Method for diagnosing a rhinovirus infection

Abstract

The present invention relates to a pharmaceutical composition comprising at least one peptide consisting of a minimum of 8 and a maximum of 50 amino acid residues comprising amino acid residues 1 to 8 of a rhinovirus capsid protein selected from the group consisting of VP1, VP2, VP3 and VP4.

Claims

1. A method for diagnosing in vitro a rhinovirus infection caused by at least one of rhinovirus strains 1B, 29, 47, 62, 79 and 89 in a mammal comprising the steps of: providing an antibody comprising sample of a mammal, contacting said sample with at least one peptide consisting of a minimum of 15 and a maximum of 50 amino acid residues comprising amino acid residues 1 to 15 of a rhinovirus VP1 capsid protein of rhinovirus strain 89, and diagnosing a rhinovirus infection when the binding of antibodies to said at least one peptide is detected.

2. The method according to claim 1, characterized in that the sample is a blood sample, a sputum sample, neural lavage fluid sample or tear sample.

3. The method according to claim 1, characterised in that the amino acid residues 1 to 15 of the rhinovirus capsid protein have amino acid sequence NPVENYIDSVLNEVL (amino acids 1-15 of SEQ ID NO:49).

4. The method according to claim 1, characterised in that the at least one peptide is selected from the group consisting of NPVENYIDSVLNEVLVVPNIQPSTSVSSHAA (SEQ ID NO:48) and NPVENYIDSVLNEVLVVPNIQ (SEQ ID NO:49).

5. The method according to claim 2, wherein the blood sample is serum or plasma.

Description

(1) The present invention is further illustrated by the following figures and examples, yet, without being restricted thereto.

(2) FIG. 1 shows the seasonality of IgA response to VP1 in human sera taken over a period of one year. Sera from 8 allergic and 6 non-allergic patients were taken in winter, spring, summer and autumn and titers of IgA antibodies specific for VP1 were determined by ELISA and are expressed as optical value (OD 405 nm) on the y-axis. The optical values correspond to the level of antibody in the human sera. The results are shown in box plots, where 50% of the values are within the boxes and non-outliers between the bars. The line within the boxes indicates the median values.

(3) FIG. 2 shows the VP1-specific IgA levels in a vaccinated individual over the study period. The VP1-specific IgA titers were measured by ELISA. The day of the blood donation is applied on x-axis, the optical density (OD) on y-axis. The optical value corresponds to the level of IgA antibody in human sera.

(4) FIG. 3 shows VP1-specific IgA response in mice. Groups of mice were immunized with VP1 antigen. VP1-specific IgA titers were measured by ELISA and are expressed as optical value (OD 405 nm) on the y-axis. The optical value corresponds to the level of IgA antibody in mouse sera.

(5) FIG. 4 shows a neutralization test with VP1 of human rhinovirus serotype 14.

(6) FIG. 5 shows a neutralization test with VP1 of human rhinovirus serotype 89.

(7) FIG. 6 shows the purification of recombinant VP1 proteins. (A) 89VP1 and (B) 14VP1 were stained with Coomassie blue after SDS-PAGE (left) and with an anti-His6 antibody (right) after blotting on nitrocellulose. Molecular weights in kDa are indicated at the left.

(8) FIG. 7 shows VP1-specific immune responses of immunized rabbits and mice. (A) 89VP1- and 14VP1-specific IgG responses in rabbits. Rabbits were immunized with 89VP1 or 14VP1. Serum samples were taken on the day of the first immunization (pre-immune serum) and after the second and third injection in 3-4 weeks intervals (top of the box: Immune serum 1; Immune serum 2). Dilutions of the sera (rabbit89VP1; rabbit14VP1) are presented on the x-axis (10.sup.3-10.sup.6 indicated as log). IgG reactivities to the immunogens (89VP1, 14VP1) are displayed as bars. (B) A group of five mice was immunized with 89VP1. Serum samples were taken on the day of the first immunization (0) and in three weeks intervals (w3-w9) (x-axis). IgG1 reactivities are displayed for the group as box plot where 50% of the values are within the boxes and non-outliers between the bars. The lines within the boxes indicate the median values. IgG1 levels specific for 89VP1 are displayed as optical density values (y-axis).

(9) FIG. 8 shows that anti-VP1 antibody raised against recombinant VP1 react with rhinovirus-derived VP1 and whole virus. (A) Nitrocellulose-blotted HRV14 protein extract and recombinant 14VP1 were incubated with anti-14VP1 antibodies and the corresponding pre-immune serum (pre-IS). Molecular weights in kDa are indicated at the left. (B) Electron micrographs of labelled virus preparations after negative staining. Immobilized HRV89 was incubated with anti-89VP1 IgG antibodies and the binding sites were visualized by a secondary IgG antibody probe coupled to colloidal gold particles with a diameter of 10 nm. The left micrograph gives a detail from a virus particle (VP) connected with four gold particles (GP). The right micrograph shows the control preparation using the pre-immune Ig. Bars: left micrograph, 50 nm; right micrograph, 100 nm.

(10) FIG. 9 shows the reactivity of rabbit antisera raised against recombinant 14VP1 protein or 14VP1-derived peptides. Rabbits were immunized with recombinant 14VP1, PVP1A, PVP1B or PVP3A (top of the box) and sera exposed to 14VP1 (top) or 89VP1 (bottom). The dilutions of the sera are displayed on the x-axis (10.sup.3-10.sup.6 indicated as log). IgG levels specific for 14VP1 and 89VP1 correspond to the optical density values (bars: y-axis).

(11) FIG. 10 shows that HRV14 is neutralized by anti-14VP1 antibodies. HRV14 at 100 TCID.sub.50 was preincubated with serial dilutions of antiserum as indicated for 2 h at 37 C. and the mixture was added to subconfluent HeLa cells in 24 well plates. After 4 days at 34 C. remaining cells were stained with crystal violet. Pre-IS, pre-immune serum used as a control.

(12) FIG. 11 shows (A) Phylogenetic tree of the VP1 sequences of the HRVs investigated. VP1 sequences were retrieved from the data bank and their similarity was analyzed with ClustalW. (B) Inhibition of HRV infections by the respective VP1-specific antibodies. HRVs at 100 TCID.sub.50 were pre-incubated with twofold serial dilutions of the respective antisera at 1:2 (a) to 1:16 (d) for 3 hours at 37 C. and the mixtures were applied to subconfluent HeLa cells in 96 well plates. After incubation for 3 days at 34 C., cells were stained with crystal violet, washed, the stain was dissolved, and the OD was read at 560 nm. Meanstandard error of four independent experiments is shown.

(13) FIG. 12 shows a Coomassie blue stained 12.5% SDS-PAGE gels containing purified VP1, VP2, VP3 and VP4 his-tagged proteins (Lane 1: 5 l molecular marker; Lane 2: 10 l VP1; 10 l VP2; 10 l VP3; 10 l VP4, respectively).

(14) FIG. 13 shows IgA, IgM, IgG.sub.1 and IgG.sub.2 responses to VP1, VP2, VP3 and VP4 detected in human blood from patients with positive HRV-specific PCR test results. Fifty seven patient's sera were tested for the presence of four antibodies specific for rhinovirus-derived capsid proteins. Titers were measured by ELISA and are expressed as optical value (OD 405 nm) on the y-axis. The optical values correspond to the levels of antibodies in the human sera. The results are shown in box plots, where 50% of the values are within the boxes and non-outliers between the bars. The line within the boxes indicates the median values.

(15) FIG. 14A shows the multiple alignment of the VP1 amino acid sequences of HRV prototype strains. Sequences were retrieved from Protein Database and aligned with GeneDoc followed by manual editing. They represent HRV serotypes belonging to different species and different receptor group: HRV37 and 89 are the major group genus A, HRV3, 14 and 72 are the major group genus B, HRV1A, 18 and 54 are the K-types and HRV1A, HRV29 and 44 are the minor group genus A. The black squares denote three epitopes derived from VP1 of the HRV89 strain.

(16) FIG. 14B shows IgA, IgM, IgG1, IgG2, IgG3 and IgG4 responses to Ep_1, Ep_2 and Ep_3 detected in human blood from patients with positive HRV-specific PCR test results. Fifty seven patients' sera were tested for six antibodies specific for VP1-derived epitopes. Titers were measured by ELISA and are expressed as optical value (OD 405 nm) on the y-axis. The optical values correspond to the level of antibody in the human blood. The results are shown in box plots, where 50% of the values are within the boxes and non-outliers between the bars. The line within the boxes indicates the median values.

(17) FIG. 15 shows the cross-reactivity of guinea pig IgG to recombinant VP1, VP2, VP3 and VP1-derived epitopes. However, this regards only to the recognition of the antigens (to be used for diagnosis). It is not a proof for the neutralization of each virus but indicates cross-protection. Nutralization of different HRV strains is shown in FIG. 11B. Because the data correlate we might assume that antibodies against VP1 or VP1-derived N-terminal fragment from HRV89 will also neutralize other strains when tested by neutralization tests.

(18) FIG. 16 shows epitope mapping of the major capsid protein VP1.

(19) FIG. 17 shows IgG.sub.1 immune response to synthetic peptides derived from N-terminal epitope of VP1 in comparison to peptides previously described (Mc Cray et al., Nature 329 (1987): 736-738) detected in human blood from patients with positive HRV-specific PCR test results.

(20) FIG. 18 shows a ROC curve for the antibody values in patients with HRV/Influenza double infection.

(21) FIG. 19 shows IgG.sub.1 responses to P1-derived peptides, each comprising approximately 30 (FIG. 19A) or 20 (FIG. 19B) amino acids, or P1A-derived peptides (B), each comprising 20 amino acids, detected in human blood from fifty seven patients with positive HRV-specific PCR test results. IgG.sub.1 reactivities were measured by ELISA and are expressed as optical value (OD 405 nm) on the yaxis. The optical values correspond to the levels of antibodies in the human sera. The results are shown in box plots, where 50% of the values are within the boxes and non-outliers between the bars. The line within the boxes indicates the median values.

(22) FIG. 20 shows inhibition of HRV infections by anti-VP1, anti-VP2, anti-VP3 anti-VP4 antibodies. HRVs at 10 TCID50 (A), 100 TCID50 (B) or 1000 TCID50 (C) were pre-incubated with twofold serial dilutions of the respective anti-sera 1:2 to 1:1:128 for 3 hours at 37 C. and the mixture were applied to subconfluent HeLa cells in 96 well plates. After incubation for 3 days at 34 C., cells were stained with crystal violet, washed, the stain was dissolved, and the OD was read at 560 nm.

(23) FIG. 21 shows reactivity of rabbit anti-89VP1 and anti-14VP1 antibodies with 14VP1, 89VP1 and three recombinant 89VP1 fragments. Rabbit sera were diluted 1:5000 and A.sub.560 corresponding to bound IgG antibodies is shown on the y-axis.

EXAMPLES

Example 1

VP1 Specific IgA Antibody Response of Three Allergic Patients Determined in Different Seasons

(24) Blood samples were taken in winter 2006 (win06), spring 2007 (spr), summer 2007 (sum), autumn 2007 (aut) and winter 2007 (win07). Antibody titer was measured by ELISA experiments. ELISA plates (Nunc Maxisorb, Denmark) were coated with 5 g/ml of VP1 (of rhinovirus strain 89) and incubated with mouse sera diluted 1:50. All experiments were performed in doublets and mean OD were calculated. Bound antibodies were detected with monoclonal mouse anti-mouse human IgA antibodies (BD Pharmingen, San Diego, Calif., USA) diluted 1:1000, and then with rat anti-mouse IgG POX-coupled antibodies (Amersham Bioscience) diluted 1:2000. OD was measured at 405 nm and 490 nm in an ELISA reader (Dynatech, Germany).

(25) The antibody titer varies from season to season and from patient to patient. This leads to the conclusion that exposure to rhinoviruses can be determined by VP1 (FIG. 1).

Example 2

The Rhinoviral Protein VP1 Induces a Strong IgA Response in a Healthy Volunteer

(26) A healthy volunteer was vaccinated with a formulation containing the whole VP1 molecule, a rhinoviral protein, adsorbed to Al(OH).sub.3 (20 g/injection). This vaccine was injected subcutaneously in the upper arm of the subject three times (Day 0, 21, 42). Before the first vaccination and at days 65, 79, 91, 98 and 119 blood was taken to analyze the development of the antigen-specific immune response.

(27) In FIG. 2 the increase of VP1-specific IgA antibodies is demonstrated by ELISA measurements. The x-axis shows the dates of blood sampling and the y-axis the corresponding optical density (OD) values. The maximal amount of VP1-specific IgA antibodies is reached at day 65 (OD=0.551) where, compared to the preimmune serum (day 0), a threefold increase of VP1-specific IgA antibodies could be measured. After day 65 a slow decline of the IgA level could be detected. But at day 119 the level of VP1-specific IgA antibodies (OD=0.372) was almost twice as much as at day 0 (OD=0.195).

Example 3

VP1-Specific IgA Response of Immunized Mice

(28) In order to determine the VP1-specific IgA response, a group of five mice was immunized subcutaneously with 5 g of VP1 antigen adsorbed to aluminum hydroxide in three-week intervals. Serum samples were taken from the tail veins on the day before the first immunization (0) and after the second immunization (6w). VP1-specific IgA antibody levels were determined by ELISA. Plates were coated with 5 g/ml of the VP1 protein and incubated overnight with mouse serum diluted 1:500. Bound IgA was detected with monoclonal rat anti-mouse IgA antibodies diluted 1:1000 and subsequently with goat anti-rat IgG PDX-coupled antibodies diluted 1:2000, respectively. OD was measured at 405 nm and 490 nm. All ELISA experiments were performed in duplicates, and the mean values were calculated.

(29) Although immunization with recombinant VP1 protein induced VP1-specific IgA response in mice, the increase of antibody level after 6 weeks was not significant (FIG. 3).

Example 4

Recombinant Rhinovirus-Derived VP1 for Vaccination Against Common Cold Infections

(30) Materials and Methods

(31) Construction of expression vectors containing the VP1 cDNA of HRV14 or HRV89

(32) The plasmid containing the whole genome of HRV14 (33) was used as a template for the amplification of 14VP1 (VP1 of HRV14) by PCR. The following primers were used:

(33) TABLE-US-00003 (SEQIDNO:35) 5 CGGAATTCCCATGGGCTTAGGTGATGAATTAGAAGAAGTCATCGTT GAGA3 (SEQIDNO:36) 5 GATGGAATTCTCAGTGGTGGTGGTGGTGGTGATAGGATTTAATGTC AC3

(34) The restriction sites (NcoI, EcoRI) are underlined. The cDNA coding for the 14VP1 coding region (data base # AY355195) was inserted into the NcoI and EcoRI sites of plasmid pET23d (Novagen, Merck Bioscience, Germany).

(35) Virus stocks of strain 89 were obtained from the collection of the Institute of Virology, Medical University of Vienna. Viral RNA was prepared from cell culture supernatants using the QIAamp viral RNA kit (Qiagen, Germany) and RNase inhibitor (Boehringer GmbH, Germany) was added to a final concentration of 0.01 U/l. The 89VP1 cDNA (VP1 of HRV89) was amplified by RT-PCR using a SuperScript One Step RT PCR Kit from Invitrogen (USA) using the following primers:

(36) TABLE-US-00004 (SEQIDNO:37) 5 CGGAATTCATTAATATGAACCCAGTTGAAAATTATATAGATAGTGT ATTA3 (SEQIDNO:38) 5 CGATTAATTCAGTGGTGGTGGTGGTGGTGGACGTTTGTAACGGTA A3

(37) The restriction sites (EcoRI, Asel) are underlined. The cDNA coding for the complete 89VP1 coding region (data base # AY355270) was subcloned into the NdeI and EcoRI site of a pET17b vector (Novagen, Merck Bioscience, Darmstadt, Germany).

(38) Expression and Purification of Recombinant 89VP1 and 14VP1

(39) Recombinant 89VP1 and 14VP1 were expressed in E. coli BL21(DE3) (Stratagene, USA). Protein synthesis was induced for 5 hours at 37 C. with 1 mM IPTG and the recombinant proteins were purified from the inclusion body fraction after solubilization in 6 M guanidinium hydrochloride, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris, pH 8 using a Ni-NTA affinity matrix (Qiagen, Hilden, Germany). The proteins were washed with washing buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl, 8 M urea pH 5.9) and eluted with the same buffer at pH 3.5. Protein preparations were dialyzed against buffers with decreasing urea concentration and finally against H.sub.2Odd. Protein purity and concentration were checked by SDS-PAGE and Coomassie blue staining.

(40) Synthetic Peptides and Peptide Conjugates

(41) HRV14-derived peptides (PVP1A, PVP1B and PVP3A) were synthesized on the Applied Biosystems (USA) peptide synthesizer Model 433A using a Fmoc (9 fluorenyl methoxy carbonyl) strategy with HBTU [2-(1H-Benzotriazol-1-yl)1,1,3,3 tetramethyluronium hexafluorophosphat] activation. The following peptides were purified to >90% purity by preparative HPLC and their identity was verified by mass spectrometry:

(42) TABLE-US-00005 PVP1A(SEQIDNO:39): VVQAMYVPPGAPNPKEC; aminoacids147-162ofVP1(10) PVP1B(SEQIDNO:40): CRAPRALPYTSIGRTNYPKNTEPVIKKRKGDIKSY; aminoacids256-289ofVP1(seeWO2008/057158) PVP3A(SEQIDNO:41): KLILAYTPPGARGPQDC. aminoacids126-141ofVP3(10)

(43) Purified peptides were coupled to KLH using an Imject Maleimide Activated Immunogen Conjugation Kit (Pierce, USA) according to the manufacturer's instruction.

(44) Immunization of Mice and Rabbits

(45) Rabbit antibodies against 14VP1, 89VP1, PVP1A, PVP1B or PVP3A were obtained by immunizing rabbits (Charles River, Kisslegg, Germany). Groups of five mice were also immunized subcutaneously with 5 g of 89VP1 adsorbed to Alum in three-week intervals and bled from the tail veins.

(46) ELISA Experiments

(47) 5 g/ml 89VP1 or 14VP1 were coated to ELISA plates. The mouse sera were diluted 1:500 and the rabbit sera 1:10.sup.3-1:10.sup.6. Antigen-specific IgG1 mouse antibodies were detected with 1:1000 diluted alkaline phosphatase-coupled mouse monoclonal anti-mouse IgG1 antibodies (Pharmingen). Antigen-specific rabbit IgG antibodies were developed with a 1:2000 dilution of donkey anti-rabbit IgG peroxidase-coupled antibodies (Amersham Bioscience). The ODs corresponding to bound antibodies were measured at 405 nm and 490 nm for rabbit antibodies and at 405 nm and 450 nm for mice antibodies in an ELISA reader (Dynatech, Germany).

(48) Reactivity of Anti-VP1 Antibodies with Blotted Rhinovirus Extract and Rhinovirus

(49) Cell culture supernatants from HRV-infected HeLa cells were centrifuged in a bench fuge (15.000 rpm, 10 min, 20 C.) to remove insoluble particles. Then, 0.5 ml PEG (40% v/v polyethylene glycol 6000, 2.4% w/v NaCl, pH 7.2) was added to 2 ml of virus-containing supernatant. The solution was incubated at 4 C. over night and then centrifuged at 2,300rpm for 45 minutes in a bench fuge at RT. The pellet was re-suspended in 100 l PBS and lysed in 50 l SDS sample buffer. 10 l of this HRV14 protein extract and 0.5 g purified 14VP1 were separated by 12% SDS PAGE and blotted onto nitrocellulose membranes. Identically prepared blots were incubated with 1:500 dilutions of rabbit anti-14VP1 antibodies or the corresponding pre-immune Ig. Bound antibodies were detected with 125I-labelled donkey anti-rabbit IgG and visualized by autoradiography.

(50) For immunogold electron microscopy, 4.2 l aliquots of the re-suspended viral precipitate were pipetted onto carbon-coated, plasma-cleaned copper grids and air-dried. After 5 minutes, remaining liquid was removed with a piece of filter paper. The grids were then incubated face down (moist chamber at room temperature) in the following buffers: First, PBS containing 1% (w/v) BSA at pH 7.4 and then Tris buffer containing 1% (w/v) BSA at pH 8.2.

(51) Then the following incubation steps were done: (a) 5% (w/v) BSA, 5 min; (b) protein G-purified anti-VP11 g or pre-immune Ig adjusted to an OD280 nm of 0.6, 45 min; (c) 6PBS buffer, 5 seconds each; (d) 6Tris buffer, 5 seconds each; (e) goat anti-rabbit Ig coupled to colloidal gold particles with a diameter of 10 nm (Plano, Wetzlar, Germany), diluted 1:20 in Tris buffer, 30 min; (f) 6Tris buffer, 5 seconds each; (g) 6 distilled water, 5 seconds each. After labelling, negative staining was performed by pipetting a saturated solution of uranyl acetate on the grids. After 1 minute, surplus negative stain was removed with a wet filter paper. The grids were then dried on air and viewed in a Philips EM 410 transmission electron microscope equipped with a high resolution CCD camera. Micrographs were taken at a magnification of 165,000 or 240,000 .

(52) HRV Neutralization Test

(53) Rhinovirus stocks and the HRV-sensitive Ohio strain of HeLa cells (Stott E J and Tyrrell D A, Arch. Gesamte Virusforsch. 1968; 23:236-244.) were used. HeLa cells were seeded in 24 well plates and grown to approximately 90% confluence. In a first set of experiments, 300 l aliquots of HRV14 (100 TCID.sub.50) in medium were incubated for 2 h at 37 C. with 300 l of rabbit anti-sera (anti-14VP1, anti-PVP1A, anti-PVP1B or PVP3A) or the corresponding pre-immune sera (undiluted or diluted 1:2-1:32) and added to the cells. MEM-Eagle medium (Invitrogen, USA) containing 1% FCS and 40 mM MgCl.sub.2 was used as a diluent in the experiments. Plates were incubated at 34 C. in a humidified 5% CO.sub.2 atmosphere and viable cells were stained with crystal violet after three days. Cross-neutralization tests were carried out in 96 well plates; HeLa cells were seeded in minimal essential medium (MEM) containing 2% fetal calf serum, 30 mM MgCl.sub.2, and 1 mM glutamine (infection medium) and grown over night at 37 C. to about 70% confluency. HRVs (100 TCID.sub.50 in 100 l infection medium) were mixed with 100 l of the respective undiluted antiserum and serial twofold dilutions thereof in the same medium. After incubation for 3 h at 37 C., the cells were overlaid with these solutions and incubation was continued at 34 C. for 3 days. The medium was removed and cells were stained with crystal violet (0.1% in water) for 10 min. After washing with water, the plate was dried, the stain was dissolved in 30 l 1% SDS under shaking for 1 hour and cell protection was quantified as OD at 560 nm in a plate reader.

(54) Results

(55) Expression and Purification of Recombinant VP1 Proteins from HRV89 and HRV14

(56) Recombinant VP1 of HRV89 (89VP1; FIG. 6A) and HRV14 (14VP1; FIG. 6B) were expressed in E. coli with a His6-tag at their C-termini and purified from solubilized inclusion bodies by single step Nickel affinity chromatography. The purified protein bands appear after Coomassie blue staining at approximately 34 kDa in SDS-PAGE. The recombinant proteins 89VP1 and 14VP1 reacted specifically with the anti-His-tag antibody due to their C-terminal hexa-histidine tag (right lanes; FIG. 6).

(57) 89VP1 and 14VP1 induce a VP1-specific immune response in animals. Immunization of rabbits with recombinant 89VP1 and 14VP1 induced VP1-specific IgG responses (FIG. 7A). The immune response to 89VP1 was stronger than that to 14VP1 with antibodies detected up to a serum dilution of 10.sup.5 after the second and up to a dilution of 10.sup.6 after the third immunization The 14VP1-specific IgG response was detectable up to a serum dilution of 10.sup.3 after the second and up to a 10.sup.4 dilution after the third immunization (FIG. 7A). VP1-specific antibody responses were obtained also in mice immunized with Alum-adsorbed VP1 proteins. IgG1 antibodies specific for 89VP1 were detected already after the first immunization and continued to increase at the second and third immunization (FIG. 7B).

(58) Reactivity of Antibodies Raised Against Recombinant VP1 Proteins Toward Virus-Derived VP1 and Entire Virions

(59) The reactivity of antibodies induced by immunization with recombinant VP1 proteins with natural, virus-derived VP1 and whole virus was studied by immunoblotting and electron microscopy, respectively. As a representative example, binding of rabbit anti-14VP1 antibodies and of pre-immune Ig to nitrocellulose-blotted HRV14 proteins and 14VP1 is shown FIG. 8A. Antibodies raised against recombinant 14VP1, but not the pre-immune Ig, reacted with natural and recombinant 14VP1 at approximately 34 kDa (FIG. 8A). Specific binding of anti-89VP1 antibodies to HRV89 was visualized using the immunogold electron microscopy method. When immobilized virions were exposed to anti-89VP1 antibodies and gold-conjugated secondary antibodies approximately 10% of the virus particles appeared coated with one up to five colloidal gold particles (FIG. 8B). No attachment of gold to the virions was found in the control preparations with the pre-immune Ig; few gold particles were present but not associated with virus particles (FIG. 8B; right panel).

(60) Immunization of Rabbits with Recombinant 14VP1 Yields Higher 14VP1- and 89VP1-Specific Antibody Titers than Immunization with KLH-Coupled HRV14-Derived Peptides

(61) Antisera were raised against KLH-coupled peptides which have been earlier described as possible vaccine candidates. The anti-peptide antisera contained high titers of peptide-specific antibodies (PVP1A:10.sup.3; PVP1B:10.sup.5; PVP3A:10.sup.5). However, in comparison with antisera raised against recombinant 14VP1, they reacted only weakly with the 14VP1 protein and showed weak cross-reactivity with 89VP1 (FIG. 9). Most remarkably, antiserum raised against recombinant 14VP1 showed a comparable reactivity with 14VP1 and 89VP1. The antiserum against the VP1 protein reacted with both viral proteins at least tenfold more strongly than the peptide antisera (FIG. 9).

(62) 14VP1-Specific Antibodies Inhibit HRV Infection of HeLa Cells Better than Peptide-Specific Antibodies

(63) Next, it was investigated whether rabbit IgG antibodies raised against recombinant 14VP1 protein can inhibit HRV infection of HeLa cells. Results from one set of cell protection experiments performed with HRV14 are shown in FIG. 10. Presence of 14VP1 antibodies prevented cell death on challenge with HRV14 at 100 TCID.sub.50 up to a 1:32 dilution of the antiserum.

(64) Also the ability of antibodies raised against complete 14VP1 with antibodies raised against 14VP1-derived peptides for protection of the cells against viral infection was analyzed. Serial dilutions (undiluted or diluted 1:2-1:32) of anti-14VP1, -PVP1A, -PVP1B or -PVP3A antisera were incubated together with HRV14 and added to HeLa cells. The ability to inhibit cell infection of all three anti-peptide antisera was comparable amongst each other. A clear reduction in CPE was seen at a dilution of 1:8 with anti-PVP1A and anti-PVP1B and at a dilution of 1:4 with anti-PVP3A. A similar degree of inhibition of infection (i.e., partial CPE) was obtained with the anti-14VP1 antiserum up to dilution of 1:32. This suggests that the latter antiserum was approximately 8-fold more potent in inhibiting viral infections (Table 1).

(65) TABLE-US-00006 TABLE 1 Inhibition of HRV14 infection with antisera raised against 14VP1 and HRV14 derived peptides undiluted 1:2 1:4 1:8 1:16 1:32 1:64 14VP1 +++ +++ ++ ++ + + PVP1A +++ +++ + + +/ +/ PVP1B +++ +++ + + +/ +/ PVP3A +++ +++ + +/ +/ +/

(66) In table 1 the neutralization of infection by antibodies raised against 14VP1 and HRV14 derived peptides is shown. A dilution of anti-14VP1, anti-PVP1A, anti-PVP1B or anti-PVP3A antibodies (undiluted or diluted 1:2-1:32) were preincubated with 100 TCID.sub.50 HRV14 and added to HeLa cells. Virus neutralizations and cytopathic effects (CPE) observed are indicated: +++: complete neutralization; ++: minimal CPE; +: partial CPE; +/: almost complete CPE; complete CPE.

(67) Antibodies Raised Against Recombinant VP1 Proteins Show Cross-Protection Against Distantly Related HRV Strains.

(68) FIG. 11A shows the evolutionary relationship of the rhinovirus types used for the cross-protection experiments. They were selected to belong to different species and different receptor groups: HRV37 and 89 are major group genus A, HRV3, 14 and 72 are major group genus B, HRV1A, 18 and 54 are K-types (i.e., major group HRVs possessing a lysine in the HI loop of VP1) and HRV29 and 44 are minor group genus A. Both, the anti-89VP1 and anti-14VP1 antibodies inhibited infection of HeLa cells by half of the HRV serotypes in a concentration-dependent manner independent of their evolutionary relationship (FIG. 11B). Interestingly, anti-14VP1 antibodies inhibited infection by HRV89 more strongly than anti-89VP1 antibodies whereas anti-89VP1 antibodies only weakly inhibited infection by HRV14 (FIG. 11B). Remarkably, both antisera showed extensive cross-reaction with weakly related HRVs (compare to FIG. 11A).

CONCLUSIONS

(69) A vaccine protecting against rhinovirus infections may be useful to reduce rhinovirus-induced asthma exacerbations. The HRV-derived VP1 capsid protein was investigated as a potential vaccine antigen for several reasons. The work of Rossmann et al., elucidating the crystal structure of HRV14, demonstrates that VP1 is critically involved in HRV binding to its receptor on human epithelial cells. It was found that five copies of VP1 form a depression, called canyon and that the ICAM-1 receptor binds into the central part of this canyon. Furthermore, studies of spontaneous mutations in the viral coat led to the identification of four neutralizing immunogenic (NIm) sites on the surface of HRV14. Additional investigations revealed that antibodies to two of the four antigenic sites which are located on the VP1 protein blocked cellular attachment.

(70) The complete VP1 proteins from HRV89 and HRV14, which belong to the phylogenetically distant species HRV-A and HRV-B, respectively, were expressed in E. coli and purified afterwards. Using the ClustalW program for alignment (http://www.ebi.ac.uk/clustalw) only a 45% nucleotide and 41% amino acid identity could be found between 89VP1 and 14VP1. Recombinant 14VP1 and 89VP1 were purified via a C-terminal His-tag by Nickel affinity chromatography in a single step procedure. Immunization of mice and rabbits with recombinant 14VP1 as well as 89VP1 proteins led to the development of VP1-specific antibody responses recognizing natural VP1 from the virus and even intact virus as demonstrated by immunogold electron microscopy.

(71) The antibody responses obtained with the VP1 proteins were compared with those induced by HRV14 VP1- and VP3-derived peptides which had been earlier described as vaccine candidates and with those obtained with a peptide PVP1B located at the C-terminus of the VP1 protein, being part of the ICAM-1 attachment site in HRV14. It was found that the anti-HRV14 VP1 antisera reacted much stronger with VP1 than the anti-peptide antisera and exhibited a higher neutralization titer. The higher neutralization capacity of the antibodies raised against the complete proteins is most likely due to the fact that the antiserum raised against the complete protein recognizes several different epitopes on the VP1 protein and hence may exhibit a higher avidity than the peptide-specific antibodies.

(72) There is a relatively low degree of sequence identity of 45% at the nucleotide and 41% at the amino acid level between 89VP1 and 14VP1. Yet it was found that antibodies raised against the recombinant VP1 proteins from each of these strains inhibited the infection of cultured HeLa cells by a variety of different rhinovirus strains belonging to the major and minor group. The latter finding may be important because it indicates that it may be possible to engineer a broadly cross-protective and effective vaccine against HRV by combining VP1 proteins from a few rhinovirus strains. The efficacy of such a vaccine may be also improved by the addition of other capsid proteins such as VP2, VP3, and/or VP4. The latter one has recently gained attention as it has also elicited cross-protection.

(73) Major advantages of a vaccine based on recombinant rhinovirus capsid proteins are that the vaccine antigens can be easily produced under controlled conditions by large scale recombinant expression in foreign hosts, such as E. coli at reasonable costs. A broadly cross-protective HRV vaccine may be especially useful for the vaccination of patients suffering from rhinovirus-induced asthma attacks and may thus reduce asthma exacerbations.

Example 5

Construction of Vectors Containing the VP1, VP2, VP3 and VP4 cDNAs of HRV89

(74) The cDNAs coding for VP1, VP2, VP3 and VP4 of HRV89 were codon optimized for Escherichia coli and synthetically synthesized with the addition of six histidine residues at the 3 end. The complete genes were inserted into the NdeI/XhoI fragment of multiple cloning site of pET-27b (ATG Biosynthetics, Germany). The resulting constructs are referred to as vectors p89VP1, p89VP2, p89VP3 and p89VP4 and gene products VP1, VP2, VP3 and VP4. The DNA sequences of VP1, VP2, VP3 and VP4 were confirmed by nucleotide sequencing and double digestion and are shown in FIG. 11.

Example 6

Expression and Purification of Recombinant VP1, VP2, VP3 and VP4

(75) In order to achieve the expression of recombinant capsid proteins, Escherichia coli strains BL21 (DE3) were transformed with p89VP1, p89VP2, p89VP3 or p89VP4, respectively, and plated on LB plates containing 100 g/ml kanamycin. A single colony was used to inoculate 250 ml LB medium containing 100 mg/L kanamycin. This culture was grown to an optical density (600 nm) of 0.6 and the protein expression was induced by adding IPTG to a final concentration of 1 mM. Cells were harvested by centrifugation at 3500 rpm at 40 C for 10 min. Purification was performed with the Qiagen protocol using Ni-NTA. The cell pellet was resuspended under denaturing conditions in 10 ml 6M guanidine hydrochloride for 4 hours. After centrifugation (20 min, 18 000 rpm) the supernatant was incubated with 2 ml Ni-NTA for an additional 2 hours. The suspension was then loaded onto a column, washed twice with 10 ml wash buffer (8 M Urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl pH 6.1) and then eluted with 12 ml elution buffer (8 M Urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl pH 3.5. Renaturation was achieved after dialysis with decreasing molarity of urea.

(76) Purity and size of the recombinant proteins were analyzed by SDS-PAGE as shown in FIG. 12. Protein bands correlated with the calculated protein sizes of 33.6 kDa for VP1, 30.8 kDa for VP2, 27.8 kDa for VP3 and 8.3 kDa for VP4. Protein sizes were also confirmed by MALDI-TOF analysis.

Example 7

Cloning of Constructs Expressing MBP-VP1 Epitopes Fusion Proteins

(77) The cDNA coding for VP1 was used as a template for the amplification of VP1-derived epitopes by PCR (Table I). The EcoRI and BamHI restriction sites (underlined in Table I) of the pMalc4X vector were used for the insertion of PCR products down-stream of the malE gene of E. coli, which encodes maltose-binding protein (MBP), resulting in the expression of MBP fusion proteins (New England BioLabs). The insertion of cDNAs for VP1-derived epitopes was confirmed by nucleotide sequencing and the gene products are referred to as Ep_1, Ep_2 and Ep_3 (FIG. 14A).

(78) TABLE-US-00007 TABLEI PrimersusedforcloningofPCRfragments (5 to3). SEQ ID Primers No. Ep_1 CGGAATTCATGAACCCAGTTGAAAATTAT 1 forward ATAGAT Ep_1 CGGGATCCTTATTTGAATCCTTTACCAAT 2 reverse TTTATC EP_2 CGGAATTCACATGGAAGGTTAGTCTTCAA 3 forward GAAATG Ep_2 CGGGATCCTTAATAAAACATGTAATAGGC 4 reverse TGATGC EP_3 CGGAATTCGATGGTTATGATGGTGATAGT 5 forward GCAGCATC Ep_3 CGGGATCCTTAGACGTTTGTAACGGTAAA 6 reverse AACATCAG
Amino Acid Sequences of the N-Terminal Epitope (Epitope 1):

(79) TABLE-US-00008 Ep_1a: (SEQIDNO:42) MNPVENYIDSVLNEVLVVPNIQPST SVSSHAA Ep_1b: (SEQIDNO:43) PALDAAETGHTSSVQPEDMIETRYV ITDQTRDET Ep_1c: (SEQIDNO:44) SIESFLGRSGCIAMIEFNTSSDKTE HDKIGKGFK

Example 8

Expression and Purification of MBP Fusion Proteins

(80) Recombinant fusion proteins (Ep_1, Ep_2, Ep_3) were expressed in E. coli strain BL21 (DE3) as described in Example 6. The purification was performed using MBP's affinity for maltose. The inclusion body fraction was solubilized with 8 M Urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl and dialyzed against the Column Buffer (20 mM Tris, 200 mM NaCl, 1 mM EDTA pH=7.4). The clear lysate was loaded onto an equilibrated amylose resin affinity column, washed twice with 60 ml Column Buffer and eluted with 20 ml Column Buffer containing 10 mM Maltose.

(81) Identity of the fusion proteins was confirmed by Western blot analysis using anti-VP1 rabbit antiserum.

Example 9

Detection of VP1-, VP2-, VP3 and VP4-Specific Antibodies in Blood from Patients with Positive HRV-Specific PCR Test Results

(82) To investigate the occurrence of VP1-, VP2- VP3- and VP4-specific antibodies in human blood, enzyme linked immunosorbent assay (ELISA) was performed. ELISA plates (Nunc) were coated with 5 g/ml of recombinant rhinovirus-derived capsid proteins (VP1, VP2, VP3, VP4) and human serum albumin (HSA) was used as a control. The whole blood from 57 HRV-positive patients was diluted 1:50. Bound human IgA, IgM, IgG.sub.1 and IgG.sub.2 (BD Pharmingen) 1:1000 were detected with sheep anti-mouse peroxidase-coupled (Amersham Bioscience) 1:2000. The optical value (OD 405 nm) is displayed on the y-axis and corresponds to the level of VP1-, VP2- VP3- and VP4-specific antibodies in human blood (FIG. 13). Interesting fine specificities of isotype and subclass specific immune responses were found in HRV-positive patients. Of the four viral capsid proteins, VP1 and VP2 were predominantly recognized by IgG.sub.1 and IgA, whereas VP3 and VP4 reacted mainly with IgM. These results show that HRV-infected patients recognize different rhinovirus-derived proteins (VP1, VP2, VP3 and VP4) preferably by IgG.sub.1 and IgA antibodies and that those proteins can be used for the diagnosis and monitoring of rhinovirus infections in general and in particular for the identification of patients who suffer from rhinovirus-induced exacerbations of respiratory diseases.

Example 10

Reactivity of Anti-HRV Guinea Pig IgG to VP1-, VP2-, VP3 and VP1-Derived Epitopes

(83) In order to evaluate whether recombinant capsid proteins of HRV89 and VP1-derived epitopes cross-react with a variety of different rhinovirus strains, ELISA plates were coated with 5 g/ml of each antigen. Guinea pig sera raised against twenty seven rhinovirus strains, belonging to different species and different receptor groups, were diluted 1:1000. Antigen-specific IgG were detected with 1:2000 diluted goat anti-guinea pig peroxidase-coupled antibodies (Jackson ImmunoResearch). The OD's corresponding to bound antibodies were measured at 405 nm and 490 nm in an ELISA reader. Anti-HRV89 serum and anti-quinea pig serum were used as controls (Sigma) (FIG. 15).

(84) A high anti-VP1 IgG titer could be detected in sera raised against almost a half of the strains tested and an enhanced anti-Ep_1 IgG titer was found in sera with a high anti-VP1 antibody level. These findings have important implications for the diagnosis of HRV infections, especially in the context of airway diseases, because they show that VP1 and its epitopes located mostly within the N-terminus of the entire protein are recognized not only by anti-guinea pig sera raised against the major group but also by sera raised against the minor group rhinoviruses.

Example 11

Comparison of HRV-Specific Antibody Responses with Various Patients' Clinical Data

(85) In order to investigate whether it is possible to find a correlation between VP1-, VP2-, VP3- and VP4-specifc antibody responses and different clinical manifestations, a single variant analysis using the Mann-Whitney test was used (p values <0.05 were considered positive). The following clinical data were considered: fever convulsions sex croup HRV PCR and Influenza PCR Time of gestation Rhinitis Cough Exposure to smoke Wheeze Whistle Administration of bronchodilators Asthma Bronchiolitis

(86) A significant statistical connection was found among: VP1-specific IgM and convulsions VP4-specific IgG1 and croup VP1-, VP2-, VP3- and VP4-specific IgA and HRV/Influenza double positive PCR VP3- and VP4-specific IgG1, VP3-specific IgM and bronchiolitis VP4-specific IgG1 and VP1- and VP2-specific IgA and asthma VP1-specific IgG2 and VP3- and VP4-specific IgA and exposure to smoke

(87) Next, a multi-variant analysis was performed. Basically, in this test clinical data were grouped with various ways and then compared with the antibody values like in the single variant tests. The only 2 groups that gave a correct hypothesis (p <0.05) were the following:

(88) Group 1:

(89) asthma/bronchiolitis/convulsion/croup

(90) Group 2:

(91) Asthma, bronchiolitis, viral positive PCR, convulsion, croup

(92) Group 2 produced various statistical significant results. These were mostly affected by the presence of the viral double infection factor which seemed to be very important throughout the single and multi-variant analyses. For VP2-specific IgM there was a connection between viral double infection and convulsion, while for VP1-specific IgA a relationship between viral double infection and asthma was found.

(93) Furthermore, it was found that antibody levels might be used as a biological marker for the HRV/Influenza double infection. FIG. 20 shows the ROC curve for the Ig values in patients with double infection. There is not only a statistical significance in the hypothesis (Ig values as biological marker) but also the possibility to establish threshold values for VP1-, VP2- VP3- and VP4-specific IgA.

(94) Based on these results, it is assumed that it will be possible to develop serological tests for the diagnosis of rhinovirus infections and their association with respiratory illnesses.

Example 12

Mapping the Antigenic Determinants of the Major Capsid Protein VP1

(95) Recombinant VP1 of the HRV89 has been found to be the most immunologically important surface protein in human blood samples (FIG. 13). Therefore, three VP1-derived fragments were amplified by PCR using cDNA coding for VP1 as a template and fused to the C-terminus of the Maltose Binding Protein (MBP). The MBP-fusion proteins containing VP1-derived fragments, each comprising approximately 100 amino acids (FIG. 14A), were expressed in E. coli. The fusion proteins were purified by affinity chromatography and analyzed by SDS-PAGE. The integrity of the fusion proteins was confirmed by immunoblotting with anti-MBP and anti-VP1 rabbit antiserum (data not shown). The purified MBP-fusion proteins were used to asses whether epitope-specific antibodies can be found in human blood and which antibody subclasses can be identified. As shown in FIG. 14B, the major IgG.sub.1 epitopes were located at the N-terminal recombinant VP1 fragment comprising the first 100 amino acids of the entire protein. Enhanced reactivity was detected for IgA, while no reactivity was found for IgM, IgG.sub.2, IgG.sub.3 and IgG.sub.4 (FIG. 14B). To further analyze the epitope specificity, different peptides derived from the N-terminus of the VP1, each comprising approximately 30 (FIG. 19A) or 20 (FIG. 19B) amino acids were synthesized. The peptides were then used to investigate the occurrence of antibody responses in HRV-infected patients. In both experiments, the major IgG.sub.1 epitopes were located within the first 32 (FIG. 19A) or even 15 (FIG. 19B) amino acids of the VP1 protein.

(96) The amino acid sequences referred to in this example and in FIG. 19 are the following

(97) Amino Acid Residues 1 to 100 of VP1 HRV89 (Referred to as P_1)

(98) TABLE-US-00009 (SEQIDNO:7) MNPVENYIDSVLNEVLVVPNIQPST SVSSHAAPALDAAETGHTSSVQPED MIETRYVITDQTRDETSIESFLGRS GCIAMIEFNISSDKTEHDKIGKGFK
P_1 Derived Peptides of VP1 89HRV:

(99) TABLE-US-00010 1.P1A,31aa (SEQIDNO:48) NPVENYIDSVLNEVLVVPNIQPST SVSSHAA 2.P1B,34aa (SEQIDNO:51) PALDAAETGHTSSVQPEDMIETRY VITDQTRDET 3.P1C,34aa (SEQIDNO:52) SIESFLGRSGCIAMIEFNISSDKT EHDKIGKGFK
P1A Derived Peptides of VP1 89HRV

(100) TABLE-US-00011 1.P1a (SEQIDNO:49) NPVENYIDSVLNEVLVVPNIQ 2.P1b (SEQIDNO:53) VVPNIQPSTSVSSHAAPALD 3.P1c (SEQIDNO:54) APALDAAETGHTSSVQPEDM 4.P1d (SEQIDNO:55) QPEDMIETRYVITDQTRDET 5.P1e (SEQIDNO:56) TRDETSIESFLGRSGCIAMI 6.P1f (SEQIDNO:57) CIAMIEFNTSSDKTEHDKIG 7.P1g (SEQIDNO:58) HDKIGKGFKTWKISLQEMAQ

Example 13

Antibodies Raised Against Recombinant Capsid Proteins Inhibit HRV Infection of HeLa Cells

(101) It was investigated whether rabbit IgG antibodies raised against recombinant VP1, VP2, VP3 and VP4 capsid proteins can inhibit HRV infection of HeLa cells. Results from one set of experiments are shown in FIG. 19. Serial dilutions (1:2 to 1:128) of anti-VP1, anti-VP2, anti-VP3 anti-VP4 were incubated together with HRV89 at 10 TCID.sub.50, 100 TCID.sub.50 and 1000 TCID.sub.50 and added to the HeLa cells. All four anti-sera showed the ability to inhibit cell infection when challenged with HRV89 at 10 TCID.sub.50. When higher amounts of virus were used, a significant reduction of CPE was obtained with anti-VP1, anti-VP2 and anti-VP4.

(102) This suggests that not only antibodies raised against VP1, but also VP2 and VP4, are able to protect HeLa cells from HRV infection (FIG. 20). Therefore, it may be assumed that a vaccine consisting of a mixture of different recombinant capsid proteins might show more extensive cross-reaction with other HRV strains.

Example 14

Reactivity of Rabbit Anti-89VP1 and Anti-14VP1 Antibodies with 14VP1, 89VP1 and Three Recombinant 89VP1 Fragments

(103) In order to confirm the specificity of the rabbit anti-HRV14VP1 and anti-HRV89VP1 anti-sera an ELISA experiment using purified recombinant VP1 proteins from HRV14 and 89 as well as three recombinant fragments of HRV89-derived VP1 was performed. It has been found that anti-HRV14VP1 antibodies cross-reacted with VP1 and three VP1 fragments spanning aa 1-100 (see example 12), aa 101-200 and aa 201-293 but had a much lower titer than the anti-HRV89VP1 antibodies. In this context, it is noteworthy, that the anti-VP1 anti-sera obtained by immunization with VP1 from HRV14 and HRV89 differentially reacted with these recombinant fragments of 89VP1. It thus appears that this latter anti-serum contains IgGs reacting with many more epitopes than the anti-serum raised against 14VP1. Furthermore, it confirms the assumption that using VP1-derived fragments it is possible to detect antibodies directed against distantly related rhinovirus species.