, XL388, and Zotarolimus (ABT-578).

(76) Small molecules capable of inhibiting CHK include AZD-7762, CHIR-124, LY2603618, MK-8776 (SCH 900776), and PF-477736.

(77) In one embodiment, a subject having a reduction in SLC16A11 activity or level is treated by replacing the subject's endogenous SLC16A11 polynucleotide with a wild-type form of SLC16A11. In another approach, the subject is treated by expressing a heterologous polynucleotide encoding SLC16A11 in one or more tissues of the subject. In particular embodiments, the heterologous polynucleotide comprises a promoter upstream of SLC16A11, as well as the 5′ untranslated region. Methods for the heterologous expression of polynucleotides are known in the art and described herein. Such methods are useful not only to those having a mutation in an SLC16A11 protein or nucleic acid sequence encoding the protein or regulating protein expression, but also to subjects suffering from type 2 diabetes who do not have such mutations.

(78) In an embodiment, the expression level of the SLC16A11 protein in cells is stabilized and/or modulated by preventing proteasome-mediated degradation at the N-terminus of the protein as a therapeutic approach for treating T2D, both in the broader at-risk population and in risk variant carriers. The level of the SLC16A11 protein expressed in cells is stabilized and/or enhanced by inhibiting its proteasome-mediated degradation and blocking or preventing the ubiquitination of SLC16A11 at its N-terminus. In an embodiment, a stabilized SLC16A11 protein is provided wherein the protein comprises an N-terminus that is modified so as to block, hinder, interfere with, or inhibit N-terminal ubiquitination and subsequent proteosomal degradation of the protein.

(79) As described herein, the SLC16A11 protein was stabilized in cells by inhibition of proteasome degradation. The presence of a peptide at the N-terminus of SLC11A11 blocked N-terminal ubiquitination of the protein and prevented its proteosomal degradation, thereby providing increased and stabilized levels of SLC16A11 in the cell. More specifically, as described in Example 12 and shown in FIG. 5H, removing the N-terminal 24 amino acids of SLC16A11 and moving the V5 epitope tag from the C-terminus to the N-terminus of the protein increased. SLC16A11 protein levels. As also demonstrated infra, the P2D SLC16A11 variant having an aspartate amino acid residue at position 2 of the N-terminus of the protein, a potential site of regulation through an N-terminal ubiquitination pathway (Ciechanover, A., 2005, Methods Mol Biol, 301:255-270), to reduce N-terminal methionine excision (NME) while promoting N-terminal acetylation (N-Ac) of the initiator methionine, was able to compete with ubiquitination of this residue such that the variant exhibited increased SLC16A11 protein levels. The locations of the P2D, K7A, and AltM mutations in the SLC16A11 protein are shown in FIG. 5A (top panel).

(80) In embodiments, methods, compounds, molecules, or agents that inhibit the proteasomal pathway and/or enzymes active in the ubiquitin pathway, may be used to block, interfere with, mask, or inhibit ubiquitination of SIX 16A11 at its N-terminus. Nonlimiting examples of agents (e.g., small molecules) that target various components of the ubiquitin pathway leading to protein degradation and that may be used according to the invention include, without limitation, proteasomal pathway inhibitors such as MG132, (see, e.g., Example 12 and FIG. 5E (bottom)), bortezomib (or the PS-341 active ingredient), epoxomicin, lactacystin, celastrol, aclacinomycin A, carfilzomib, MLN2238, MLN9708, oprozomib, or pharmaceutically acceptable derivatives, analogs, or forms thereof. In other embodiments, compounds that inhibit E3 ubiquitin ligase include, without limitation, SMER3 (a selective inhibitor of Skp1-Cullin-F-box ubiquitin ligase), thalidomide, TAME, NCS-66811, Nutlin-3, SL-01, SKPin C1, SMER3, PTC-209, or pharmaceutically acceptable derivatives, analogs, or forms thereof, may be useful. In other embodiments, compounds that inhibit the ubiquitin E1 enzyme include PYR-41 or a pharmaceutically acceptable derivative, analog, or form thereof, may be useful. Inhibitors of the chaperone-like protein p97, which guides protein substrates to the 26S proteasome for degradation may be useful and include DBeQ (inhibits the AAA-ATPase p97), MDBN (inhibits p97/valosin-containing protein and NMS-873 (an allosteric inhibitor of the ATPase activity of p97.

(81) In accordance with the invention, the methods by which SLC16A11 is stabilized against proteasome-mediated degradation are not intended to be limiting. Any process that specifically blocks or interferes with the N-terminal region or residue(s) of the N-terminus of SLC16A11 that are involved in ubiquinating the protein may be used to prevent N-terminal ubiquitination and subsequent proteosomal degradation of SLC16A11. In a particular embodiment, an agent, e.g, a peptide, protein, or small molecule compound, that specifically binds to an N-terminal region or site involved in the ubiquitination of SLC16A11 and that specifically blocks, masks, hinders, or otherwise interferes with binding of one or more enzymes of the ubiquitin pathway at the N-terminus of SLC16A11, in particular, the amino acid residue at position 2 of the N-terminus of SLC16A11, may be suitable for use. In a particular embodiment, the agent blocks or masks the proline residue at amino acid position 2 of the N-terminus of the SLC16A11 protein. In an embodiment, the agent is an antibody or an antigen binding fragment thereof that binds to the N-terminus of SLC16A11. In a particular embodiment, such an antibody or an antigen binding fragment thereof blocks or masks the proline residue at amino acid position 2 of the the N-terminus of SLC16A11. In embodiments, such a peptide, protein (e.g., anti-SLC1611 antibody or an antigen binding fragment thereof), agent or small molecule compound may sterically or conformationally block one or more enzymes/proteins of the ubiquitination pathway to inhibit or thwart ubiquitination of the SLC16A11 protein. In an embodiment, the ubiquitination-blocking agent may be reversibly bound to the N-terminus of the SLC16A11 protein. In accordance with the methods described herein, the blocking/unblocking of the N-terminus of the SLC16A11 protein provides a useful approach to modulating the longevity of SLC16A11 in vivo.

(82) In an embodiment, a small molecule that is specifically designed to target, and block or mask, the region or amino acid residue sites in the N-terminus of SLC16A11 that are bound by one or more proteins/enzymes of the ubiquitination system, may be provided, e.g., to a cell of a subject, thereby preventing proteasome degradation of SLC16A11 and stabilizing, enhancing, or increasing its expression level in the cell. In an embodiment, the N-terminus of the SLC16A11 protein can be blocked or unblocked to modulate (e.g., increase or decrease, respectively) the longevity of the SLC16A11 protein in a cell. In an embodiment, the small molecule blocks or masks the proline residue at amino acid position 2 of the N-terminus of the SLC16A11 protein. In an embodiment, the small molecule compound may be identified through one or more conventional screening assays that assess and determine whether the small molecule increases or stabilizes SLC16A11 expression level or activity in a cell that expresses SLC16A11, e.g., without limitation, an adipocyte, hepatocyte, myocyte, pancreatic cell, thyroid cell, salivary gland cell, and progenitor cells thereof.

(83) In a particular embodiment, an SLC16A11 protein having a proline to aspartic acid substitution (P2D) at amino acid position 2 of the N-terminus may be used to increase SLC16A11 protein levels in a cell, such as, for example, a liver cell or a pancreatic cell.

(84) Uses of CHK and mTOR Inhibitors

(85) In particular embodiments, the invention features methods for increasing the expression or activity of SLC16A11 by contacting a cell with a Checkpoint (CHK) inhibitor or mechanistic target of rapamycin (mTOR) inhibitor to treat or prevent type 2 diabetes. In general, the method includes a step of contacting a diabetic or metabolically deficient cell with an effective amount of a compound of the invention. The present method can be performed on cells in culture, e.g., in vitro or ex vivo, or can be performed on cells present in an animal subject, e.g., as part of an in vivo therapeutic protocol. The therapeutic regimen can be carried out on a human or other subject.

(86) The compounds of the invention or otherwise described herein can be tested initially in vitro for their effects on the metabolic function and expression of SLC16A11 on cells suitable for the study of type 2 diabetes. Examples of cell lines that can be used are any of the cell lines described herein (e.g., HuH7 human hepatocellular carcinoma cells) or any other suitable cell line known in the art. Alternatively, the activity of compounds of the invention can be tested in vivo using various animal models known in the art. Agents that increase the expression of SLC16A11 (A11) are identified as useful in the methods of the invention.

(87) The methods discussed herein can be used to increase the expression of SLC16A11 in virtually any cell. The invention provides methods for treating or preventing type 2 diabetes by administering to the subject an effective amount of an agent that inhibits CHK or mTOR signaling as described herein. In certain embodiments, the subject is a mammal, in particular, a human. Agents that are determined to be effective for the prevention or treatment of type 2 diabetes in animals, e.g., dogs, rodents, may also be useful in the treatment of type 2 diabetes in humans.

(88) Pharmaceutical Compositions

(89) In particular embodiments, the invention provides pharmaceutical compositions for the prevention or treatment of type 2 diabetes, comprising an effective amount of an agent that inhibits Checkpoint kinase (CHK) or the mechanistic target of rapamycin (mTOR) and a pharmaceutically acceptable carrier. In particular embodiments, the effective amount is effective to increase the expression of SLC16A11 in a cell or to otherwise treat or prevent type 2 diabetes in a subject, as described herein.

(90) In an embodiment, the agent is administered to the subject using a pharmaceutically-acceptable formulation. In certain embodiments, these pharmaceutical compositions are suitable for oral or parenteral administration to a subject. In still other embodiments, as described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound. In certain embodiments, the subject is a mammal, e.g., a primate, e.g., a human.

(91) The methods of the invention further include administering to a subject a therapeutically effective amount of a compound in combination with a pharmaceutically acceptable excipient. The phrase “pharmaceutically acceptable” refers to those compounds of the invention, compositions containing such compounds, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

(92) The phrase “pharmaceutically-acceptable excipient” includes pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, solvent or encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

(93) Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

(94) Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

(95) Compositions containing a compound(s) include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, aerosol and/or parenteral administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

(96) Methods of preparing these compositions include the step of bringing into association a agent(s) with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

(97) Compositions of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound(s) as an active ingredient. A compound may also be administered as a bolus, electuary or paste.

(98) In solid dosage forms of the invention for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

(99) A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

(100) Liquid dosage forms for oral administration of the compound(s) include pharmaceutically-acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

(101) In addition to inert diluents, the oral compositions can include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

(102) Suspensions, in addition to the active compound(s) may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

(103) Pharmaceutical compositions of the invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compound(s) with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active agent.

(104) Compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.

(105) Dosage forms for the topical or transdermal administration of a compound(s) include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound(s) may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

(106) The ointments, pastes, creams and gels may contain, in addition to compound(s) of the present invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

(107) Powders and sprays can contain, in addition to a compound(s), excipients, such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

(108) The compound(s) can be alternatively administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation or solid particles containing the compound. A nonaqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers are preferred because they minimize exposing the agent to shear, which can result in degradation of the compound.

(109) Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of the agent together with conventional pharmaceutically-acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular compound, but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids, such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.

(110) Transdermal patches have the added advantage of providing controlled delivery of a compound(s) to the body. Such dosage forms can be made by dissolving or dispersing the agent in the proper medium. Absorption enhancers can also be used to increase the flux of the active ingredient across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the active ingredient in a polymer matrix or gel.

(111) Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.

(112) Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more compound(s) in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

(113) Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

(114) These compositions may also contain adjuvants, such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

(115) In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

(116) Injectable depot forms are made by forming microencapsule matrices of compound(s) in biodegradable polymers, such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.

(117) When the compound(s) are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically-acceptable carrier. In one embodiment, AZD8055 is administered orally at a dose of 10 mg/kg twice daily or 20 mg/kg daily. In another embodiment, AZD8055 is administered orally at a dose of 1, 5, 10, 20, 25, 30, 40, or 50 mg/kg daily.

(118) Regardless of the route of administration selected, the compound(s), which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of ordinary skill in the art.

(119) Actual dosage levels and time course of administration of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. An exemplary dose range is from about 0.1 μg to 20 milligram per kilogram of body weight per day (mg/kg/day) (e.g., 0.1 μm/kg to 10 mg/kg, 0.1-10 μm/kg, 0.1-1 mg/kg). In other embodiments, the amount varies from about 0.1 mg/kg/day to about 100 mg/kg/day. In still other embodiments, the amount varies from about 0.001 μg to about 100 μg/kg (e.g., of body weight). Ranges intermediate to the above-recited values are also intended to be part of the invention.

(120) Agents of the invention can be used alone, or in combination with conventional therapeutics useful for the treatment of diabetes, such agents include oral agents that are generally used to promote insulin secretion (sulfonylureas and repaglinide), to improve insulin action in the liver (metformin), to improve insulin action in muscle and fat (troglitazone), or to delay the absorption of carbohydrates from the meal, allowing the delayed secretion of insulin to catch up with rapid carbohydrate absorption (acarbose or miglitol).

(121) Genome Editing to Introduce SLC16A11

(122) Therapeutic gene editing is a major focus of biomedical research, embracing the interface between basic and clinical science. A large number of different recessive hereditary human disease syndromes are caused by inheritance of biallelic inactivating point mutations of disease genes. The development of novel “gene editing” tools provides the ability to manipulate the DNA sequence of a cell at a specific chromosomal locus, without introducing mutations at other sites of the genome. This technology effectively enables the researcher to manipulate the genome of a subject's cells in vitro or in vivo, to effect a reversion of a deleterious genotype.

(123) In one embodiment, gene editing involves targeting an endonuclease (an enzyme that causes DNA breaks internally within a DNA molecule) to a specific site of the genome and thereby triggering formation of a chromosomal double strand break (DSB) at the chosen site. If, concomitant with the introduction of the chromosome breaks, a donor DNA molecule is introduced (for example, by plasmid or oligonucleotide introduction), interactions between the broken chromosome and the introduced DNA can occur, especially if the two sequences share homology. In this instance, a process termed “gene targeting” can occur, in which the DNA ends of the chromosome invade homologous sequences of the donor DNA by homologous recombination (HR). By using the donor plasmid sequence as a template for HR, a seamless repair of the chromosomal DSB can be accomplished. Importantly, if the donor DNA molecule differs slightly in sequence from the chromosomal sequence, HR-mediated DSB repair will introduce the donor sequence into the chromosome, resulting in gene conversion/gene correction of the chromosomal locus. In the context of therapeutic gene targeting, the altered sequence chosen would be an active or functional fragment (e.g., wild type, normal) of the disease gene of interest. By targeting the nuclease to a genomic site that contains the disease-causing point mutation, the concept is to use DSB formation to stimulate HR and to thereby replace the mutant disease sequence with wild-type sequence (gene correction). The advantage of the HR pathway is that it has the potential to generate seamlessly a wild type copy of the gene in place of the previous mutant allele.

(124) Current genome editing tools use the induction of double strand breaks (DSBs) to enhance gene manipulation of cells. Such methods include zinc finger nucleases (ZFNs; described for example in U.S. Pat. Nos. 6,534,261, 6,607,882, 6,746,838, 6,794,136, 6,824,978, 6,866,997, 6,933,113, 6,979,539, 7,013,219, 7,030,215, 7,220,719, 7,241,573, 7,241,574, 7,585,849, 7,595,376, 6,903,185, and 6,479,626, and U.S. Pat. Publ. Nos. 20030232410 and US2009020314, which are incorporated herein by reference), Transcription Activator-Like Effector Nucleases (TALENs; described for example in U.S. Pat. Nos. 8,440,431, 8,440,432, 8,450,471, 8,586,363, and 8,697,853, and U.S. Pat. Publ. Nos. 20110145940, 20120178131, 20120178169, 20120214228, 20130122581, 20140335592, and 20140335618, which are incorporated herein by reference), and the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system (described for example in U.S. Pat. Nos. 8,697,359, 8,771,945, 8,795,965, 8,871,445, 8,889,356, 8,906,616, 8,932,814, 8,945,839, 8,993,233, and 8,999,641, and U.S. Pat. Publ. Nos. 20140170753, 20140227787, 20140179006, 20140189896, 20140273231, 20140242664, 20140273232, 20150184139, 20150203872, 20150031134, 20150079681, 20150232882, and 20150247150, which are incorporated herein by reference). For example, ZFN DNA sequence recognition capabilities and specificity can be unpredictable. Similarly, TALENs and CRISPR/Cas9 cleave not only at the desired site, but often at other “off-target” sites, as well. These methods have significant issues connected with off-target double-stranded break induction and the potential for deleterious mutations, including indels, genomic rearrangements, and chromosomal rearrangements, associated with these off-target effects. ZFNs and TALENs entail use of modular sequence-specific DNA binding proteins to generate specificity for ˜18 bp sequences in the genome.

(125) RNA-guided nucleases-mediated genome editing, based on Type 2 CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat)/Cas (CRISPR Associated) systems, offers a valuable approach to alter the genome. In brief, Cas9, a nuclease guided by single-guide RNA (sgRNA), binds to a targeted genomic locus next to the protospacer adjacent motif (PAM) and generates a double-strand break (DSB). The DSB is then repaired either by non-homologous end joining (NHEJ), which leads to insertion/deletion (indel) mutations, or by homology-directed repair (HDR), which requires an exogenous template and can generate a precise modification at a target locus (Mali et al., Science. 2013 Feb. 15; 339(6121):823-6). Unlike other gene therapy methods, which add a functional or partially functional copy of a gene to a patient's cells, but retain the original dysfunctional copy of the gene, this system can remove the defect. Genetic correction using engineered nucleases has been demonstrated in tissue culture cells and rodent models of rare diseases.

(126) CRISPR has been used in a wide range of organisms including bakers yeast (S. cerevisiae), zebra fish, nematodes (C. elegans), plants, mice, and several other organisms. Additionally CRISPR has been modified to make programmable transcription factors that allow scientists to target and activate or silence specific genes. Libraries of tens of thousands of guide RNAs are now available.

(127) Since 2012, the CRISPR/Cas system has been used for gene editing (silencing, enhancing or changing specific genes) that even works in eukaryotes like mice and primates. By inserting a plasmid containing cas genes and specifically designed CRISPRs, an organism's genome can be cut at any desired location.

(128) CRISPR repeats range in size from 24 to 48 base pairs. They usually show some dyad symmetry, implying the formation of a secondary structure such as a hairpin, but are not truly palindromic. Repeats are separated by spacers of similar length. Some CRISPR spacer sequences exactly match sequences from plasmids and phages, although some spacers match the prokaryote's genome (self-targeting spacers). New spacers can be added rapidly in response to phage infection.

(129) CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays. As of 2013, more than forty different Cas protein families had been described. Of these protein families, Cas1 appears to be ubiquitous among different CRISPR/Cas systems. Particular combinations of cas genes and repeat structures have been used to define 8 CRISPR subtypes (E. coli, Y. pest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube), some of which are associated with an additional gene module encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may occur in a single genome. The sporadic distribution of the CRISPR/Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.

(130) Exogenous DNA is apparently processed by proteins encoded by Cas genes into small elements (about.30 base pairs in length), which are then somehow inserted into the CRISPR locus near the leader sequence. RNAs from the CRISPR loci are constitutively expressed and are processed by Cas proteins to small RNAs composed of individual, exogenously-derived sequence elements with a flanking repeat sequence. The RNAs guide other Cas proteins to silence exogenous genetic elements at the RNA or DNA level. Evidence suggests functional diversity among CRISPR subtypes. The Cse (Cas subtype E. coli) proteins (called CasA-E in E. coli) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. In other prokaryotes, Cas6 processes the CRISPR transcripts. Interestingly, CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 and Cas2. The Cmr (Cas RAMP module) proteins found in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. RNA-guided CRISPR enzymes are classified as type V restriction enzymes. See also U.S. Patent Publication 2014/0068797, which is incorporated by reference in its entirety.

(131) Cas9

(132) Cas9 is a nuclease, an enzyme specialized for cutting DNA, with two active cutting sites, one for each strand of the double helix. The team demonstrated that they could disable one or both sites while preserving Cas9's ability to home located its target DNA. Jinek et al. (2012) combined tracrRNA and spacer RNA into a “single-guide RNA” molecule that, mixed with Cas9, could find and cut the correct DNA targets. It has been proposed that such synthetic guide RNAs might be able to be used for gene editing (Jinek et al., Science. 2012 Aug. 17; 337(6096):816-21).

(133) Cas9 proteins are highly enriched in pathogenic and commensal bacteria. CRISPR/Cas-mediated gene regulation may contribute to the regulation of endogenous bacterial genes, particularly during bacterial interaction with eukaryotic hosts. For example, Cas protein Cas9 of Francisella novicida uses a unique, small, CRISPR/Cas-associated RNA (scaRNA) to repress an endogenous transcript encoding a bacterial lipoprotein that is critical for F. novicida to dampen host response and promote virulence. Coinjection of Cas9 mRNA and sgRNAs into the germline (zygotes) generated mice with mutations. Delivery of Cas9 DNA sequences also is contemplated.

(134) gRNA

(135) As an RNA guided protein, Cas9 requires a short RNA to direct the recognition of DNA targets. Though Cas9 preferentially interrogates DNA sequences containing a PAM sequence NGG it can bind here without a protospacer target. However, the Cas9-gRNA complex requires a close match to the gRNA to create a double strand break. CRISPR sequences in bacteria are expressed in multiple RNAs and then processed to create guide strands for RNA. Because Eukaryotic systems lack some of the proteins required to process CRISPR RNAs the synthetic construct gRNA was created to combine the essential pieces of RNA for Cas9 targeting into a single RNA expressed with the RNA polymerase type 2I promoter U6). Synthetic gRNAs are slightly over 100 bp at the minimum length and contain a portion which is targets the 20 protospacer nucleotides immediately preceding the PAM sequence NGG; gRNAs do not contain a PAM sequence.

(136) In one approach, one or more cells of a subject are altered to express a wild-type form of SLC16A11 using a CRISPR-Cas system. Cas9 can be used to target a SLC16A11 comprising a mutation. Upon target recognition, Cas9 induces double strand breaks in the SLC16A11 target gene. Homology-directed repair (HDR) at the double-strand break site can allow insertion of a desired wild-type SLC16A11 sequence.

(137) The following US patents and patent publications are incorporated herein by reference: U.S. Pat. No. 8,697,359, 20140170753, 20140179006, 20140179770, 20140186843, 20140186958, 20140189896, 20140227787, 20140242664, 20140248702, 20140256046, 20140273230, 20140273233, 20140273234, 20140295556, 20140295557, 20140310830, 20140356956, 20140356959, 20140357530, 20150020223, 20150031132, 20150031133, 20150031134, 20150044191, 20150044192, 20150045546, 20150050699, 20150056705, 20150071898, 20150071899, 20150071903, 20150079681, 20150159172, 20150165054, 20150166980, and 20150184139.

(138) Cas9-Based Synthetic Transactivators

(139) Given the presence of non-coding variants in the credible set proximal to the SLC16A11 transcription start site and the recent development of programmable transactivators, such transactivators could be used as a strategy for precisely increasing the levels of the reference SLC16A11 transcript. Heterozygous carriers of the T2D risk haplotype, as well as individuals in the general population at risk or with T2D, might benefit from such a strategy. For example, Cas9 based transactivators (SAM or synergistic activation mediators) as described in Konermann et al. (Nature 517: 583-588, 2015) could be targeted to sequences proximal to the SLC16A11 transcription start site such as rs77086571 or rs74577409 (FIG. 11). The effects of transactivators on SLC16A11 transcript levels are shown by FIG. 12. Since the T2D risk haplotype would carry the alternative allele at these variants which results in disrupted PAMs for guides targeting regions immediately proximal to these variants, the reference haplotype could be specifically targeted.

(140) Polynucleotide Therapy

(141) Polynucleotide therapy featuring a polynucleotide encoding a SLC16A11 protein, variant, or fragment thereof is another therapeutic approach for treating type 2 diabetes in a variety of subjects. Expression of such proteins in a cell of a subject is expected to ameliorate diabetes in the subject by increasing the level or activity of SLC16A11 in the subject. Such nucleic acid molecules can be delivered to cells of a subject expressing a wild-type or a variant form of SLC16A11. The nucleic acid molecules must be delivered to the cells of a subject in a form in which they can be taken up so that therapeutically effective levels of a SLC16A11 protein or fragment thereof can be produced.

(142) Polynucleotide Delivery

(143) Polynucleotides are introduced into cells using a variety of methods known in the art. Transducing viral (e.g., retroviral, adenoviral, and adeno-associated viral) vectors can be used to introduce a desired polynucleotide to the cell of a subject, especially because of their high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. U.S.A. 94:10319, 1997). For example, a polynucleotide encoding a SLC16A11 protein, variant, or a fragment thereof, can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; Le Gal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346). Most preferably, a viral vector is used to administer a SLC16A11 polynucleotide systemically.

(144) Non-viral approaches can also be employed for the introduction of therapeutic to a cell of a patient. For example, a nucleic acid molecule can be introduced into a cell by administering the nucleic acid in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Preferably the nucleic acids are administered in combination with a liposome and protamine.

(145) Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell. Transplantation of normal genes into the affected tissues of a patient can also be accomplished by transferring a normal nucleic acid into a cultivatable cell type ex vivo (e.g., an autologous or heterologous primary cell or progeny thereof), after which the cell (or its descendants) are injected into a targeted tissue.

(146) cDNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.

(147) Another therapeutic approach included in the invention involves administration of a recombinant therapeutic, such as a recombinant a SLC16A11 protein, variant, or fragment thereof, either directly to the site of a potential or actual disease-affected tissue or systemically (for example, by any conventional recombinant protein administration technique). The dosage of the administered protein depends on a number of factors, including the size and health of the individual patient. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.

(148) Diagnostics

(149) Subjects having type 2 diabetes are likely to benefit by increasing SLC16A11 function. In particular embodiments, subjects are selected for treatment using a method of the invention by detecting the presence of the SLC16A11 risk haplotype. Methods for detecting this haplotype include, but are not limited to, detecting the presence of any one or more of V113I, D127G, L187L, G340S, or P443T or any other variant from the credible set (e.g., rs77086571, rs74577409, rs2292351, rs13342232, rs13342692, rs117767867, rs75418188, rs17203120, rs145952323, rs75493593, rs75075014, rs78972129, rs7607064 rs77552976, rs58223766, rs4630597, rs113748381, rs73239895) in a biological sample comprising genomic DNA from the subject. In one embodiment, the method includes detecting any or all of V113I, D127G, L187L, G340S, or P443T in a biological sample comprising genomic DNA from the subject. In another embodiment, the method involves detecting L187L in combination with any one or more of V113I, D127G, G340S, and P443T.

(150) Allelic patterns, polymorphism patterns, or haplotype patterns can be identified by detecting any of the component alleles using any of a variety of available techniques, including: 1) performing a hybridization reaction between a nucleic acid sample and a probe that is capable of hybridizing to the allele; 2) sequencing at least a portion of the allele; or 3) determining the electrophoretic mobility of the allele or fragments thereof (e.g., fragments generated by endonuclease digestion). The allele can optionally be subjected to an amplification step prior to performance of the detection step. Preferred amplification methods are selected from the group consisting of: the polymerase chain reaction (PCR), the ligase chain reaction (LCR), strand displacement amplification (SDA), cloning, and variations of the above (e.g. RT-PCR and allele specific amplification). Oligonucleotides necessary for amplification may be selected, for example, from within the metabolic gene loci, either flanking the marker of interest (as required for PCR amplification) or directly overlapping the marker (as in allele specific oligonucleotide (ASO) hybridization). In a particularly preferred embodiment, the sample is hybridized with a set of primers, which hybridize 5′ and 3′ in a sense or antisense sequence to the associated allele, and is subjected to a PCR amplification.

(151) An allele may also be detected indirectly, e.g. by analyzing the protein product encoded by the DNA. For example, where the marker in question results in the translation of a mutant protein, the protein can be detected by any of a variety of protein detection methods. Such methods include immunodetection and biochemical tests, such as size fractionation, where the protein has a change in apparent molecular weight either through truncation, elongation, altered folding or altered post-translational modifications.

(152) Many methods are available for detecting specific alleles at human polymorphic loci. The preferred method for detecting a specific polymorphic allele will depend, in part, upon the molecular nature of the polymorphism. For example, the various allelic forms of the polymorphic locus may differ by a single base-pair of the DNA. Such single nucleotide polymorphisms (or SNPs) are major contributors to genetic variation, comprising some 80% of all known polymorphisms, and their density in the human genome is estimated to be on average 1 per 1,000 base pairs. SNPs are most frequently biallelic-occurring in only two different forms (although up to four different forms of an SNP, corresponding to the four different nucleotide bases occurring in DNA, are theoretically possible). Nevertheless, SNPs are mutationally more stable than other polymorphisms, making them suitable for association studies in which linkage disequilibrium between markers and an unknown variant is used to map disease-causing mutations. In addition, because SNPs typically have only two alleles, they can be genotyped by a simple plus/minus assay rather than a length measurement, making them more amenable to automation.

(153) A variety of methods are available for detecting the presence of a particular single nucleotide polymorphic allele in a subject. Advancements in this field have provided accurate, easy, and inexpensive large-scale SNP genotyping. Most recently, for example, several new techniques have been described including dynamic allele-specific hybridization (DASH), microplate array diagonal gel electrophoresis (MADGE), pyrosequencing, oligonucleotide-specific ligation, the TaqMan system as well as various DNA “chip” technologies such as the Affymetrix SNP chips. These methods require amplification of the target genetic region, typically by PCR. Still other newly developed methods, based on the generation of small signal molecules by invasive cleavage followed by mass spectrometry or immobilized padlock probes and rolling-circle amplification, might eventually eliminate the need for PCR. Several of the methods known in the art for detecting specific single nucleotide polymorphisms are summarized below. The method of the present invention is understood to include all available methods.

(154) Several methods have been developed to facilitate analysis of single nucleotide polymorphisms. In one embodiment, the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Pat. No. 4,656,127). According to the method, a primer complementary to the allelic sequence immediately 3′ to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule was complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data.

(155) In another embodiment of the invention, a solution-based method is used for determining the identity of the nucleotide of a polymorphic site. Cohen, D. et al. (French Patent 2,650,840; PCT Appln. No. WO91/02087). As in the Mundy method of U.S. Pat. No. 4,656,127, a primer is employed that is complementary to allelic sequences immediately 3′ to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.

(156) An alternative method, known as Genetic Bit Analysis or GBA® is described by Goelet, P. et al. (PCT Publication No. WO 92/15712). The method of Goelet, P. et al. uses mixtures of labeled terminators and a primer that is complementary to the sequence 3′ to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al. (French Patent 2,650,840; PCT Publication No. WO91/02087), the method of Goelet, P. et al. is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.

(157) Several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. et al., Nucl. Acids. Res. 17:7779-7784 (1989); Sokolov, B. P., Nucl. Acids Res. 18:3671 (1990); Syvanen, A.-C., et al., Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al., Proc. Natl. Acad. Sci. (U.S.A) 88:1143-1147 (1991); Prezant, T. R. et al., Hum. Mutat. 1:159-164 (1992); Ugozzoli, L. et al., GATA 9:107-112 (1992); Nyren, P. et al., Anal. Biochem. 208:171-175 (1993)). These methods differ from GBA® in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run (Syvanen, A.-C., et al., Amer. J. Hum. Genet. 52:46-59 (1993)).

(158) For mutations that produce premature termination of protein translation, the protein truncation test (PTT) offers an efficient diagnostic approach (Roest, et. al., (1993) Hum. Mol. Genet. 2:1719-2 1; van der Luijt et. al., (1994) Genomics 20:1-4). For PTT, RNA is initially isolated from available tissue and reverse-transcribed, and the segment of interest is amplified by PCR. The products of reverse transcription PCR are then used as a template for nested PCR amplification with a primer that contains an RNA polymerase promoter and a sequence for initiating eukaryotic translation. After amplification of the region of interest, the unique motifs incorporated into the primer permit sequential in vitro transcription and translation of the PCR products. Upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis of translation products, the appearance of truncated polypeptides signals the presence of a mutation that causes premature termination of translation. In a variation of this technique, DNA (as opposed to RNA) is used as a PCR template when the target region of interest is derived from a single exon.

(159) Any cell type or tissue may be utilized to obtain nucleic acid samples for use in the diagnostics described herein. In a preferred embodiment, the DNA sample is obtained from a bodily fluid, e.g., blood, obtained by known techniques (e.g. venipuncture) or saliva. Alternatively, nucleic acid tests can be performed on dry samples (e.g. hair or skin). When using RNA or protein, the cells or tissues that may be utilized must express a gene of interest (e.g., SLC16A11).

(160) Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, N.Y.).

(161) In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles may also be assessed in such detection schemes. Fingerprint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.

(162) A preferred detection method is allele specific hybridization using probes overlapping a region of at least one allele of a SLC16A11 gene or haplotype and having about 5, 10, 20, 25, or 30 nucleotides around the mutation or polymorphic region. In an embodiment of the invention, several probes capable of hybridizing specifically to allelic variants of an SLC16A11 gene are attached to a solid phase support, e.g., a “chip” (which can hold up to about 250,000 oligonucleotides). Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. Mutation detection analysis using these chips comprising oligonucleotides, also termed “DNA probe arrays” is described e.g., in Cronin et al. (1996) Human Mutation 7:244. In one embodiment, a chip comprises all the allelic variants of at least one polymorphic region of a gene. The solid phase support is then contacted with a test nucleic acid and hybridization to the specific probes is detected. Accordingly, the identity of numerous allelic variants of one or more genes can be identified in a simple hybridization experiment.

(163) These techniques may also comprise the step of amplifying the nucleic acid before analysis. Amplification techniques are known to those of ordinary skill in the art, and include, but are not limited to cloning, polymerase chain reaction (PCR), polymerase chain reaction of specific alleles (ASA), ligase chain reaction (LCR), nested polymerase chain reaction, self sustained sequence replication (Guatelli, J. C. et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D. Y. et al., 1989, Proc. Natl. Acad. Sci. USA 86:1173-1177), and Q-Beta Replicase (Lizardi, P. M. et al., 1988, Bio/Technology 6:1197).

(164) Amplification products may be assayed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detecting specific tagged oligonucleotide primers in the reaction products, allele-specific oligonucleotide (ASO) hybridization, allele specific 5′ exonuclease detection, sequencing, hybridization, and the like.

(165) PCR based detection means can include multiplex amplification of a plurality of markers simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously. Alternatively, it is possible to amplify different markers with primers that are differentially labeled and thus can each be differentially detected. Of course, hybridization based detection means allow the differential detection of multiple PCR products in a sample. Other techniques are known in the art to allow multiplex analyses of a plurality of markers.

(166) In one embodiment, the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize 5′ and 3′ to at least one allele of a metabolic gene or haplotype under conditions such that hybridization and amplification of the allele occurs, and (iv) detecting the amplification product. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

(167) In one embodiment of the subject assay, a haplotype is identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.

(168) In yet another embodiment, any of a variety-of sequencing reactions known in the art can be used to directly sequence the allele. Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert ((1977) Proc. Natl Acad Sci USA 74:560) or Sanger (Sanger et al (1977) Proc. Nat. Acad. Sci USA 74:5463). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays (see, for example Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example PCT publication WO 94/16101; Cohen et al. (1996) Adv Chromatogr 36:127-162; and Griffin et al. (1993) Appl Biochem Biotechnol 38:147-159). It will be evident to one of ordinary skill in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-track or the like, e.g., where only one nucleic acid is detected, can be carried out.

(169) In a further embodiment, protection from cleavage agents (such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine) can be used to detect mismatched bases in RNA/RNA or RNA/DNA or DNA/DNA heteroduplexes (Myers, et al. (1985) Science 230:1242). In general, the art technique of “mismatch cleavage” starts by providing heteroduplexes formed by hybridizing (labeled) RNA or DNA containing the wild-type allele with the sample. The double-stranded duplexes are treated with an agent that cleaves single-stranded regions of the duplex such as which will exist due to base pair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S1 nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc. Natl Acad Sci USA 85:4397; and Saleeba et al (1992) Methods Enzymol. 217:286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection.

(170) In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called “DNA mismatch repair” enzymes). For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662). According to an exemplary embodiment, a probe based on an allele of a metabolic gene locus haplotype is hybridized to a CDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Pat. No. 5,459,039.

(171) In other embodiments, alterations in electrophoretic mobility will be used to identify a the SLC16A11 risk haplotype. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86:2766, see also Cotton (1993) Mutat Res 285:125-144; and Hayashi (1992) Genet Anal Tech Appl 9:73-79). Single-stranded DNA fragments of sample and control SLC16A11 alleles are denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).

(172) In yet another embodiment, the movement of alleles in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).

(173) Examples of other techniques for detecting alleles include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation or nucleotide difference (e.g., in allelic variants) is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci USA 86:6230). Such allele specific oligonucleotide hybridization techniques may be used to test one mutation or polymorphic region per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations or polymorphic regions when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.

(174) Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation or polymorphic region of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3′ end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238). In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al (1992) Mol. Cell Probes 6:1). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3′ end of the 5′ sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.

(175) In another embodiment, identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Pat. No. 4,998,617 and in Landegren, U. et al. ((1988) Science 241:1077-1080). The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand. Nickerson, D. A. et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D. A. et al. (1990) Proc. Natl. Acad. Sci. USA 87:8923-27). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.

(176) Several techniques based on this OLA method have been developed and can be used to detect the SLC16A11 risk haplotype. For example, U.S. Pat. No. 5,593,826 discloses an OLA using an oligonucleotide having 3′-amino group and a 5′-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage. In another variation of OLA described in Tobe et al. ((1996) Nucleic Acids Res 24: 3728), OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e. digoxigenin and fluorescein, each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.

(177) Kits

(178) The invention provides a kit or packaged pharmaceutical for treating type 2 diabetes in a subject. In one embodiment, the kit includes a therapeutic or prophylactic composition containing an effective amount of a compound of the invention, such as an mTOR inhibitor (e.g., KU-0063794, AZD-8055, NVP-BEZ235, PI-103, WYE-354, OSI-027, or deforolimus) in unit dosage form.

(179) In another embodiment, the kit comprises a sterile container which contains a therapeutic or prophylactic composition; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.

(180) If desired a compound of the invention is provided together with instructions for administering the compound to a subject having or at risk of developing type 2 diabetes. The instructions will generally include information about the use of the composition for the treatment or prevention of type 2 diabetes. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of ischemia or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.

(181) In another embodiment, the invention provides a SLC16A11 wild type polynucleotide, vectors comprising the polynucleotide and reagents suitable for overexpressing the SLC16A11 wild type polynucleotide in a cell of a subject or replacing the subject's variant SLC16A11 polynucleotide with a wild-type version. For use in genome editing, the kit comprises 2 guide RNA vectors in pCas-Guide to ensure an efficient cleavage, Donor vector with predesigned homologous arms, and/or synergistic activation mediators (SAM) (Cas9 based transactivators) as described by Konermann et al. (Nature 517: 583-588, 2015). These reagents would provide the means of targeting transcriptional activators to regions around the credible set variants.

(182) If desired, the above-listed components are packaged in combination with probes/primer for hybridizing to or amplifying an SLC16A11 polynucleotide. Such primers and probes are useful for characterizing a SLC16A11 risk haplotype in a subject.

(183) Kits or pharmaceutical systems according to this aspect of the invention comprise a carrier means, such as a box, carton, tube or the like, having in close confinement therein one or more container means, such as vials, tubes, ampoules, bottles and the like. The kits or pharmaceutical systems of the invention may also comprise associated instructions for using the agents of the invention.

(184) The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the artisan of ordinary skill. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

(185) The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.

EXAMPLES

Example 1

Fine Mapping of the T2D Association at 17p13

(186) Analyses were performed to identify variant(s) that are most likely causal for the T2D association at the 17p13 locus. The strength of association for all variants in the region was analyzed to construct a “99% credible set,” namely, a set of variants that has a 99% probability of containing the causal variant(s). To define the T2D risk credible set at this locus, exome-chip, OMNI 2.5 genotyping array, and whole-exome sequencing data (http://www.ncbi.nlm.nih.gov/pubmed/24390345 http://www.ncbi.nlm.nih.gov/pubmed/24915262) from the Slim Initiative in Genomic Medicine for the Americas (SIGMA) Type 2 Diabetes Consortium were integrated and imputed with 1000 Genomes data (phase 3) (FIG. 1A). The posterior probability of causality for each variant was calculated with a minor allele frequency >0.1% and a r.sup.2≥0.1 with the top variant at the SLC16A11 locus. This analysis resulted in a 99% credible set and identified 18 variants (e.g., rs77086571, rs74577409, rs2292351, rs13342232, rs13342692, rs117767867, rs75418188, rs17203120, rs145952323, rs75493593, rs75075014, rs78972129, rs76070643, rs77552976, rs58223766, rs4630597, rs113748381, rs73239895 in the T2D credible set. Among these, three non-coding variant(s) proximal to the SLC16A11 transcription start site (rs77086571 and rs74577409 in the SLC16A11 proximal promoter region and rs2292351 in the 5′ UTR) are suggested as the most likely causal variants (FIG. 1B and Tables 2A, 2B, 2C).

(187) TABLE-US-00010 TABLE 2A* 99% credible sets for SLC16A11 associated region. Predicted effect and frequency in several ancestries according to 1000 Genomes project is also represented. High risk Low risk Odds posterior RSID MarkerName allele allele Ratio p-value probability Consequence IMPACT SYMBOL rs77086571 chr17: 6947393 c g 1.3 8.10E−13 0.13196989 NA NA NA rs74577409 chr17: 6947453 g c 1.3 8.22E−13 0.13196989 NA NA NA rs2292351 chr17: 6946921 g c 1.3 9.12E−13 0.12465609 NA NA NA rs13342232 chr17: 6945940 g a 1.29 1.01E−12 0.10841085 synonymous_variant LOW SLC16A11 rs13342692 chr17: 6946287 c t 1.29 1.14E−12 0.10032728 missense_variant MODERATE SLC16A11 rs117767867 chr17: 6946330 t c 1.29 1.32E−12 0.08700712 missense_variant MODERATE SLC16A11 rs75418188 chr17: 6945483 t c 1.29 1.55E−12 0.07484217 missense_variant MODERATE SLC16A11 rs17203120 chr17: 6943989 g t 1.29 4.16E−12 0.02896951 NA NA NA rs145952323 chr17: 6944349 c g 1.29 4.31E−12 0.02792187 NA NA NA rs75493593 chr17: 6945087 t g 1.29 4.24E−12 0.02792187 missense_variant MODERATE SLC16A11 rs75075014 chr17: 6944089 a g 1.29 4.45E−12 0.02741264 NA NA NA rs78972129 chr17: 6942330 a g 1.29 4.94E−12 0.02455024 NA NA NA rs76070643 chr17: 6941625 t c 1.29 5.10E−12 0.02323545 synonymous_variant LOW SLC16A13 rs77552976 chr17: 6951612 t c 1.29 5.76E−12 0.02281335 NA NA NA rs58223766 chr17: 6943729 t c 1.28 8.97E−12 0.01391709 NA NA NA rs4630597 chr17: 6942546 c t 1.28 9.02E−12 0.01388876 NA NA NA rs113748381 chr17: 6953155 a g 1.28 1.28E−11 0.01041364 NA NA NA rs73239895 chr17: 6953558 t c 1.28 1.72E−11 0.00753164 NA NA NA Amino Acids SIFT PolyPhen GMAF AFR_MAF AMR_MAF EAS_MAF EUR_MAF SAS_MAF AA_MAF EA_MAF NA NA NA C: 0.0581 C: 0.003 C: 0.2421 C: 0.0972 C: 0.0169 C: 0.0041 — — NA NA NA G: 0.0581 G: 0.003 G: 0.2421 G: 0.0972 G: 0.0169 G: 0.0041 — — NA NA NA G: 0.0581 G: 0.003 G: 0.2421 G: 0.0972 G: 0.0169 G: 0.0041 G: 0.0036 G: 0.0076 L — — G: 0.1631 G: 0.3782 G: 0.2752 G: 0.0972 G: 0.0229 G: 0.0051 G: 0.2556 G: 0.0108 D/G tolerated(0.1) benign(0) C: 0.1635 C: 0.3797 C: 0.2752 C: 0.0972 C: 0.0229 C: 0.0051 C: 0.305 C: 0.0126 I/V — — T: 0.0581 T: 0.003 T: 0.2421 T: 0.0972 T: 0.0169 T: 0.0041 T: 0.0041 T: 0.0074 S/G — — T: 0.0579 T: 0.003 T: 0.2406 T: 0.0972 T: 0.0169 T: 0.0041 T: 0.0035 T: 0.006 NA NA NA G: 0.0587 G: 0.003 G: 0.2421 G: 0.1002 G: 0.0169 G: 0.0041 — — NA NA NA C: 0.0587 C: 0.003 C: 0.2421 C: 0.1002 C: 0.0169 C: 0.0041 — — T/P — — T: 0.0587 T: 0.003 T: 0.2421 T: 0.1002 T: 0.0169 T: 0.0041 T: 0.0039 T: 0.0075 NA NA NA A: 0.0587 A: 0.003 A: 0.2421 A: 0.1002 A: 0.0169 A: 0.0041 — — NA NA NA A: 0.0599 A: 0.0076 A: 0.2421 A: 0.1002 A: 0.0169 A: 0.0041 — — Y — — T: 0.0601 T: 0.0076 T: 0.2421 T: 0.1002 T: 0.0179 T: 0.0041 T: 0.0118 T: 0.0079 NA NA NA T: 0.0581 T: 0.003 T: 0.2421 T: 0.0972 T: 0.0169 T: 0.0041 — — NA NA NA T: 0.0817 T: 0.0847 T: 0.2522 T: 0.1002 T: 0.0169 T: 0.0041 — — NA NA NA C: 0.0915 C: 0.1157 C: 0.2522 C: 0.1012 C: 0.0229 C: 0.0051 — — NA NA NA A: 0.0847 A: 0.0983 A: 0.2522 A: 0.0972 A: 0.0169 A: 0.0041 — — NA NA NA T: 0.0861 T: 0.1036 T: 0.2522 T: 0.0972 T: 0.0169 T: 0.0041 — — *Table 2A should be read from left to right across both the top and bottem panels.

(188) TABLE-US-00011 TABLE 2B T2D risk credible set at 17p13. Odds Posterior rsID Annotation Ratio p-value Probability rs77086571 SLC16A11 promoter 1.30 8.10 × 10.sup.−13 0.1320 rs74577409 SLC16A11 promoter 1.30 8.22 × 10.sup.−13 0.1320 rs2292351 SLC16A11 5′ UTR 1.30 9.12 × 10.sup.−13 0.1247 rs13342232 SLC16A11 L187L 1.29 1.01 × 10.sup.−12 0.1084 rs13342692 SLC16A11 D127G 1.29 1.14 × 10.sup.−12 0.1003 rs117767867 SLC16A11 V113I 1.29 1.32 × 10.sup.−12 0.0870 rs75418188 SLC16A11 G340S 1.29 1.55 × 10.sup.−12 0.0748 rs17203120 intergenic 1.29 4.16 × 10.sup.−12 0.0290 rs145952323 intergenic 1.29 4.31 × 10.sup.−12 0.0279 rs75493593 SLC16A11 P443T 1.29 4.24 × 10.sup.−12 0.0279 rs75075014 intergenic 1.29 4.45 × 10.sup.−12 0.0274 rs78972129 SLC16A13 intron 1.29 4.94 × 10.sup.−12 0.0246 rs76070643 SLC16A13 Y166Y 1.29 5.10 × 10.sup.−12 0.0232 rs77552976 intergenic 1.29 5.76 × 10.sup.−12 0.0228 rs58223766 intergenic 1.28 8.97 × 10.sup.−12 0.0139 rs4630597 SLC16A13 intron 1.28 9.02 × 10.sup.−12 0.0139 rs113748381 intergenic 1.28 1.28 × 10.sup.−11 0.0104 rs73239895 intergenic 1.28 1.72 × 10.sup.−11 0.0075

(189) Shown in Table 2B is the credible set of T2D-associated variants at the SLC16A11 locus, with annotation, odds ratio, p-value and posterior probability. The first three rsIDs (i.e., rs77086571, rs74577409 and rs2292351) are coding variants proximal to the SLC16A11 transcription start site. In the table, coding variants in SLC16A11 include rs13342232, rs13342692, rs117767867, rs75418188 and rs75493593.

(190) TABLE-US-00012 TABLE 2C T2D risk credible set highlights both non-coding and coding variants. chromosomal posterior cumulative variant annotation position probability probability frequency R2 rs77086571 A11 promoter chr17: 6947393 0.13197 0.13197 0.369 1.00000 rs74577409 A11 promoter chr17: 6947453 0.13197 0.26894 0.369 1.00000 rs2292351 A11 5′ UTR chr17: 6946921 0.12466 0.38860 0.369 0.99394 rs13342232 A11 L187L chr17: 6945940 0.10841 0.49701 0.386 0.92966 rs13342692 A11 D127G chr17: 6946287 0.10033 0.59733 0.386 0.92960 rs117767867 A11 V113I chr17: 6946330 0.08701 0.68434 0.368 0.99670 rs75418188 A11 G340S chr17: 6945483 0.07484 0.75918 0.369 0.99889 rs17203120 between A11 and A13 chr17: 6943989 0.02697 0.78815 0.369 0.99174 rs145952323 between A11 and A13 chr17: 6944349 0.02792 0.81607 0.369 0.99229 rs75493593 A11 P443T chr17: 6945087 0.02792 0.84400 0.369 0.99174 rs75075014 between A11 and A13 chr17: 6944089 0.02741 0.87141 0.369 0.99229 rs78972129 A13 intron chr17: 6942330 0.02455 0.89596 0.369 0.99173 rs76070643 A13 Y166Y chr17: 6941625 0.02824 0.91919 0.369 0.99119 rs77552976 A11 upstream chr17: 6951612 0.02281 0.94201 0.368 0.99345 rs58223766 between A11 and A13 chr17: 6943729 0.01392 0.96598 0.370 0.98637 rs4630597 A13 intron chr17: 6942546 0.01389 0.96991 0.375 0.96899 rs113748381 A11 upstream chr17: 6953155 0.01041 0.98023 0.369 0.97028 rs73239895 A11 upstream chr17: 6953558 0.00753 0.98776 0.369 0.96813 annotation number of variants in credible set within 500 bp of TSSs (A11) 3 exonic (T2O risk coding variants in A11) 6 intronic 2 far from TSSs 7

(191) TABLE-US-00013 TABLE 2D T2D risk credible set at 17p13 and variant frequencies across populations Chromosomal Reference Risk rs ID Position Allele Allele GMAF rs77086571 chr17: 6947393 G C C: 0.0581 rs74577409 chr17: 6947453 C G G: 0.0581 rs2292351 chr17: 6946921 C G G: 0.0581 rs13342232 chr17: 6945940 A G G: 0.1631 rs13342692 chr17: 6946287 T C C: 0.1635 rs117767867 chr17: 6946330 C T T: 0.0581 rs75418188 chr17: 6945483 C T T: 0.0579 rs17203120 chr17: 6943989 T G G: 0.0587 rs145952323 chr17: 6944349 G C C: 0.0587 rs75493593 chr17: 6945087 G T T: 0.0587 rs75075014 chr17: 6944089 G A A: 0.0587 rs78972129 chr17: 6942330 G A A: 0.0599 rs76070643 chr17: 6941625 C T T: 0.0601 rs77552976 chr17: 6951612 C T T: 0.0581 rs58223766 chr17: 6943729 C T T: 0.0817 rs4630597 chr17: 6942546 T C C: 0.0915 rs113748381 chr17: 6953155 G A A: 0.0847 rs73239895 chr17: 6953558 C T T: 0.0861 rs ID AFR_MAF AMR_MAF EAS_MAF EUR_MAF SAS_MAF rs77086571 C: 0.003 C: 0.2421 C: 0.0972 C: 0.0169 C: 0.0041 rs74577409 G: 0.003 G: 0.2421 G: 0.0972 G: 0.0169 G: 0.0041 rs2292351 G: 0.003 G: 0.2421 G: 0.0972 G: 0.0169 G: 0.0041 rs13342232 G: 0.3782 G: 0.2752 G: 0.0972 G: 0.0229 G: 0.0051 rs13342692 C: 0.3797 C: 0.2752 C: 0.0972 C: 0.0229 C: 0.0051 rs117767867 T: 0.003 T: 0.2421 T: 0.0972 T: 0.0169 T: 0.0041 rs75418188 T: 0.003 T: 0.2406 T: 0.0972 T: 0.0169 T: 0.0041 rs17203120 G: 0.003 G: 0.2421 G: 0.1002 G: 0.0169 G: 0.0041 rs145952323 C: 0.003 C: 0.2421 C: 0.1002 C: 0.0169 C: 0.0041 rs75493593 T: 0.003 T: 0.2421 T: 0.1002 T: 0.0169 T: 0.0041 rs75075014 A: 0.003 A: 0.2421 A: 0.1002 A: 0.0169 A: 0.0041 rs78972129 A: 0.0076 A: 0.2421 A: 0.1002 A: 0.0169 A: 0.0041 rs76070643 T: 0.0076 T: 0.2421 T: 0.1002 T: 0.0179 T: 0.0041 rs77552976 T: 0.003 T: 0.2421 T: 0.0972 T: 0.0169 T: 0.0041 rs58223766 T: 0.0847 T: 0.2522 T: 0.1002 T: 0.0169 T: 0.0041 rs4630597 C: 0.1157 C: 0.2522 C: 0.1012 C: 0.0229 C: 0.0051 rs113748381 A: 0.0983 A: 0.2522 A: 0.0972 A: 0.0169 A: 0.0041 rs73239895 T: 0.1036 T: 0.2522 T: 0.0972 T: 0.0169 T: 0.0041
Table 2D provides the T2D risk credible set at 17p13 and variant frequencies across populations. Chromosomal position is hg19/GRC37. GMAF is the general minor allele frequency. The following were used as abbreviation for minor allele frequencies in human populations: AFR: African, AMR: Ad mixed American, EAS: East Asian, EUR: European, and SAS: South Asian.

(192) Other potentially causal variants within the credible set include the previously reported coding variants in SLC16A11 (SIGMA Nature. 2014 Feb. 6, 506(7486):97-101). To improve fine-mapping of this region, the SIGMA results were integrated with the largest available African American genome-wide association meta-analysis data from the MEDIA consortium, Since most of the variants that are common in the SIGMA credible set are absent or rare in the MEDIA data, the updated credible set did not change the previous ranking of variants. However, the two variants that are common in the African American population (rs13342232 and rs13342692) are less strongly associated with T2D.

Example 2

Variants on the T2D Risk Haplotype at 17p13 Decrease SLC16A11 Expression in Liver

(193) The credible set analysis narrowed the search for a potential causal mechanism, and pointed to altered gene expression at the 17p13 locus as a plausible hypothesis. To investigate this further, the expression levels of genes spanned by variants comprising the T2D risk credible set (SLC16A11 and SLC16A13), and three additional genes in the vicinity of this region (BCL6B, CLEC10A, and RNASEK) was examined in T2D-relevant tissues, liver and visceral adipose from Mexican T2D risk haplotype carriers and non-carriers (i.e., individuals from Mexico who carried 0, 1, or 2 copies of the T2D risk haplotype). Gene expression in liver and visceral adipose biopsies was quantified using droplet digital PCR (ddPCR), an extremely sensitive assay that can detect transcripts from lowly-expressed genes such as SLC16A11 (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101), and then analyzed for association with genotype by using variant rs13342692 to tag the T2D risk haplotype, controlling for T2D status, sex, age, and body mass index (BMI).

(194) In liver, SLC16A11 expression was significantly reduced in a dose-dependent manner in carriers of the T2D risk haplotype, (P≈1.4×10.sup.−4), (FIG. 2A (top and bottom panels), FIG. 2B (top panel) and FIG. 2J). Heterozygous individuals had a 42% decrease in SLC16A11 expression with respect to individuals homozygous for the reference allele (n=16 heterozygous and 21 homozygous reference; P=2×10.sup.−3), whereas individuals homozygous for the T2D risk haplotype had a 66% decrease in SLC16A11 expression (n=10 homozygous risk; P=2×10.sup.−5). None of the other genes measured displayed robust genotype-dependent expression changes. A nominal increase in CLEC10A expression was detected in the homozygous reference and homozygous risk comparison (33% increase, P=0.04) for one of the probes, but this was not replicated with a second probe. None of the genes tested displayed altered expression in visceral adipose (FIG. 2C (top panel)). Information about the quantitative traits of liver and visceral adipose eQTL donors are provided at FIG. 2J (top panel) and for donors for liver RNA-sequencing analysis at FIG. 2J (bottom panel). The sensitive droplet digital PCR assay used was unable to detect any changes in RNASEK expression, for which the T2D risk haplotype was recently reported to have an eQTL effect in subcutaneous adipose, skeletal muscle, and whole blood cells (Traurig, M. et al., 2016, Diabetes, 65:510-519). These results provide evidence that the T2D risk haplotype contains an eQTL affecting SLC16A11TL expression in human liver, one of the tissues in which SLC16A11 is most highly expressed (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101) and a tissue in which disruption of metabolic processes is implicated in T2D pathophysiology. (Muoio, D. M. and Newgard, C. B., 2008, Nat Rev Mol Cell Biol, 9:193-205; Perry, R. J. et al., 2014, Nature, 510: 84-91).

Example 3

SLC16A11 Expression and H3K27ac Marks are Skewed in Heterozygous Carriers of the T2D Risk Haplotype

(195) Altered SLC16A11 gene expression could result from a direct effect of T2D risk variants on transcript levels or an indirect result from other cellular processes altered by T2D risk haplotype variants. By way of example, the T2D-risk variants could reduce SLC16A11 gene expression by acting directly in cis (affecting expression of the SLC16A11 allele carried on the risk haplotype) or indirectly in trans (affecting other cellular processes that feedback on SLC16A11 expression on both haplotypes). To determine whether the observed reduction in SLC16A11 expression in carriers of the T2D risk haplotype resulted from a decrease in SLC16A11 transcript originating from the chromosome carrying the T2D risk haplotype, allele-specific ddPCR probes that distinguish the reference and risk allele at rs13342692 were used to measure allelic SLC16A11 expression in the 16 heterozygous liver samples. Consistent with the idea that variants on the T2D risk haplotype are directly responsible for the reduced expression in carriers, SLC16A11 transcript expression is skewed, with 73% of the transcript originating from the reference allele and 27% from the T2D risk allele (P=1×10.sup.−9, FIG. 2B (bottom) and FIG. 2C (bottom)). This allelic effect size is in line with the 66% reduction in total SLC16A11 transcript levels found in T2D risk allele homozygotes.

(196) To confirm the findings from intact liver, allelic SLC16A11 expression ex vivo was examined using primary human hepatocytes from T2D risk haplotype heterozygous donors (Table 3; cells from Bioreclamation IVT).

(197) TABLE-US-00014 TABLE 3 Allelic SLC16A11 expression ex vivo using primary human hepatocytes from T2D risk haplotype. Donor Hepatocyte lot Genotype number (Bioreclamation IVT) (heterozygote for) d1 ACB T2D risk haplotype d2 BEB T2D risk haplotype d3 DSX T2D risk haplotype d4 NQA T2D risk haplotype d5 PAA T2D risk haplotype d6 QSK T2D risk haplotype d7 AIH African haplotype d8 FRY African haplotype d9 GEB African haplotype d10 JLP African haplotype d11 KDD African haplotype d12 NRE African haplotype d13 ZBG African haplotype d14 ZXO African haplotype

(198) As was observed in vivo, SLC16A11 transcript expression is skewed in primary hepatocytes, with 73% of the transcript originating from the reference allele and 27% from the T2D risk allele (n=6; P=1×10.sup.−3, FIG. 2D and FIG. 2F). Interestingly, allelic SLC16A11 expression is not skewed in human primary hepatocytes from individuals heterozygous for the African haplotype at this locus (FIG. 2D and FIG. 2G). Using the largest available African-American genome-wide association meta-analysis from the MEDIA consortium, involving 8,284 cases and 15,543 control individuals (Ng, M. C. et al., 2014, PLoS Genet 10, e1004517), no significant association with T2D risk was found: the two-coding-variant haplotype in African-Americans had an odds ratio of ˜1.06 (P≈0.08), whereas the five-coding-variant haplotype in Mexico had an odds ratio of ˜1.29 (P≈1.7×10.sup.−11 to 8.1×10.sup.−13) in the Mexican study. When comparing the effect sizes between the two studies, a statistically significant heterogeneity was seen (P.sub.HET≈4.1×10.sup.−5). As the African haplotype carries two coding variants (r513342692 and r513342232) (SIGMA Nature. 2014 Feb. 6; 506(7486):97-101) and essentially none of the other variants were in the T2D risk credible set, this suggests that the two coding variants present at high frequency in Africa, rs13342692 and rs13342232, are not sufficient to cause an association with T2D or confer skewed SLC16A11 gene expression and that the SLC16A11 cis-eQTL in human liver may not be present in individuals of African descent.

(199) To further characterize the context of T2D risk haplotype-associated changes in SLC16A11 expression, the epigenetic state of this locus was examined. The allele-specific regulatory landscape in primary human hepatocytes from three heterozygous carriers of the T2D risk haplotype was ascertained by performing ChIP-sequencing on several histone modifications (FIG. 2E (top panel and bottom panel), Table 3 and Table 4), including H3K27ac (active enhancer and promoter mark), H3K4me3 (associated with promoters and transcription start sites), and H3K4me1 (associated with enhancers).

(200) TABLE-US-00015 TABLE 4A chrom pos mark d1_counts d3_counts d6_counts d1_pvals d3_pvals d6_pvals metap signif chr17 6941625 H3K27ac 88.101 61.59 None 0.38278459 0.92731502 None 0.72261185 FALSE chr17 6941625 H3K4me1 15.14 10.10 None 1 1 None 1 FALSE chr17 6941625 H3K4me3 83.95 83.75 None 0.40973607 0.57774284 None 0.57780747 FALSE chr17 6941625 input 3.5 1.2 None 0.7265625 1 None 0.95864892 FALSE chr17 6942330 H3K27ac 77.57 36.45 None 0.1003657 0.37417442 None 0.16080622 FALSE chr17 6942330 H3K4me1 26.12 14.26 None 0.03355244 0.08069047 None 0.01871269 FALSE chr17 6942330 H3K4me3 19.23 25.15 None 0.64396896 0.15385994 None 0.32813826 FALSE chr17 6942330 input 3.2 2.1 None 1 1 None 1 FALSE chr17 6942546 H3K27ac 42.16 17.32 None 0.00086178 0.04438416 None 0.0004273 FALSE chr17 6942546 H3K4me1 5.22 5.8 None 0.00151372 0.58105469 None 0.00706818 FALSE chr17 6942546 H3K4me3 5.12 7.9 None 0.14346313 0.80361938 None 0.36435099 FALSE chr17 6942546 input 4.4 5.7 None 1 0.77441406 None 0.97239192 FALSE chr17 6943989 H3K27ac 14.10 8.8 7.16 0.54125619 1 0.09313965 0.42599241 FALSE chr17 6943989 H3K4me1 28.11 22.10 31.17 0.0094753 0.05010246 0.05946338 0.00187272 TRUE chr17 6943989 input 6.1 0.2 2.1 0.125 0.5 1 0.4760133 FALSE chr17 6944089 H3K27ac 6.6 3.12 14.7 1 0.03515625 0.18924713 0.12359025 FALSE chr17 6944089 H3K4me1 17.23 19.16 31.22 0.42959051 0.7358788 0.27167917 0.55547285 FALSE chr17 6944089 input 4.1 1.1 3.3 0.375 1 1 0.92319085 FALSE chr17 6944349 H3K4me1 13.16 12.17 22.19 0.7110711 0.45825832 0.75522866 0.83300457 FALSE chr17 6945087 H3K4me1 9.9 5.5 15.12 1 1 0.70110804 0.99426858 FALSE chr17 6945087 input 3.3 3.0 0.1 1 0.25 1 0.8368001 FALSE chr17 6945483 H3K4me1 6.6 10.0 12.14 1 0.00195313 0.84501898 0.04609604 FALSE chr17 6945483 input 0.1 3.2 4.1 1 1 0.375 0.92319085 FALSE chr17 6945940 H3K27ac 6.9 10.3 9.7 0.60723877 0.09228516 0.80361938 0.4010907 FALSE chr17 6945940 H3K4me1 16.12 5.15 7.15 0.57158819 0.04138947 0.13380051 0.07381178 FALSE chr17 6945940 H3K4me3 15.18 39.10 6.8 7.28E−01 3.85E−05 0.79052734 0.00153134 FALSE chr17 6945940 input 2.1 3.1 0.2 1 0.625 0.5 0.88737835 FALSE chr17 6946287 H3K27ac 16.10 14.15 13.7 0.32693958 1 0.26317596 0.55594745 FALSE chr17 6946287 H3K4me1 19.11 13.14 11.30 0.20048842 1 0.004324 0.02852651 FALSE chr17 6946287 H3K4me3 19.14 26.20 12.10 0.48685024 0.46139118 0.8318119 0.76316196 FALSE chr17 6946287 input 4.3 1.1 1.2 1 1 1 1 FALSE chr17 6946330 H3K27ac 20.6 9.16 11.8 0.00935531 0.22952294 0.6476059 0.04062336 FALSE chr17 6946330 H3K4me1 23.9 17.7 13.32 0.02006161 0.06391466 0.00660882 0.00068531 FALSE chr17 6946330 H3K4me3 21.10 26.17 9.9 0.07075555 0.22205282 1 0.21648176 FALSE chr17 6946330 input 3.2 2.0 1.3 1 0.5 0.625 0.88737835 FALSE chr17 6946921 H3K27ac 42.27 69.10 35.8 9.12E−02 5.54E−12 4.19E−05 1.64E−14 TRUE chr17 6946921 H3K4me1 3.14 17.7 9.15 0.01272583 0.06391466 0.30745625 0.01092499 FALSE chr17 6946921 H3K4me3 77.91 81.58 58.39 0.31587491 0.06164934 0.0670518 0.03877028 FALSE chr17 6946921 input 5.4 0.1 3.2 1 1 1 1 FALSE chr17 6947393 H3K27ac 6.17 23.7 8.3 0.03468966 0.00522288 0.2265625 0.00254967 FALSE chr17 6947393 H3K4me1 14.13 11.7 12.13 1 0.48068237 1 0.96177923 FALSE chr17 6947393 H3K4me3 23.36 26.27 23.14 0.11747735 1 0.18774156 0.26661106 FALSE chr17 6947393 input 4.0 0.5 2.6 0.125 0.0625 0.2890625 0.05793972 FALSE chr17 6947453 H3K27ac 9.15 22.7 6.3 0.30745625 0.00813006 0.5078125 0.03796454 FALSE chr17 6947453 H3K4me1 25.15 14.9 13.13 0.15385994 0.40487289 1 0.4752195 FALSE chr17 6947453 H3K4me3 22.24 21.20 9.14 0.88299591 1 0.40487289 0.91436024 FALSE chr17 6947453 input 5.2 0.2 0.4 0.453125 0.5 0.125 0.30914032 FALSE chr17 6951612 input 3.7 3.2 3.3 0.34375 1 1 0.90680646 FALSE chr17 6953155 input 5.0 2.0 1.5 0.0625 0.5 0.21875 0.12587336 FALSE chr17 6953558 input 0.1 3.4 2.1 1 1 1 1 FALSE

(201) Consistent with reduced SLC16A11 promoter activity from the T2D risk allele, H3K27ac marks near the variant located in the SLC16A11 5′UTR are significantly biased toward the reference allele at the expense of the T2D risk allele (r52292351; P=2×10.sup.−14). Aside from H3K4me1 marks near rs17203120 being skewed in favor of the reference allele (P=2×10.sup.−3 no additional significant allelic-skews in chromatin marks near other variants in the T2D risk credible set) were observed (FIG. 2H).

(202) Together, these data demonstrate the presence of a SLC16A11 cis-eQTL in human liver on the T2D risk haplotype, providing support for SLC16A11 as a likely casual gene at this locus and indicating reduced SLC16A11 function as the disease-relevant direction of effect.

Example 4

SLC16A11 Expression is Skewed in Heterozygous Carriers of the T2D Risk Haplotype

(203) In principle, the T2D-risk variants could reduce SLC16A11 gene expression by acting directly in cis (affecting expression of the SLC16A11 allele carried on the risk haplotype) or indirectly in trans (affecting other cellular processes that feedback on SLC16A11 expression on both haplotypes). To distinguish between these possibilities, the expression levels from the T2D-risk and reference (non-risk) haplotypes were compared in liver samples from 16 heterozygous individuals. Expression from the two haplotypes was measured by ddPCR, with probes that distinguish between the reference and risk allele at rs13342692. The results provide strong support for a cis-effect: expression from the risk allele is 62% lower than from the non-risk haplotype (P=2×10.sup.−73, FIG. 2B bottom panel and FIG. 2C bottom panel) consistent with the 66% lower expression level seen in homozygotes for the risk haplotype than the non-risk haplotype.

(204) A similar allelic skew was observed in primary hepatocytes, cultured ex vivo from 6 heterozygous individuals: expression from the risk haplotype is 66% lower than from the non-risk haplotype (P=2×10.sup.−63, FIG. 2F and FIG. 2G). Notably, no allelic skew was found in primary hepatocytes from individuals heterozygous for the African haplotype (FIGS. 2D and 2E (bottom panel)). These analyses indicate that the two coding variants present at high frequency in Africa, rs13342692 and rs13342232, are not alone sufficient to cause the association with T2D or confer skewed gene expression of SLC16A11, and that the SLC16A11 cis-eQTL in human liver is not present in these individuals of African descent.

Example 5

Allelic Imbalance of Histone Modifications in Carriers

(205) Experiments were conducted to determine whether the lower expression of SLC16A11 from the T2D risk haplotype is associated with chromatin structure in cis, indicative of altered transcription at the gene. The chromatin landscape on each haplotype was examined, in hepatocytes, from 3 heterozygous individuals by performing ChIP-sequencing for several histone modifications, including H3K27ac (active enhancer and promoter mark), H3K4me1 (associated with enhancers), and H3K4me3 (associated with promoters and transcription start sites) (Encode Project Consortium, 2012, Nature, 489:57-74). It was noted that peaks obtained from the histone modification ChIP-sequencing dataset are consistent with data at 17p13 (FIG. 2E, bottom panel). Consistent with reduced SLC16A11 promoter activity from the T2D risk allele, the expected allelic skew (69% lower from the T2D risk allele) was observed for the activating mark H3K27ac at a variant located near the 5′-end of SLC16A11 (r52292351; P=2×10.sup.−14, FIG. 2E top panel). The result is significant after Bonferroni correction for multiple hypothesis testing, and no additional significant allelic-skews in chromatin marks near other variants in the T2D risk credible set (FIG. 2H).

(206) ChIP-sequencing generates genome-wide data, but for a single locus it might not provide enough read counts to enable allelic imbalance studies with sufficient power. Consequently, the data lead to analysis of the ChIP libraries and next targeted PCR amplification of regions spanning T2D risk credible set variants, followed by sequencing the resulting amplicons. Of particular interest, were variants in which the coding sequence of SLC16A11. Given that the data points to reduced SLC16A11 transcription from the T2D risk haplotype, it may be expected that H3K4me3, a mark associated with active promoters and transcript start sites, to be skewed in favor of the reference haplotype over the T2D risk haplotype. Reductions in H3K4me3 were observed from the T2D risk allele at rs117767867 (46% decrease; P=0), rs13342692 (42% decrease; P=0), and rs13342232 (36% decrease; P=0) (FIG. 2I). These variants correspond to the missense mutations V113I, D127G, and L187L respectively, and are the closest coding variants to the SLC16A11 transcription start site. These data further support decreased SLC16A11 transcription from the chromosome carrying the T2D risk haplotype.

(207) Together, these data demonstrate the presence of a SLC16A11 cis-eQTL in liver carried on the risk haplotype, providing support for SLC16A11 as a causal gene at this locus and indicating decreased SLC16A11 function as the disease-relevant direction of effect.

Example 6

rs77086571 Reduces Luciferase Reporter Activity from a Fragment Containing the SLC16A11 Promoter and 5′ UTR

(208) Next experiments investigated whether variants of the T2D risk haplotype alter expression of a luciferase reporter in-vitro. Given that decreased SLC16A11 expression is associated with the T2D risk haplotype, of particular interest would be whether a single variant reduces luciferase reporter activity. The experiments focused on the three non-coding variant(s) proximal to the SLC16A11 transcription start site (r577086571, rs74577409, and r52292351) for the following reasons: 1) these variants rank as the most likely causal variants in the T2D risk credible set (Table 2B) and 2) these variants are located in the proximal promoter and the 5′ UTR of SLC16A11 making them likely candidates for altering SLC16A11 expression. Non-coding and coding variants are highlighted by the T2D risk credible set and are show in Table 2C.

(209) A 767 bp fragment was cloned into a luciferase reporter vector. This fragment spans 425 bp upstream of the SLC16A11 transcription start site (TSS) to the start of a repetitive region and 342 bp downstream of the SLC16A11 TSS to the initiator methionine of SLC16A11 (FIG. 3I, top panel). The construct containing the fragment with the reference alleles at rs77086571, rs74577409, and rs2292351 is denoted as REF and the construct with T2D risk alleles at all three of these variants as RISK. A panel of cell lines was transfected with REF and RISK: HEK293T, HepG2, HuH7, and SNU761 cells. Reduced luciferase reporter activity was noted in the presence of all three T2D risk alleles in all four of these cell lines (FIG. 3I, middle panel).

(210) In order to dissect which individual variant is sufficient to reduce reporter activity, three additional luciferase reporter constructs were made with each variant individually (FIG. 3I (bottom panel)). HEK293T cells were transfected and with respect to REF: a 20% decrease was obtained with RISK (P=9×10.sup.−4), a 28% decrease with −rs77086571 (P=5×10.sup.−5), and a 12% increase with rs74577409 (P=4×10.sup.−3). rs2292351 and rs9303212 did not significantly alter luciferase reporter activity. The variant rs9303212, found in Mexico and Latin America, was included due to its genomic location between rs77086571 and rs74577409, but is not part of the T2D risk credible set. Together, these data indicate that a single variant rs77086571 is sufficient for reduced reporter activity. The location of SNPs for variants are shown by FIG. 3J (top panel). A motif analysis elucidated the sequences that result in altered transcription factor binding at variants in the SLC16A11 promoter (FIG. 3K).

Example 7

Metabolic Processes are Altered in Livers from T2D Risk Haplotype Carriers

(211) In order to investigate which cellular pathways are altered in liver from individuals carrying the T2D risk haplotype, RNA-sequencing was performed in 8 homozygotes for the risk haplotype (RISK) and 8 homozygotes for the reference haplotype (REF). All individuals were female and there were no significant differences in age, BMI, fasting glucose, total cholesterol, triglycerides, HDL cholesterol, insulin, Hb1Ac, systolic BP, or diastolic BP. In addition within each genotype, there were 4 individuals with type 2 diabetes (T2D) and 4 non-diabetics (CNTRL).

(212) The following Table 4B shows the down-regulated metabolic processes in liver from carriers of the T2D risk haplotype.

(213) TABLE-US-00016 TABLE 4B size NES p-value FDR COMPLEMENT & COAGULATION CASCADES 69 −2.40 0.000 0.000 CITRATE CYCLE TCA CYCLE 29 −2.38 0.000 0.000 DRUG METABOLISM OTHER ENZYMES 51 −2.22 0.000 0.000 PPAR SIGNALING PATHWAY 63 −2.23 0.000 0.001 PARKINSONS DISEASE 104 −2.11 0.000 0.001 PORPHYRIN & CHLOROPHYLL METABOLISM 40 −2.13 0.000 0.001 VALINE LEUCINE & ISOLEUCINE DEGRADATION 43 −2.09 0.000 0.001 OXIDATIVE PHOSPHORYLATION 107 −2.08 0.000 0.001 HUNTINGTONS DISEASE 163 −2.00 0.000 0.002 PENTOSE PHOSPHATE PATHWAY 23 −2.00 0.000 0.002 FATTY ACID METABOLISM 42 −2.01 0.000 0.002 LYSOSOME 114 −2.02 0.000 0.002 FRUCTOSE & MANNOSE METABOLISM 34 −2.02 0.000 0.002 PENTOSE & GLUCURONATE INTERCONVERSIONS 26 −2.03 0.000 0.002 PROTEASOME 43 −1.94 0.000 0.004 BUTANOATE METABOLISM 31 −1.93 0.000 0.004 ADIPOCYTOKINE SIGNALING PATHWAY 61 −1.92 0.000 0.004 SPLICEOSOME 123 −1.91 0.000 0.004 PYRUVATE METABOLISM 38 −1.89 0.000 0.004 ASCORBATE & ALDARATE METABOLISM 24 −1.89 0.000 0.004

(214) Top 20 pathways with an FDR<0.05 are shown. Size refers to the gene set size, NES stands for normalized enrichment score, and FDR stands for false discovery rate.

(215) In the RISK versus REF comparison, a single gene APOA4 was significantly altered after correcting for multiple hypothesis testing (50% decrease; P=9×10.sup.−7). As expected SLC16A11 was one of the most significantly altered genes ranking 55 out of over 20,000 genes tested for differential expression (38% decrease; P=3×10.sup.−4). It is noted that SLC16A11 is expressed in liver at low levels and hence precise quantification of a change in expression by RNA-sequencing is challenging. Despite this caveat, SLC16A11 was the most differentially expressed gene within 100 kb of rs77086571 and among all SLC16 family members in the RISK versus REF comparison.

Example 8

Metabolomics Analysis of Human Liver Cell Line Expressing SLC16A11.SUP.REF

(216) Unbiased approaches, such as metabolomics and phenotype microarrays, were used to generate hypotheses about what substrates SLC16A11REF, the protein encoded by the non-risk haplotype, might transport. Next, target assays were used to test whether individual metabolites are transported by SLC16A11.

(217) SLC16A11.sup.REF was expressed in HuH7, a human hepatoma cell line, and after 72 hours samples were collected to measure steady-state levels of over 150 metabolites by mass spectrometry. The 18 biological replicates of SLC16A11.sup.REF and 24 controls (denoted by CNTRL and consisting of BFP, GFP, HcRed, and Luciferase) were profiled across two different experiments. The data indicated that the levels of 10 intracellular metabolites in HuH7 cells were significantly altered (P<10.sup.−5) by expression of SLC16A11.sup.REF (Table 5B). Since members of the SLC16 family transport monocarboxylates, experiments were conducted to identify which of these metabolites had a single carboxylate group and found: pantothenate, glutathione-oxidized, lactate, GABA, pyruvate, and asparagine. Of particular interest are pyruvate and lactate because SLC16 family members transport both (FIG. 3K).

(218) Perturbing a transporter and observing significantly altered metabolites does not directly provide evidence that the altered metabolites are substrates for the transporter. Conversely, it is not necessarily expected that the steady state levels of a substrate will be altered by perturbing its transporter. This is due to redundancy in transporters and significant overlap among metabolic pathways. Results from these experiments were combined with other information to generate hypotheses about what substrates SLC16A11 might transport, which were then tested with targeted assays.

Example 9

SLC16A11 is an H.SUP.+.-Coupled Monocarboxylate Transporter

(219) To better understand the consequence of reduced SLC16A11 activity on T2D risk, the function of this previously uncharacterized protein was assessed. As noted supra, characterized members of the SLC16 family can be segregated into, at least, two distinct categories: chaperone-dependent, H.sup.+-coupled monocarboxylate transporters (category I) or facilitators of hydrophobic monocarboxylate diffusion (category II), with SLC16A11 falling into a third category of as-yet-uncharacterized transporters (Table 5A).

(220) TABLE-US-00017 TABLE 5A SLC16A family of monocarboxylate transporters. Category Family member Primary substrates Mechanism Ancillary proteins I SLC16A1 Pyruvate, Lactate, H.sup.+ coupled Basigin (BSG) SLC16A3 Ketone bodies Embigin (EMB) SLC16A7 SLC16A8 Lactate II SLC16A2 T3, T4 hormones Facilitated No interaction SLC16A10 Aromatic amino diffusion — acids Uncharacterized SLC16A6 β-hydroxybutyrate — — SLC16A9 Carnitine Not H.sup.+ coupled SLC16A4 — — SLC16A5 SLC16A11 SLC16A12 SLC16A13 SLC16A14 Table 5A: Categorization of SLC16 family members with transport substrates, mechanism, and ancillary proteins indicated. SLC16A11 (in bold) is an uncharacterized member of the family.

(221) To gain insight into which category SLC16A11 might reside, the structures of category I and category II SLC16 family members was compared to identify structural motifs corresponding to the differences in function. Previously, transmembrane domains (TMDs) 1 and 8 have been highlighted as mediating the catalytic core in SLC16A1, with charged residue K38 on TMD 1 and residues D309 and R313 on TMD 8 singled out as mediating monocarboxylate transport. While R313 is present in all six members of the two categories, multiple sequence alignment revealed that residues K38 and D309 are only conserved in the four category I SLC16 proteins, but are replaced by non-charged residues in SLC16 proteins identified as category II (FIG. 3A). In SLC16A11, the charges at these positions are conserved and correspond to positions R57, D290, and R294. Three-dimensional homology modeling of SLC16A11 based on the bacterial glycerol-3-phosphate transporter (G1PT) supports this finding, placing these three residues in the inner pore of the protein in a similar fashion as modeled for SLC16A1 (FIG. 3B). These structural analyses suggest SLC16A11 is a category I SLC16 family member, and would thus transport monocarboxylates via a H.sup.+-coupled mechanism. To study the transport properties of SLC16A11, the protein encoded by the non-risk haplotype, denoted SLC16A11 (or SLC16A11.sup.REF), and the protein encoded by the risk haplotype—which contains all five coding variants found on the T2D risk allele (denoted SLC16A11.sup.T2D) were studied.

(222) To inform the development of an assay to monitor substrate transport, experiments were conducted to verify the subcellular localization of SLC16A11. Through immunofluorescent imaging, previously conducted experiments reported that V5-tagged SLC16A11 localizes to the endoplasmic reticulum (SIGMA Nature. 2014 Feb. 6; 506(7486): 97-101). Other SLC16 family members have been reported to localize to the plasma membrane as well as to intracellular membranes. To explore the possibility that SLC16A11 is also present at the cell surface, membrane extraction assays were performed with HEK293T (“293T”) cells expressing SLC16A11. Consistent with previous findings, the majority of SLC16A11 remains associated with intracellular membranes (FIG. 3C). Nevertheless, a portion (5%) of SLC16A11 localized to the plasma membrane, indicating it might modulate metabolite transport across the plasma membrane.

(223) To obtain “proof of concept” for monocarboxylate transport by SLC16A11, pyruvate was focused on as the metabolite transported by all four SLC16 category I proteins, whose real-time transport in mammalian cells can be readily studied by the pyruvate FRET sensor, pyronic. 293T cells were co-transfected with pyronic and either empty vector control or SLC16A11-V5, which increases SLC16A11 levels without affecting other category I family members (FIG. 3M). Cells were perfused in physiological pH 7.4 Ringer's solution and 0.4 mM pyruvate was added at the indicated time point (FIG. 3D), resulting in an increase of the fluorescence signal, indicative of pyruvate uptake. This signal is completely diminished upon pre-incubation of the cells with AR-C155858 (FIG. 3H), a chemical inhibitor of SLC16A1 and SLC16A7 transport. Thus, this is consistent with the increase in fluorescence resulting from SLC16-dependent pyruvate transport.

(224) Influx (rising phase) and efflux (falling phase) rates of pyruvate transport were compared in SLC16A11-expressing and control cells. Pyruvate transport rates in both directions were found to be ˜45% higher in cells expressing SLC16A11 (FIG. 3E), supporting the idea that SLC16A11 is a category I monocarboxylate transporter. Similar patterns of bi-directional transport have been previously reported for other members of the SLC16 family. A difference between SLC16A11-expressing cells and control cells was only observed at neutral pH, likely due to activation of other, endogenous SLC16 family members at acidic pH. (FIG. 3N).

(225) To assess if SLC16A11 utilizes a H.sup.+-coupled transport mechanism similar to other category I family members, pH changes were monitored in SLC16A11-expressing and control 293T cells using BCECF-AM, a pH-sensitive fluorescent probe. An ˜40% increase in the rates of acidification and alkalization was observed, with both phases reciprocal to influx and efflux of pyruvate, supporting a H.sup.+-coupled mechanism underlying SLC16A11 transport (FIG. 3F and FIG. 3G).

(226) To further support this finding, SLC16A11 mRNA was injected into Xenopus oocytes, following which labeled pyruvate was added to the media. Oocytes were then lysed and labeled, and pyruvate uptake was monitored by a scintillation counter. Expression of SLC16A11 was sufficient to provide for pyruvate uptake (FIG. 8A), and SLC16A11 affinity to pyruvate was found to be higher than that of SLC16A1 (FIG. 8B).

(227) Expression of SLC16A11 in oocytes was sufficient to provide for pyruvate uptake. SLC16A11 has higher affinity to pyruvate and greater translocation efficiency. To determine if SLC16A11 modulates steady state levels of cellular pyruvate, metabolic profiling was performed on a human liver cell line, HuH7, expressing WT SLC16A11 or control proteins. Expression of WT SLC16A11 resulted in a 22% increase in steady-state cellular pyruvate levels (P=9×10.sup.−7) (FIG. 4E). Similarly, intracellular levels of lactate, a derivative of pyruvate and a substrate for other SLC16 category I transporters, increased by 29% (P=1×10.sup.−7) (FIG. 4F). These results support the notion that SLC16A11 plays a role in monocarboxylate transport.

(228) Thus, bioinformatic analyses combined with transport assays firmly place SLC16A11 into category I with other H.sup.+-coupled, monocarboxylate transporters.

Example 10

T2D Risk Coding Variants Attenuate SLC16A11 Transport Activity

(229) The T2D risk haplotype contains five variants in the coding sequence of SLC16A11: four of these are missense variants and result in amino acid altering mutations (V113I, D127G, G340S, and P443T), and one is a silent variant (L178L). These SLC16A11 haplotypes and the frequency at which they occur in certain populations are shown in FIG. 4G. The positions of single nucleotide polymorphism (SNP) locations for V113I, D127G, G340S, and L187L are depicted on a SLC16A11 ribbon diagram (FIG. 5A, top panel).

(230) To determine if these coding changes altered SLC16A11 function, the transport activity of wild-type (WT, the human reference protein) and T2D risk SLC16A11 (the mutant protein resulting from the presence of all five T2D risk-associated coding variants) was compared. Using the pyronic based assay in 293T cells, pyruvate transport rates of WT and T2D risk SLC16A11 were compared (FIG. 4A). Pyruvate influx and efflux rates mediated by T2D risk SLC16A11 were found to be approximately half that of WT SLC16A11 (FIG. 4B). Similarly, proton transport rates were reduced in T2D risk SLC16A11 expressing cells, when compared to WT SLC16A11 (SLC16A11.sup.REF) expressing cells (FIG. 4C and FIG. 4D, top panel). FIG. 4E and FIG. 4F show normalized abundance of pyruvate and lactate in wild-type and control cells. These data demonstrate that the T2D risk-associated coding variants resulted in reduced SLC16A11 transport activity, consistent with the disease-relevant direction of effect observed for the SLC16A1 cis-eQTL.

(231) TABLE-US-00018 TABLE 5B Significantly altered metabolites in HuH7 cells expressing SLC16A11.sup.REF. Intracellular polar metabolites significantly altered in the SLC16A11.sup.REF versus CNTRL comparison (p-value < 10-5) Metabolite name Percent change p-value pantothenate −32% 6.79 × 10.sup.−11 glutathione-oxidized −33% 4.12 × 10.sup.−8 C5-carnitine 10% 1.01 × 10.sup.−7 lactate 29% 1.28 × 10.sup.−7 GABA −37% 1.29 × 10.sup.−7 2-aminoadipate 31% 1.58 × 10.sup.−7 pyruvate 22% 9.27 × 10.sup.−7 asparagine −17% 1.36 × 10.sup.−5 inositol 29% 3.19 × 10.sup.−6 lactose 16% 7.17 × 10.sup.−6 guanosine −30% 8.38 × 10.sup.−6

(232) In addition to steady-state measurement of metabolite levels, flux was measured through metabolic pathways. SLC16A11.sup.REF or an empty vector control was expressed in HepG2, a human hepatocellular carcinoma cell line, and used phenotype microarrays to determine rates of metabolite utilization. A phenotype microarray is a 96-well plate where each well contains a unique metabolite that serves as an energy source. Cells are grown in minimal media in order to consume their internal energy stores. After this, they consume the metabolite found in the well. Energy status of the cells is by measuring the NADH reduction of a tetrazolium dye.

(233) Data were collected for 4 biological replicates of SLC16A11.sup.REF and empty vector control in one experiment, enabling the simultaneous analysis of the utilization rates of more than 90 metabolites. A phenotype microarray was profiled that consisted of carbon and other energy sources, and found that utilizations of the following three metabolites were significantly altered (P<0.05) upon the expression of SLC16A11.sup.REF: pyruvate, lactate, and acetate (FIG. 3L). Together with the metabolomics analysis in HuH7 cells, these data indicate that SLC16A11 likely alters pyruvate and lactate levels, perhaps by mediating transport of these metabolites.

(234) In other analyses, the metabolites pyruvate, lactate and glucose were found to alter SLC16A11 protein levels in HuH7 cells stably expressing SLC16A11 and cultured with these metabolites (FIG. 19). FIG. 20 provides results of experiments showing that glucose deprivation of HuH7 cells stably expressing SLC16A11 resulted in a rapid decrease of SLC16A11 protein levels. FIG. 21 provides results of experiments showing that pyruvate and lactate alter protein levels of SLC16A11 in HuH7 cells stably expressing SLC16A11 and cultured in the presence of these metabolites at high and low concentrations.

Example 11

SLC16A11 Runs as a Doublet Under Reducing SDS-PAGE Conditions

(235) The data indicated that the SLC16A11 protein generates a doublet under reducing SDS-PAGE conditions. Remarkably the ratio of the lower to upper band of the doublet is consistently reduced for SLC16A11.sup.T2D compared to SLC16A11.sup.REF (FIG. 4D (bottom panel)). It was hypothesized that a post-translational modification of SLC16A11 might be resulting in the doublet.

(236) Mass spectrometry was used to search for phosphorylated residues on SLC16A11. Detecting membrane proteins by mass spectrometry is challenging, but eventually this technique was able to achieve 78% coverage of SLC16A11.sup.T2D. Despite good coverage, phosphorylated residues were not detected.

(237) The data indicated that the SLC16A11 doublet is sensitive to the amount of glycerol present when running the SLC16A11 protein on a reducing SDS-PAGE gel. Phosphatase treatment was able to resolve the SLC16A11 doublet but this was attributed to the glycerol that was used to stabilize the phosphatase. In addition, data indicated that the SLC16A11 doublet was sensitive to the reducing agent used to prepare samples before they were run on a SDS-PAGE gel. Beta-mercaptoethanol, but not dithiothreitol, was able to resolve the doublet.

(238) Together this data indicated that the SLC16A11 doublet is most likely a result of incomplete denaturation of the protein under reducing SDS-PAGE conditions. This can occur for some membrane proteins. When combined with the altered ratio of the doublet for SLC16A11.sup.T2D, this might indicate that SLC16A11.sup.T2D adopts a slightly different conformation from SLC16A11.sup.REF. This could affect how SLC16A11.sup.T2D sits in the membrane and consequently might affect transport or protein-protein interactions.

Example 12

SLC16A11 Interacts with SLC16 Category I Ancillary Proteins

(239) There are a number of mechanisms by which the T2D risk-associated coding variants could reduce SLC16A11 activity. Based on the SLC16A11 homology model, the T2D risk coding variants are distant from the putative catalytic site formed between TMDs 1 and 8 (FIG. 5A (top panel)). This data indicates that the T2D risk coding variants are unlikely to directly interfere with transport.

(240) Alternatively, these variants may result in reduced transport because they disrupt protein-protein interactions responsible for correct SLC16A11 function. To explore this possibility, SLC16A11 was immunoprecipitated from HEK293T cells expressing either REF or T2D risk SLC16A11-V5 or empty vector control and quantitative mass spectrometry was used to define the SLC16A11 interactome. Comparable levels of SLC16A11.sup.REF and SLC16A11.sup.T2D protein expression was achieved (FIG. 5F, bottom panel).

(241) Another mechanism through which the variants could affect activity is through disruption of protein-protein interactions. To explore this possibility, quantitative mass spectrometry-based protein-protein interaction studies were performed to define the SLC16A11 interactome and evaluate if the T2D risk coding variants alter any interactions. FIG. 5B, top right panel shows SLC16A11.sup.REF protein-protein interactions with a plot showing the enrichment of protein immunoprecipitated from HECK293T cells expressing P2D SLC16A11.sup.REF-V5 compared to cells expressing empty vector control. Putative proteins that interact with SLC16A11 are shown in Table 5C.

(242) TABLE-US-00019 TABLE 5C Putative SLC16A11 Interactors (top 20/53). geneSymbol proteinName B.A. logFC B.A. P.Value B.A. adj.P.Val SEC61A1 Protein transport protein Sec61 subunit 1.84 1.42E−05 3.26E−03 DHCR7 7-dehydrocholesterol reductase 1.69 4.15E−05 3.26E−03 EMC3 ER membrene protein complex 1.65 7.04E−05 3.26E−03 subunit SLC25A3 Phosphate carrier protein, 1.65 1.11E−05 3.26E−03 mitochondria DDOST Dolichyl-diphosphooligossceharide 1.65 4.87E−05 3.26E−03 SEC61A2 Protein transport protein Sec61 subunit 1.59 4.82E−05 3.26E−03 EMB Embigin 1.55 1.43E−05 3.26E−03 BSG Basigin 1.43 2.08E−05 3.26E−03 RNF5 E3 ubiquitin-protein ligase RNF5 1.42 1.04E−05 3.26E−03 CANX Caloexin 1.38 5.14E−05 3.26E−03 SLC16A11 Monocarboxylate transporter 11 1.34 2.94E−05 3.26E−03 SURF4 Surfelt locus protein 4 1.33 6.67E−05 3.26E−03 PSMD14 26S proteasome non-ATPase regular 1.31 7.60E−05 3.26E−03 HSDI7B12 Estrediol 17-beta-dehydrogenase 1 1.26 7.07E−05 3.26E−03 SACM1L Phosphutidylinositide phosphatase 1.26 3.68E−05 3.26E−03 BAG2 BAG family molecular chsperone 1.26 6.68E−05 3.26E−03 TMEM33 Transmembrane protein 33 1.25 3.77E−05 3.26E−03 FAP2 FAS-associated factor 2 1.23 4.86E−05 3.26E−03 TIMM23B Putative mitochondrial import inner 1.22 7.22E−05 3.26E−03 UBAC2 Ubiquitin-associated domain-contain 1.21 8.68E−05 3.26E−03 PSMA1 Proteasome subunit alpha type-1 1.20 5.64E−05 3.26E−03

(243) TABLE-US-00020 TABLE 5D shows putative SLC16A11.sup.REF interaction partners. accession BA BA BA adjusted gene symbol number log fold change p-value p-value SEC61A1 B4DR61 1.84 1.42E−05 3.26E−03 DHCR7 Q9UBM7 1.69 4.15E−05 3.26E−03 EMC3 Q9P0I2 1.65 7.04E−05 3.26E−03 SLC25A3 Q00325-2 1.65 1.11E−05 3.26E−03 DDOST P39656 1.65 4.87E−05 3.26E−03 SEC61A2 Q9H9S3 1.59 4.82E−05 3.26E−03 EMB Q6PCB8 1.55 1.43E−05 3.26E−03 BSG P35613 1.43 2.08E−05 3.26E−03 RNF5 Q99942 1.42 1.04E−04 3.26E−03 CANX P27824-2 1.38 5.14E−05 3.26E−03 SLC16A11 Q8NCK7 1.34 2.94E−05 3.26E−03 SURF4 O15260 1.33 6.67E−05 3.26E−03 PSMD14 O00487 1.31 7.60E−05 3.26E−03 HSD17B12 Q53GQ0 1.26 7.07E−05 3.26E−03 SACM1L Q9NTJ5 1.26 3.68E−05 3.26E−03 BAG2 O95816 1.26 6.68E−05 3.26E−03 TMEM33 P57088 1.25 3.77E−05 3.26E−03 FAF2 Q96CS3 1.23 4.86E−05 3.26E−03 TIMM23B Q5SRD1 1.22 7.22E−05 3.26E−03 UBAC2 Q8NBM4 1.21 8.68E−05 3.26E−03 PSMA1 P25786-2 1.20 5.64E−05 3.26E−03 SLC25A22 Q9H936 1.20 9.47E−05 3.26E−03 PPP6R3 Q5H9R7-5 1.18 6.98E−05 3.26E−03 PSMD12 O00232 1.18 9.84E−05 3.26E−03 ATP1B3 P54709 1.18 5.64E−05 3.26E−03 PSMC3 P17980 1.16 5.09E−05 3.26E−03 LPCAT1 Q8NF37 1.16 5.48E−05 3.26E−03 AGPAT6 Q86UL3 1.16 9.94E−05 3.26E−03 XPO5 Q9HAV4 1.14 7.76E−05 3.26E−03 VDAC2 P45880-1 1.14 5.53E−05 3.26E−03 PHGDH O43175 1.11 7.84E−05 3.26E−03 ADCK4 Q96D53 1.11 1.03E−04 3.26E−03 TECR Q9NZ01 1.10 6.44E−05 3.26E−03 AUP1 Q9Y679 1.10 6.41E−05 3.26E−03 ATP1A1 P05023-4 1.10 6.50E−05 3.26E−03 MAGED1 Q9Y5V3-2 1.09 1.02E−04 3.26E−03 PSMA3 P25788 1.09 9.50E−05 3.26E−03 SCFD1 Q8WVM8 1.08 6.87E−05 3.26E−03 BAG6 P46379-3 1.08 7.04E−05 3.26E−03 DNAJB4 Q9UDY4 1.08 9.21E−05 3.26E−03 QIL1 Q5XKP0 1.08 7.28E−05 3.26E−03 DNAJC7 Q99615 1.05 7.96E−05 3.26E−03 TUBA1B P68363 1.05 1.04E−04 3.26E−03 TUBA1C F5H5D3 1.04 8.74E−05 3.26E−03 BRAT1 Q6PJG6 1.04 9.57E−05 3.26E−03 HEATR2 Q86Y56 1.03 9.04E−05 3.26E−03 PSMD11 O00231-2 1.02 8.89E−05 3.26E−03 TUBA4A P68366 1.02 9.90E−05 3.26E−03 GCN1L1 Q92616 1.01 9.27E−05 3.26E−03 PSMD2 Q13200 0.98 1.05E−04 3.26E−03 KIAA0368 J3KN16 1.16 1.08E−04 3.27E−03 STT3A P46977 1.27 1.16E−04 3.36E−03 DNAJC3 Q13217 1.22 1.23E−04 3.36E−03
SLC16A11 is in bold while BSG and EMB are shown in italics. The 53 proteins in the table are the top 10% with a Blandt-Altman-adjusted P<0.05. BA is used for Blandt-Altman.

(244) SLC16A11 protein levels were low, even after transient overexpression (FIG. 5A (bottom panel)). To provide robust levels for the protein-interaction studies, SLC16A11 proteins containing a proline to aspartic acid substitution (P2D) that was found to increase SLC16A11 protein levels were utilized (FIG. 5B (top panel)).

(245) Examination of proteins enriched following immunoprecipitation of WT SLC16A11 when compared to the empty vector control immunoprecipitation revealed strong enrichment of SLC16A11 (FIG. 5B (bottom)). Notably, BSG and EMB, the ancillary proteins previously shown to interact with SLC16 category I family members, were also among the most enriched proteins. As interactions with BSG and EMB are an additional parameter segregating SLC16 category I and category II family members (Table 2); this provides additional support for SLC16A11 belonging to category I.

(246) SLC16A1 is part of a larger molecular complex (FIG. 5B (bottom panel)) composed of stoichiometry 2 SLC16A1 molecules and 2 BSG molecules. Given this, experiments tested whether SLC16A11 might also be part of a larger molecular complex containing more than one SLC16A11 molecule. Co-immunoprecipitation assays were used to demonstrate that SLC16A11.sup.REF interacts with SLC16A11.sup.REF and SLC16A11.sup.T2D interacts with SLC16A11.sup.T2D. Further work is needed to determine the stoichiometry.

(247) GeNets (http://apps.broadinstitute.org/genets#), a pathway-based analysis tool, were used to identify and visualize protein networks enriched for interaction with WT SLC16A11 (FIG. 5C (bottom)). This analysis revealed that SLC16A11 interacts with a cluster of proteasome components, which is consistent with the results demonstrating that transiently expressed SLC16A11 protein is rapidly degraded and undergoes proteasome-mediated degradation (FIG. 5D (top panel) and FIG. 5E (top and bottom panels)). These data indicate that SLC16A11 protein levels may be tightly regulated.

(248) Translation was inhibited with cycloheximide and the results indicated that SLC16A11 has a short half-life on the order of 45 minutes (FIG. 5D (top panel)). The other SLC16 family members tested, SLC16A1 and SLC16A13, do not undergo the same rapid degradation as was observed for SLC16A11. Other SLC16A11 variants did not have significantly altered half-lives compared to reference SLC16A11 (FIG. 18). Experiments were also conducted to determine whether the T2D risk variants altered SLC16A11 protein half-life and did not detect any appreciable differences between SLC16A11.sup.T2D and SLC16A11.sup.REF. Observations that SLC16A11 protein undergoes proteasome-mediated degradation were confirmed by inhibiting the proteasome with MG132 and observing increased SLC16A11 protein levels (FIG. 5E (bottom panel)). Together, these data suggest that exogenous SLC16A11 is rapidly degraded by the proteasome.

(249) In order to identify variants that might enable proteomic studies and potentially illuminate pathways underlying SLC16A11 degradation, a panel of SLC16A11 variants were generated, it was hypothesized the variants might alter protein levels. Given that targeting to the proteasome canonically occurs through ubiquitination on lysine residues, first the sole lysine in SLC16A11 (K7) was mutated (K7A). The data indicated that this had no effect on protein levels (FIG. 5H). Interestingly, removal of the N-terminal 24 amino acids of SLC16A11 (AltM) and moving the V5 epitope from the C terminus to the N terminus both increased protein levels (FIG. 5H). These findings led us to hypothesize that N-terminal ubiquitination of SLC16A11 might be occurring (Ciechanover, A., 2005, Methods Mol Biol, 301:255-270).

(250) After translation, proteins undergo N-terminal post-translational modifications (NPMs). Residues at position two are particularly important for determining whether NPMs such as N-terminal methionine excision (NME) or N-terminal acetylation (N-Ac) occur. An acidic residue at the second position decreases NME while increasing N-Ac. SLC16A11 is predicted to undergo NME. This would result in an unacetylated proline residue being exposed, which could then serve as a site for N-terminal ubiquitination. Because it was observed that the SLC16A11 protein was rapidly degraded following inhibition of protein synthesis and was stabilized by proteasome inhibition (FIGS. 5D-A and 5D-B), experiments were conducted to stabilize SLC16A11 against proteasome-mediated degradation. A P2D SLC16A11 variant (having a proline to aspartic acid substitution (P2D) at a potential site of regulation through a N-terminal ubiquitination pathway) was generated with the logic that aspartate at position 2 would reduce NME while promoting N-Ac of the initiator methionine. This would then compete with ubiquitination of this residue. While mutation of the sole lysine residue in SLC16A11 had no effect, it was found that the P2D SLC16A11 variant increased SLC16A11 protein levels (FIG. 5B (top panel, left). Therefore, SLC16A11 proteins containing the P2D mutation were used in proteomic studies, resulting in successful enrichment of tagged SLC16A11 and associated proteins in immunoprecipitations. (FIG. 5H). The locations of P2D, K7A, and AltM variants are shown in FIG. 5A top panel.

(251) Mass spectrometry was used to identify proteins that interact with SLC16A11.sup.REF. Among the ˜50 most highly enriched proteins (top 10% of interactors with a Blandt-Altman adjusted P<0.05; FIG. 5B (top panel, right)), the BSG and EMB proteins stood out. BSG and EMB act as chaperones that promote cell-surface localization of SLC16 proteins in category I, and co-localize with these SLC16 family members at the cell surface. The interactions between SLC16A11 and BSG and EMB provide further support that SLC16A11 is a member of category I.

(252) In addition, proteins in the SLC16A11.sup.REF interactome were analyzed using the pathway-based analysis tool GeNets (http://apps.broadinstitute.org/genets#) (FIG. 5C (bottom panel)). This analysis revealed that SLC16A11 interacts with a cluster of proteasome components, which explains the low levels of SLC16A11 found in transient expression experiments, namely, that the protein undergoes proteasome-mediated degradation (FIGS. 5D-A and 5D-B (top panel)).

(253) Collectively these data indicate that SLC16A11 protein levels may be tightly regulated. It is noted that all of the stability studies were performed on exogenous SLC16A11.

Example 13

T2D Risk Coding Variants Reduce SLC16A11 Localization to the Plasma Membrane by Disrupting an Interaction with BSG

(254) How the T2D risk coding variants alter the SLC16A11 interactome was examined. By comparing the enrichment of proteins bound to T2D risk SLC16A11 versus WT SLC16A11, a single protein interaction that was disrupted by the T2D risk coding variants was identified: the interaction with BSG (FIG. 5C (top panel)). Using co-immunoprecipitation assays, both the interaction between WT SLC16A11 and BSG was confirmed, as well as the finding that T2D risk-associated coding variants in SLC16A11 disrupt this interaction (FIG. 5D (bottom) and FIG. 5E (top panel)).

(255) BSG plays a key role in plasma membrane localization of other SLC16 category I family members. To determine whether BSG performs a similar function for SLC16A11, CRISPR/Cas9 was used with two different sgRNAs to generate BSG-knockout 293T cells and then examined SLC16A11 localization by plasma membrane extraction. Indeed, plasma membrane localization of SLC16A11 was significantly reduced (by ˜80%) in the absence of BSG (FIG. 5F top and bottom panels). In contrast, intracellular membrane localization of SLC16A11 is unaltered by BSG. These results were confirmed using an orthogonal plasma-membrane localization assay based on a split β-galactosidase reporter, in which enzyme complementation and activity was restored only when SLC16A11 localized to the cell surface (FIGS. 5I-A and 5I-B). As expected by the BSG-dependence of SLC16A11 plasma membrane localization and the finding that the T2D risk-associated coding variants disrupt the interaction between SLC16A11 and BSG, the T2D risk coding variants reduce SLC16A11 plasma membrane localization (FIG. 5G, top and bottom panels). These data demonstrate that the T2D risk coding variants reduce SLC16A11 activity through a molecular mechanism involving disruption of its interaction with the ancillary protein BSG, preventing proper plasma membrane localization. This was confirmed, as an approximately 60% reduction in plasma membrane localization of SLC16A11.sup.T2D with respect to SLC16A11.sup.REF was observed (FIG. 5G (top and bottom panels) and FIGS. 5I-C).

(256) Together, these experiments establish that the T2D-risk variants reduce SLC16A11 activity in two distinct ways: (i) the variants decrease SLC16A11 gene expression and (ii) the coding variants alter the protein in a manner that disrupts its interaction with BSG, decreasing the amount of SLC16A11 protein at the plasma membrane. Without wishing to be bound by a particular theory, under a model whereby T2D risk variants reduce both SLC16A11 gene expression and plasma membrane localization each by ˜60% per copy of the T2D risk allele, it is estimated that homozygous carriers may have up to ˜85% less SLC16A11 at the cell surface. Importantly, these findings indicate that diminished levels of SLC16A11 at the plasma membrane is the causal mechanism of increased T2D risk associated with variants at this locus.

Example 14

T2D Risk Haplotype Induced Disruption of SLC16A11 is Associated with Changes in Liver Metabolism

(257) As noted supra, these data indicate that one or more variants on the T2D risk haplotype contribute to decreased SLC16A11 function through two independent mechanisms involving: 1) lower SLC16A11 expression resulting from gene regulation effects, and 2) attenuated SLC16A11 activity resulting from reduced plasma membrane localization due to the disruption of its interaction with BSG. Together, these findings indicate that diminished SLC16A11 function is likely a causal factor for the increased T2D risk associated with this locus.

(258) To gain insight into the cellular impact of T2D risk-associated variants and the consequences of reduced SLC16A11 activity in human liver, which might lead to increased risk of T2D, cellular metabolic pathway changes associated with the T2D risk haplotype were examined by RNA-sequencing. Gene expression profiles from liver biopsies of Mexican individuals homozygous for either the T2D risk or reference haplotype at 17p13 were generated. When stratified based on either SLC16A11 genotype or T2D status, these individuals did not display differences in glycemic traits, including body mass index (BMI), Fasting Glucose, HbA1c, and plasma insulin levels (FIG. 6C).

(259) In line with the SLC16A11 liver cis-eQTL, transcriptome profiling identified SLC16A11 as one of the most differentially expressed genes between carriers and non-carriers of the T2D risk haplotype (FIG. 6A, Table 6A and Table 6B provide a summary).

(260) TABLE-US-00021 TABLE 6A Summary human liver RNAseq genes Gene_Symbol BaseMean log2FoldChange pvalue padj 1 APOA4 93.133 −0.994 8.99E−07 0.025 2 RP11-5A19.5 26.524 −0.730 3.48E−06 0.049 3 SEMA6D 2063.586 0.678 9.07E−06 0.086 4 FITM1 27.097 −0.699 1.49E−05 0.105 5 CTD-2050N2.1 37.860 0.740 2.58E−05 0.130 6 SENP7 2699.001 0.221 2.83E−05 0.130 7 SSU72 559.820 −0.267 3.79E−05 0.130 8 P3H1 207.411 −0.324 3.88E−05 0.130 9 ACTR1A 344.893 −0.288 4.90E−05 0.130 10 ATP6V0D1 437.463 −0.338 6.14E−05 0.130 11 ACO2 1178.974 −0.314 6.52E−05 0.130 12 ECE2 47.805 −0.590 7.08E−05 0.130 13 RAB43 872.435 −0.608 8.30E−05 0.130 14 MIR22HG 140.991 −0.715 8.37E−05 0.130 15 AVPR1A 1086.571 −0.788 8.43E−05 0.130 16 RP11-98F14.11 21.561 −0.775 9.03E−05 0.130 17 CIC 392.476 −0.377 9.09E−05 0.130 18 SCAPER 5464.252 0.284 9.39E−05 0.130 19 PEF1 352.702 −0.329 9.90E−05 0.130 20 SLC16A11 13.956 −0.700 3.32E−04 0.171

(261) TABLE-US-00022 TABLE 6B Summary of top 20 differently expressed genes in RISK and REF. log2Fold- gene symbol baseMean Change pvalue padj 1 APOA4 93.13 −0.99 8.99E−07 0.03 2 RP11-5A19.5 26.52 −0.73 3.48E−06 0.05 3 SEMA6D 2063.59 0.68 9.07E−06 0.09 4 FITM1 27.10 −0.70 1.49E−05 0.11 5 SSU72 559.82 −0.27 3.79E−05 0.13 6 PEF1 352.70 −0.33 9.90E−05 0.13 7 P3H1 207.41 −0.32 3.88E−05 0.13 8 RP11-529E15.1 21.56 −0.78 1.22E−04 0.13 9 CSRNP1 212.82 −0.79 1.24E−04 0.13 10 SENP7 2699.00 0.22 2.83E−05 0.13 11 RAB43 872.44 −0.61 8.30E−05 0.13 12 ISY1-RAB43 1059.66 −0.54 1.04E−04 0.13 13 ECE2 47.80 −0.59 7.08E−05 0.13 14 TCTEX1D2 43.19 0.57 1.40E−04 0.13 15 FST 619.96 −0.77 1.34E−04 0.13 16 SNRNP48 526.08 0.30 1.42E−04 0.13 17 RHBDD2 206.59 −0.35 1.20E−04 0.13 18 ACTR1A 344.89 −0.29 4.90E−05 0.13 19 KBTBD3 281.27 0.31 1.15E−04 0.13 20 AVPR1A 1086.57 −0.79 8.43E−05 0.13 . . . custom character 55 SLC16A11 13.96 −0.70 3.32E−04 0.17

(262) Pathway-based analysis revealed that transcripts encoding proteins involved in a number of metabolic pathways are significantly altered in carriers of the T2D risk haplotype (false-discovery rate (FDR)<0.20) (Table 7A).

(263) TABLE-US-00023 TABLE 7A NAME SIZE ES NES NOM p-val FDR q-val KEGG_COMPLEMENT_AND_COAGULATION_CASCADES 69 −0.58 −2.43 0.00E+00 0.00E+00 KEGG_CITRATE_CYCLE_TCA_CYCLE 29 −0.69 −2.41 0.00E+00 0.00E+00 KEGG_PPAR_SIGNALING_PATHWAY 63 −0.55 −2.23 0.00E+00 0.00E+00 KEGG_DRUG_METABOLISM_OTHER_ENZYMES 51 −0.57 −2.2 0.00E+00 0.00E+00 KEGG_PORPHYRIN_AND_CHLOROPHYLL_METABOLISM 40 −0.57 −2.09 0.00E+00 0.00E+00 KEGG_PARKINSONS_DISEASE 104 −0.47 −2.08 0.00E+00 0.00E+00 KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_DEGRADATION 43 −0.56 −2.08 0.00E+00 0.00E+00 KEGG_LYSOSOME 114 −0.45 −2.04 0.00E+00 9.52E−04 KEGG_OXIDATIVE_PHOSPHORYLATION 107 −0.46 −2.04 0.00E+00 1.07E−03 KEGG_PENTOSE_AND_GLUCURONATE_INTERCONVERSIONS 26 −0.61 −2.03 0.00E+00 1.13E−03 KEGG_HUNTINGTONS_DISEASE 163 −0.42 −1.99 0.00E+00 1.36E−03 KEGG_FATTY_ACID_METABOLISM 42 −0.53 −2 0.00E+00 1.45E−03 KEGG_PENTOSE_PHOSPHATE_PATHWAY 23 −0.62 −1.99 2.08E−03 1.46E−03 KEGG_FRUCTOSE_AND_MANNOSE_METABOLISM 34 −0.57 −2 0.00E+00 1.59E−03 KEGG_RNA_POLYMERASE 29 −0.57 −1.92 0.00E+00 2.80E−03 KEGG_SPLICEOSOME 123 −0.42 −1.91 0.00E+00 2.94E−03 KEGG_ASCORBATE_AND_ALDARATE_METABOLISM 24 −0.59 −1.91 0.00E+00 3.11E−03 KEGG_BUTANOATE_METABOLISM 31 −0.55 −1.91 0.00E+00 3.30E−03 KEGG_PYRUVATE_METABOLISM 38 −0.52 −1.9 2.15E−03 3.38E−03 KEGG_ADIPOCYTOKINE_SIGNALING_PATHWAY 61 −0.47 −1.87 0.00E+00 4.39E−03

(264) These include pathways in which pyruvate plays a central role—the TCA cycle, amino acid, fatty acid, and lipid metabolism—and which are implicated in insulin resistance and T2D pathogenesis. As SLC16A11 is the only significantly altered gene within 100 Kb of the T2D risk haplotype (FIG. 6A) and no other SLC16 family members are significantly altered (FIG. 6B), these data point to disruption of SLC16A11 as a driver of altered hepatic metabolic function in individuals carrying the T2D risk haplotype.

Example 15

Expressing SLC16A11.SUP.REF .and SLC16A11.SUP.T2D .in Primary Human Hepatocytes

(265) In order to investigate which metabolic pathways SLC16A11 plays a role in and how the T2D risk coding variants alter these roles, SLC16A11.sup.REF and SLC16A11.sup.T2D were over-expressed in primary human hepatocytes and steady-state levels of 60 intracellular polar metabolites were measured. Eight biological replicates of SLC16A11.sup.REF, SLC16A11.sup.T2D, and empty vector control (denoted by CNTRL) were profiled across two different experiments. Primary human hepatocytes were transduced with lentivirus expressing the relevant vectors and samples for metabolite profiling were collected 96 hours after transduction. An increase of ˜17 fold was achieved in SLC16A11 transcript levels in hepatocytes transduced with SLC16A11 lentivirus, with comparable SLC16A11 levels in cells transduced with SLC16A11.sup.REF or SLC16A11.sup.T2D (FIG. 9A).

(266) In hepatocytes transduced with SLC16A11.sup.REF (REF) versus control (CNTRL), the levels of 2 intracellular metabolites were significantly altered after correcting for multiple hypothesis testing (Table 7B). These metabolites were phosphocreatine, citrate, hexose monophosphate (denoting glucose 6-phosphate or fructose 6-phosphate which could not be distinguish in the dataset), and fructose 1-phosphate. Citrate is an intermediate in the TCA cycle and it can be used to transport acetyl-CoA from mitochondria to the cytoplasm to be used in fatty acid synthesis. Glucose 6-phosphate and fructose 6-phosphate are intermediates in glycolysis. No significant changes in pyruvate levels were observed. As noted above, steady state levels of SLC16A11 substrates were not necessarily expected to be altered.

(267) For the REF versus CNTRL comparison, two significantly altered metabolic pathways were found (FDR<0.05): glyoxylate and dicarboxylate metabolism and TCA cycle (Table 7C). FDR (false discovery rate) and NES (normalized enrichment score). There is some debate on whether vertebrates use the glyoxylate/dicarboxylate pathway (Davis and Goodman, 1992). This pathway shares similarities to the TCA cycle and many overlapping metabolites. Over-expression of SLC16A11.sup.REF resulted in decreased TCA cycle metabolites suggesting that SLC16A11 might play a role in mediating flux through this pathway. It was noted that the most altered metabolites in the TCA cycle (citrate and aconitate) are immediately downstream of where acetyl-CoA (a major source of which is pyruvate) enters the pathway. Decreasing flux through a central pathway such as the TCA cycle could result in the remodeling of cellular metabolism. Sufficient metabolites in glycolysis were not measured so as to analyze overall changes in this pathway.

(268) TABLE-US-00024 TABLE 7B Altered metabolites in primary human hepatocytes expressing SLC16A11.sup.REF. Metabolite name Percent change p-value phosphocreatine −16% 2.84 × 10.sup.−6 citrate −20% 2.81 × 10.sup.−5 hexose monophosphate +13% 2.74 × 10.sup.−4 fructose 1-phosphate +12% 2.74 × 10.sup.−4 aconitate −18% 6.56 × 10.sup.−4 fructose 1,6-bisphosphate +46% 1.83 × 10.sup.−3 alpha-glycerophosphate +24% 5.62 × 10.sup.−3 alpha/beta-hydroxybutyrate −6% 6.81 × 10.sup.−3 hippurate +27% 1.06 × 10.sup.−2 DHAP/glyceraldehyde-3-phosphate +12% 1.29 × 10.sup.−2

(269) TABLE-US-00025 TABLE 7C Altered metabolic pathways in primary human hepatocytes expressing SLC16A11.sup.REF. Name size members p-value FDR NES Information Citrate cycle 9 8 0.001 0.00 −2.21 Depleted (TCA cycle) Glyoxylate/ 12 7 0.001 0.00 −2.08 Depleted dicarboxylate metabolism
Significantly altered metabolic pathways as assessed by metabolite set enrichment analysis (FDR<0.05). FDR is the false discovery rate and NES is the normalized enrichment score.

(270) In the RISK versus REF comparison, no individual metabolites were significantly altered after correcting for multiple hypotheses testing. However, in this comparison, 2 significantly altered metabolic pathways (FDR<0.05) were found: a decrease in purine metabolism metabolites and an increase in glyoxylate/dicarboxylate metabolism metabolites. Given that over-expression of SLC16A11.sup.REF resulted in a decrease in glyoxylate/dicarboxylate metabolism metabolites, and under the assumption that the T2D risk coding variants confer reduced activity, one might expect an increase in glyoxylate/dicarboxylate metabolism metabolites in the RISK versus REF comparison.

(271) In the REF versus CNTRL comparison, a 46% increase in fructose-1,6-bisphosphate levels in hepatocytes expressing SLC16A11.sup.REF (P=2×10.sup.−3) was observed. Compared to other metabolite fold-changes observed in these studies, this is a large fold-change. This metabolite was nominally significant in the RISK versus REF comparison, with a 19% decrease in fructose-1,6-bisphosphate levels in cells expressing SLC16A11.sup.T2D compared to cells expressing SLC16A11.sup.REF (P=0.03). Fructose-1,6-bisphosphate is generated by the one of the critical step in glycolysis whereby phosphofructokinase converts fructose-6-phosphate to fructose-1,6-bisphosphate.

(272) Interestingly, SLC16A11 expression was highly correlated with PFKL expression (which encodes the major phosphofructokinase isoform in liver). This follows from an analysis of 119 human liver samples from the Genotype-Tissue Expression project (GTEx) where PFKL expression across these samples ranked 19 out of over 45,000 transcripts tested in terms of correlation to SLC16A11 expression (Spearman correlation coefficient=0.64; P=0). Analysis of this dataset will be described further in the Examples that follow. Without wishing to be bound by theory, this data suggest that increasing SLC16A11 activity results in shifting from reliance on the TCA cycle to reliance on glycolysis for energy production.

Example 16

Knocking-Down SLC16A11 in Primary Human Hepatocytes

(273) The data presented herein strongly support the notion that the T2D risk haplotype disrupts SLC16A11 activity in liver. Consequently, a key question is how disrupted SLC16A11 activity increases T2D risk.

(274) As a first step, how decreased SLC16A11 levels impact metabolism in primary human hepatocytes was studied. SLC16A11 was knocked-down in primary human hepatocytes and 48 hours after adding siRNAs to cells, samples were collected for metabolite profiling. Steady-state levels of ˜350 polar and lipid intracellular metabolites and 339 polar and lipid metabolites in the media (extracellular) were measured. The samples consisted of 8 or 12 biological replicates of hepatocytes treated either with pooled siRNAs targeting SLC16A11 or pooled negative controls across 2 or 3 replicate experiments. A ˜90% knock-down of SLC16A11 transcript levels was achieved with no effect on SLC16A13, other category I SLC6 family members (SLC16A1, SLC16A3, SLC16A7, SLC16A8), or BSG transcript levels (FIG. 9B, top panel).

(275) In the SLC16A11 siRNA versus negative control siRNA comparison, no metabolites were significantly altered between the two groups (FIG. 9B, bottom panel). In the same comparison in media, 4 individual metabolites were significantly altered: C58:8 TAG (27% increase, P=7.40×10.sup.−7), C56:8 TAG (10% increase, P=5.92×10.sup.−6), 1-methylguanosine (9% decrease, P=4.96×10.sup.−5), and C56:5 TAG (10% increase, P=1.03×10.sup.−4). Interestingly, 3 of these species are triacylglycerols (TAGs).

(276) In this comparison, 6 significantly altered metabolic pathways (FDR<0.05) were found (FIG. 9B and Table 7F). Acylcarnitines were increased in the SLC16A11 knockdown cells. Without wishing to be bound by theory, this might suggest a decrease in fatty acid degradation and possibly an increase in fatty acid synthesis. Acylcarnitines levels are increased in the plasma of patients with mutations in fatty acid oxidation compared to controls and these levels have been found to correlate with acylcarnitine levels in the liver. Acylcarnintines levels in plasma are increased in type 2 diabetics. Acylcarnitines transfer fatty acids into the mitochondria for degradation and this process is inhibited by malonyl-CoA, which is formed in the committed step of fatty acid synthesis.

(277) Among the lipids measured, levels of triacylglycerols (TAGs) and diacylglycerols (DAGs) were increased while lysophosphatidylcholines (LPCs) and phosphatidylcholines (PCs) were decreased. It is interesting to note that TAGs and PCs compete for the same pool of fatty acids through intermediate DAGs. Without wishing to be bound by theory, these results suggest that reduced SLC16A11 activity results in a shift of fatty acid usage in preference of triacylglycerols over other lipid species such as phosphatidylcholines. The increases in triacylglycerols and diacylglycerols are particularly intriguing given that increases in both are associated with diabetic insulin resistance. Although neither was significant, TCA cycle intermediates were increased and glycolytic intermediates were decreased in SLC16A11 knockdown cells.

(278) Table 7D shows the top 10 metabolites with the smallest p-values are ranked by increasing p-value. Table 7E shows significantly altered metabolic pathways as assessed by metabolite set enrichment analysis (FDR<0.05). FDR is the false discovery rate and NES is the normalized enrichment score.

(279) TABLE-US-00026 TABLE 7D Altered metabolites resulting from knockdown of SLC16A11 in primary human hepatocytes. Metabolite name Percent change p-value cAMP −32% 0.01 DHAP/G3P −19% 0.03 adenine 109% 0.05 3-methyladipate/pimelate −32% 0.05 hippurate 55% 0.07 UDP-galactose/UDP-glucose 11% 0.07 alpha-hydroxybutyrate −14% 0.08 adipate −18% 0.10 quinolinate −15% 0.11 UMP 14% 0.12

(280) TABLE-US-00027 TABLE 7E Altered metabolic pathways resulting from knockdown of SLC16A11 in primary human hepatocytes. Name size members p-value FDR NES Information TAGs 58 48 0.001 0.000 3.27 Enriched Carnitines 20 12 0.001 0.000 2.97 Enriched LPCs 11 10 0.001 0.000 −2.36 Depleted Pyrimidine 21 11 0.002 0.004 2.17 Enriched metabolism PCs 25 21 0.002 0.021 −2.08 Depleted DAGs 10 9 0.011 0.029 1.73 Enriched

(281) In the SLC16A11 siRNA versus negative control siRNA comparison in media, we found 2 significantly altered metabolic pathways (FDR<0.05) (FIG. 9B and Table 7F). Of particular interest is the increase in triacylglycerols in media. Hepatocytes secrete excess triacylglycerols and other lipids in the form of very low-density lipoproteins (VLDL). Triacylglycerols are increased in plasma of type 2 diabetics.

(282) TABLE-US-00028 TABLE 7F Altered metabolic pathways resulting from knockdown of SLC16A11 in media from primary human hepatocytes. Name size members p-value FDR NES Information LPEs 8 6 0.001 0.000 −2.23 Depleted TAGs 58 38 0.001 0.003 2.23 Enriched
Significantly altered metabolic pathways as assessed by metabolite set enrichment analysis (FDR<0.05). FDR is the false discovery rate and NES is the normalized enrichment score.
Thus, SLC16A11 is likely involved in mediating flux through central metabolite pathways, possibly by acting on the key intermediate metabolite, pyruvate. This resulted in increased intracellular levels of diacylglycerols and triacylglycerols—lipids implicated in insulin resistance and T2D.

(283) FIGS. 9K-9O illustrate several key observations on the impact of SLC16A11 disruption on cellular metabolism from the metabolite profiling dataset. Intracellular increases in acylcarnitines, DAGs, and TAGs were observed, as well as extracellular increases in TAGs, which are secreted by hepatocytes in the form of VLDLs. (FIG. 9K (top panel)). Acylcarnitine levels increased in plasma of patients with mutations in fatty acid degradation and T2D; importantly plasma levels correlated with liver levels. In addition, intracellular DAGs were associated with diabetic insulin resistance, while intracellular TAGs, which are a hallmark of hepatic steatosis and associated with inflammation, liver damage, diabetic insulin resistance, and T2D showed increased levels in the plasma of type 2 diabetics. Together, the results demonstrate that disruption of SLC16A11 in primary human hepatocytes leads to T2D-relevant changes in fatty acid and lipid metabolism. More specifically, these changes demonstrate that SLC16A11 affects cellular fatty acid and lipid metabolism, with the increase in acylcarnitines indicating an effect on fatty acid β-oxidation by the mitochondria and the increases in DAGs and TAGs indicating a shift toward energy storage in the form of glycerolipids. These results implicate reduced SLC16A11 functions in liver as a causal factor for T2D.

(284) The metabolic changes found in these experiments match those seen in the pathophysiology of insulin resistance and T2D: (1) acylcarnitines are elevated in the plasma of people with type 2 diabetes; (2) DAGs are associated with hepatic and skeletal muscle insulin resistance; and (3) TAG accumulation in liver and plasma is associated with diabetic insulin resistance and T2D.

(285) Thus, variants on the T2D risk haplotype disrupt SLC16A11 function through two distinct molecular mechanisms and result in changes in cellular metabolism consistent with those seen in insulin resistance and T2D in human patients. (FIG. 9K (bottom panel)).

Example 17

Generating CRISPR-Cas9 Slc16a11 and Slc16a13 Mouse Models

(286) A Slc16a11 global knockout mouse model was generated by replacing endogenous Slc16a11 with a LacZ Neo cassette (denote as Slc16a11* in FIG. 9C, top panel). This mouse was generated using traditional methods. Homozygous knockout mice die by 4 weeks of age. These mice are smaller in size and have lower fasting glucose levels than their wild-type littermates. In this mouse model, the data showed that both Slc16a11 and Slc16a13, and possibly Bcl6b to a lesser extent, were perturbed in liver (FIG. 9C, middle panel). Similar results were obtained in kidney. In mice, Slc16a11 and Slc16a13 are separated by only ˜400 bp. This data indicated that this mouse model was likely a double knockout for Slc16a11 and Slc16a13. Upon the removal of the Neo cassette, Slc16a13 and Bcl6b levels were no longer altered (denote as Slc16a11.sup.−Neo in FIG. 9C, top and middle panel). In parallel, additional Slc16a11 knockout mouse models were generated.

(287) A Slc16a11 global knockout mouse model with CRISPR-Cas9 (FIG. 9D, bottom panel) was generated. In addition, a Slc16a13 global knockout mouse model was generated. Data presented herein supports SLC16A11 as the effector gene through which variation on the T2D risk haplotype acts. The Slc16a13 models were generated with the intention of also studying the other gene at this locus that likely has many overlapping roles with SLC16A11. Of particular interest would be any unique functions that SLC16A11 has, but not SLC16A13.

(288) sgRNAs targeting Slc16a11 or Slc16a13 were prepared. Together with Cas9 mRNA these were microinjected into mouse zygotes by the Genome Modification Facility at Harvard University. A total of 32 pups were born from Slc16a11 injections (99% mutant at the targeted locus) and 46 pups from Slc16a13 injections (96% mutant). Subsets of these pups were then crossed with wild-type C57BL/6J mice in order to achieve germline transmission. A 92% germline transmission was achieved for the Slc16a11 models and 94% for the Slc16a13 models. Colonies of Slc16a11 CRISPR-Cas9 KO mice with multiple independent mutant alleles were established. The experiments focused on one line in particular, Slc16a11 del19 (a deletion of 19 bp resulting in an out-of-frame mutation in the Slc16a11 reading frame and a truncated Slc16a11 protein), and began phenotyping this model. Expression levels of Slc16a11, Slc16a13, and Bcl6b are shown in FIG. 9I. A gene set enrichment analysis of down-regulated genes in human carriers of the T2D risk haplotype in Slc16a11 knockout mice is shown at FIG. 9J. At the top are shown the Gene Set Enrichment Analysis (GSEA) results. Query gene sets were made from the 50, 100, and 150 most down-regulated (by fold-change) genes or 50, 100, and 150 most up-regulated genes in human liver from homozygotes for the T2D risk haplotype (RISK) versus homozygotes for the reference haplotype (REF). These gene sets were queried against a ranked list (also ordered by fold-change) generated from Slc16a11 knockout versus wild-type mouse liver. FDR stands for false discovery rate and gene sets with FDR<0.05 are indicated with arrows. Enrichment plots for the genes down-regulated in liver from human carriers of the T2D risk haplotype but up-regulated in Slc16a11 knockout mouse liver are shown below.

Example 18

Targeted Knockout of SLC16A11 in Mice Leads to Changes in Liver Metabolism that are Associated with Insulin Resistance and T2D

(289) To evaluate the physiological consequences of Slc16a11 and Slc16a13 perturbation in mice, multiple Slc16a11 and Slc16a13 knockout mouse models were generated using CRISPR/Cas9 technology. Following co-injection of zygotes with Cas9 mRNA and either Slc16a11- or Slc16a13-targeting guide RNAs, high percentage mosaic founders carrying a variety of inactivating mutations in the Slc16a11 and Slc16a13 genes were obtained. These animals were bred to achieve germline transmission and multiple, independent lines carrying distinct inactivating (frameshift) mutations were established.

(290) To examine the short-term metabolic changes associated with Slc16a11 loss-of-function, four-week old Slc16a11 wild-type and knockout animals were placed on a high fat diet for one week, and then liver and plasma samples were collected for metabolite profiling and RNA-sequencing (FIG. 9D). Analyses of transcriptional changes revealed an increase in pathways related to glucose metabolism, inflammation, and mitochondrial function (Table 8 and Table 9), indicating the Slc16a11 knockout animals have an increased metabolic burden following this short-term nutritional challenge.

(291) TABLE-US-00029 TABLE 8 Mouse KO RNAseq GSEA Pathway Results NAME SIZE ES NES NOM p-val FDR q-val KEGG_RIBOSOME 67 0.72 2.97 0.00E+00 0.00E+00 KEGG_SYSTEMIC_LUPUS_ERYTHEMATOSUS 56 0.57 2.23 0.00E+00 0.00E+00 KEGG_PROTEASOME 39 0.58 2.12 0.00E+00 4.27E−04 KEGG_LEISHMANIA_INFECTION 47 0.52 1.98 0.00E+00 7.61E−03 KEGG_OXIDATIVE_PHOSPHORYLATION 90 0.42 1.85 1.47E−03 2.56E−02 KEGG_FRUCTOSE_AND_MANNOSE_METABOLISM 32 0.51 1.8 4.90E−03 2.76E−02 KEGG_ANTIGEN_PROCESSING_AND_PRESENTATION 36 0.5 1.8 6.45E−03 2.83E−02 KEGG_PARKINSONS_DISEASE 88 0.41 1.77 1.42E−03 3.07E−02 KEGG_HEMATOPOIETIC_CELL_LINEAGE 64 0.44 1.81 1.54E−03 3.20E−02 KEGG_PRION_DISEASES 33 0.51 1.81 3.17E−03 3.62E−02 KEGG_GLYCOLYSIS_GLUCONEOGENESIS 48 0.45 1.74 4.68E−03 3.73E−02 KEGG_PATHOGENIC_ESCHERICHIA_COLI_INFECTION 47 0.44 1.69 6.19E−03 4.79E−02 KEGG_LYSOSOME 109 0.38 1.69 4.22E−03 4.90E−02

(292) TABLE-US-00030 TABLE 9A Top 20 Differentially expressed genes in KO compared to WT gene_symbol human_gene_symbol baseMean log2FoldChange pvalue padj 1 Serpina3e-ps 621.52 0.57 2.62E−10 5.38E−06 2 Gpaa1 GPAA1 419.30 0.30 6.26E−06 4.29E−02 3 2510039O18Rik KIAA2013 566.57 0.34 1.40E−05 5.13E−02 4 Slc38a10 SLC38A10 2339.35 0.28 1.50E−05 5.13E−02 5 Sugct SUGCT 10540.20 −0.36 1.46E−05 5.13E−02 6 Pgp PGP 133.23 0.47 2.11E−05 5.48E−02 7 Nfe2l2 NFE2L2 2977.29 −0.27 5.29E−05 8.39E−02 8 Gm43980 186.70 −0.35 5.02E−05 8.39E−02 9 Prkcsh PRKCSH 1744.14 0.34 4.60E−05 8.39E−02 10 Tysnd1 TYSND1 1021.91 0.32 5.71E−05 8.39E−02 11 Nme1 NME1 628.68 0.38 5.46E−05 8.39E−02 12 Frmpd4 FRMPD4 42.84 −0.50 4.62E−05 8.39E−02 13 Gpc1 GPC1 121.91 0.42 1.04E−04 9.23E−02 14 Rmdn3 RMDN3 1060.79 0.20 1.35E−04 9.23E−02 15 Rcc2 RCC2 686.17 0.31 1.00E−04 9.23E−02 16 Urad URAD 885.92 0.26 1.47E−04 9.23E−02 17 Irgq IRGQ 535.61 0.29 1.64E−04 9.23E−02 18 Mir5121 44.34 0.49 9.05E−05 9.23E−02 19 RP23-474J16.2 153.01 −0.40 1.42E−04 9.23E−02 20 RP24-178G20.2 99.39 0.44 7.30E−05 9.23E−02 . . . 45 Slc16a11 SLC16A11 106.45 −0.43 2.34E−04 9.42E−02

(293) As with the transcriptional changes in human carriers of the T2D risk haplotype, Slc16a11 is the only significantly altered gene at this locus (FIG. 9E, top) and expression of no other SLC16 family members is significantly altered (FIG. 9E, bottom), pointing toward the targeted disruption of Slc16a11 as the driver these changes. Examination of metabolite levels revealed the Slc16a11 knockout has increased levels of liver and plasma metabolites that are associated with insulin resistance and T2D pathogenesis, including lactate, diacylglycerols (DAGs), triacylglycerols (TAGs), and malondialdehyde (MDA), a marker of lipid oxidation and oxidative stress (FIG. 9F, FIG. 9G, FIG. 9H). Increases in these biomarkers of insulin resistance and T2D support the idea that reduced SLC16A11 has physiological consequences related to T2D (FIG. 10).

(294) TABLE-US-00031 TABLE 9B Significantly altered metabolite pathways in livers of Slc16a11 del19 knockout mice versus wild-type littermates. Name p-value FDR NES Information Aminoacyl-tRNA biosynthesis 0.001 0.000 −2.63 Depleted CEs 0.001 0.000 −2.76 Depleted custom character 0.001 0.002 2.32 Enriched custom character 0.001 0.002 2.26 Enriched LPCs 0.001 0.003 2.35 Enriched Cyanoamino acid metabolism 0.001 0.005 −2.31 Depleted PEs 0.008 0.020 1.81 Enriched Propanoate metabolism 0.008 0.020 1.76 Enriched LPEs 0.009 0.022 1.83 Enriched Primary bile acid biosynthesis 0.005 0.024 −1.88 Depleted Glycine serine and threonine 0.006 0.026 −1.90 Depleted metabolism Carnitines 0.002 0.026 −1.98 Depleted Glutathione metabolism 0.004 0.029 −1.92 Depleted Biosynthesis of unsaturated 0.003 0.033 −1.79 Depleted fatty acids Histidine metabolism 0.007 0.035 −1.77 Depleted PCs 0.020 0.037 −1.71 Depleted Nitrogen metabolism 0.015 0.039 −1.72 Depleted Arginine and proline metabolism 0.021 0.039 −1.67 Depleted Triacylglycerols and diacylglycerols are shown in bold italics. FDR stands for false discovery rates. Only pathways with an FDR <0.05 are shown.

(295) TABLE-US-00032 TABLE 9C Significantly altered metabolite pathways in plasma of Slc16a11 del19 knockout mice versus wild-type littermates. Name p-value FDR NES Information custom character 0.001 0.000 4.39 Enriched CEs 0.001 0.000 −2.87 Depleted custom character 0.001 0.000 2.90 Enriched PCs 0.001 0.001 −2.69 Depleted Biosynthesis of unsaturated fatty 0.001 0.002 −2.27 Depleted acids SMs 0.001 0.003 −2.27 Depleted LPCs 0.001 0.003 −2.30 Depleted Purine metabolism 0.001 0.009 2.13 Enriched Triacylglycerols and diacylglycerols are shown in bold italics. FDR stands for false discovery rates. Only pathways with an FDR <0.05 are shown.

Example 19

SLC16A11 is Regulated at the mRNA Level

(296) SLC16A11, SLC16A1 and SLC16A13 were transiently expressed in HeLa cells using a CMV-driven promoter. Despite being expressed from the same plasmid with the same promoter, SLC16A11 levels are an order of magnitude lower than SLC16A13 and SLC16A1, indicating SLC16A11 is being regulated at the mRNA level by a mechanism involving sequencings within the SLC16A11 open reading frame (FIGS. 7A, 7B and 7C).

Example 20

SLC16A11 is Regulated at the mRNA Level

(297) SLC16A11, SLC16A1 and SLC16A13 were transiently expressed in HeLa cells using a CMV-driven promoter, and gene expression was measured using Nanostring nCounter (SIGMA T2D Consortium, 2014 Nature, 506:97-101). Despite being expressed from the same plasmid with the same promoter, SLC16A11 levels are an order of magnitude lower than SLC16A13 and SLC16A1, indicating SLC16A11 is being regulated at the mRNA level by a mechanism involving sequences within the SLC16A11 open reading frame (FIGS. 7A, 7B and 7C). Determining the mechanism underlying SLC16A11 mRNA instability may lead to future therapeutic strategies.

Example 21

SpCas9-Based Transactivation of SLC16A11 Expression

(298) These experiments are based upon Cas9 based transactivators (SAM or synergistic activation mediators) as described in Konermann et al (Nature 517: 583-588, 2015). Similar experiments based on other types of transactivators that are more finely tuned to distal activation such as those described in Hilton et al. (Nature 33:510-518, 2015) could also be envisioned. Cas9 was used to target transactivators to sites near individual variants in the credible set. Their ability to activate SLC16A11 gene expression was assessed (Table 10).

(299) TABLE-US-00033 TABLE 10 Increases SLC16A11 transcript levels in Variant trans- disrupts activator PAM rs id target sequence 1 target sequence 2 assay targeting rs77086571 AACCCCCAGGCCCGGGGGAG TCGCCGCTCCCCCCTCCCCC TRUE YES rs74577409 ACCTGCCGCCTGCTGCGCGC CCCTGCGCGCAGCAGGCGGC TRUE YES rs2292351 AGCCTCTGGCTGCTCGCCCG CACCCCGGGCGAGCAGCCAG TRUE NO rs17203120 CTTATTTGATTTTATCTCAA TTATTTGATTTTATCTCAAA FALSE N/A rs145952323 CAAAAATTAGCCGGGTGTGT CAGGCACACGCCAACACACC FALSE N/A rs75075014 GGAAGTGGAGGAGAGTGTCC GGAGTCATGCCTGGAAGTGG FALSE N/A rs78972129 GATGCTATGGTTGGCCACGC AGTACAGTACACAGCCTGCG FALSE N/A rs77552976 GAAAGGGCTGCCGTGCTGTT CCTGGCTGGACCTAACAGCA FALSE N/A rs58223766 TCAGGAGTTCGAGACCATCC GATCCACCCCCCCCCCCCCT FALSE N/A rs4630597 GGTGCCTCAGATACCTGGTT AACCAGGTATCTGAGGCACC FALSE N/A rs113748381 GCCTCGGCCTCCCAAAGTGC GCACTTTGGGAGGCCGAGGC FALSE N/A rs73239895 ACTCCTGCCGGAGGTTCTCG AGGCCCCGAGAACCTCCGGC FALSE N/A rs186568031 GATTTTCACTCTTGTTGCCC TTCACTCTTGTTGCCCAGGC FALSE N/A rs312457 TGATGAAACCTGGCCGGGCA GTGAGCCACCGTGCCCGGCC FALSE N/A rs17203148 TCTGCCAATCTTGGCTCTGT GAAACCTACAGAGCCAAGAT FALSE N/A rs1698227 TGGTGCTAAGGGGCACACAC TGCTCATTTTCCTCTGCACT FALSE N/A rs191133 TGAAAGTAAGTCAATCATGG ATGATTGACTTACTTTCATC FALSE N/A rs193399 TAGAACCAGCTTCTAGGTTC TCCTTCCTGAACCTAGAAGC FALSE N/A NA TCACGCGCGGCTTGCCGGAT TGGGACGCGGGGTGTACGGA TRUE N/A NA GTACATAATTCAATCCCCGT GCGGCGAGAAATGAATGCAG TRUE N/A NA CTATTTCCACGCGTTGGCGG ACCTGCCGCCTGCTGCGCGC TRUE N/A NA TGTTCTCAGGAACGTTGCCG ATTGATATCCGAGATTTACC TRUE N/A NA TTACAGGCTTGCACCGCGCC TGGGTGAATCACCTGACGTC TRUE N/A NA ACGGAAACTGGCGCGCTCCA TATCACTGGGGTGTCCGGGC TRUE N/A NA GCGGGATTTAGGCATTGTTG CGGGAGCCCCGCGTCCTCAT TRUE N/A NA TGGCAGTCCCCGCGTCACGT CATGCGTAAGGAGGGGCGTT TRUE N/A NA TGGCTCTGGGTGCTGAAACG GACTCTCTTGCTTTAATGAG TRUE N/A NA GGCTGCGTGTTAGTGGCTTC GGAATTGCAAGGCCCTGTTG TRUE N/A

(300) In Table 10, the polynucleotide sequences for target sequence 1 are denoted as follows: rs7708657: aacccccaggcccgggggag (SEQ ID NO: 28); rs74577409: acctgccgcctgctgcgcgc (SEQ ID NO: 29); rs2292351: agcctctggctgctcgcccg (SEQ ID NO: 30); rs17203120: cttatttgattttatctcaa (SEQ ID NO: 31); rs145952323: caaaaattagccgggtgtgt (SEQ ID NO: 32); rs75075014: ggaagtggaggagagtgtcc (SEQ ID NO: 33); rs78972129: gatgctatggttggccacgc (SEQ ID NO: 34); rs77552976: gaaagggctgccgtgctgtt (SEQ ID NO: 35); rs58223766: tcaggagttcgagaccatcc (SEQ ID NO: 36); rs4630597: ggtgcctcagatacctggtt (SEQ ID NO: 37); rs113748381: gcctcggcctcccaaagtgc (SEQ ID NO: 38); rs73239895: actcctgccggaggttctcg (SEQ ID NO: 39); rs186568031: gattttcactcttgttgccc (SEQ ID NO: 40); rs312457: tgatgaaacctggccgggca (SEQ ID NO: 41); rs17203148: tctgccaatcttggctctgt (SEQ ID NO: 42); rs1698227: tggtgctaaggggcacacac (SEQ ID NO: 43); rs191133: tgaaagtaagtcaatcatgg (SEQ ID NO: 44); rs193399: tagaaccagcttctaggttc (SEQ ID NO: 45); NA: tcacgcgcggcttgccggat (SEQ ID NO: 46); NA: gtacataattcaatccccgt (SEQ ID NO: 47); NA: ctatttccacgcgttggcgg (SEQ ID NO: 48); NA: tgttctcaggaacgttgccg (SEQ ID NO: 49); NA: ttacaggcttgcaccgcgcc (SEQ ID NO: 50); NA: acggaaactggcgcgctcca (SEQ ID NO: 51); NA: gcgggatttaggcattgttg (SEQ ID NO: 52); NA: tggcagtccccgcgtcacgt (SEQ ID NO: 53); NA: tggctctgggtgctgaaacg (SEQ ID NO: 54); and NA: ggctgcgtgttagtggcttc (SEQ ID NO: 55).

(301) In Table 10, the polynucleotide sequences for target sequence 2 are denoted as follows: rs77086571: tcgccgctcccccctccccc (SEQ ID NO: 56); rs74577409: ccctgcgcgcagcaggcggc (SEQ ID NO: 57); rs2292351: caccccgggcgagcagccag (SEQ ID NO: 58); rs17203120: ttatttgattttatctcaaa (SEQ ID NO: 59); rs145952323: caggcacacgccaacacacc (SEQ ID NO: 60); rs75075014: ggagtcatgcctggaagtgg (SEQ ID NO: 61); rs78972129: agtacagtacacagcctgcg (SEQ ID NO: 62); rs77552976: cctggctggacctaacagca (SEQ ID NO: 63); rs58223766: gatccaccccccccccccct (SEQ ID NO: 64); rs4630597: aaccaggtatctgaggcacc (SEQ ID NO: 65); rs113748381: gcactttgggaggccgaggc (SEQ ID NO: 66); rs73239895: aggccccgagaacctccggc (SEQ ID NO: 67); rs186568031: ttcactcttgttgcccaggc (SEQ ID NO: 68); rs312457: gtgagccaccgtgcccggcc (SEQ ID NO: 69); rs17203148: gaaacctacagagccaagat (SEQ ID NO: 70); rs1698227: tgctcattttcctctgcact (SEQ ID NO: 71); rs191133: atgattgacttactttcatc (SEQ ID NO: 72); rs193399: tccttcctgaacctagaagc (SEQ ID NO: 73); NA: tgggacgcggggtgtacgga (SEQ ID NO: 74); NA: gcggcgagaaatgaatgcag (SEQ ID NO: 75); NA: acctgccgcctgctgcgcgc (SEQ ID NO: 29); NA: attgatatccgagatttacc (SEQ ID NO: 76); NA: tgggtgaatcacctgacgtc (SEQ ID NO: 77); NA: tatcactggggtgtccgggc (SEQ ID NO: 78); NA: cgggagccccgcgtcctcat (SEQ ID NO: 79); NA: catgcgtaaggaggggcgtt (SEQ ID NO: 80); NA: gactctcttgctttaatgag (SEQ ID NO: 81); and NA: ggaattgcaaggccctgttg (SEQ ID NO: 82).

(302) Significantly, transactivators targeted to regions proximal to a gene promoter increased that gene's transcript levels. In 293T cells, only transactivators targeted to the three variants proximal to the SLC16A11 transcriptional start site increased expression of this gene. In this context, transactivators targeted to the other 15 non-coding variants did not alter the expression of SLC16A11. Moreover, SLC16A13 expression was not altered by any of the variant-directed transactivators. This demonstrated the specificity of this approach. Due to the sequence specificity required for transactivator targeting, gRNAs that overlap a variant would be expected to specifically induce expression of the non-variant allele.

Example 22

Mining Library of Integrated Cellular Signatures (LINCS) Dataset for Connections to SLC16A11 Gene Expression Signatures

(303) Given that gene expression is tightly correlated, measuring a small number of genes is sufficient to impute most of the gene expression content of the transcriptome. For the Library of Integrated Cellular Signatures (LINCS) dataset, 978 genes are directly measured and an inference model, trained on publically available Affymetrix microarray data, is then used to impute gene expression for 20,000 additional probes. Given that SLC16A11 gene expression was not directly measured nor was it inferred, query signature was generated first.

(304) Gene expression data in 119 human liver samples was obtained from the Genotype-Tissue Expression project (GTEx) and ranked genes by how well correlated their expression was to SLC16A11 expression. Samples were selected from 50, 100, and 150 of the most positively and negatively correlated genes respectively and used them to generate 3 SLC16A11 gene expression signatures. These signatures served as surrogates for SLC16A11 transcript levels. These query signatures were used to search the entire space of compounds profiled in the LINCS dataset. The goal was to identify compound signatures that were most similar to the query signature. It was predicted that these signatures were generated by compound treatments that might also increase SLC16A11 expression.

(305) A connectivity score ranging from 100 for a positive connection to −100 for a negative connection was used to quantify the similarity between signatures as previously described. A positive connection between two signature means that both signatures result from similar changes in gene expression. Conversely for a negative connection, the changes in gene expression are opposite meaning that the set of genes most up-regulated in one signature tend to be down-regulated in the other and vice versa. The results from the three query signatures were averaged to nominate compound treatments that consistently made positive connections with the SLC16A11 gene expression signature as shown in Table 11. Connectivity scores for the top 25 positive connections to the SLC16A11 gene expression signature are shown in Table 11A. The signature size corresponds to the number of positively and negatively correlated genes used in the query signature. Compounds that were annotated as inhibiting the mechanistic target of rapamycin (mTOR) are shown in bold.

(306) TABLE-US-00034 TABLE 11A Mining LINCS dataset for connections to SLC16A11 gene expression signatures. SLC16A11 SLC16A11 SLC16A11 signature signature signature Compound Name size 50 size 100 size 150 Average tipifarnib-P2 99.51 98.95 98.56 99.01 calpeptin 98.94 99.15 98.87 98.99 KU-0063794 98.66 98.98 98.98 98.87 MEK1-2-inhibitor 98.66 98.77 98.98 98.80 fostamatinib 98.31 99.33 98.73 98.79 AZD-8055 98.48 98.80 98.73 98.67 NVP-BEZ235 98.48 98.80 98.70 98.66 PP-30 99.05 98.45 98.20 98.57 PD-0325901 98.06 98.17 96.81 97.68 PIK-90 96.93 97.92 97.95 97.60 BMS-536924 97.31 95.91 98.20 97.14 PI-828 96.34 97.89 97.00 97.08 PI-103 97.11 96.93 96.48 96.84 KIN001-244 94.96 96.52 97.43 96.30 serdemetan 96.36 95.53 96.97 96.29 PP-2 96.67 95.95 96.05 96.22 WYE-354 97.28 96.34 94.74 96.12 methotrexate 94.72 95.56 98.02 96.10 U0126 91.55 97.78 98.94 96.09 U-0126 89.44 98.73 98.13 95.43 NU-7026 97.96 96.01 92.29 95.42 OSI-027 97.46 94.66 93.87 95.33 selumetinib 93.12 97.43 95.24 95.26 deforolimus 95.95 96.13 93.56 95.21 PAC-1 96.36 95.08 91.90 94.45

(307) Among the top 25 positive connections to the SLC16A11 gene expression signature, compounds that had been annotated with mTOR inhibition as a mechanism of action had generated 7 signatures. There were a 2837 signatures queried in total and 22 of these were annotated as mTOR inhibitors. This represented a highly significant enrichment of mTOR inhibitors among the most 25 positive connections (P=1×10.sup.−10 by the hypergeometric test) and indicates in favor of the hypothesis that mTOR inhibition might increase SLC16A11 expression.

(308) Table 11B shows the top 25 compounds and gene targets from the 2837 signatures.

(309) TABLE-US-00035 TABLE 11B Top 25 connections from dataset for connections to SLC16A11 gene expression signatures cell_id gene_target id moa pert_id pert_iname pert_type A11_SCORR_UP_50 SUMMLY FNTA|FNTB BRD-K62965 farnesyltransferase BRD-K62965 tipifarnib-P2 trt_cp 99.51 inhibitor SUMMLY −666 BRD-A84045 calpain inhibitor BRD-A84045 calpeptin trt_cp 98.94 SUMMLY MTOR BRD-K67566 mTOR inhibitor BRD-K67566 KU-0063794 trt_cp 98.66 SUMMLY MAP2K1|MA BRD-K12244 MEK inhibitor BRD-K12244 MEK1-2-inhibitor trt_cp 98.66 SUMMLY SYK|FLT3|R8 BRD-K20285 SYK inhibitor BRD-K20285 fostamatinib trt_cp 98.31 SUMMLY MTOR BRD-K69932 mTOR inhibitor BRD-K69932 AZD-8055 trt_cp 98.48 SUMMLY MTOR|PIK3O BRD-K12184 mTOR inhibitor BRD-K12184 NVP-BEZ235 trt_cp 98.48 SUMMLY RAF1 BRD-K30677 RAF inhibitor BRD-K30677 PP-30 trt_cp 99.05 SUMMLY MAP2K1|MA BRD-K49865 MEK inhibitor BRD-K49865 PD-0325901 trt_cp 98.06 SUMMLY −666 BRD-K99818 PI3K inhibitor BRD-K99818 PIK-90 trt_cp 96.93 SUMMLY IGF1R|AKT1 BRD-K34581 IGF-1 inhibitor BRD-K34581 BM5-536924 trt_cp 97.31 SUMMLY −666 BRD-K97365 PI3K inhibitor BRD-K97365 PI-828 trt_cp 96.34 SUMMLY PIK3CA|PIK3 BRD-K67868 mTOR inhibitor BRD-K67868 PI-103 trt_cp 97.11 SUMMLY PDPK1 BRD-K09186 dihydrofolate BRD-K09186 KIN001-244 trt_cp 94.96 SUMMLY MDM2 BRD-K60219 MDM inhibitor BRD-K60219 serdemetan trt_cp 96.36 SUMMLY SRC|LCK|AB BRD-K95785 src inhibitor BRD-K95785 PP-2 trt_cp 96.67 SUMMLY MTOR BRD-K77008 mTOR inhibitor BRD-K77008 WYE-354 trt_cp 97.28 SUMMLY DHFR|AOX1 BRD-K59456 phosphoinositide BRD-K59456 methotrexate trt_cp 94.72 SUMMLY JAK2|MAP2K BRD-K46419 MEK inhibitor BRD-K46419 U0126 trt_cp 91.55 SUMMLY AKT1|CHEK1 BRD-K18787 MEK inhibitor BRD-K18787 U-0126 trt_cp 89.44 SUMMLY PRKDC BRD-K09537 DNA dependent BRD-K09537 NU-7026 trt_cp 97.96 SUMMLY MTOR BRD-K94294 mTOR inhibitor BRD-K94294 OSI-027 trt_cp 97.46 SUMMLY MAP2K1|MA BRD-K57080 MEK inhibitor BRD-K57080 selumetinib trt_cp 93.12 SUMMLY MTOR BRD-K29733 mTOR inhibitor BRD-K29733 deforolimus trt_cp 95.95 SUMMLY CASP3 BRD-K92991 caspase active BRD-K92991 PAC-1 trt_cp 96.36 cell_id gene_target id A11_SCORR_UP_100 A11_SCORR_UP_150 AVG SUMMLY FNTA|FNTB BRD-K62965 98.95 98.56 99.01 SUMMLY −666 BRD-A84045 99.15 98.87 98.99 SUMMLY MTOR BRD-K67566 98.98 98.98 98.87 SUMMLY MAP2K1|MA BRD-K12244 98.77 98.98 98.80 SUMMLY SYK|FLT3|R8 BRD-K20285 99.33 98.73 98.79 SUMMLY MTOR BRD-K69932 98.8 98.73 98.67 SUMMLY MTOR|PIK3O BRD-K12184 98.8 98.7 98.66 SUMMLY RAF1 BRD-K30677 98.45 98.2 98.57 SUMMLY MAP2K1|MA BRD-K49865 98.17 96.81 97.68 SUMMLY −666 BRD-K99818 97.92 97.95 97.60 SUMMLY IGF1R|AKT1 BRD-K34581 95.91 98.2 97.14 SUMMLY −666 BRD-K97365 97.89 97 97.08 SUMMLY PIK3CA|PIK3 BRD-K67868 96.83 96.48 96.84 SUMMLY PDPK1 BRD-K09186 96.52 97.43 96.30 SUMMLY MDM2 BRD-K60219 95.53 96.97 96.29 SUMMLY SRC|LCK|AB BRD-K95785 95.95 96.05 96.22 SUMMLY MTOR BRD-K77008 96.34 94.74 96.12 SUMMLY DHFR|AOX1 BRD-K59456 95.56 98.02 96.10 SUMMLY JAK2|MAP2K BRD-K46419 97.78 98.94 96.09 SUMMLY AKT1|CHEK1 BRD-K18787 98.73 98.13 95.43 SUMMLY PRKDC BRD-K09537 96.01 92.29 95.42 SUMMLY MTOR BRD-K94294 94.66 93.87 95.33 SUMMLY MAP2K1|MA BRD-K57080 97.43 95.24 95.26 SUMMLY MTOR BRD-K29733 96.13 93.56 95.21 SUMMLY CASP3 BRD-K92991 95.08 91.9 94.45

Example 23

mTOR Inhibitors as Modulators of SLC16A11 Gene Expression

(310) A small number of the compounds that made the strongest positive connections to the SLC16A11 gene expression signature were selected and tested. The inhibitor KU-0063794 and AZD-8055 were selected because they are both mTOR inhibitors. Methotrexate was also included, which had been annotated as a dihydrofolate reductase inhibitor. SNU761 cells (derived from a human hepatocellular carcinoma) and NCIH716 cells (derived from a human cecum adenocarcinoma), which both express SLC16A11, were treated with the compounds. The same compound concentrations and treatment times were used as in the LINCS dataset experiments. The results indicated the mTOR inhibitors, KU-0063794 and AZD-8055, increased SLC16A11 transcript levels about 3-fold in compound treated cells compared to DMSO treated cells (FIG. 13A, left and right panels). The chemical structures of the mTOR inhibitors AZD-8055 and KU-00637947 are shown in FIG. 13B. In contrast, methotrexate did not alter SLC16A11 transcript levels and thus represented a false positive result obtained through mining of the Library of Integrated Cellular Signatures (LINCS) dataset. For normalization, a different housekeeper gene, HPRT1, was used and obtained similar results with the mTOR inhibitors (FIGS. 14A and 14B). The expression of SLC16A1 was also measured and the data indicated that these mTOR inhibitors did not increase expression of this gene, but rather resulted in a slight decrease (FIGS. 14C and 14D). The graphs presented in FIGS. 14A-D thus show that mTOR inhibitors increase SLC16A11 but not SLC16A1 transcript levels.

(311) Next an unbiased approach was used to investigating the compounds that made the strongest positive connections to the SLC16A11 gene expression signature (Table 11C).

(312) TABLE-US-00036 TABLE 11C moa pert_iname avg_fc pvalue_fc CHK inhibitor AZD-7762 4.92401276 0.02949981 mTOR inhibitor AZD-8055 4.2531982 0.06697925 mTOR inhibitor KU-0063794 4.00923817 0.02591343 mTOR inhibitor WYE-354 3.51686403 0.00252449 mTOR inhibitor OSI-027 3.38355907 0.00401379 mTOR inhibitor WYE-125132 3.33600456 0.02742533 3.33141845 0.00994261 3.27703893 0.01331774 SYK inhibitor fostamatinib 3.27387727 0.04164977 Aurora kinase inhibitor reversine 3.23490477 0.00732965 mTOR inhibitor torin-2 2.84341284 0.03756893 mTOR inhibitor torin-1 2.83974255 0.03157075 mTOR inhibitor|PI3K inhibitor NVP-BEZ235 2.77949368 0.06359898 mTOR inhibitor|PI3K inhibitor PI-103 2.45335902 0.08424547 MEK inhibitor PD-0325901 2.18064833 0.01367536 PI3K inhibitor AZD-6482 2.17592976 0.02429224 PI3K inhibitor GDC-0941 2.07949266 0.00714229 MEK inhibitor selumetinib 1.96392721 0.02357516 mTOR inhibitor deforolimus 1.90342737 0.00016188 MEK inhibitor U0126 1.88524262 0.10090469 1.78730201 0.06046331 RAF inhibitor HG-6-64-01 1.72832221 2.80E−05 MEK inhibitor AS-703026 1.68014838 0.25778722 mTOR inhibitor sirolimus 1.66202644 0.05653636 VEGFR inhibitor tivozanib 1.64672418 0.1283144 PI3K inhibitor PIK-90 1.48685288 0.03401197 MEK inhibitor PD-184352 1.44468429 0.22689753 MEK inhibitor MEK1-2-inhibitor 1.41413951 0.11185062 ATPase inhibitor digitoxin 1.37498564 0.29793571 mTOR inhibitor temsirolimus 1.3723327 0.22240465 EGFR inhibitor|receptor tyrosine CP-724714 1.36950068 0.04682589 protein kinase inhibitor RAF inhibitor vemurafenib 1.36812997 0.20857533 JNK inhibitor CG-930 1.33675685 0.19881349 PI3K inhibitor PI-828 1.33568521 0.46648565 1.32817918 0.00953097 gamma secretase inhibitor DAPT-GSI-IX 1.28555707 0.04853151 PI3K inhibitor GSK-1059615 1.25007248 0.54883079 protein synthesis inhibitor cycloheximide 1.24299068 0.32796445 src inhibitor PP-2 1.18969809 0.45381445 opioid receptor antagonist naltrexone 1.18344455 0.33874774 lanosterol demethylase econazole 1.17782824 0.04437152 inhibitor|sterol demethylase inhibitor MEK inhibitor nobiletin 1.1292611 0.11222204 PARP inhibitor DR-2313 1.12695386 0.42639695 DNA dependent protein kinase NU-7026 1.11955507 0.07115831 inhibitor|mTOR inhibitor|PI3K inhibitor PI3K inhibitor TG100-115 1.08577313 0.51539111 phosphoinositide dependent kinase KIN001-244 1.08422339 0.39899681 inhibitor farnesyltransferase inhibitor tipifarnib-P2 1.07986686 0.59434491 1.07891653 0.54130639 cyclooxygenase inhibitor valdecoxib 1.06912194 0.72926832 hepatocyte growth factor receptor SU-11274 1.0592887 0.77051943 inhibitor|tyrosine kinase inhibitor calpain inhibitor calpeptin 1.03354484 0.7689418 dopamine receptor quetiapine 1.01854187 0.91762955 antagonist|serotonin receptor antagonist nucleoside reverse transcriptase zalcitabine 1.01005088 0.81043915 inhibitor PI3K inhibitor AS-604850 1.00926516 0.94312224 0.99207472 0.95545578 serotonin receptor partial agonist RS-56812 0.9914154 0.79583413 src inhibitor PP-1 0.98793731 0.96979528 0.98600855 0.85805542 ephrin inhibitor ALW-II-38-3 0.97344232 0.86528021 acetylcholinesterase inhibitor herniarin 0.9563387 0.69522575 dopamine receptor antagonist|serotonin receptor clozapine 0.9466189 0.54015202 antagonist 0.94300019 0.54918996 cyclooxygenase inhibitor meloxicam 0.94140559 0.73523383 potassium channel blocker E-4031 0.94109648 0.5025332 dehydropeptidase inhibitor cilastatin 0.93712719 0.50908085 MAP kinase inhibitor FR-180204 0.91499016 0.66896245 antihypertensive agent aliskiren 0.88528492 0.13659314 p38 MAPK inhibitor VX-702 0.8683097 0.45056948 potassium channel blocker linopirdine 0.86287534 0.07291565 adrenergic receptor antagonist|serotonin receptor carpindolol 0.85483751 0.07955479 antagonist calcium channel blocker bepridil 0.85445892 0.50041792 phosphodiesterase inhibitor T-0156 0.83784524 0.43354974 serotonin receptor agonist MK-212 0.80218908 0.45970382 MEK inhibitor PD-98059 0.79292953 0.34910221 sodium/potassium/chloride bendroflumethiazide 0.79167177 0.29891918 transporter inhibitor PI3K inhibitor AS-605240 0.79075412 0.17814334 sodium channel blocker ranolazine 0.76544356 0.15748844 protein tyrosine kinase inhibitor tyrphostin-AG-112 0.75944216 0.09151528 acetylcholine receptor agonist pilocarpine 0.73789297 0.08551291 AKT inhibitor MK-2206 0.69718673 0.16777507 serotonin receptor agonist GR-46611 0.66093209 0.01348733 coloring agent erythrosine 0.64902572 0.01655812 MDM inhibitor serdemetan 0.63835589 0.09413608 adenosine inhibitor cladribine 0.59937722 0.01922744 HDAC inhibitor JNJ-26854165 0.53282722 0.00040551 CDK inhibitor|PKC inhibitor bisindolylmaleimide 0.42648463 0.01118945

(313) From the total list of compounds, 59 readily available compounds were selected from the 79 compounds with the largest connectivity scores to the query signature and 20 middle compounds with connectivity scores centered on 0 (FIG. 15A) and then treated SNU761 cells at the same doses and treatment times as were used in the LINCS dataset. It was expected that the top compounds would be enriched for compounds that increased SLC16A11 expression. It was expected that the middle compounds would not alter SLC16A11 expression, as their signatures did not resemble the query signature. The results were aligned with the expectations (FIG. 15B). Hierarchical clustering of the SLC16 expression profiles generated by the compound treatments are shown by the heat map in FIG. 15C.

(314) The compounds AZD-8055 and KU-0063794 ranked second and third in their ability to increase SLC16A11 expression, each with about a 4-fold increase. AZD-7762, annotated as a Checkpoint Kinase (CHK) inhibitor, was ranked first and increased SLC16A11 expression by about 5-fold. In total, 13 compounds annotated as mTOR inhibitors were tested, and 9 of these resulted in at least 2-fold increases in SLC16A11 expression in compound treated cells compared to DMSO treated cells (Table 11C). Interestingly, compounds that increased SLC16A11 expression in SNU761 for the most part did not affect SLC16A13 expression while most decreased SLC16A1 expression. The most promising compound, AZD-8055, was selected to confirm that it was able to increase SLC16A11 expression in human hepatocytes (FIG. 16). In human hepatocytes, this compound resulted in decreased SLC16A13 and SLC16A1 expression.

(315) The data presented herein indicates that treating cells, including cell lines, such as SNU761 and NCIH716, as well as primary human hepatocytes, with AZD-8055 results in increased SLC16A11 expression. mTOR exists as 2 protein complexes: mTORC1 and mTORC2. AZD-8055 is an ATP-competitive inhibitor of mTOR and inhibits both mTORC1 and mTORC2. At concentrations of 10 μM, the concentration used in the experiments described herein, AZD-8055 is reported to not show significant activity against a panel of 260 other kinases. Inhibiting mTORC1 with rapamycin has been shown to rapidly shift metabolism from TCA cycle and oxidative phosphorylation to reliance on glycolysis in human leukemia cells. This is reminiscent of experiments showing that over-expression of SLC16A11 was found to result in decreased TCA cycle metabolites. This data again indicates that SLC16A11 might be involved in mediating flux through central metabolite pathways such as glycolysis and TCA cycle.

(316) SLC16A11 is expressed at low levels in a small number of human tissues indicating that SLC16A11 expression may be under tight regulation. One might speculate that some signal induces SLC16A11 expression. Mining the LINCS dataset for connections to an SLC16A11 gene expression signature is an unbiased approach to identify cellular conditions that result in increased SLC16A11 expression. Alternatively, more targeted experiments testing metabolically relevant metabolites and hormones such as pyruvate, lactate, oleic acid, insulin, and glucagon could be performed.

(317) The data presented herein indicates that the T2D risk variants result in reduced SLC16A11 activity in liver. One might wonder how disruption of SLC16A11 leads to T2D risk when other family members, and in particular SLC16A13, which might share overlapping functions, are also expressed in liver. Without wishing to be bound to theory, one possibility is that these genes are regulated differently and SLC16A11 is particularly relevant under some yet to be determined physiological conditions. The data in presented herein indicates that at least some differences in gene regulation for SLC16A11, SLC16A13, and SLC16A1 exist, with mTOR inhibition increasing SLC16A11 expression but decreasing SLC16A13 and SLC16A1 expression in primary human hepatocytes.

Example 24

Development of Droplet Digital PCR (ddPCR) Based Screening for Modulators of SLC16A11 Expression

(318) Expression of SLC16A11 is low and does not reach the threshold of detection for standard PCR techniques. Therefore, the utilization of highly sensitive droplet digital PCR (ddPCR) is a more suitable strategy to detect SLC16A11 expression. However, manual assays that take advantage of the sensitivity of ddPCR are low-throughput, and can only test the effect of a low number of small molecules on SLC16A11 expression at a time. Although the entire process cannot be automated, automating RNA extraction improves efficiency. The improved assay will allow for a higher throughput screening process that can test the effects of thousands of small molecules on SLC16A11 expression.

(319) As detailed herein above, SLC16A11 (A11) belongs to a family of monocarboxylate transporters. Expression of A11 was studied in SNU 761 cell lines. These liver cancer cells are ideal for studying SLC16A11 expression because A11 is expressed in higher quantity in liver cells, although expression of the gene in all tissues is extremely low. The 5 SNP risk haplotype causes lowered expression and interferes with protein-protein interactions between A11 and a cofactor protein, indicating loss of function. Therefore, increasing A11 expression in individuals with the risk haplotype is likely beneficial.

(320) In order find small molecules that can increase SLC16A11 (A11) expression a strong assay to screen for small molecules of interest is required. Strong assays have a high signal to background ratio, low variability, and are highly sensitive. A schematic graph showing the output of an assay is shown in FIG. 17A, including a separation band, data variability bands, with frequency (y axis) and assay signal (x axis). Strong assays have a large separation band, meaning they can differentiate between positive and negative controls.

(321) The quality of an assay can be quantified by Z′, a measure of how well the assay can differentiate between the positive and negative controls. Using the formula:

(322) Z = 1 - ( 3 σ C + + 3 σ C - ) .Math. μ C + - μ C - .Math.
a cell based assay was developed, where the formula output can be categorized using the following ranges: Excellent: 0.5<Z′<1; Good: 0.3<Z′<0.5; Poor: 0<Z′<0.3; and Unusable: Z′<0. Statistical parameters for use in evaluation and validation of high throughput screening assays are described by Zhang et al. (1999, J Biomol Screen., 4(2):67-73).
Methods and Assay Optimization

(323) First the cells were treated with inhibitor compounds, their RNA was extracted, and that RNA was used as a template to create DNA. Then, the DNA was quantified using droplet digital PCR (ddPCR), analyzed and quantified using QuantaSoft™ (BioRad).

(324) The compounds AZD 8055 and KU-0063794 were tested for their effect on SLC16A11 (A11) expression. The compounds are chemically similar and inhibit mTOR, a metabolic regulator (FIG. 13B).

(325) Automation of this assay was developed after validating manual protocol for RNA extraction. A protocol for a Bravo liquid handling machine was created and implemented to make the RNA extraction faster and more efficient due to decreased human intervention.

(326) Next the RT reaction was optimized. The One-step RT-ddPCR Advanced kit was highly efficient because it performed the RT reaction and included all the reagents needed for ddPCR in a single step. This saved time and decreased variability by eliminating pipetting steps.

(327) Assay development for A11 is especially difficult because A11 is expressed at levels below the detection threshold for standard PCR techniques. Therefore, highly sensitive droplet digital PCR (ddPCR) was utilized, which uses microfluidics to create thousands of droplets from a single sample. FIG. 17B shows a schematic of partitioning of a PCR sample into thousands of samples in ddPCR. Each droplet has its own PCR reaction, and is scored positive if it has the gene of interest, or negative if it does not. This scoring gives an exact copy number of the gene of interest instead of a relative abundance.

(328) Assay Results

(329) From the QuantaSoft scoring of each droplet, the means and standard deviations of SLC16A11 expression levels was determined in response to compound treatment. Using QuantaSoft ddPCR analysis, each point represents a single droplet. Points in light gray had the gene of interest and were scored as positive (FIG. 17C). SLC16A11 was scored in the graph. Since AZD 8055 and KU-0063794 increased A11 expression, they could be used to as positive controls and calculate Z's for the manual assay (FIG. 17D). The Z′ for AZD was 0.65 and the Z′ for KU was 0.69. Since both Z's were above 0.6, a strong assay could be developed for screening small molecules that increase A11. It is probable that the Z′ score will improve once the assay is fully automated.

Example 25

Assessment of Metabolic Effectors on SLC16A11 and SLC16A13 Transcript Levels

(330) To assess whether metabolic effectors regulated SLC16A11 and SLC16A13 transcript levels, endogenous transcripts in SNU761 cells (derived from a human hepatocellular carcinoma) were examined following exposure of the cells to different metabolic perturbations. SNU761 cells were cultured in the presence of various metabolic effectors for 24 hours after which time cell lysates were collected and the relative endogenous expression levels of SLC16A11 and SLC16A13 transcripts were assessed. The metabolic effectors included in the cell cultures included oleic acid (OA) at a low concentration (0.3 mM) or a high concentration (1.5 mM); insulin at a low concentration (100 nM) or a high concentration (500 nM) and glucagon at a low concentration (100 nM) and a high concentration (500 nM). Cells cultured in 2-FBS were used as a control. These metabolic effectors were found to alter the SLC16A11 and SLC16A13 transcripts at 17p13, with SLC16A13 transcript levels showing an increase at both the low and high concentrations of OA. (FIG. 22). Similarly, SNU761 cells were cultured in the presence or absence of low or high concentrations of pyruvate or lactate in the culture medium for 24 hours after which time cell lysates were analyzed. In the cultures, low (L) pyruvate concentration was 2 mM; high (H) pyruvate concentration was 10 mM, and low lactate concentration was 20 mM, while high lactate concentration was 100 mM. Pyruvate and lactate were found to alter transcripts at 17p13 at both low and high concentrations of pyruvate and lactate. (FIG. 23). In particular, high concentrations of pyruvate and lactate increased the relative transcript levels of SLC16A13, as seen in FIG. 23.

(331) The experiments and experimental results described in the Examples herein above were obtained using the methods and materials described below.

(332) Integration of Data and Imputation

(333) The cohorts, genotyping, and credible set analysis have been described previously (SIGMA T2D Consortium, 2014, Nature, 506:97-101; Estrada, K. et al., 2014, JAMA, 311(22): 2305-2314). Briefly, for the credible set analysis, two datasets were built first (FIG. 1A). One dataset was comprised of 4,478 samples that had been genotyped by exome chip and OMNI 2.5. The other dataset comprised another subset of 3,732 samples genotyped by exome chip, OMNI2.5 and whole-exome sequencing. All the variants with minor allele frequency (MAF) higher than 0.001 for both datasets. Both datasets were phased with SHAPEIT26 (version 2.5). Next the 1000 G (phase 3, release June 2014) was imputed into both datasets separately. The whole-exome variants that were not imputable using 1000G phase 3 were also imputed into the samples that had not been ascertained by whole-exome sequencing. An impute 2 information score >0.8 was used as a post-imputation quality control. The association analysis was then performed separately in each cohort using SNP test adjusting for body mass index (BMI), age, sex and the first two principal components to adjust for population stratification. Both results were then meta-analyzed using Metal7.

(334) The Genomics Platform at the Broad Institute (Cambridge, Mass.) received, QC'd and tracked DNA samples for Exome array processing. The samples were plated into 96-well plates that included a quality control sample for processing on the Illumina HumanExome BeadChip (Illumina, Inc. San Diego, Calif.) using manufacturer's protocols. The arrays were scanned using Illumina iScans. Genotypes were called using three different calling algorithms: Illumina GenCall, Z-call (Goldstein, J. I. et al., 2012, Bioinformatics, 28:2543-2545) and Birdsuite (http://www.broadinstitute.org/science/programs/medical-and-population-genetics/birdsuite/birdsuite-0).

(335) Clusters were fit using the Birdseed algorithm to each genotyping plate independently. Genotypes with confidence below 99.9% were excluded from analysis (e.g., considered “missing” or “no-call” genotypes). Samples with low numbers of non-reference alleles (<˜20,000, depending on the cohort), low call rate (<99.3%) or unusually high heterozygosity (>˜0.05, depending on the cohort) were removed from subsequent analysis; thresholds were chosen based on visual inspection of the sample distributions. Variants with low call rate (<99.2%) or mean confidence for alternative genotype calls (<99%) were also excluded from subsequent analysis.

(336) Integration of Data and Credible Set Analysis

(337) For the credible set analysis, first two datasets were built (FIG. 1A). One dataset was comprised of 4,478 samples that had been genotyped by exome chip and OMNI 2.5 (Dataset 1) (SIGMA T2D Consortium et al., 2014, Nature, 506:97-101). The other dataset comprised another subset of 3,732 samples genotyped by exome chip, OMNI2.5, and whole-exome sequencing (Dataset 2) (Estrada, K. et al., 2014, JAMA, 311(22): 2305-2314). All the variants with MAF higher than 0.001 were retained for both datasets. Both datasets were phased with SHAPEIT2 (Delaneau, O. et al., 2013, Nat Meths, 10:5-6) (version 2.5) and then imputed the 1000 G (phase 3, release June 2014) into both datasets separately. Whole-exome variants that were not imputable using 1000G phase 3 were also imputed into samples that had not been ascertained by whole-exome sequencing (Dataset 1). Variants with impute 2 information score<0.8 were removed as a post-imputation quality control. The association analysis was then performed separately in each cohort using SNPtest adjusting for body mass index (BMI), age, sex and the first two principal components to adjust for population stratification. Both results were then meta-analyzed using Metal (Willer, C. J. et al., 2010, Bioinformatics, 26:2190-2191).

(338) The credible set was constructed as previously described (Wakefield, J., 2007, Am J Hum Genet, 81:208-227). Briefly, for each association meta-analysis results, an approximate Bayes factor was computed for each variant with an r-squared greater than 0.1 with the top variant at the SLC16A11 locus using the formula:

(339) abf = ( 1 - r ) exp ( - r × z 2 2 ) where z = beta / se and r = 0.04 se 2 + 0.04
under the assumption that the prior on beta is Gaussian with variance 0.04. The posterior probability for each variant was then computed by dividing the ABF by the total number of variants in the region. All variants were ranked by posterior probability and the minimal set of variants that resulted in a cumulative posterior probability of 0.99 was deemed the 99% credible set.
Association Analysis in MEDIA

(340) The MEDIA dataset consists of meta-analysis results from 17 T2D studies (ARIC, CARDIA, CFS, CHS, FamHS, GeneSTAR, GENOA, HANDLS, Health ABC, HUFS, JHS, MESA, MESA Family, SIGNET-REGARDS, WFSM, FIND, and WHI) with up to 23,827 African American subjects (8,284 cases and 15,543 controls) (Ng, M.C. et al., 2014, PloS Genetics, 10:e1004517). The results of each study were imputed using the HapMap reference panel and meta-analyzed using inverse-variance fixed-effects meta-analysis using METAL.

(341) Cell Culture

(342) HEK293-T (human embryonic kidney) and HuH7 (Human Hepatoma) cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% Fetal Calf Serum (FCS), 100 ug/ml Streptomycin and 100U/ml Penicillin. Cells were grown in either 75 cm.sup.2 or 175 cm.sup.2 flasks, in a humidified CO.sub.2 incubator, at 37° C.

(343) Primary Human Hepatocytes

(344) Primary human hepatocytes were purchased from Bioreclamation IVT. Lots heterozygous for the T2D risk haplotype include ACB, BEB, DSX, NQA, PAA, and QSK. Lots heterozygous for the African haplotype include AIH, FRY, GEB, JLP, KDD, NRE, ZBG, and ZXO. Genotyping at rs13342232 and rs75493593 from Bioreclamation IVT was used to infer heterozygosity for the T2D haplotype (heterozygous for the alternative allele at both SNPs) and the African haplotype (heterozygous for the alternative allele at rs13342232 and homozygous reference at rs75493593). Cells were thawed and immediately resuspended in CP medium (Bioreclamation IVT) with torpedo antibiotic (Bioreclamation IVT). Cell concentration and viability were assessed prior to use. For RNA isolation, cell pellets were frozen at −80° C. For ChIP-sequencing, 1×10.sup.6 cells were cross-linked with 1% formaldehyde for 10 minutes at 37° C. prior to freezing in liquid nitrogen.

(345) eQTL and Allele-Specific Expression Analyses

(346) For the eQTL analyses, normalized gene expression counts were compared between individuals who carried 0, 1, or 2 copies of the T2D risk haplotype. Within each genotype, the mean count for each gene was calculated. Percent change and standard error mean were calculated for each pairwise comparison between genotypes. Statistical significance was assessed with a t-test. The analysis accounted for multiple hypothesis testing using a Bonferroni correction for the number of genes tested and the number of comparisons between genotypes.

(347) Statistical significance was assessed by linear regression assuming an additive model for the SNP, and adjusting by age, sex, BMI, and T2D status. Multiple hypothesis testing was accounted for using a Bonferroni correction for the number of traits tested and the number of comparisons between genotypes.

(348) For each heterozygote individual in the allele-specific expression analyses, the proportion of total SLC16A11 gene expression counts that originate from the T2D risk allele versus the reference allele was computed. The overall proportion and 95% confidence intervals from all the samples were calculated by meta-analyzing with inverse variance method after logit transformation using the ‘meta’ package (version 4.5-0). The statistical significance of the differences between the pooled proportion and the expected proportion under the null (0.5) was calculated by computing the Z-statistic from which the two-tailed p-value was derived.

(349) Luciferase Reporter Assays and Analysis

(350) Cells were plated into 96 well plates and after 24 hours were transfected with 150 ng of the appropriate firefly vector, 50 ng empty vector control pLX304, and 20 ng of the renilla vector pRL-CMV (Promega). After 48 hr, luminescence was detected using Dual-Glo® Luciferase Assay System (Promega) and a Synergy H4 microplate reader (BioTek). For each well, firefly luminescence was normalized by renilla luminescence. To combine data across experiments, the average value for a given construct in a given experiment was used and statistical significance was assessed using a t-test.

(351) RNA-Sequencing and Analysis

(352) 250 ng total RNA was depleted for ribosomal RNA using NEBNext® rRNA Depletion Kit (New England BioLabs) according to the manufacturer's protocol. First strand synthesis was completed with Maxima Reverse Transcriptase using random hexamers (Thermo Fisher Scientific). Second strand synthesis was done with NEBNext® mRNA Second Strand Synthesis Module (New England BioLabs). Illumina library construction was performed with Nextera® XT DNA Library Preparation Kit (Illumina) according to the manufacturer's protocol with the following modification: 0.4 ng of dsDNA was tagmented at 55° C. for 10 min. Library quality was assessed with BioAnalyzer (Agilent) and concentration was determined by Qubit fluorometric quantification (Thermo Fischer Scientific). Libraries were sequenced on an Illumina NextSeq500, 75 bp paired end. Fastqc (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was used to assess read quality. STAR (Dobin et al., 2012) was used to map reads to an index generated from GRCh38 and Gencode v24. RNA-SeQC (DeLuca et al., 2012) was used to assess overall quality of the RNA-sequencing experiment. FeatureCounts (Liao et al, 2014, Mol Cell Biol, 31:2591-2604) was used to summarize reads across genes. Finally, DESeq2 (Love et al., 2014) was used to perform differential expression analysis and GSEA PreRanked (http://software.broadinstitute.org/gsea/index.jsp) was used for pathway analysis.

(353) Visceral Adipose and Liver Tissue Collection

(354) Visceral adipose and liver samples were collected from subjects undergoing bariatric surgery for severe obesity (BMI greater than 40 kg/m2, or greater than 35 kg/m2 with comorbid entities) or elective surgery in nonobese patients. Patients were selected for bariatric surgery after 6 months of rigorous lifestyle intervention. All individuals were Mexican Mestizos older than 18 years, carefully selected from the Integral Clinic of Surgery for Obesity and Metabolic Diseases or General Surgery Department at the Tláhuac Hospital in Mexico City. Tissue samples were obtained at the beginning of the surgery with harmonic scalpel in all cases as follow: visceral fat was obtained from the greater omentum at the middle of the greater curvature of the stomach. Liver biopsy was obtained at the distal end of the left hepatic lobe, just above the spleen. VAT and liver samples were frozen immediately after removal. The protocol for collecting VAT and liver samples was approved by the respective local research and ethics committees and all patients signed an informed consent.

(355) For genotyping, genomic DNA was purified from whole blood samples using a modified salting-out precipitation method (Gentra Puregene, Qiagen Systems, Inc., Valencia, Calif., USA). Genotyping of the rs149483638 variant was performed using a custom TaqMan SNP Genotyping Assay (Applied Biosystems, Foster City, Calif., USA) and genotype of each sample was assigned automatically by SDS 2.3 software (Applied Biosystems, Foster City, Calif., USA). Genotyping of variants rs13342692 (Assay ID: C_25760519_10) and rs13342232 (Assay ID: C_31793671_10) were performed using TaqMan SNP Genotyping Assay (Applied Biosystems, Foster City, Calif., USA). Five previously genotyped samples were added in all plates as positive controls.

(356) RNA Isolation

(357) Total RNA was extracted from cells using the RNeasy Mini Kit (Qiagen) according to the manufactures protocol. RNA was isolated from frozen tissue samples by the Broad Institute's Genomics Platform using the miRNeasy Mini Kit from Qiagen.

(358) siRNA Treatment

(359) The following siRNAs were ordered from GE Dharmacon: Accell Human SLC16A11 siRNA SMARTpool (E-007404-00-0050) and Accell Non-targeting Pool (D-001910-10-50). siRNAs were reconstituted in PBS at 100 μM. Hepatocytes were plated into 24 well plates (Corning, 354408) at a density of 350,000 cells per well. After 4 hours, cells were washed once with HI media (Bioreclamation IVT) and siRNAs in HI media were added at a final concentration of 1 μM. After 24 hours, fresh CP media was added. Hepatocytes were grown for an additional 24 hours.

(360) Droplet Digital PCR (ddPCR)

(361) Total RNA was extracted using miRNeasy Mini Kits or RNeasy Mini Kits (Qiagen). RNA was DNase treated and converted into cDNA using the High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific). The following FAM-labeled, TaqMan Real-Time PCR assays (Thermo Fisher Scientific) were used to quantify gene expression: RNASEK (Hs00947009_m1 and Hs00947010_g1), BCL6B (Hs00394655_m1 and Hs00960914_g1), SLC16A13 (Hs00416832_m1 and Hs00914030_m1), SLC16A11 (Hs00601062_g1 and Hs01558330_g1), and CLEC10A (Hs00924864_g1 and Hs00197107_m1). VIC-labeled probes for TBP (Hs00427620_m1) and HPRT1 (Hs02800695_m1) were used for normalization. For allele-specific expression experiments, ddPCR assays (Fwd primer: 5′-AGGCAGCCAGCCC-3′ (SEQ ID NO: 83); Rev primer: 5′-CCGAGGTAGAGATGCAG-3′(SEQ ID NO: 84) that distinguish the SLC16A11 reference (5′-TTTCGCCAGCGATCTG-3′ (SEQ ID NO: 85); HEX-labeled probe) and T2D risk (5′-TCGCCAGCGGTCTG-3′ (SEQ ID NO: 86); FAM-labeled probe) alleles at rs13342692 were custom designed by BioRad. Droplets were generated and analyzed using a QX200 Droplet Generator and Reader system (BioRad). Data were extracted using QuantaSoft (BioRad) and analyzed using Microsoft Excel.

(362) ChIP-Sequencing and Analysis

(363) Chromatin immunoprecipitation (ChIP)-sequencing for H3K27ac, H3K4me1, and H3K4me3 were performed on primary human hepatocytes (lots ACB, DSX, and QSK). Cross-linked pellets were lysed for 10 min on ice and chromatin fragmented using a Branson 250 digital sonifier. Each ChIP was performed as described previously (Bernstein et al., 2005, Cell, 120:169-181) with 1 mg of antibody, incubated overnight at 4° C. The following antibodies were used for ChIP: H3K27ac (Active Motif 39133), H3K4me1 (Cell Signaling Technologies 5326BF), and H3K4me3 (Cell Signaling Technologies 9751BF). A 50/50 slurry of protein A and protein G Dynabeads was used to capture enriched chromatin, which was then washed before reverse-crosslinking and proteinase K digestion at 65° C. AMPure XP beads were used to clean up and isolate ChIP DNA for subsequent library construction. Illumina sequencing library construction was performed as previously described (Mikkelsen et al., 2007, Nature, 448:553-560) and sequenced on an Illumina NextSeq500, 150 bp paired end.

(364) Reads for immunoprecipitated H3K27ac, H3K4me1, H3K4me3, and input DNA were mapped to GRCh37 using Bowtie2 (Langmead and Salzberg, 2012, Nat Methods, 9:357-359). Peaks were called using HOMER (Heinz, S. et al., 2010, Mol. Cell., 38:576-589). Alignments were processed using WASP to adjust for reference-mapping bias (van de Geijn, B. et al., 2015, Nat Methods, 12:1061-1063). Evidence of the risk SNP was not detected at rs4630597, rs78972129, and rs76070643 in lot QSK and, consequently, removed these variants in this donor from further analyses. For each variant in each sample, a binomial test was performed in order to detect a skew in reference versus alternate (T2D risk) allele read counts. P-values across samples were combined using Fisher's method and accounted for multiple hypothesis testing using a Bonferroni correction for the number of variants and histone modifications tested. A histone modification at a variant was considered significantly skewed if it met the selected Bonferroni-corrected significance threshold and if the direction of the allelic imbalance was consistent across all donors.

(365) ChIP-PCR and Analysis

(366) 5 ng of input and histone modification ChIP libraries were PCR amplified using PrimeSTAR HS DNA polymerase (Clontech) with primers spanning T2D risk credible set variants. A second PCR was performed to add indices and adapters compatible with Illumina next-generation sequencing (Nextera® XT Index Kit, Illumina). PCR amplicons were purified using a QIAquick PCR Purification Kit (Qiagen). Library concentration was determined by Qubit fluorometric quantification (Thermo Fischer Scientific). Libraries were then sequenced on an Illumina MiSeq, 155 bp single end.

(367) At the genomic location corresponding to each T2D risk credible set variant, we computed the proportion of total read counts that originate from the T2D risk allele versus the reference allele. Allele-specific analyses were then performed as described in the eQTL section.

(368) Preparation of Reagents for Microinjection in Mouse Zygotes

(369) The following guides were used for generating the Slc16a11 and Slc16a13 knockout mice respectively: 5′ AGTCCTAACCTCGCTTGGCT-3′ (SEQ ID NO: 87) and 5′-GCAGCCCAATACTCAGGTAT-3′ (SEQ ID NO: 88). DNA oligos encoding the guides placed downstream of a T7 promoter and upstream of the tracrRNA sequence were ordered from Integrated DNA Technologies. An oligo encoding the reverse complement of the T7 promoter was also synthesized. The long DNA oligos were annealed by placing at 95° C. for 5 min followed by slow cooling to 4° C. sgRNAs were in vitro transcribed using the Standard RNA Synthesis kit (New England BioLabs, E2040) following the manufacturer's guidelines. sgRNAs were then purified with the MEGAclear Kit Purification for Large Scale Transcription Reactions kit (Thermo Fischer Scientific, AM1908) according to the manufacturer's guidelines. We included the DNase treatment step. sgRNAs targeting Slc16a11 or Slc16a13 and Cas9 mRNA (in the form of hspCas9 SmartNuclease mRNA: CAS500A-1 from System Biosciences) were delivered to the Genome Modification Facility at Harvard University, where they were microinjected into C57BL/6J mouse zygotes.

(370) Next-Generation Sequencing for Genotyping Mice and Data Analysis

(371) gDNA was extracted from tails using standard protocols. About 100 ng of gDNA was PCR amplified using PrimeSTAR HS DNA polymerase (Clontech) with primers spanning the targeted site. A second PCR was performed to add indices and adapters compatible with Illumina next-generation sequencing (Nextera® XT Index Kit, Illumina). PCR amplicons were purified using a QIAquick PCR Purification Kit (Qiagen). Library concentration was determined by Qubit fluorometric quantification (Thermo Fischer Scientific). Libraries were then sequenced on an Illumina MiSeq, 150 bp paired end. Given that a range of indels were expected in the mice born from the sgRNA and Cas9 microinjections, custom scripts were used to compare the sequences of mutant mice obtained from next-generation sequencing to the wild-type sequence. After colonies of mice were established, we used PCR based methods for genotyping.

(372) RNA-Sequencing and Analysis

(373) 300 ng total RNA was depleted for ribosomal RNA using NEBNext® rRNA Depletion Kit (New England BioLabs) according to the manufacturer's protocol. First strand synthesis was completed with Maxima Reverse Transcriptase using random hexamers (Thermo Fisher Scientific). Second strand synthesis was done with NEBNext® mRNA Second Strand Synthesis Module (New England BioLabs). Illumina library construction was performed with Nextera® XT DNA Library Preparation Kit (Illumina) according to the manufacturer's protocol with the following modification: 0.4 ng of dsDNA was tagmented at 55° C. for 10 min. Library quality was assessed with BioAnalyzer (Agilent) and concentration was determined by Qubit fluorometric quantification (Thermo Fischer Scientific). Libraries were sequenced on an Illumina NextSeq 500, 75bp paired end. Fastqc (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was used to assess read quality. STAR (Dobin et al., 2012) was used to map reads to an index generated from GRCm38 and Gencode vM9. RNA-SeQC (DeLuca et al., 2012) was used to assess overall quality of the RNA-sequencing experiment. FeatureCounts (Liao et al, 2014, Mol Cell Biol, 31:2591-2604) was used to summarize reads across genes. Finally, DESeq2 (Love et al., 2014) was used to perform differential expression analysis and GSEA PreRanked (http://software.broadinstitute.org/gsea/index.jsp) was used for pathway analysis.

(374) CRISPR Transactivation Assay

(375) Cell lines derived from HEK293-T cells were established by lentivirus infection resulting in stable integration of two components of the SAM system namely dCas9-VP64 and MS2-p65-HSF1. The resulting stable cell lines were then plated into 96 well plates and left overnight. The next day, cells were transfected with the guide RNAs (pHKO23), the final component of the SAM system. After an additional 48 hours, cells were harvested for gene expression analyses.

(376) Plasmids

(377) Plasmids encoding C-terminus, V5-tagged human wild-type (reference) and T2D risk SLC16A11 (SLC16A11.sup.REF and SLC16A11.sup.T2D, respectively) were generated through synthesis of the open reading frames and subcloning into the pLX304 lentiviral vector (Genscript). K7A and P2D variants of SLC16A11 were introduced through site-directed mutagenesis (Agilent). The AltM variant of SLC16A11 was generated by PCR amplifying the shorter protein with attB1 and attB2 sites and then Gateway® recombination-mediated replacement of the ccdB gene in pLX304. SLC16A11 tagged with a N-terminus V5 epitope in pLX304 was generated using standard cloning techniques by inserting a V5 tag in front of the SLC16A11 initiator methionine and a stop codon before the V5 tag encoded by pLX304. SLC16A13 and BSG pLX304 expression plasmids were obtained from the Genetic Perturbation Platform at the Broad Institute. SLC16A1 pLX304 has been described previously (SIGMA T2D Consortium et al., 2014, Nature, 506:97-101). Empty vector control pLX304 was generated by Gateway® recombination-mediated replacement of the ccdB gene with a multiple cloning site. Plasmids encoding SLC16A11 tagged with a C-terminus HA epitope in pLX304 were generated using standard cloning techniques by inserting a HA tag and a stop codon before the V5 tag encoded by pLX304. Pyronic was a gift from Luis Felipe Barros (Addgene plasmid #51308) (San Martin, A. et al., 2014, PLoS One, 9:e85780). For CRISPR/Cas9-mediated genome editing, two guide sequences targeting human BSG (5′-TGGATGTTGGCCGTGCCCAT-3′ (SEQ ID NO: 89) and 5′-CACCTGTCACTGACTGGGCC-3′ (SEQ ID NO: 90) were cloned into LentiCRISPRv2 (a gift from Feng Zhang), as described (Sanjana, N. E. et al., 2014, Nat Methods, 11:783-784; Shalem, O. et al., 2014, Science, 343:84-87).

(378) The pHKO23 plasmid (similar to pLentiCRISPRv2) was used for CRISPR/Cas9-mediated genome engineering in cells. Plasmids used for Cas9-transactivation are available from Addgene (https://www.addgene.org/browse/article/9503/) and include lenti-sgRNA(MS2)_Zeo, lenti dCAS-VP64, and lenti sgRNA(MS2)_Zeo.

(379) Transient Transfections

(380) Transient plasmid transfections were performed using lipofectamine 2000 (for HEK-293T cells) or Lipofectamine 3000 (for HuH7 cells), 48 hours prior to experiments, according to the guidelines provided by the manufacturer (Invitrogen or Thermo Fisher Scientific).

(381) Lentivirus Generation

(382) HEK293-T cells (3×10.sup.6) were platted into 10 cm plates and left overnight. The next day, cells were transfected with 12 ug pHKO23, 9 ug PAX2, and 3 ug VSVG using Transit according to the manufacturer's protocol. After 24 hours, medium was changed to media supplemented with 30% FBS in phenol free DMEM. After an additional 24 hours, lentivirus was harvested and cellular debris was removed using a 0.45 um filter and lentivirus was concentrated with a 100 KDa spin column according to the manufacturer's protocol.

(383) Lentiviral Transduction

(384) The Genetic Perturbation Platform at the Broad Institute generated lentivirus carrying SLC16A11 variants from pLX304 plasmids. To generate lentivirus for CRISPR/Cas9-mediated knockout, HEK293T cells were plated at a density of 3×10.sup.6 cells per 10 cm plate. The next day, cells were transfected with 12 μg LentiCRISPRv2 plasmid carrying guides targeting human BSG, 9 μg PAX2, and 3 μg VSVG using TransIT (Mirus Bio). After 24 hr, medium was replaced with medium supplemented with 30% FBS in phenol-free DMEM. Twenty-four hours later, lentivirus was harvested and cellular debris removed by filtration through a 0.45 μm filter (Millipore). Lentivirus was concentrated with a 100 kDa spin column (Millipore).

(385) For viral transduction, HEK293T, HuH7, or U2OS MEM-EA cells were spin-infected for 1 hr at 800 g at 31° C. with lentivirus and 8 μg/mL polybrene. Transduced cells were selected with either 3 μg/mL puromycin or 5 μg/mL of blasticidin (Thermo Fisher Scientific) for at least 7 days to establish stable cell lines.

(386) Western Blot Analyses

(387) Total protein concentration was measured using a BCA assay (Thermo Fisher Scientific) and equal quantities of protein were loaded on each gel. Lysates were prepared for western blotting by adding LDS sample buffer (Thermo Fisher Scientific) and either NuPage reducing reagent (Thermo Fisher Scientific) or 5% beta-mercaptoethanol. Samples were denatured by incubation at 42° C. for 10 min prior to analysis by SDS-PAGE and immunoblotting. Nitrocellulose membranes were blocked for 15 min with 5% milk in TBST and then incubated with primary antibody in blocking solution overnight at 4° C. Primary antibodies are detailed below. Higher antibody dilutions were used to detect immunoprecipitated proteins. Signals were detected with HRP-conjugated secondary antibodies, followed by chemiluminescent detection and autoradiography.

(388) TABLE-US-00037 Primary Antibodies used in Western Blot Analysis Product Protein Dilution Number Company V5 epitope 1:1,000-1:15,000 #13202 D3H8Q Cell Signaling HA epitope 1:1,000-1:20,000 #3724 C29F4 Cell Signaling BSG 1:750-1:2,500 #12314 Cell Signaling Na/KATPase 1:20,000 ab7671 Abeam Caleuxin 1:10,000 #2433 Cell Signaling Tubulin 1:10,000 ab21058 Abeam Vinculin 1:10,000 ab129002 Abeam

(389) For membrane fractionation experiments, autoradiographs were scanned and densitometry quantified with ImageJ. Data was exported to Excel and SLC16A11-V5 levels in plasma membrane fractions were normalized to SLC16A11-V5 levels in the intracellular membrane fraction. Data from independent experiments was combined by dividing each normalized value in a given experiment by the average of the normalized values obtained for SLC16A11.sup.REF in that experiment. The relative amount of SLC16A11 at the plasma membrane was then calculated by averaging across these values and statistical significance was assessed with a t-test.

(390) Analysis of SLC16 Protein Levels

(391) For evaluation of SLC16 family member and SLC16A11 variant levels by western blot analysis, cell lysates were collected 48 hr after transfection. For protein stability experiments, HEK293T cells transfected with SLC16 family members were treated with 10 mg/mL cycloheximide (Cayman Chemical, 14126) for 10 min, 30 min, 1 hr, 2 hr, or 4 hr prior to collection of protein lysates. For evaluation of proteasomal degradation, HuH7 cells stably transduced with SLC16A11.sup.REF-V5 and stably expressing SLC16A11 were treated with 5 μM MG132 (Cayman Chemical, 10012628) for 3 hours prior to collection of protein lysates. Protein lysates were collected in lysis buffer containing 1% NP40, 0.1% SDC, 150 mM NaCl, 50 mM TrisHCl pH 7.5, and 1 mM EDTA with protease inhibitors (Roche). Lysates were rotated for 30 min at 4° C. Supernatant was collected following centrifugation for 10 min at 14,000 g at 4° C.

(392) Metabolomics and Data Analysis

(393) HuH7 cells were plated in 6-well plates at a density of 400,000 per well. After 24 hours, cells were transfected with 1.5 μg of SLC16A11.sup.REF or controls. After 24 hours, media was changed. After an additional 48 hours, intracellular metabolites and media were harvested as previously described in SIGMA T2D Consortium et al., 2014, Nature, 506:97-101. Within each experiment, metabolite-profiling data was first total signal normalized. Individual metabolite values were flagged as outliers and removed if they were more than 3 standard deviations from the mean value within a sample type (where sample types were overexpression of SLC16A11.sup.REF or controls). Additionally all metabolite values within a sample type were removed if they had a coefficient of variation greater than 0.5. For each experiment, metabolite values were log transformed and normalized by the mean value for that metabolite within all sample types as previously described in SIGMA T2D Consortium et al., 2014, Id. This enabled aggregation of data across the 2 experiments. Fold-changes for each metabolite were calculated by dividing the median value of the SLC16A11.sup.REF treatments by the median value of the control treatments. Significance was computed using a Wilcoxon test between the two sample types.

(394) For the primary human hepatocyte experiments, intracellular metabolites were harvested as previously described in SIGMA T2D Consortium et al., 2014, Id. For the over-expression experiments ion chromatography/mass spectrometry was used for metabolite profiling. For the knock-down experiments liquid chromatography/mass spectrometry was used.

(395) The over-expression and knock-down experiments in primary human hepatocytes were analyzed as follows. Within each experiment, metabolite-profiling data was first total signal normalized. Individual metabolite values were flagged as outliers and removed if they were more than 2 standard deviations from the mean value within a sample type (where sample types are SLC16A11 siRNA or negative control siRNA treatment). For each experiment, metabolite values were normalized by the mean value for that metabolite within the negative control siRNA treatments to enable aggregation of data across all 3 experiments. The additional data in the combined dataset allowed for improved ability to detect outliers. Outlier values were identified and removed if they were more than 2 standard deviations from the mean value within a sample type. Fold-changes for each metabolite were calculated by dividing the median value of the SLC16A11 siRNA treatments by the median value of the negative control siRNA treatments. Significance was computed using a Wilcoxon test between the two sample types.

(396) For mouse experiments, livers and plasma from 5 weeks old female Slc16a11 KO and their wild-type controls on a high fat diet for one week were collected after 2 hours fast. Liver samples were snap-frozen in liquid nitrogen at the time of collection and a liver powder as obtained using a Covaris LE220 according to the manufacture's guidelines. For metabolite profiling, about 80 mg of powder liver and 100 μL of plasma were used. Processed metabolomics data was analyzed by first normalizing by the average of the wild-type mice within a litter. Fold-changes were computed by dividing the mean of normalized values for knockout mice by the corresponding values for wild-type mice. Statistical significance was assessed using a t-test.

(397) Metabolite enrichment analysis was computed as previously described in SIGMA T2D Consortium et al., 2014, Nature, 506:97-101.

(398) Membrane Fractionation

(399) Plasma membranes were separated from intracellular membranes using a Plasma Membrane Protein Extraction Kit (Abcam ab65400) with minor modifications to the manufacturer's protocol. Briefly, a 15 cm plate of HEK293T cells transfected with SLC16A11.sup.REF or SLC16A11.sup.T2D was harvested in 1 mL homogenization buffer prior to Dounce homogenization. The plasma membrane fraction was resuspended in 33 μL lysis buffer. The cytoplasmic and intracellular membrane fractions were diluted by adding 75 μL lysis buffer to 25 μL of each fraction prior to quantification. Equal quantities of protein from each fraction were used in western blot analyses.

(400) PathHunter® MEM-EA Pharmacotrafficking Assay and Data Analysis

(401) SLC16A11.sup.REF or SLC16A11.sup.T2D with a C-terminal V5 tag were cloned into ProLink2 (DiscoveRx) for the PathHunter® MEM-EA Pharmacotrafficking assays (DiscoveRx) using standard cloning techniques. U2OS MEM-EA cells (DiscoverX) were plated into 96-well plates at a density of 8,000 per well. After 24 hours, cells were transfected with 200 ng of the appropriate SLC16A11 construct using Lipofectamine 2000. Medium was changed 24 hours after transfection. Luminescence was measured 24 hours later using the PathHunter® Detection kit (DiscoveRx) and an EnVision plate reader according to the manufacturer's protocol. Data were analyzed in Excel. Background from empty vector controls was subtracted from SLC16A11 signal. To combine data across different experiments, each data within an experiment was normalized to the average value of the variants in that experiment. Statistical significance was assessed by a t-test across the combined data.

(402) Immunoprecipitations for Protein-Protein Interactions

(403) HEK293T cells plated onto 15 cm plates were transfected with 40 μg plasmid encoding SLC16A11.sup.REF or SLC16A11.sup.T2D and/or BSG or empty vector control. After 48 hours, protein lysates were harvested in lysis buffer. Lysates were passed through a 20 G syringe and rotated for 30 min at 4° C., Supernatant was collected following a 10 min spin at 14,000 g at 4° C., and total protein concentration was measured using a BCA assay (Thermo Fisher Scientific).

(404) For proteomics analysis, 20 μg total protein lysate was incubated with 100 mL of anti-V5 conjugated agarose beads (SIGMA, A7345) for 3 hr at 4° C. Beads were then washed once with lysis buffer and three times with wash buffer. After the last wash, residual wash buffer was removed, 10 μL fresh wash buffer was added, and beads were stored at −80° C. until analysis by the Proteomics Platform at the Broad Institute, as detailed in the “Proteomics Methods for SLC16A11 Protein Interaction Studies” below.

(405) For co-immunoprecipitation analysis, 5-10 μg total protein lysates were incubated with 50 μL anti-V5 or anti-HA conjugated agarose beads (SIGMA, A7345 and A2095, respectively). Beads were washed three times with lysis buffer and once with wash buffer. Immunoprecipitated proteins were eluted off beads with 50 μL LDS sample buffer (Thermo Fisher Scientific) diluted in wash buffer and either NuPage reducing reagent (Thermo Fisher Scientific) or 5% beta-mercaptoethanol. Samples were incubated at 42° C. for 15 min and then 70° C. for 1 minute.

(406) Live Cell Imaging

(407) Cells were transferred onto glass cover slips in 60 mm tissue culture dishes 72 hr prior to the experiment. For pyruvate transport assays, HEK293T cells were co-transfected 24 hr after plating with 2 μg pyronic and 2 μg empty pLX304, SLC16A11.sup.REF-pLX304 or SLC16A11.sup.T2D-pLX304. Ten minutes prior to imaging, cells were equilibrated in physiological Ringer's solution (140 mM NaCl, 2 mM KCl, 1.5 mM Na2HPO4, 1 mM MgSO4, 2 mM CaCl2, and 10 mM D-glucose in 10 mM HEPES buffer; pH 7.4), following which cells were mounted onto a Ludin chamber (Life Imaging Services) for imaging. Pyruvate uptake was initiated by switching the buffer in the chamber to Ringer's solution containing 0.4 mM pyruvate at the indicated time point. The slopes immediately following addition and withdrawal of pyruvate indicate rates of pyruvate influx and efflux. Cytoplasmic pH changes, indicative of H.sup.+ transport, were determined in cells loaded with 1 μM BCECF-AM (Rink, T. J. et al., 1982, J Cell Biol, 95:189-196), a pH sensitive dye. Proton uptake was initiated by adding 0.4 mM pyruvate. Rates of proton influx and efflux were calculated as the slopes immediately following addition and withdrawal of pyruvate, after correcting for baseline drift. Baseline drift due to fluorescence bleaching is calculated during the initial 50 seconds of each trace prior to addition of pyruvate. Linear regression of initial rates was calculated in Kaleidograph (Synergy Software) and normalized to empty vector controls.

(408) Microscopy

(409) The imaging system consisted of a Zeiss Cell Observer microscope (Zeiss), an X-Cite 120LED illumination system (Lumen Dynamics) and a Hamamatsu Orca-Flash4.0 digital CMOS camera (Hamamatsu).

(410) Pyronic was excited using a 436/20 nm band-pass filter; emission was collected through a 540/40 band-pass filter nm with a 510 nm dichroic mirror for venus, and a 480/40 band-pass filter with a 455 nm dichroic mirror, for mTFP.

(411) BCECF-AM was excited using a 436/20 nm band-pass filter for λ1, and a 495/10 nm band-pass filter for λ2; emission was collected through a 540/40 band-pass filter nm with a 510 nm dichroic mirror. Fluorescent imaging measurements were acquired (every 5 seconds) with the ZEN software (Zeiss) and analyzed using Microsoft excel (Microsoft), and Kaleidograph (Synergy Software).

(412) Phenotype Microarrays and Data Analysis

(413) HepG2 cells were plated into 10 cm plates at a density of 1.8×10.sup.6 cells. After 24 hours, cells were transfected with 9 μg of SLC16A11.sup.REF or empty control vector. After 48 hours, cell viability was assessed and HepG2 cells were re-plated at a density of 10,000 cells per well into PM-M1 MicroPlate™ Carbon and Energy Sources (Biolog, 13101). Cells were plated in the minimal media MC-0 that was prepared according to the manufacturer's guideline with the modification that dialyzed FBS (Thermo Fischer Scientific) was used in place of FBS. After 24 hours, energy status was monitored using an OmniLog PM System.

(414) Sequence Alignment and Three Dimensional Homology Modeling

(415) Sequences of SLC16 family members (obtained from Uniprot) were aligned using the multiple sequence alignment program Clustal Omega (Sievers, F. et al., 2011, Mol Syst Biol, 7:539). A three-dimensional structural model of SLC16A11 was generated by homology modeling (von Grotthuss, M. et al., 2003, Proteins 53 Suppl 6:418-423). A template for the modeling was obtained using the GeneSilico Metaserver (Kurowski and Bujnicki, 2003, Nucl Acids Res, 31:3305-3307). The crystal structure of bacterial Glycerol-3-phosphate transporter, GlpT (1PW4) was ranked first by several different fold recognition methods, and was therefore chosen as a high confidence homologue. The SLC16A11 model was created using MODELLER (Sali, A. and Blundell, T. L., 1993, J Mol Biol, 234:779-815) based on the alignment provided by the profile-profile FFAS method (Rychlewski, L. et al., 2000, Protein Sci, 9:232-241).

(416) Co-Immunoprecipitations

(417) Protein lysate supernatant was harvested and total protein concentration was measured using BCA as described in the Western blot analysis section. About 20 mg total protein for the protein-protein interaction dataset and 5-10 mg total protein for addition IPs was added to anti-V5 or anti-HA conjugated to agarose beads (SIGMA). Protein lysates were rotated head-over-head for 3 hr at 4° C. Beads were then washed once with the lysis buffer (1% NP40, 0.1% SDC) and three times with a wash buffer (lysis buffer without any detergents). After the last wash, any residual wash buffer was removed with an insulin syringe, 10 μL of wash buffer was then added and beads were stored at −80° C. until proteomics analysis or Western blot analysis.

(418) Proteomics Methods for SLC16A11 and T2D Risk (QNT) Protein Interaction Studies On-Bead Digest:

(419) The beads from immunopurification were washed once with IP lysis buffer, then three times with PBS, the three different lysates of each replicate were resuspended in 90 uL digestion buffer (2M Urea, 50 mM Tris HCl), 2 ug of sequencing grade trypsin added, 1 hour shaking at 700 rpm. The supernatant was removed and placed in a fresh tube. The beads were then washed twice with 50 uL digestion buffer and combined with the supernatant. The combined supernatants were reduced (2 uL 500 mM DTT, 30 minutes, RT), alkylated (4 uL 500 mM IAA, 45 minutes, dark) and a longer overnight digestion performed: 2 ug (4 uL) trypsin, shake o/n, The samples were then quenched with 20 uL 10% FA and desalted on 10 mg SepPak columns.

(420) iTRAQ Labeling of Peptides and Strong Cation Exchange (scx) Fractionation

(421) Desalted peptides were labelled with iTRAQ reagents according to the manufacturer's instructions (AB Sciex, Foster City, Calif.). Peptides were dissolved in 30 μl of 0.5 M TEAB pH 8.5 solution and labeling reagent was added in 70 ul of ethanol. After 1 h incubation the reaction was stopped with 50 mM Tris/HCl pH 7.5. Differentially labelled peptides were mixed and subsequently desalted on 10 mg SepPak columns.

(422) TABLE-US-00038 iTRAQ labeling 114 115 116 117 Rep1 WT T2Drisk (QNT) Empty vector Empty vector Control1 Control 2 Rep2 WT T2Drisk (QNT) Empty vector Empty vector Control1 Control 2
SCX fractionation of the differentially labelled and combined peptides was done as described in Rappsilber et al., (2007, Nat Protoc., 2(8):1896-1906), with 6 pH steps (buffers—all contain 25% acetonitrile) as below: 1: ammonium acetate 50 mM, pH 4.5, 2: ammonium acetate 50 mM, pH 5.5, 3: ammonium acetate 50 mM, pH 6.5, 4: ammonium bicarbonate 50 mM. pH 8, 5: ammonium hydroxide 0.1%, pH 9, 6: ammonium hydroxide 0.1%, pH 11.
Empore SCX disk used to make StageTips as described in the Rappsilber et al. publication, supra.
MS Analysis

(423) Reconstituted peptides were separated on an online nanoflow EASY-nLC 1000 UHPLC system (Thermo Fisher Scientific) and analyzed on a benchtop Orbitrap Q Exactive Plus mass spectrometer (Thermo Fisher Scientific). The peptide samples were injected onto a capillary column (Picofrit with 10 μm tip opening/75 μm diameter, New Objective, PF360-75-10-N-5) packed in-house with 20 cm C18 silica material (1.9 μm ReproSil-Pur C18-AQ medium, Dr. Maisch GmbH, r119.aq). The UHPLC setup was connected with a custom-fit microadapting tee (360 μm, IDEX Health & Science, UH-753), and capillary columns were heated to 50° C. in column heater sleeves (Phoenix-ST) to reduce backpressure during UHPLC separation. Injected peptides were separated at a flow rate of 200 nL/min with a linear 80 min gradient from 100% solvent A (3% acetonitrile, 0.1% formic acid) to 30% solvent B (90% acetonitrile, 0.1% formic acid), followed by a linear 6 min gradient from 30% solvent B to 90% solvent B. Each sample was run for 120 min, including sample loading and column equilibration times. The Q Exactive instrument was operated in the data-dependent mode acquiring HCD MS/MS scans (R=17,500) after each MS1 scan (R=70,000) on the 12 top most abundant ions using an MS1 ion target of 3×10.sup.6 ions and an MS2 target of 5×10.sup.4 ions. The maximum ion time utilized for the MS/MS scans was 120 ms; the HCD-normalized collision energy was set to 27; the dynamic exclusion time was set to 20 s, and the peptide match and isotope exclusion functions were enabled.

(424) Quantification and Identification of Peptides and Proteins

(425) All mass spectra were processed using the Spectrum Mill software package v6.0 pre-release (Agilent Technologies) which includes modules developed by us for iTRAQ-based quantification. Precursor ion quantification was done using extracted ion chromatograms (XIC's) for each precursor ion. The peak area for the XIC of each precursor ion subjected to MS/MS was calculated automatically by the Spectrum Mill software in the intervening high-resolution MS1 scans of the LC-MS/MS runs using narrow windows around each individual member of the isotope cluster. Peak widths in both the time and m/z domains were dynamically determined based on MS scan resolution, precursor charge and m/z, subject to quality metrics on the relative distribution of the peaks in the isotope cluster vs theoretical. Similar MS/MS spectra acquired on the same precursor m/z in the same dissociation mode within +/−60 sec were merged. MS/MS spectra with precursor charge>7 and poor quality MS/MS spectra, which failed the quality filter by not having a sequence tag length>1 (i.e., minimum of 3 masses separated by the in-chain mass of an amino acid) were excluded from searching.

(426) For peptide identification MS/MS spectra were searched against human Uniprot database to which a set of common laboratory contaminant proteins was appended as well as the sequence for V5-tagged SLC16A11 (also called SLC16A11.sup.REF, WT, wild-type, throughout the proteomics datasets) and T2D risk (also called QNT throughout the proteomics datasets). Search parameters included: ESI-QEXACTIVE-HCD scoring parameters, trypsin enzyme specificity with a maximum of two missed cleavages, 40% minimum matched peak intensity, +/−20 ppm precursor mass tolerance, +/−20 ppm product mass tolerance, and carbamidomethylation of cysteines and iTRAQ labeling of lysines and peptide n-termini as fixed modifications. Allowed variable modifications were oxidation of methionine, N-terminal acetylation, Pyroglutamic acid (N-termQ), Deamidated (N), Pyro Carbamidomethyl Cys (N-termC), with a precursor MH+ shift range of −18 to 64 Da. Identities interpreted for individual spectra were automatically designated as valid by optimizing score and delta rank1-rank2 score thresholds separately for each precursor charge state in each LC-MS/MS while allowing a maximum target-decoy-based false-discovery rate (FDR) of 1.0% at the spectrum level.

(427) In calculating scores at the protein level and reporting the identified proteins, redundancy is addressed in the following manner: the protein score is the sum of the scores of distinct peptides. A distinct peptide is the single highest scoring instance of a peptide detected through an MS/MS spectrum. MS/MS spectra for a particular peptide may have been recorded multiple times, (i.e. as different precursor charge states, isolated from adjacent SCX fractions, modified by oxidation of Met) but are still counted as a single distinct peptide. When a peptide sequence >8 residues long is contained in multiple protein entries in the sequence database, the proteins are grouped together and the highest scoring one and its accession number are reported. In some cases when the protein sequences are grouped in this manner there are distinct peptides which uniquely represent a lower scoring member of the group (isoforms or family members). Each of these instances spawns a subgroup and multiple subgroups are reported and counted toward the total number of proteins. iTRAQ ratios were obtained from the protein-comparisons export table in Spectrum Mill. To obtain iTRAQ protein ratios the median was calculated over all distinct peptides assigned to a protein subgroup in each replicate. To assign interacting proteins the Limma package in the R environment was used to calculate moderated t-test p, as described previously by Udeshi, N. D. et al., 2012, Mol. Cell Proteomics, 11:148-159) and added Blandt-Altman testing to filter out proteins for which the CI for reproducibility was below 95%.

(428) BSG CRISPR/Cas9-Knockout Cells

(429) BSG knockout HEK-293T cell lines were generated by transduction with lentivirus encoding spCas9 and guide RNAs targeting BSG. The following target sequences were cloned into the pHKO23 plasmid (F. Zhang) for generation of two, independent BSG knockout cell lines: TGGATGTTGGCCGTGCCCAT (SEQ ID NO: 91) and CACCTGTCACTGACTGGGCC (SEQ ID NO: 92).

(430) Generation of Slc16a11 and Slc16a13 Knockout Mice with CRISPR/Cas9

(431) CRISPR knockout mice were generated by co-injection of the necessary CRISPR/Cas9 mRNA components into zygotes. For Slc16a11, the sequence targeted in the mouse genome was: AGTCCTAACCTCGCTTGGCT (SEQ ID NO: 93). For Slc16a13, the sequence targeted in the genome was GCAGCCCAATACTCAGGTAT (SEQ ID NO: 94). DNA oligos were ordered from IDT encoding: 1) T7 promoter, spacer, and tracrRNA and 2) complementary sequence to the T7 promoter. DNA oligos were annealed and in vitro transcribed using the T7 High Yield RNA Synthesis Kit (New England BioLabs) according to the manufacture's protocol. The reaction was then DNAse I treated and purified with the MEGAclear Purification for Large Scale Transcription Reactions Kit (Ambion). Purified spacer-tracrRNA and hspCas9 SmartNuclease mRNA (System Biosciences) were injected into zygotes by the Gene Modification Facility at Harvard University.

(432) For metabolite profiling and RNA-sequencing experiments, Slc16a11 wild-type and knockout mice were placed on a high fat diet (RDI, D12492i) for 1 week, and then euthanized for collection of liver and plasma. Liver was homogenized prior to analyses using a Covaris tissue Tube pulverizer.

(433) Knockdown of SLC16A11 for Metabolite Profiling

(434) The following siRNAs were ordered from GE Dharmacon: Accell Human SLC16A11 siRNA SMARTpool (E-007404-00-0050) and Accell Non-targeting Pool (D-001910-10-50). siRNAs were reconstituted in PBS at 100 μM. Hepatocytes were plated into collagen coated 24 well plates (Corning, 354408) at a density of 350,000 cells per well. After 4 hours, cells were washed once with HI media (Bioreclamation IVT) and siRNAs in HI media were added at a final concentration of 1 μM. After 24 hours, fresh CP medium was added. Hepatocytes were grown for an additional 24 hours. The samples consisted of 8 or 12 biological replicates of hepatocytes treated either with pooled siRNAs targeting SLC16A11 or negative controls across 2 or 3 replicate experiments. Lysates were collected for profiling 48 hours after siRNA knockdown. Due to the media change, differences in extracellular metabolites reflect changes accumulated during the 24 hour period prior to sample collection.

(435) Primary human hepatocytes were removed from the incubator and immediately placed on ice. 500 μL of media was collected from the hepatocytes and put aside. Hepatocytes were then washed with 1 mL PBS. Lipids were extracted from hepatocytes by scraping in 250 μL of isopropanol (HPLC Grade; Honeywell) containing 1,2-didodecanoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids; Alabaster, Ala.). Polar metabolites were extracted by scraping in 250 μL of 80% methanol (VWR) containing 0.05 ng/μL inosine-15N4, 0.05 ng/μL thymine-d4, and 0.1 ng/μL glycocholate-d4 as internal standards (Cambridge Isotope Laboratories). Medium was centrifuged at 600 g at 4° C. for 5 min to remove any debris. Media metabolites for lipid analyses were precipitated by taking 10 μL and adding 190 μL isopropanol. Media metabolites for HLIC-neg were precipitated with 30 μL media+120 μL extraction solution (0.05 ng/μL Inosine-15N4, 0.05 ng/μL Thymine-d4, 0.1 ng/μL Glycocholate-d4 in 80% Methanol). Finally, media metabolites for HILIC-pos were precipitated with 10 μL media+90 μL extraction solution consisting of Acetonitrile: Methanol:Formic acid (75:25, 0.2 v:v:v) with a nominal concentration of 0.2 μg/mL valine-d8 (Sigma) and phenylalaine-d8 (Cambridge Isotopes Laboratories).

(436) Metabolomics and Data Analysis

(437) Analyses of lipids were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to an Exactive Plus orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.). Lipid extracts were injected onto an ACQUITY BEH C8 column (100×2.1 mm, 1.7 μm; Waters, Milford, Mass.). The column was eluted isocratically with 80% mobile phase A (95:5:0.1 vol/vol/vol 10 mM ammonium acetate/methanol/formic acid) for 1 minute followed by a linear gradient to 80% mobile-phase B (99.9:0.1 vol/vol methanol/formic acid) over 2 minutes, a linear gradient to 100% mobile phase B over 7 minutes, then 3 minutes at 100% mobile-phase B. MS data were acquired using electrospray ionization in the positive ion mode over 200-1100 μm/z and at 70,000 resolution. Other MS settings were: sheath gas 50, in source CID 5 eV, sweep gas 5, spray voltage 3 kV, capillary temperature 300° C., S-lens RF 60, heater temperature 300° C., microscans 1, automatic gain control target 1e6, and maximum ion time 100 ms. Raw data data were processed using TraceFinder 3.3 (Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK) software for detection and integration of LC-MS peaks. Lipid identities were determined based on comparison to reference standards and reference plasma extracts and were denoted by total number of carbons in the lipid acyl chain(s) and total number of double bonds in the lipid acyl chain(s). Samples for negative and positive ion mode analyses of polar metabolites were achieved using the HILIC (hydrophilic interaction chromatography) method under basic conditions as described previously in SIGMA T2D Consortium et al., 2014, Nature, 506:97-101.

(438) Within each experiment, metabolite-profiling data was first total signal normalized. Individual metabolite values were flagged as outliers and removed if they were more than 2 standard deviations from the mean value within a sample type (where sample types are SLC16A11 siRNA or negative control siRNA treatment). For each experiment, metabolite values were normalized by the mean value for that metabolite within the negative control siRNA treatments to enable aggregation of data across all 3 experiments. The additional data in the combined dataset allowed for improved ability to detect outliers. Outlier values were identified and removed if they were more than 2 standard deviations from the mean value within a sample type. Fold-changes for each metabolite were calculated by dividing the median value of the SLC16A11 siRNA treatments by the median value of the negative control siRNA treatments. Significance was computed using a Wilcoxon test between the two sample types.

(439) To identify metabolite changes at the pathway level, a strategy that is commonly used for analysis of gene expression data was applied, namely, gene-set enrichment analysis (GSEA). Pathway enrichment was computed using the GSEA PreRanked tool, as implemented at http://software.broadinstitute.org/gsea/index.jsp, using an unweighted enrichment score and 1,000 permutations. The log 2 transformed fold-changes between SLC16A11 knockdown and control were used as input, along with curated sets of KEGG pathways from the human reference set and 15 additional classes of metabolites covering lipid sub-types and carnitines. Only metabolite pathways and classes with at least 5 members measured in our dataset were considered.

(440) Metabolic Profiling on HuH7 Cell Extracts

(441) HuH7 cells were plated in 6 well plates and then transiently transfected with expression plasmids encoding C-terminus, V5-tagged SLC16A11 and control proteins (BFP, GFP, HcRed, and Luciferase). The day after transfection, the medium was removed and fresh medium was added to the cells. Two days later (after 3 days of gene expression), cellular metabolites were extracted in 80% methanol containing inosine-.sup.15N4, thymine-d4 and glycocholate-d4 internal standards (Cambridge Isotope Laboratories; Andover, Mass.). (FIGS. 19-21).

(442) HILIC-neg—Hydrophilic interaction liquid chromatography/negative ion mode MS detection to measure polar metabolites. HILIC analyses of water soluble metabolites in the negative ionization mode were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to a Q Exactive Plus hybrid quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.). Cellular extracts were injected directly onto a 150×2.0 mm Luna NH2 column (Phenomenex; Torrance, Calif.) that was eluted at a flow rate of 400 μL/min with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide in water) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol) followed by a 10 min linear gradient to 100% mobile phase A. MS analyses were carried out using electrospray ionization in the negative ion mode using full scan analysis over 70-750 μm/z at 70,000 resolution and 3 Hz data acquisition rate. Other MS settings were: sheath gas 55, sweep gas 10, spray voltage −3 kV, capillary temperature 350° C., S-lens RF 50, heater temperature 325° C., microscans 1, automatic gain control target 1e6, and maximum ion time 250 ms. Metabolite identities were confirmed using authentic reference standards. Raw data were processed using TraceFinder software (version 3.3; Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK).

(443) Metabolic Profiling on Mouse Plasma and Liver

(444) HILIC-neg—Hydrophilic interaction liquid chromatography/negative ion mode MS detection to measure polar metabolites. HILIC analyses of water soluble metabolites in the negative ionization mode were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to a Q Exactive Plus hybrid quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.). Plasma or tissue homogenate (at a 4-to-1 uL water to mg tissue) (30 μL) was extracted using 120 μL of 80% methanol containing inosine-.sup.15N4, thymine-d4 and glycocholate-d4 internal standards (Cambridge Isotope Laboratories; Andover, Mass.). The samples were centrifuged (10 min, 9,000×g, 4° C.) and supernatants were injected directly onto a 150×2.0 mm Luna NH2 column (Phenomenex; Torrance, Calif.) that was eluted at a flow rate of 400 μL/min with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide in water) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol) followed by a 10 min linear gradient to 100% mobile phase A. MS analyses were carried out using electrospray ionization in the negative ion mode using full scan analysis over 70-750 μm/z at 70,000 resolution and 3 Hz data acquisition rate. Other MS settings were: sheath gas 55, sweep gas 10, spray voltage −3 kV, capillary temperature 350° C., S-lens RF 50, heater temperature 325° C., microscans 1, automatic gain control target 1e6, and maximum ion time 250 ms. Metabolite identities were confirmed using authentic reference standards. Raw data were processed using TraceFinder software (version 3.3; Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK).

(445) HILIC-pos—Hydrophilic interaction liquid chromatography/positive ion mode MS detection to measure polar metabolites. HILIC analyses of water soluble metabolites in the positive ionization mode were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to a Q Exactive hybrid quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.). Plasma or tissue homogenate (at a 4-to-1 uL water to mg tissue) (10 μL) were prepared via protein precipitation with the addition of nine volumes of 74.9:24.9:0.2 v/v/v acetonitrile/methanol/formic acid containing stable isotope-labeled internal standards (valine-d8, Sigma-Aldrich; St. Louis, Mo.; and phenylalanine-d8, Cambridge Isotope Laboratories; Andover, Mass.). The samples were centrifuged (10 min, 9,000×g, 4° C.), and the supernatants were injected directly onto a 150×2 mm, 3 μm Atlantis HILIC column (Waters; Milford, Mass.). The column is eluted isocratically at a flow rate of 250 μL/min with 5% mobile phase A (10 mM ammonium formate and 0.1% formic acid in water) for 0.5 minute followed by a linear gradient to 40% mobile phase B (acetonitrile with 0.1% formic acid) over 10 minutes. MS analyses were carried out using electrospray ionization in the positive ion mode using full scan analysis over 70-800 μm/z at 70,000 resolution and 3 Hz data acquisition rate. Other MS settings were: sheath gas 40, sweep gas 2, spray voltage 3.5 kV, capillary temperature 350° C., S-lens RF 40, heater temperature 300° C., microscans 1, automatic gain control target 1e6, and maximum ion time 250 ms. Metabolite identities were confirmed using authentic reference standards. Raw data were processed using TraceFinder software (version 3.3; Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK).

(446) C8-pos—Reversed-phase C8 chromatography/positive ion mode MS detection to measure lipids. Analyses of polar and non-polar plasma lipids were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to an Exactive Plus orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.). Plasma or tissue homogenate (at a 4-to-1 uL water to mg tissue) (10 μL) were extracted for lipid analyses using 190 μL of isopropanol containing 1,2-didodecanoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids; Alabaster, Ala.). After centrifugation, supernatants were injected directly onto a 100×2.1 mm, 1.7 μm ACQUITY BEH C8 column (Waters; Milford, Mass.). The column is eluted isocratically with 80% mobile phase A (95:5:0.1 vol/vol/vol 10 mM ammonium acetate/methanol/formic acid) for 1 minute followed by a linear gradient to 80% mobile-phase B (99.9:0.1 vol/vol methanol/formic acid) over 2 minutes, a linear gradient to 100% mobile phase B over 7 minutes, then 3 minutes at 100% mobile-phase B. MS analyses were carried out using electrospray ionization in the positive ion mode using full scan analysis over 200-1100 μm/z at 70,000 resolution and 3 Hz data acquisition rate. Other MS settings were: sheath gas 50, in source CID 5 eV, sweep gas 5, spray voltage 3 kV, capillary temperature 300° C., S-lens RF 60, heater temperature 300° C., microscans 1, automatic gain control target 1e6, and maximum ion time 100 ms. Lipid identities were determined based on comparison to reference plasma extracts and were denoted by total number of carbons in the lipid acyl chain(s) and total number of double bonds in the lipid acyl chain(s). Raw data were processed using TraceFinder software (version 3.3; Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK).

(447) C18-neg—Reversed-phase C18 chromatography/negative ion mode MS detection to measure free fatty acids, bile acids, and metabolites of intermediate polarity. Analyses of free fatty acids and bile acids were conducted using an LC-MS system comprised of a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.; Marlborough, Mass.) coupled to a Q Exactive hybrid quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, Mass.)). Plasma or tissue homogenate (at a 4-to-1 uL water to mg tissue) (30 μL) were extracted using 90 uL of methanol containing PGE.sub.2-d4 (Cayman Chemical Co.; Ann Arbor, Mich.) and centrifuged (10 min, 9,000×g, 4° C.). The samples were injected onto a 150×2 mm ACQUITY BEH C18 column (Waters; Milford, Mass.). The column is eluted isocratically at a flow rate of 450 μL/min with 20% mobile phase A (0.01% formic acid in water) for 3 minutes followed by a linear gradient to 100% mobile phase B (acetonitrile with 0.01% acetic acid) over 12 minutes. MS analyses were carried out in the negative ion mode using electrospray ionization, full scan MS acquisition over 70-850 μm/z, and a resolution setting of 70,000. Metabolite identities were confirmed using authentic reference standards. Other MS settings were: sheath gas 45, sweep gas 5, spray voltage −3.5 kV, capillary temperature 320° C., S-lens RF 60, heater temperature 300° C., microscans 1, automatic gain control target 1e6, and maximum ion time 250 ms. Raw data were processed using TraceFinder software (version 3.3; Thermo Fisher Scientific; Waltham, Mass.) and Progenesis QI (Nonlinear Dynamics; Newcastle upon Tyne, UK).

(448) Metabolite Profiling Analysis

(449) Metabolite data from different experiments were independently total signal normalized; media data was not normalized. Outlier data were discarded within individual experiments based on the following criteria: 1) an individual metabolite value that was more than 3 standard deviations from the mean values for that metabolite within a sample type, 2) metabolite values within a sample type that had a coefficient of variation greater than 50%, and 3) any metabolite value associated with a sample that was more than 3 standard deviations from the mean correlation for all samples of a given sample type. Data were then log-transformed. Subtracting from each metabolite value the mean value of that metabolite across all samples in that experiment combined data from different experiments. Fold changes (FC) were then computed by comparing the median value of each metabolite in one sample type to the median value in another sample type and the Wilcox test was then applied to test whether the two distributions were equal.

(450) Constructing the SLC16A11 Gene Expression Signature

(451) Gene RPKM values from 119 human liver samples were downloaded from the Genotype-Tissue Expression project (GTEx) portal at http://www.gtexportal.org/home/datasets/. The file used was GTEx_Analysis_v6_RNA-seq_RNA-SeQCv1.1.8_gene_rpkm.gct. All genes were ranked by their Spearman correlation to SLC16A11 expression across the samples. We took the 50, 100, and 150 of the most positively and negatively correlated genes, that were measured in the LINCS dataset, and used them to generate to construct 3 SLC16A11 gene expression signatures.

(452) Mining the LINCS Dataset

(453) The SLC16A11 gene expression signatures were used to search the entire space of profiles in the LINCS dataset. The query was performed using the Clue App query found at https://clue.io/query. Connections made to compounds were extracted and further analyzed.

(454) Cell Culture

(455) SNU761 (human hepatocellular carcinoma) and NCIH716 (human cecum adenocarcinoma) were cultured in RPMI Medium 1640 supplemented with 10% Fetal Bovine Serum (FBS), 100 μg/ml Streptomycin and 100 U/ml Penicillin. Cells were grown in a humidified CO.sub.2 incubator, at 37° C.

(456) Primary human hepatocytes were purchased from Bioreclamation IVT. Hepatocyte lot used was BHL. Cells were thawed and immediately resuspended in CP media (Bioreclamation IVT) supplemented with torpedo antibiotic (Bioreclamation IVT). Cell concentration and viability were assessed prior to use. Cells were grown in a humidified CO.sub.2 incubator, at 37° C.

(457) Compound Treatments

(458) KU-0063794 (Cayman Chemical, 13597), AZD-8055 (Cayman Chemical, 16978), and methotrexate (Cayman Chemical, 13960) stock solutions were prepared in DMSO. For the unbiased approach taken to investigate the compounds that connected to the SLC16A11 gene expression signature, compounds were obtained from compound management at the Broad Institute.

(459) SNU761 and NCIH716 cells were plated into 96 well plates at a density of 20,000 cells per well. Hepatocytes were plated into collagen coated 96 well plates (Corning, 354408) at a density of 50,000 cells per well. After 24 hours, cells were treated with compounds at a final concentration of 10 μM or vehicle control for the appropriate amount of time.

(460) RNA Isolation

(461) At the time of collection, cells in 96 well plates were lysed by directly adding 50 μL of RLT buffer (Qiagen). 75 μL of AMPure XP beads, diluted by a factor of 5 in polyethylene glycol, were then added to bind nucleic acids. One wash with polyethylene glycol was then performed. DNase treatment (Qiagen) was carried out according to the manufacturer's protocol in a final volume of 50 μL. 100 μL of polyethylene glycol was added after the DNase treatment to crowd nucleic acids back onto the beads. Two washes with 80% ethanol were performed and residual ethanol was removed. RNA was then eluted in water.

(462) Droplet Digital PCR (ddPCR)

(463) RNA was DNase treated and converted into cDNA using the High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific). The following FAM-labeled TaqMan Real-Time PCR assays (Thermo Fisher Scientific) were used to quantify gene expression: SLC16A11 (Hs00601062_g1), SLC16A13 (Hs00416832_m1), SLC16A1 (Hs01560299_m1). The VIC-labeled TaqMan Real-Time assays TBP (Hs00427620_m1) or HPRT1 (Hs02800695_m1) were used for normalization. Droplets were generated and analyzed using a QX200 Droplet Generator and Reader system (BioRad). Data was extracted using QuantaSoft (BioRad) and analyzed using Microsoft Excel.

Other Embodiments

(464) From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

(465) The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

(466) All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.