Method for Improving GlcNAc Production of Recombinant Bacillus Subtilis

20170130253 ยท 2017-05-11

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides an effective method for improving N-acetylglucosamine (GlcNAc) production by engineered B. subtilis Deletion of phosphoenolpyruvate carboxykinase encoding gene pckA and encoding pyruvate kinase gene pyK in recombinant GlcNAc-producing strain BSGNK-PxylA-glmS-P43-GNA1 (BSGNK) is first performed to enhance GlcNAc production, followed by overexpression of pyruvate carboxylase encoding gene pycA for facilitating cell growth. Finally, the GlcNAc production of the recombinant strain BPTS3 reached to 11.3 g/L, which was 1.84-fold of BSGNK. This method can be used for improve cellular property of engineered B. subtilis for GlcNAc production, which can be further applied to industrial production of GlcNAc.

    Claims

    1. A method for improving GlcNAc production of recombinant Bacillus Subtilis comprising deletion of phosphoenolpyruvate carboxykinase encoding gene pckA, deletion of pyruvate kinase encoding gene pyk, as well as overexpression of pyruvate carboxylase encoding gene pycA in the recombinant Bacillus Subtilis.

    2. The method as claimed in claim 1, wherein the recombinant Bacillus Subtilis is BSGNK which is obtained by overexpressing a glucosamine-6-phosphate synthase glms under the control of an inducible promoter PxylA and GlcN-6-phosphate N-acetyltransferase GNA1 under the control of a constitutive promoter P43 in the basis of deleting nagP, gamP, nagA, nagB, gamA and glck of Bacillus Subtilis 168.

    3. The method as claimed in claim 1, wherein deletion of phosphoenolpyruvate carboxykinase encoding gene pckA comprises step of constructing a pckA disrupt cassette which includes a pckA upstream homology sequence, a zeocin resistant gene expression cassette, and a pckA downstream homology sequence, from Bacillus Subtilis 168.

    4. The method as claimed in claim 3, wherein the length of the pckA upstream homology sequence is 0.5-1.5 kb, and the length of the pckA downstream homology sequence is 0.5-1.5 kb.

    5. The method as claimed in claim 4, wherein the DNA sequence of the pckA disrupt cassette is shown as SEQ ID NO.1.

    6. The method as claimed in claim 1, wherein deletion of pyruvate kinase encoding gene pyk comprises step of constructing a pyk disrupt cassette which includes a pyk upstream homology sequence, a zeocin resistant gene expression cassette, and a pyk downstream homology sequence, from B. subtilis 168.

    7. The method as claimed in claim 6, wherein the length of the pyk upstream homology sequence is 0.5-1.5 kb, and the length of the pyk downstream homology sequence is 0.5-1.5 kb.

    8. The method as claimed in claim 7, wherein the DNA sequence of the pyk disrupt cassette is shown as SEQ ID NO.2.

    9. The method as claimed in claim 1, wherein the pyruvate carboxylase pycA is overexpressed under the control of a constitutive promoter P43 and replacing a start codon GTG with ATG.

    10. The method as claimed in claim 9, wherein overexpression of pyruvate carboxylase encoding gene pycA further comprises step of constructing a pycA overexpressed cassette which includes a pycA upstream homology sequence, a zeocin resistant gene expression cassette, a P43 strong promoter, and a pycA sequence with replacing the start codon GTG with ATG, from B. subtilis 168.

    11. The method as claimed in claim 10, wherein the length of the pycA upstream homology sequence is 0.5-1.5 kb.

    12. The method as claimed in claim 11, wherein the DNA sequence of the pycA overexpressed cassette is shown as SEQ ID NO.3.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0039] FIG. 1 is a graph showing the comparison of cell growth of the strains BSGNK, BPTS1, BPTS2 and BPTS3 during fermentation;

    [0040] FIG. 2 is a graph showing the comparison of GlcNAc titer of the strains BSGNK, BPTS1, BPTS2 and BPTS3 during fermentation;

    [0041] FIG. 3 is a graph showing the comparison of the residual glucose concentration of the strains BSGNK, BPTS1, BPTS2 and BPTS3 during fermentation.

    DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0042] The invention will be further illustrated in more detail with reference to accompanying drawings. It is noted that, the following embodiments are intended for purposes of illustration only and are not intended to limit the scope of the invention.

    [0043] The present invention provides a g method for improving GlcNAc production in engineered B. subtilis. Specifically, the method comprises the steps of deletion of phosphoenolpyruvate carboxykinase encoding gene pckA, deletion of pyruvate kinase encoding gene pyk and overexpression of pyruvate carboxylase encoding gene pycA in a recombinant Bacillus Subtilis. In a preferable embodiment, the starting strain is BSGNK-PxylA-glmS-P43-GNA1 (BSGNK), and the finally obtained strain with improved GlcNAc production and yield is BPTS3.

    Embodiment 1

    [0044] Deletion of Phosphoenolpyruvate Carboxykinase Encoding Gene pckA of the Strain BSGNK to Block the Anaplerosis from PEP to Oxaloacetate, to Obtain the Recombinant Strain BPTS1, Wherein BSGNK is Obtained by the Method Disclosed in China Patent Application Ser. No. 201510394205.7.

    [0045] Deletion of phosphoenolpyruvate carboxykinase pckA was first performed to block the anaplerosis from PEP to oxaloacetate. Specifically, a primer pckA-F (ACGGACTTCACTTAGGCGGC)/pckA-R (GACGGATTTTTATATTTGCGCG) was used to amplify a pckA disrupt cassette, which included a pckA upstream homology sequence (1 kb), a zeocin resistant gene expression cassette, and a pckA downstream homology sequence (1 kb), from B. subtilis 168. DNA sequence of the pckA disrupt cassette is as shown in SEQ ID NO.1. The amplified pckA disrupt cassette was transformed into the strain BSGNK, and transformants were selected on LB plate with 30 g/mL zeocin. Positive transformants with pckA gene deletion were further verified by colony PCR with primers pckA-F/pckA-R. The vector pTSC was introduced into the Positive transformants to promote the recombination between lox71 and lox66, thereby deleting the resistance marker cassette. Plasmid pTSC was then evicted by incubating at 50 C. for 12 h to obtain the strain without the selected marker and plasmid, naming BPTS1.

    Embodiment 2

    [0046] Deletion of Pyruvate Kinase Encoding Gene pyK in the Strain BPTS1 to Block the Synthesis from PEP to Pyruvate by Glycolysis Pathway.

    [0047] Deletion of pyruvate kinase pyK was performed to block the synthesis from PEP to pyruvate by glycolysis pathway. Specifically, the primer pyK-F (ACGAATAGGGGTATTAACGAGCG)/pyK-R(CAGCTAACAGCAAAGCAATCAGC) was used to amplify a pyK disrupt cassette, which included a pyK upstream homology sequence (1 kb), a zeocin resistant gene expression cassette, and a pyK downstream homology sequence (1 kb), from B. subtilis 168. DNA sequence of the pyK disrupt cassette is as shown in SEQ ID NO.2. The amplified pyk disrupt cassette was transformed into the strain BPTS1, and transformants were selected for on LB plate with 30 g/mL zeocin. Positive transformants with pyK gene deletion were further verified by colony PCR with primers pyK-F/pyK-R. The vector pTSC was introduced into the Positive transformants to promote the recombination between lox71 and lox66, thereby deleting the resistance marker cassette. Plasmid pTSC was then evicted by incubating at 50 C. for 12 h to obtain the strain without the selected marker and plasmid, naming BPTS2.

    Embodiment 3

    [0048] Overexpression of Pyruvate Carboxylase Encoding Gene pycA of the Strain BPTS2 to Facilitate Cell Growth.

    [0049] Overexpression of pyruvate carboxylase encoding gene pycA was performed to facilitate cell growth. Specifically, a primer pycA-F (GCAGAGCTGGTTTAAAATCGG)/pycA-R(CCCAAGTTGAAAGCTTAACGAGA) was used to amplify a pycA overexpressed cassette, which included a pycA upstream homology sequence (1 Kb), a zeocin resistant gene expression cassette, a P43 strong promoter, a pycA sequence with replacing the start codon GTG with ATG, from B. subtilis 168. DNA sequence of pycA overexpressed cassette is as shown in SEQ ID NO.3. The amplified pycA overexpressed cassette was transformed into the strain BPTS2, and transformants were selected on LB plate with 30 g/mL zeocin. Positive transformants with pycA gene overexpression were further verified by colony PCR with primers pycA-F/pycA-R. The vector pTSC was introduced into the positive transformants to promote the recombination between lox71 and lox66, thereby deleting the resistance marker cassette. Plasmid pTSC was then evicted by incubating at 50 C. for 12 h to obtain the strain without the selected marker and plasmid, naming BPTS3.

    Shake-Flask Fermentation of the Strains BSGNK, BPTS1, BPTS2 and BPTS3.

    [0050] The seed medium was Luria-Bertani broth or agar plates containing (g/L): tryptone 10, yeast extract 5, and NaCl 10. The fermentation medium contained (g/L): tryptone 6, yeast extract 12, (NH.sub.4)SO.sub.4 6, K.sub.2HPO.sub.4.3H.sub.2O 12.5, KH.sub.2PO.sub.4 2.5, MgSO.sub.4.7H2O 3, CaCO.sub.3 5, glucose 60, and 15 ml of trace metal solution. The trace metal solution contained (per liter of 5M HCl) (g/L): FsSO.sub.4.7H.sub.2O 4.0, CaCl.sub.2 4.0, MnSO.sub.4.5H.sub.2O 1.0, CoCl.sub.2.6H.sub.2O 0.4, NaMnO.sub.4.2H.sub.2O 0.2, ZnSO.sub.4.7H.sub.2O 0.2, AlCl.sub.3.6H.sub.2O 0.1, CuCl.sub.2.H2O 0.1, and H.sub.3BO.sub.4 0.05. Seed culture was carried out in 250-mL shake flasks each containing 20 ml of seed medium with shaking at 200 rpm and 37 C. for 12 h. The seed culture (5 ml) was inoculated into 500-mL shake flasks containing 95 mL of fermentation medium. And then, fermentation was carried out at 220 rpm and 37 C. for 48 h on rotary shakers. When the optical density at 600 nm (OD600) reached 0.4, xylose was added to the medium to a final concentration of 5 g/L to induce gene expression under the control of the xylose-inducible P.sub.xyla promoter.

    Embodiment 4

    [0051] Effects of Deletion of Phosphoenolpyruvate Carboxykinase Encoding Gene pckA on Cell Growth and GlcNAc Production

    [0052] To determine the effects of deletion of phosphoenolpyruvate carboxykinase encoding gene pckA on cell growth and GlcNAc production, the strain BPTS1 and BSGNK were inoculated with an inoculum size of 5% (v/v) into 500-mL shake flasks each containing 95 mL of fermentation medium. And then, fermentation was carried out at 220 rpm and 37 C. for 48 h on rotary shakers.

    [0053] It can be seen from FIGS. 1-2 that the strain BPTS1 produced GlcNAc to a higher concentration than BSGNK by 7.14 g/L in the flask cultivation, which was 1.16-fold of that of BSGNK, and deletion of phosphoenolpyruvate carboxykinase encoding gene pckA had little influence on cell growth. The results indicate that deletion of phosphoenolpyruvate carboxykinase encoding gene pckA is benefit for the GlcNAc synthesis.

    Embodiment 6

    [0054] Effects of Deletion of Pyruvate Kinase Encoding Gene pyk on Cell Growth and GlcNAc Production

    [0055] To determine the effects of deletion of pyruvate kinase encoding gene pyk on cell growth and GlcNAc production, the strains BPTS2 and BPTS1 were inoculated with an inoculum size of 5% (v/v) into 500-mL shake flasks each containing 95 mL of fermentation medium. And then, fermentation was carried out at 220 rpm and 37 C. for 48 h on rotary shakers.

    [0056] It can be seen from FIG. 2 that the strain BSPT2 produced GlcNAc to a higher concentration than BPTS1 by 8.5 g/L in the flask cultivation, which was 1.18-fold of that of BPTS1. However, deletion of pyruvate kinase encoding gene pyk leaded to the low glucose consumption rate and decreased DCW. FIG. 3 shows the time profile of glucose consumption of BSGNK, BPTS1, BPTS2, BPTS3 in shake flask. The residual glucose concentration of BPTS2 was 12.2 g/L. This was thought to be the non-optimal TCA flux and reduced glycolytic flux.

    Embodiment 7

    [0057] Overexpression of Pyruvate Carboxylase Encoding Gene pycA to Facilitate Cell Growth

    [0058] It is possible that the overexpression of pycA can lead more pyruvate to synthesize OAA and facilitates the glutamine synthesis. Finally, we tested the effects of overexpression of pyruvate carboxylase to cell growth and GlcNAc production. It can be seen from FIGS. 1-2 that the overexpression of pycA can facilitate cell growth, and the glucose consumption rate of BPTS3 was improved than that of BPTS2. Finally, the GlcNAc production of BPTS3 reached 11.3 g/L, which was 32.8% higher than that of BPTS2 and 1.84-fold of that of BSGNK.

    [0059] FIGS. 1-3 show the effects of deletion of phosphoenolpyruvate carboxykinase encoding gene pckA and pyruvate kinase encoding gene pyk and overexpression of pyruvate carboxylase encoding gene pycA on cell growth, GlcNAc production and glucose consumption.

    [0060] Table 1 shows the comparison of the maximum GlcNAc titer, the maximum DCW and the GlcNAc productivity of BSGNK, BPTS1, BPTS2, BPTS3 in shake flask fermentation system.

    TABLE-US-00001 TABLE 1 The maximum The maximum GlcNAc GlcNAc titer DCW productivity Strains (g/L) (g/L) (g/L/h) BSGNK 6.17 7.17 0.036 BPTS1 7.14 6.81 0.044 BPTS2 8.48 6.08 0.030 BPTS3 11.3 6.03 0.052

    [0061] The above preferred embodiments are described for illustration only, and are not intended to limit the scope of the invention. It should be understood, for a person skilled in the art, that various improvements or variations can be made therein without departing from the spirit and scope of the invention, and these improvements or variations should be covered within the protecting scope of the invention.