Medicaments and methods for treating mesothelioma

Abstract

The present invention relates to the use of at least one attenuated measles virus for the manufacture of a medicament intended for treating malignant mesothelioma in an individual.

Claims

1. A method of treating cancer, comprising administering vaccinal dendritic cells to an individual, obtained by the method for preparing spontaneously mature cancer vaccinal dendritic cells in an individual, comprising the following steps: in vitro infection of cancer cells taken from the individual by an attenuated measles strain to yield a cell lysate; and contacting dendritic cells with the cell lysate to yield vaccinal dendritic cells which are spontaneously mature; wherein the method comprises no step of maturation of said dendritic cells consisting of contacting said dendritic cells with a combination of TLR3 ligand and a pro-inflammatory cytokine.

2. The method according to claim 1, wherein the cancer is malignant mesothelioma.

3. The method according to claim 1, wherein the cancer is malignant pleural mesothelioma.

4. The method according to claim 1, wherein the cancer is malignant peritoneal mesothelioma.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIGS. 1, 2, 3, 4 and 5: Mesothelioma susceptibility to attenuated Measles Virus (MV).

(2) FIG. 1Selective Oncolytic activity of Schwarz MV vaccine strain. A panel of human epithelioid mesothelioma cell lines (M11, M13, M47, M56 & M61) and an immortalized normal mesothelial cell line (Met5A) were infected with non-recombinant MV (MOI 1.0) and microscope observations of infected cultures morphology were performed 72 hours later.

(3) FIGS. 2-3Higher surface expression level of CD46 receptors for tumoral cells in comparaison with their normal counterparts. Cells were stained with FITC-conjugated CD46-specific antibodies (grey histogram) or related isotype Ig control (white histogram) (FIG. 2). Numbers indicate the mean fluorescence index and histogram shows mean values of CD46 expression obtained for mesothelial (white bar) and mesothelioma (hatched bar) cell lines (FIG. 3).

(4) FIGS. 4-5Schwarz MV vaccine strain preferentially infects transformed tumoral cells. Equal numbers of M13 and Met5A cells were cultured separately (FIG. 4) or co-cultured (FIG. 5) overnight, allowing cellular adherence, and infection was done at MOI of 1.0 with eGFP-recombinant MV. In separate cultures, analysis of eGFP expression was performed at different times post-infection (24, 48, & 72 hours) by flow cytometry (FIG. 4). In co-culture model, the same experiment was conducted along with HLA-A2 staining, as HLA alleles differential expression allowed distinction between two cell lines. Histogram shows % eGFP-positive cells for Met5A (white bar) and M13 (black bar) cells from co-culture (FIG. 5).

(5) FIG. 6: Immunogenicity of MV-infected mesothelioma cell line.

(6) FIG. 6Cellular death induced by MV- and UV-treatments. Flow cytometry analysis of M13 tumoral cells apoptosis triggered by UV exposure (5 kJ/cm.sup.2) or MV infection (MOI=1.0) at the indicated time points (D1=24 h, D2=48 h, D3=72 h, and D4=96 h) (hatched bars) vs. untreated control cells (white bars).

(7) FIGS. 7 and 8: Phagocytosis of apobodies by monocyte-derived DCs.

(8) FIG. 7UV- or MV-treated M13 tumor cells were labelled with PKH-26 and co-cultured with immature DCs for 24 hours. Harvested DCs were subsequently stained with FITC-conjugated anti HLA-DR antibodies and analysed by flow cytometry. One representative experiment of three with similar results is shown. The number of double-positive DCs, that is the percentage of PKH-26 positive DCs gated on basis of HLA-DR expression (FITC-conjugated antibodies, clone B8.12.2, Immunotech), indicates the phagocytosis efficiency of apoptotic cells.

(9) FIG. 8The histogram represents mean values of phagocytosis yield obtained for each loading condition tested.

(10) FIGS. 9, 10 and 11: DC maturation induced by co-culture with MV-infected mesothelioma cells.

(11) FIGS. 9 and 10Immature DCs and M13 tumoral cells were cultured in the indicated combinations (ratio 1/1) for 24 hours. As controls, DCs were incubated with TLR3 ligand, polyinosinic:polycytidylic acid (50 g/ml; Sigma), or directly infected with MV (MOI=1.0). Subsequently DCs were harvested and stained with a PE-conjugated antibody panel specific for the indicated cell surface molecules (FIG. 9HLA molecules; FIG. 10Maturation Markers). DCs were gated according to their morphology characteristic, and dead cells were excluded on basis of TOPRO-3 staining (Molecular Probes). DCs surface phenotype was analysed by three-colors flow cytometry. Histogram shows means values obtained from four independent donors.

(12) FIG. 11DC cytokine secretion pattern was investigated on 24 hours supernatant co-culture by CBA (for IL-6, IL-1, TNF, IL-12 & IL-10) and ELISA (for IFN) assays.

(13) FIG. 12: DCs loaded with MV-infected mesothelioma cells induce MSLN-specific CD8 T cell priming.

(14) FIG. 12Number of MSLN-specific CD8 T cells, derived from one week sensitization co-culture with unpulsed or UV-M13 or MV-M13 pulsed DCs, was analysed by flow cytometry. Histogram indicates the percentage of PE-tetramer positive cells among T cells gated on basis of human CD8 expression (PE-Cy5-conjugated antibodies, clone RPA-T8, BD Biosciences). One representative experiment is shown.

EXAMPLES

Example 1

Mesothelioma Susceptibility to MV Infection and Oncolytic Activity

(15) To compare MV-related cytopathic effect on tumoral and non-tumoral cells, a panel of five epithelioid mesothelioma cell lines (M11, M13, M47, M56, and M61) and mesothelial cells (Met5A) were infected with a Schwarz vaccine strain at a Multiplicity Of Infection (MOI) of 1.0.

(16) The mesothelioma cell lines (M11, M13, M47, M56, and M61) were established from pleural effusion collected by thoracocentesis of cancer patients. Diagnosis of epithelioid mesothelioma was established by biopsies immunohistochemical staining. The control mesothelial cell line (Met5A) was isolated from pleural fluids of cancer-free patients and immortalized by transfection with the pRSV plasmid encoding SV40 T-antigen (ATCC-LGC Promochem, Molsheim, France). Cell lines were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated Foetal Calf Serum (FCS from Biowest, Nuaille, France), 1% L-glutamine and 1% penicillin/streptomycin antibiotics (all purchased from Sigma, St Quentin Fallavier, France). Cellular cultures were routinely checked for Mycoplasma contaminations using Hoechst 33258 staining (Sigma).

(17) Attenuated MV Schwarz vaccine strains were obtained from F. Tangy (Pasteur Institut, France). Schwarz MV was rescued from the pTM-MVSchw (SEQ ID NO: 1) cDNA by use of the helper-cell-based rescue system described by Radecke et al. (1995) EMBO J. 14:5773-5784 and modified by Parks et al. (1999) J. Virol. 73:3560-3566. Briefly, 293-3-46 helper cells were transfected with 5 g of pTM-MVSchw and 0.02 g of pEMC-Lschw expressing the Schwarz MV-L gene (Combredet et al. (2003) J. Virol. 77:11546-11554) (SEQ ID NO: 2). After overnight incubation at 37 C., a heat shock was applied for 2 h at 43 C., and transfected cells were transferred onto a Vero cell monolayer. Syncytia that appeared in 15 days coculture were transferred to 35-mm wells and then expanded in 75-cm.sup.2 and 150-cm.sup.2 flasks of Vero cells culture in 5% FCS DMEM. When syncytia reached 80-90% confluence, the cells were scraped into a small volume of OptiMEM and frozen-thawed once. After low-speed centrifugation to pellet cellular debris, virus-containing supernatant was stored at 80 C. The titer of recom binant MV stock was determined by an endpoint limit-dilution assay on Vero cells. The TCID50 was calculated by use of Krber method (Karber (1931) Arch. Exp. Path. Pharmak. 162:480-483).

(18) Viral infections of the mesothelioma cell lines were performed at a MOI=1.0 for 2 hours incubation at 37 C. Three days following MV infection, typical morphological modifications of MV-infected cells were observed, that is development of an important cytopathic effect (CPE) on most tumoral MPM lines (4/5), by contrast with non cancerous Met5A cells (FIG. 1). CPE was evidenced through development of more or less important syncitia, which finally led to shedding in culture supernatant of cytoplasmic inclusion bodies of dead tumoral cells (FIG. 1). The development of these multinucleated giant syncitia is characteristic of measles infection and is produced by fusion of HA.sup.+ infected cells with neighbour CD46.sup.+ culture cells.

(19) A significant upregulated expression of live-attenuated MV strains receptor CD46 by mesothelioma cells could be evidenced (FIGS. 2-3).

(20) In order to quantify susceptibility to MV infection, Met5A and M13 cell lines were infected with eGFP-recombinant MV stock (Combredet et al. (2003) J. Virol. 77:11546-11554). The GFP-transgene expression was used as a marker of viral infection, thus allowing determination of infected cells percentage by flow cytometry. MV infection yield of both culture cells was dose-dependent (MOI ranging from 0.01 to 5.0), indicating the specificity of eGFP signal. Whereas Met5A was infected by the MV strain (for MOI ranging from 0.5), M13 was also significantly infected by MV, but always at lowest MOI (for MOI ranging from 0.1). A significant increased infection yield of tumour cells in comparison to normal cells (for MOI 1.0), was also observed both in cellular separate culture (FIG. 4) and co-culture (FIG. 5) systems (ratio 1:3) at 48 hours post-infection. Moreover, virus infection could also be evidenced by down-regulation of CD46 surface expression observed in infected cellular cultures.

(21) Thus, according to these in vitro results, mesothelioma tumors present a more important susceptibility both to MV-mediated infection and MV-related cytolytic activity than mesothelial tissue. Consequently, MPM appears as a relevant candidate for virotherapy approach based on measles virus administration.

Example 2

Tumoral Cell-Death Induced by MV and UV Treatments

(22) After demonstrating that MV is able to infect mesothelioma cells, the inventors verified if virus infection could also lead to apoptosis-mediated cell death.

(23) Sub-confluent monolayer M13 cells culture were either MV-infected (MOI 1.0), or UV-B-irradiated (312 nm-5 kJ/m.sup.2) using an UV Stratalinker2400 (Stratagene Europe, Amsterdam, Netherlands), as positive control for apoptosis. Cells were collected at different times post-treatment, and cellular death was quantified as described by Ebstein et al. (2004) Am. J. Respir. Crit. Care Med. 169:1322-1330 by concomitant phosphatidylserine and Annexin-V stainings.

(24) As shown in FIG. 6, 24 hours exposition of M13 cells to UV-B irradiation and 72 hours infection of M13 cells with MV yielded an equivalent rate of tumoral cell death (comprised between 70% and 80% of Annexin-V positive cells), which indicates that MV induces apoptosis in infected tumor cells. The thus-defined M13 cell death-induced conditions were used in following experiments.

(25) Moreover, virus-related cell killing was also confirmed by observation of an important cytopathic effect, leading to complete dislocation of M13 cellular layer 72-96 hours post-infection (FIG. 1).

Example 3

Follow-Up of Viral Replication Cycle in MV-Infected Tumoral Cells

(26) In order to follow viral growth kinetic in infected M13 cells culture (MOI=1.0), RT-PCR specific for viral dsRNA potential receptors (Mda-5, TLR-3, RIG-I and PKR) were performed. Specific primers for the -actin gene were used as an internal experiment control.

(27) Briefly, M13 cells were either incubated with polyinosinic:polycytidylic acid ligand (10 g/ml) or MV (MOI=1.0) and cellular pellets were collected at different times. Whole cellular RNA was then extracted using RNeasy kits (Qiagen, Courtaboeuf, France) according to manufacturer's instructions, and reverse-transcribed using RTase (Invitrogen, Paisley, UK). Resulting cDNA was used as template for PCR amplification using primers specific for Mda-5, TLR-3, RIG-I, PKR, IFN, and -actin. PCR primers sequences are listed in Table 1. PCR products were visualized by agarose gel electrophoresis.

(28) TABLE-US-00001 TABLE2 primersequences Fragment SEQ size ID Primer Sequence (bp) NO: -actin ForwardATCTGGCACCACACCTTCTACAATGAGCTGCG 837 3 ReverseCGTCATACTCCTGCTTGCTGATCCACATCTGC 4 TLR-3 ForwardATTGGGTCTGGGAACATTTCTCTTC 319 5 ReverseGTGAGATTTAAACATTCCTCTTCGG 6 Mda-5 ForwardGAGCAACTTCTTTCAACCAC 633 7 ReverseGAACACCAGCATCTTCTCCA 8 RIG-I ForwardGAACGATTCCATCACTATCC 580 9 ReverseGGCATCATTATATTTCCGCA 10 PKR ForwardCTTCTCAGCAGATACATCAG 689 11 ReverseGTTACAAGTCCAAAGTCTCC 12

(29) It could thus be shown that a viral replication peak occurred between 1 day to 4 days post-infection of mesothelioma M13 cells. Besides, PCR products corresponding to viral dsRNA potential receptors (Mda-5, TLR-3, RIG-I and PKR) could also be evidenced.

Example 4

Efficient Uptake of Apoptotic Mesothelioma Cells by Immature DCs

(30) The uptake by dendritic cells (DCs) of apobodies from MV-infected (72-hours) was then studied and compared to that of UV-irradiated (24-hours) M13 tumoral cells.

(31) Dendritic cells were derived from monocytes generated from leukapheresis harvests of HLA-A0201 healthy donors (EFS, Nantes, France), after obtaining informed consent. Monocytes-enriched fraction (>85% purity) was first separated by Ficoll density gradient centrifugation (PAA Laboratories, Les Mureaux, France). Monocytes were then enriched by elutriation (counterflow centrifugation) using a Beckman Avanti J20 centrifuge equipped with a JE5.0 rotor and a 40-ml elutriation chamber. Routinely, purity of elutriated monocytes was over 80%, as assessed by flow cytometry based on the detection of the CD14 marker. Monocytes were cultured at 210.sup.8 cells/ml with 500 IU/ml GM-CSF and 200 IU/ml (Cell Genix Technology, Freiburg, Germany). Cells were then allowed to differentiate for 6 days.

(32) On day 6, monocytes-derived DCs were collected from culture supernatant and seeded in culture for subsequent loading. Immature DCs were incubated with 2.10.sup.8 cells/ml of apoptotic material, derived from UV-treated or MV-infected allogenic M13 tumoral cells, for additionally 24 hours co-culture (ratio 1:1). DC phagocytosis yield analysis was assessed both by flow cytometry and confocal laser microscopy, as previously described (Mass et al. (2002) Cancer Research 32:1050-1056). Briefly, UV- or MV-treated M13 cells were labelled with PKH-26 membrane dye colorant, according to the manufacturer's protocol (Sigma, St Quentin Fallavier, France). After 24 hours co-culture, DCs were stained with FITC-conjugated anti HLA-DR antibodies (Immunotech, Marseilles, France). After PBS washes, cells were harvested and analysed either on a FACSCalibur (BD Biosciences, Grenoble, France), or with a TCS NT microscope (Leica Instruments, Heidelberg, Germany). DCs that have ingested apoptotic cells were identified as HLA-DR/PKH-26 double positive cells (FIG. 7).

(33) As shown in FIG. 8, it could be evidenced that DCs efficiently engulfed UV- and MV-treated mesothelioma cells at the same rate, as illustrated by a similar percentage of PKH26-positive DCs gated on basis of HLA-DR expression (65% and 74% for DCs loaded respectively with UV- or MV-treated M13 cells).

(34) Confocal laser-scanning microcopy experiments further confirmed an efficient internalization of apoptotic M13 cells by immature DCs within 24 hours co-culture, irrespective of the death-induced strategy used (MV-infected or UV-irradiated).

Example 5

Tumor Cells Infected with MV Induce Spontaneous DC Maturation, by Contrast with UV Radiation-Induced Apoptotic M13 Cells

(35) The inventors next examined whether cell material derived from MV-infected M13 tumoral cells could efficiently stimulate DC maturation.

(36) DC maturation status was assessed within 24 hours following engulfment of tumoral cells killed either by radiation exposition or virus-mediated cytolytic activity.

(37) Phenotype of viable DCs (gated on basis of TOPRO-3 positive staining exclusion) was investigated by surface expression of Class I and II MHC molecules (FIG. 9) and of maturation markers CD80, CD86, CD83 and CD40 (FIG. 10), completed by cytokines secretion pattern analysis performed on co-culture supernatant (FIG. 11). As controls, DCs were left alone, or matured with a combination of TLR3 ligand and one pro-inflammatory cytokine (polyinosinic:polycytidylic acid/IFN, as a mimick of viral infection), or directly primed by measles virus contact (MV).

(38) Briefly, immunostaining was performed with a panel of monoclonal antibodies (all purchased from Immunotech, Marseilles, France) specific for HLA-ABC (clone B9.12.1), HLA-DR (clone B8.12.2), CD80 (clone MAB104), CD83 (clone HB15a), CD86 (clone HA5.2B7), and CD40 (clone MAB89). DCs were incubated with each of the above antibodies (1 g/ml) at 4 C. for 30 min prior to flow cytometry. Cytokines pattern secretion was assayed in supernatants collected 24 hours after engulfment. IL-10, IL-12, IL-6, IL-1 and TNF concentrations were measured using commercially available Cytometric Beads Array kits (BD Biosciences, Le Pont de Claix, France), according to the manufacturer's protocol. Quantification of IFN was performed with an ELISA test (Biosource, Camarillo, USA).

(39) A spontaneous maturation program could be observed only for DCs loaded with apobodies derived from mesothelioma cells infected with MV, at a level essentially equivalent to the positive control maturation cocktail used in the experiment (Polyl:C/IFN). Spontaneous maturation was evidenced by significant up-regulation of co-stimulation molecules expression (for CD80, CD83, CD86, CD40 and HLA-ABC), and production of numerous pro-inflammatory cytokines (for IL-6, IL-1, TNF, and IFN).

(40) However, in line with previous reports, pulsing DCs with UV-irradiated apoptotic tumoral cells, as well as direct infection of DCs by measles virus (MV), did not lead to this effect.

(41) Overall these data strongly support an increased immunogenicity of MV-infected tumoral cells with respect to UV-irradiated tumoral cells.

Example 6

Cross-Priming of MSLN-Specific CD8 T-Cell Response

(42) Finally, the inventors tested whether DCs loaded with apobodies derived from mesothelioma cells infected with MV could stimulate an effector CD8 response specific for an MPM-associated tumor antigen, such as Mesothelin (MSLN).

(43) In order to assess this question, tetramer immunostaining was performed on CD8 T-lymphocytes sensibilized for one-week with autologous DCs loaded with apoptotic material derived from UV- or MV-treated M13 cells. As controls, a similar experiment was conducted with the Jurkat lymphoma T-cell line, chosen on the basis of its susceptibility to MV and its MSLN-negative expression characteristics (FIG. 12). As internal experiment controls, MelanA/Mart-1-specific tetramer staining (MelanA26-35L) was achieved in complement of those specific for the two selected MSLN-derived CTL epitopes. These peptides (MSLN 531-539 and MSLN 541-550) were identified by scanning MSLN amino-acid sequence (GenPept NP 005814) for matches to consensus motifs for HLA-A0201 binding, using two computer algorithms BIMAS and SYFPEITHI (Table 2):

(44) TABLE-US-00002 TABLE2 tetramercharacteristics HLA-A0201binding score Tetramername Localisation Sequence SYFPEITHI BIMAS HLA-A2VLP9 531-539 VLPLTVAEV 29/30 272/285 (SEQIDNO:13) HLA-A2KLL10 541-550 KLLGPHVEGL 30/31 312/312 (SEQIDNO:14)

(45) Briefly, CD8 T lymphocytes were prepared from HLA-A0201 healthy donors PBMCs by positive selection with the MACS column systems using CD8 multisort kit (Miltenyi Biotec, Paris, France). Purified nave CD8 T cells (>90% purity) were stimulated with autologous DCs loaded with each apoptotic preparation or unloaded DCs as a control. The co-culture was performed in round bottom 96-well plates (BD Falcon), by mixing 2.10.sup.4 mature DCs with 2.10.sup.5 responder T cells (ratio 1:10) in 200 l of 8% human serum RPMI 1640 medium, supplemented with 10 ng/ml IL-12 for the first 3 days (AbCys SA, Paris, France) and with 10 U/ml IL-2 (Proleukin, Chiron Therapeutics, USA) for the next days. IL-2 was added every three days, allowing regular culture medium renewal. After 7-8 days culture, T cells were harvested and stained with MSLN-specific tetramers as follows.

(46) The selected CD8 epitope peptides (synthesis performed by Eurogentec, Liege, Belgium) were used for monomers production (Recombinant Proteins Production Platform, U601-IFR26, Nantes, France) as previously described (Labarrire et al. (2002) Int. J. Cancer 101:280-286). HLA-A2 VLP9 and HLA-A2 KLL10 monomers were oligomerized with PE-labeled streptavidin (BD Biosciences). Staining and washing were performed in 0.1% BSA-PBS. T cells were stained successively with 10 g/ml of PE-labeled pMHC multimers at 4 C. for 30 min, and with 1 g/ml diluted PE-Cy5-conjugated anti-CD8 antibodies (clone RPA-T8, BD Biosciences) for additionally 30 min at 4 C. Cells were washed and immediately analysed on a FACSCalibur.

(47) Interestingly, a significant increase of MSLN-specific T-cells percentage among the CD8-positive gated population could be observed for co-cultures with DCs loaded with apoptotic material derived from MV-treated M13 cells with respect to co-cultures with DCs loaded with apoptotic material derived from UV-treated M13 cells.