P5SM suicide exon for regulating gene expression
09637750 ยท 2017-05-02
Assignee
Inventors
Cpc classification
C12N15/8279
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to inducible hybrid plant 5S rRNA mimic (P5SM) RNA elements that regulate gene expression by alternative splicing, and to methods of using such RNA elements for regulating transgene expression in eukaryotic host cells and plants.
Claims
1. A vector comprising a transgene, wherein the transgene comprises an isolated DNA encoding a plant 5S rRNA mimic (P5SM), operably linked to a regulatory sequence, and comprises an Adenine nucleotide at position 2 of the 5 splice site of the P5SM, and a Guanine nucleotide at position 1 of the 5 splice site of the P5SM; and wherein the P5SM comprises P1, P2, P3a, P3b, and P3c pairing elements and a L3 loop derived from a first plant species; and a L2 loop derived from a second plant species, wherein the L2 loop comprises an extended purine-rich region; and wherein the first plant species and second plant species are angiosperms.
2. The vector of claim 1, wherein the first plant species is a monocotyledonous plant species.
3. The vector of claim 1, wherein the first plant species is selected from the group consisting of Festuca arundinacea, Hordeum vulgare, Oryza sativa, Triticum aestivim, and Zea mays.
4. The vector of claim 1, wherein the first plant species is Oryza sativa.
5. The vector of claim 1, wherein the second plant species is a dicotyledonous plant species.
6. The vector of claim 1, wherein the second plant species is selected from the group consisting of Arabidopsis thaliana, Brassica oleracea, Brassica napus, Glycine max, Lycopersicon esculentum, Mesembryanthemum crystallinum, Medicago trunculata, Phaseolus vulgaris, and Solanum tuberosum.
7. The vector of claim 1, wherein the L2 loop comprises the extended purine-rich sequence from Arabidopsis thaliana.
8. The vector of claim 1, wherein the extended purine-rich region comprises at least four purine nucleotides.
9. The vector of claim 1, wherein the extended purine-rich region comprises at least five purine nucleotides.
10. The vector of claim 1, wherein the L2 loop comprises nucleotides 217 to 221 of SEQ ID NO: 1 (HyP5SM).
11. The vector of claim 1, wherein the regulatory sequence is selected from the group consisting of a constitutive promoter sequence, an inducible promoter sequence, and the endogenous promoter sequence of the transgene.
12. The vector of claim 1, wherein the P5SM comprises a nucleotide sequence at least 90% identical to nucleotides 197 to 320 of SEQ ID NO: 1 (HyP5SM).
13. The vector of claim 1, wherein the P5SM comprises nucleotides 197 to 320 of SEQ ID NO: 1 (HyP5SM).
14. The vector of claim 1, wherein the isolated DNA comprises a nucleotide aptamer that binds a chemical inducer.
15. The vector of claim 14, wherein binding of the chemical inducer to the nucleotide aptamer induces excision of the P5SM from a gene transcript when the P5SM is incorporated into a gene in a host organism.
16. The vector of claim 14, wherein binding of the chemical inducer to the nucleotide aptamer inhibits excision of the P5SM from a gene transcript when the P5SM is incorporated into a gene in a host organism.
17. A host cell comprising the vector of claim 1.
18. The host cell of claim 17, wherein the P5SM inhibits transgene protein expression.
19. The host cell of claim 18, further comprising a second vector, wherein the second vector comprises an inducible promoter sequence and a recombinant nucleotide encoding an L5 ribosomal protein.
20. The host cell of claim 19, wherein the L5 ribosomal protein is derived from the first plant species.
21. The host cell of claim 19, wherein the L5 ribosomal protein induces excision of the P5SM.
22. A transgenic plant comprising the vector of claim 1.
23. The transgenic plant of claim 22, further comprising a second vector, wherein the second vector comprises an inducible promoter sequence and a recombinant nucleotide encoding an L5 ribosomal protein.
24. Seed comprising the vector of claim 1.
25. The seed of claim 24, further comprising a second vector, wherein the second vector comprises an inducible promoter sequence and a recombinant nucleotide encoding an L5 ribosomal protein.
26. A method of regulating transgene expression in a plant, comprising: (a) providing a plant comprising a first vector and a second vector, wherein the first vector is the vector of claim 1, and the second vector comprises an inducible promoter sequence and a recombinant polynucleotide encoding an L5 ribosomal protein; (b) growing the plant under conditions whereby the first vector is expressed to produce mRNA comprising the P5SM; and (c) inducing the expression of the L5 ribosomal protein in the plant, wherein the L5 ribosomal protein induces excision of the P5SM from the mRNA, thereby allowing expression of the protein encoded by the transgene in the first vector.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION
Definitions
(21) Unless defined otherwise, all scientific and technical terms are understood to have the same meaning as commonly used in the art to which they pertain. For the purpose of the present disclosure, the following terms are defined.
(22) As used herein, plant 5S rRNA mimic and P5SM are used interchangeably and refer to an RNA element residing within a highly conserved, alternatively spliced suicide exon that controls gene expression in eukaryotic organisms, such as land plants.
(23) As used herein, a derived from a plant species refers to a fragment, section, motif, or domain of a polynucleotide, such as a P5SM, that is designed, purified, and/or isolated from a plant species. For example, in certain embodiments, the L2 loop of a hybrid P5SM element is the L2 loop of the Arabidopsis thaliana P5SM, while the rest of the hybrid P5SM element (i.e., the P1, P2, P3a, P3b, P3c pairing elements and the L3 loop) is that of the Oryza sativa P5SM element.
(24) As used herein, a gene refers to a polynucleotide, or fragment thereof, that includes the coding sequence of a gene product, such as a protein.
(25) As used herein, the terms polynucleotide, nucleic acid, nucleic acid sequence, sequence of nucleic acids, and variations thereof shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose), to any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base, and to other polymers containing non-nucleotidic backbones, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA. Thus, these terms include known types of nucleic acid sequence modifications, for example, substitution of one or more of the naturally occurring nucleotides with an analog; inter-nucleotide modifications, such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalkylphosphoramidates, aminoalkylphosphotriesters); those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.); those with intercalators (e.g., acridine, psoralen, etc.); and those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.). As used herein, the symbols for nucleotides and polynucleotides are those recommended by the IUPAC-IUB Commission of Biochemical Nomenclature (Biochem. 9:4022, 1970).
(26) As used herein, a polypeptide is an amino acid sequence containing a plurality of consecutive polymerized amino acid residues (e.g., optionally at least about 15 consecutive polymerized amino acid residues, at least about 30 consecutive polymerized amino acid residues, or at least about 50 consecutive polymerized amino acid residues). In many instances, a polypeptide contains a polymerized amino acid residue sequence that is an enzyme, a methyltransferase, a demethylase, a deacteylase, a predicted protein of unknown function, or a domain or portion or fragment thereof. The polypeptide optionally contains modified amino acid residues, naturally occurring amino acid residues not encoded by a codon, and non-naturally occurring amino acid residues.
(27) As used herein, protein refers to an amino acid sequence, oligopeptide, peptide, polypeptide, or portions thereof whether naturally occurring or synthetic.
(28) Genes and proteins that may be used in the present disclosure include genes encoding conservatively modified variants and proteins that are conservatively modified variants of those genes and proteins described throughout the application. Conservatively modified variants as used herein include individual substitutions, deletions or additions to a polypeptide sequence which result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the disclosure. The following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
(29) Homologs of the genes and proteins described herein may also be used in the present disclosure. As used herein, homology refers to sequence similarity between a reference sequence and at least a fragment of a second sequence. Homologs may be identified by any method known in the art, preferably, by using the BLAST tool to compare a reference sequence to a single second sequence or fragment of a sequence or to a database of sequences. As described below, BLAST will compare sequences based upon percent identity and similarity. As used herein, orthology refers to genes in different species that derive from a common ancestor gene.
(30) The terms identical or percent identity, in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same. Two sequences are substantially identical if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 29% identity, optionally 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200, or more amino acids) in length.
(31) For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. When comparing two sequences for identity, it is not necessary that the sequences be contiguous, but any gap would carry with it a penalty that would reduce the overall percent identity. For blastn, the default parameters are Gap opening penalty=5 and Gap extension penalty=2. For blastp, the default parameters are Gap opening penalty=11 and Gap extension penalty=1.
(32) A comparison window, as used herein, includes reference to a segment of any one of the number of contiguous positions including, but not limited to from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970) J Mol Biol 48(3):443-453, by the search for similarity method of Pearson and Lipman (1988) Proc Natl Acad Sci USA 85(8):2444-2448, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection [see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (Ringbou Ed)].
(33) Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1997) Nucleic Acids Res 25(17):3389-3402 and Altschul et al. (1990) J. Mol. Biol 215(3)-403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix [see Henikoff and Henikoff, (1992) Proc Natl Acad Sci USA 89(22):10915-10919] alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
(34) The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc Natl Acad Sci USA 90(12):5873-5877). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
(35) Other than percentage of sequence identity noted above, another indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
(36) Overview
(37) The present disclosure relates to isolated DNAs encoding a plant 5S rRNA mimic (P5SM) containing pairing elements P1, P2, P3a, P3b, P3c; and loops L2 and L3, where the P1, P2, P3a, P3b, P3c pairing elements, and the L3 loop are derived from a first plant species; and the L2 loop is derived from a second plant species. The present disclosure also relates to isolated DNAs encoding a P5SM containing pairing elements P1, P2, P3a, P3b, and P3c; and loops L2 and L3, where the P5SM is capable of binding to an L5 ribosomal protein resulting in excision of the P5SM from a gene transcript when the P5SM is incorporated into a gene in a host organism; where the P5SM contains at least one modification in one or more of the pairing elements and/or one or more of the loops; where the modified P5SM is incapable of binding to an L5 ribosomal protein and excising from a gene transcript in response to L5 ribosomal protein binding when the modified P5SM is incorporated into a gene in a host organism; and where the isolated DNA further contains a nucleotide aptamer. The present disclosure further relates to isolated DNAs encoding a P5SM containing pairing elements P1, P2, P3a, P3b, and P3c; and loops L2 and L3, where the P5SM is capable of binding to an L5 ribosomal protein resulting in excision of the P5SM from a gene transcript when the P5SM is incorporated into a gene in a host organism; where the P5SM contains at least one modification in one or more of the pairing elements and/or one or more of the loops; where the modified P5SM is incapable of responding to an L5 ribosomal protein resulting in constitutive excision from a gene transcript when the modified P5SM is incorporated into a gene in a host organism; and where the isolated DNA further contains a nucleotide aptamer. The present disclosure also relates to vectors containing such isolated DNAs, host cells containing such isolated DNAs and vectors, transgenic plants containing such isolated DNAs and vectors, and seed from such transgenic plants.
(38) The present disclosure further relates to methods of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing a first vector and a second vector, where the first vector is any of the above vectors containing isolated DNAs of the present disclosure, and the second vector contains a recombinant polynucleotide encoding an L5 ribosomal protein, where the second vector is operably linked to an inducible promoter sequence; culturing the eukaryotic cell under conditions whereby the first vector is expressed to produce mRNA comprising the P5SM; and inducing expression of the L5 ribosomal protein in the eukaryotic cell, where the L5 ribosomal protein induces excision of the P5SM from the mRNA, thereby allowing transgene protein expression. The present disclosure also relates to methods of regulating transgene expression in a plant, by providing a plant containing a first vector and a second vector, where the first vector is any of the above vectors containing isolated DNAs of the present disclosure, and the second vector contains a recombinant polynucleotide encoding an L5 ribosomal protein, where the second vector is operably linked to an inducible promoter sequence; growing the plant under conditions whereby the first vector is expressed to produce mRNA comprising the P5SM; and inducing the expression of the L5 ribosomal protein in the plant, where the L5 ribosomal protein induces excision of the P5SM from the mRNA, thereby allowing transgene protein expression.
(39) The present disclosure further relates to methods of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of binding to an L5 ribosomal protein and excising from a gene transcript in response to L5 ribosomal protein binding when the modified P5SM is incorporated into a gene in a host organism; culturing the eukaryotic cell under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the eukaryotic cell, where the chemical inducer binds the nucleotide aptamer resulting in excision of the modified P5SM from the mRNA, thereby allowing transgene protein expression. The present disclosure also relates to methods of regulating transgene expression in a plant, by providing a plant containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of binding to an L5 ribosomal protein and excising from a gene transcript in response to L5 ribosomal protein binding when the modified P5SM is incorporated into a gene in a host organism; growing the plant under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the plant, where the chemical inducer binds the nucleotide aptamer resulting in excision of the modified P5SM from the mRNA, thereby allowing transgene protein expression.
(40) The present disclosure also relates to methods of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of responding to an L5 ribosomal protein resulting in constitutive excision from a gene transcript when the modified P5SM is incorporated into a gene in a host organism; culturing the eukaryotic cell under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the eukaryotic cell, where the chemical inducer binds the nucleotide aptamer resulting in inhibition of P5SM excision from the mRNA, thereby inhibiting transgene protein expression. The present disclosure also relates to methods of regulating transgene expression in a plant, by providing a plant containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of responding to an L5 ribosomal protein resulting in constitutive excision from a gene transcript when the modified P5SM is incorporated into a gene in a host organism; growing the plant under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the plant, where the chemical inducer binds the nucleotide aptamer resulting in inhibition of P5SM excision from the mRNA, thereby inhibiting transgene protein expression.
(41) P5SM Elements of the Present Disclosure
(42) Certain aspects of the present disclosure relate to an isolated DNA encoding a plant 5S rRNA mimic (P5SM) containing pairing elements P1, P2, P3a, P3b, P3c; and loops L2 and L3, where the P5SM contains at least one modification in one or more of the pairing elements and/or one or more of the loops; and to the use of such isolated DNAs in regulating the expression of one or more transgenes in eukaryotic organisms, such as yeast, mammalian cells, and plants. In certain embodiments, the P5SM element contains at least two, at least three, at least four, at least five, or more modifications in one or more of the pairing elements and/or one or more of the loops. As used herein, a modification can be the addition of one or more nucleotides, a deletion of one or more nucleotides, or a substitution of one more nucleotides. Methods of modifying nucleotide molecules, such as RNA elements, are well known in the art and include, without limitation, molecular cloning, mutagenesis and screening, site-directed mutagenesis, and PCR mutagenesis. In certain embodiments, P5SM elements of the present disclosure are modified to confer better regulatory activity.
(43) Advantageously, P5SM elements of the present disclosure can inducibly regulate expression of a transgene of interest. When not induced, a non-modified P5SM element that has been inserted into the coding region of the transgene introduces a premature termination codon that targets the expressed mRNA transcript for nonsense-mediated decay instead of undergoing translation. However, when a P5SM-specific inducer such as the ribosomal protein L5 is introduced, it binds P5SM and induces alternative splicing that removes P5SM from the expressed transgene transcript, resulting in protein expression of the transgene. Thus, the presence of a P5SM in a transgene allows for the controlled expression of the transgene.
(44) P5SM elements of the present disclosure are RNA elements residing within a highly conserved, alternatively spliced suicide exon that controls expression in land plants (23, 26). P5SM elements of the present disclosure have a conserved secondary structure that resembled that of 5S rRNA. The secondary structure of P5SM contains the pairing elements P1, P2, P3a, P3b, and P3c; as well as the loops L2 and L3 (
(45) Suitable P5SM elements may be identified and isolated from monocot and dicot plants. Examples of such plants include, without limitation, Arabidopsis spp., Oryza sativa, and Nicotiana benthamiana. Examples of suitable P5SM elements include, without limitation, those listed in
(46) In certain embodiments, the P5SM element contains a modified L2 loop. In some embodiments, the L2 loop has been modified to contain an extended purine-rich sequence within the L2 loop. In certain preferred embodiments, the extended purine-rich sequence is the extended purine-rich sequence of L2 loop of the A. thaliana P5SM element.
(47) While naturally-occurring P5SM elements maintain splicing fidelity and regulation within diverse transgene coding sequences, basal transgene activation from the endogenous expression of the P5SM induce ribosomal protein L5 contributes to background transgene expression. One solution to this problem is to use a P5SM element from a more divergent plant species from that of the host plant species containing the P5SM-inducible transgene that might be less responsive to the endogenous ribosomal L5 protein of the host plant. Accordingly, in embodiments where a transgene of interest is expressed in a plant, the P5SM element of the present disclosure is derived from a different plant species from that of the host plant species. For example, if the transgene is being expressed in a dicotyledonous plant species, then the P5SM element is may be derived from a monocotyledonous plant species.
(48) The L2 loop of certain P5SM elements, such as the A. thaliana P5SM element has an extended purine-rich sequence. It had been shown that elimination of this purine-rich sequence leads to constitutive exon skipping (23). Moreover, P5SM elements from monocotyledonous plant species, such as Oryza sativa, do not contain an extended purine-rich sequence in the L2 loop. Accordingly, in certain embodiments, the P5SM element is a hybrid molecule that contains the P1, P2, P3a, P3b, and P3c pairing elements, and the L3 loop of a monocotyledonous plant species, such as Oryza sativa, and an L2 loop that contains an extended purine-rich sequence. Preferably, the L2 loop is from a dicotyledonous plant species, such as Arabidopsis thaliana.
(49) In other embodiments, a P5SM element of the present disclosure has a nucleotide sequence that is at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the nucleotide sequence of HyP5SM (i.e., SEQ ID NO: 1).
(50) Advantageously, P5SM elements of the present disclosure can require an effector protein, such that when coupled to a gene of interest expression of the gene becomes regulated by its own promoter and the promoter of the gene encoding the effector protein. Since the effector protein can control mRNA splicing and is not coupled to transcription of the gene of interest, the two promoters can be any two promoters. Accordingly, any two promoters can be stacked in parallel. Additionally, P5SM elements of the present disclosure can provide traceless regulation, as the mRNA processing step does not change or add any sequence to the open reading frame of the gene of interest.
(51) Moreover, multiple distinct P5SM elements of the present disclosure that are recognized by the same effector protein may be used to coordinate the regulation of multiple genes of interest. This would be similar to how a transcription factor can be used to regulate a suite of genes by using the same promoter sequence over and over again. However, using the same promoter can be problematic due to homology-based gene silencing. By using P5SM elements, the splicing effector recognizes an RNA structure which can be encoded by non-homologous sequences. Thus use of the P5SM elements avoids the problem of homology-based gene silencing and genome instability.
(52) Accordingly, P5SM elements of the present disclosure find many uses including, without limitation, regulation of gene expression, promoter stacking for RNA-based regulation of gene expression, and coordinated regulation of multiple genes.
(53) P5SM elements of the present disclosure may also be used as tools in plant biology research, such as in the area of plant disease resistance. For example, P5SM elements may be used to elucidate the downstream signaling events in disease resistance signaling pathways, such as effector-triggered immunity signaling pathways.
(54) Chemically Inducible P5SM Elements
(55) P5SM elements of the present disclosure can also be modified so as to become unresponsive to the natural P5SM-specific inducer, such as the ribosomal protein L5. For example, the P2 pairing element of the P5SM element can be modified by substituting at least one, at least two, at least three, at least four, at least five, at least six, or more nucleotides such that the P5SM element can no longer binds the natural P5SM-specific inducer. Thus, when such a modified P5SM element is inserted into a transgene and the transgene is expressed, the modified P5SM element will not be excised from the mRNA transcript of the transgene in the presence of the natural P5SM-specific inducer and protein expression of the transgene will not occur.
(56) Additionally, the P2 pairing element or the L2 loop of the P5SM element can also be modified by substituting at least one, at least two, at least three, at least four, at least five, at least six, or more nucleotides such that when the P5SM element is inserted into a transgene and the transgene is expressed, it will be excised from the mRNA transcript of the transgene in the absence of the natural P5SM-specific inducer. In this manner, the modified P5SM element is unresponsive to the natural P5SM-specific inducer, and is constitutively excised from the mRNA transcript of the transgene.
(57) Such modified P5SM elements can be utilized in a P5SM splicing cassette that is incorporated into a gene of interest. Such a splicing cassette contains a 5 proximal splice site, a 5 distal splice site, a 3 proximal splice site, and a 3 distal splice site. When the distal splice sites are utilized, the P5SM element is excised from the mRNA of the expressed gene by spliceosomal processing of the mRNA. However, when the proximal splice sites are utilized, the P5SM element is retained in the mRNA of the expressed gene.
(58) Such splicing cassettes containing a modified P5SM element can be adapted to be responsive to a chemical. For example, a splicing cassette containing the modified P5SM can also contain a nucleotide aptamer sequence that is specific for the chemical. In certain embodiments, the aptamer sequence is inserted to overlap the proximal 5 P5SM splice site or the proximal 3 P5SM splice site. Thus, when the chemical is introduced, the aptamer sequesters the proximal splice sites, which results in utilization of the distal splice sites and excision of the P5SM element. Advantageously, modified P5SM elements of the present disclosure that are not excised from the mRNA of an expressed transgene in the presence of the natural P5SM-specific inducer can be incorporated into a splicing cassette containing an aptamer sequence that overlaps the proximal 5 or 3 splice site in order to generate a P5SM element whose excision is induced by a chemical. Such a chemically inducible P5SM element can be incorporated into a transgene of interest so that protein expression of the transgene is induced by the chemical.
(59) In other embodiments, the aptamer sequence is inserted to overlap the distal 5 P5SM splice site or the distal 3 P5SM splice site. Thus, when the chemical is introduced, the aptamer sequesters the distal splice sites, which results in utilization of the proximal splice sites and retention of the P5SM element. Advantageously, modified P5SM elements of the present disclosure that are constitutively excised from the mRNA of an expressed transgene can be incorporated into a splicing cassette containing an aptamer sequence that overlaps the distal 5 or 3 splice site in order to generate a P5SM element whose excision is inhibited by a chemical. Such a chemically inducible P5SM element can be incorporated into a transgene of interest so that protein expression of the transgene is inhibited by the chemical.
(60) Suitable chemicals that can be used to induce the retention or excision of a modified P5SM element of the present disclosure include, without limitation, theophylline and tetracycline.
(61) P5SM Induction
(62) Other aspects of the present disclosure relate to inducing protein expression of a transgene in a host cell or plant by inducing excision of a modified P5SM element of the present disclosure from the mRNA of the expressed transgene, or inhibiting protein expression of a transgene in a host cell or plant by inducing the retention of a modified P5SM element of the present disclosure within the mRNA of the expressed transgene.
(63) In certain embodiments, P5SM excision can be induced by the ribosomal protein L5. Generally, L5 binding to P5SM induces alternative splicing that causes the P5SM to be skipped during transcription. Accordingly, in certain embodiments, protein expression of the transgene is inhibited by the presence of the P5SM. In other embodiments, protein expression of the transgene is activated by inducing excision of the P5SM from the mRNA of the transgene. Any L5 ribosomal protein known in the art may be used to induce splicing out of the P5SM from the transgene. In certain embodiments, the L5 ribosomal protein is from the same plant species as the P1, P2, P3a, P3b, and P3c pairing elements and the L3 loop of the P5SM. Preferably, the L5 ribosomal protein is from a monocotyledonous plant species, such as Oryza sativa. In other embodiments, the L5 ribosomal protein is a transgenic L5 ribosomal protein.
(64) Excision of the modified P5SM element can also be induced by a chemical inducer such as theophylline or tetracycline. Thus, in certain embodiments, transgene protein expression is induced by the chemical inducer.
(65) In embodiments, where the P5SM is constitutively excised from the mRNA of a transgene, excision of the P5SM element can be inhibited by a chemical inducer such as theophylline or tetracycline. Thus, in certain embodiments, transgene protein expression is inhibited by the chemical inducer.
(66) Transgenes of the Present Disclosure
(67) Other aspects of the present disclosure relate to utilizing P5SM elements to regulate the expression of one or more transgenes of interest in eukaryotic organisms, such as yeast, mammalian cells, or plants, by inserting the P5SM element into the coding region of the one or more transgenes of interest.
(68) As used herein, a transgene refers to a gene that has been modified to contain a P5SM element of the present disclosure. The transgene can be either endogenous or heterologous to the eukaryotic host into which the gene is transferred. Methods for inserting the P5SM element into the coding region of a gene of interest are well known in the art and include, without limitation, the methods described herein.
(69) In certain embodiments, the one or more transgenes are derived from bacteria, fungi, algae, yeast, insects, mammals, or plants. Methods of introducing transgenes into eukaryotic hosts, such as yeast or plants, are well known in the art. Transgenes may be inserted into eukaryotic hosts in order to provide a production system for a desired protein, or may be added to the genetic compliment in order to modulate the metabolism of the eukaryotic host.
(70) Examples of suitable transgenes include, without limitation, genes involved in lignocellulosic degradation, genes involved in lignocellulosic metabolism, genes involved in biochemical synthesis, genes involved in organic alcohol synthesis, genes involved in biofuel synthesis, genes involved in disease resistance, genes involved in pathogen resistance, genes involved in desiccation tolerance, genes involved in salt tolerance, and genes involved in fertility or sterility. In certain embodiments, the suitable genes may be genes encoding effector proteins, such as the avrBs2 gene and the ATR151 gene.
(71) In certain embodiments, the transgene contains an Adenine nucleotide at position 2 of the 5 splice site of the P5SM, and a Guanine nucleotide at position 1 of the 5 splice site of the P5SM.
(72) Vectors and Host Cells of the Present Disclosure
(73) Certain aspects of the present disclosure relate to vectors containing a transgene of the present disclosure that is operably linked to a regulatory sequence, where the transgene contains a P5SM element of the present disclosure; and to host cells containing such vectors. Such host cells may be used to inducibly express the transgene. A transgene containing a P5SM element of the present disclosure may be included in an expression cassette and/or cloned into a suitable expression vector by standard molecular cloning techniques. Such expression cassettes or vectors contain regulatory sequences that assist initiation and termination of transcription (e.g., promoters and terminators), and generally contain a selectable marker.
(74) Vectors
(75) The expression cassette or vector is introduced in a suitable expression host cell, which then expresses the corresponding transgene containing a P5SM element of the present disclosure. Expression host cells may include, without limitation, fungal cells, yeast cells, algal cells, insect cells, mammalian cells, and plant cells. Particularly suitable yeast expression hosts such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Hansenula polymorpha, Kluyveromyces lactis or Pichia pastoris. Especially suited are fungal expression hosts such as Aspergillus niger, Chrysosporium lucknowense, Aspergillus (e.g., A. oryzae, A. niger, A. nidulans, etc.) or Trichoderma reesei. Also suited are mammalian expression hosts such as mouse (e.g., NS0), Chinese Hamster Ovary (CHO) or Baby Hamster Kidney (BHK) cell lines. Other eukaryotic hosts such as insect cells or viral expression systems (e.g., bacteriophages such as M13, T7 phage or Lambda, or viruses such as Baculovirus) are also suitable for producing the transgene containing a P5SM element of the present disclosure.
(76) The vectors preferably contain one or more selectable markers which permit easy selection of transformed hosts. A selectable marker is a gene the product of which provides, for example, biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
(77) The vectors preferably also contain an element(s) that permits integration of the vector into the host's genome or autonomous replication of the vector in the cell independent of the genome.
(78) Promoter sequences of the present disclosure can be the endogenous promoter sequence of the transgene containing a P5SM element of the present disclosure. Alternatively, the promoter sequence can be a heterologous promoter sequence that is either constitutive or inducible. Examples of suitable promoter sequences include any promoter sequence known in the art that drives expression of a gene in a particular host of interest.
(79) For example, in embodiments where the transgene containing a P5SM element of the present disclosure is expressed in a plant cell, a plant promoter can be employed to control the expression of the transgene. Examples of suitable constitutive plant promoter sequences include, without limitation, the core promoter of the Rsyn7, the core CaMV 35S promoter (Odell et al., Nature (1985) 313:810-812), CaMV 19S (Lawton et al., 1987), rice actin (Wang et al., 1992; U.S. Pat. No. 5,641,876; and McElroy et al., Plant Cell (1985) 2:163-171); ubiquitin (Christensen et al., Plant Mol. Biol. (1989)12:619-632; and Christensen et al., Plant Mol. Biol. (1992) 18:675-689), pEMU (Last et al., Theor. Appl. Genet. (1991) 81:581-588), MAS (Velten et al., EMBO J. (1984) 3:2723-2730), nos (Ebert et al., 1987), Adh (Walker et al., 1987), the P- or 2-promoter derived from T-DNA of Agrobacterium tumefaciens, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP 1-8 promoter, and other transcription initiation regions from various plant genes known to those of skilled artisans, and constitutive promoters described in, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5, 608,142. Examples of inducible plant promoter sequences include, without limitation, the AdhI promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, and the PPDK promoter which is inducible by light.
(80) Transgenes containing a P5SM element of the present disclosure are introduced into expression host cells by a number of transformation methods including, without limitation, electroporation, lipid-assisted transformation or transfection (lipofection), chemically mediated transfection (e.g., using calcium chloride and/or calcium phosphate), lithium acetate-mediated transformation (e.g., of host-cell protoplasts), biolistic gene gun transformation, PEG-mediated transformation (e.g., of host-cell protoplasts), protoplast fusion (e.g., using bacterial or eukaryotic protoplasts), liposome-mediated transformation, Agrobacterium tumefaciens, adenovirus or other viral or phage transformation or transduction.
(81) In certain embodiments, a vector of the present disclosure is a binary vector that can replicate in E. coli and Agrobacterium tumefaciens, but that only expresses the corresponding transgene containing a P5SM element of the present disclosure when introduced into plants.
(82) Host Cells
(83) Further aspects of the present disclosure relate to host cells containing vectors of the present disclosure that contain a transgene of interest containing a P5SM element of the present disclosure.
(84) Host cell refers to a living biological eukaryotic cell that can be transformed via insertion of recombinant DNA or RNA. Such recombinant DNA or RNA can be in an expression vector. Any eukaryotic host cell may be used in the present disclosure so long as it remains viable after being transformed with a sequence of nucleic acids. Preferably, the host cell is not adversely affected by the transduction of the necessary nucleic acid sequences, the subsequent expression of the proteins or the resulting intermediates. Suitable eukaryotic cells include, without limitation, fungal, yeast, plant, insect, and mammalian cells.
(85) Examples of suitable fungal cells include, without limitation, cells of the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
(86) Examples of suitable yeast cells include, without limitation, Candida, Hansenula, Issatchenkia, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain. In other embodiments, the yeast host is a Saccharomyces carlsbergensis (Todkar, 2010), Saccharomyces cerevisiae (Duarte et al., 2009), Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces monacensis (GB-Analysts Reports, 2008), Saccharomyces bayanus (Kristen Publicover, 2010), Saccharomyces pastorianus (Nakao et al., 2007), Saccharomyces pombe (Mousdale, 2008), Saccharomyces oviformis strain, Kluyveromyces lactis (O. W. Merten, 2001), Kluyveromyces fragilis (Pestal et al., 2006; Siso, 1996), Kluyveromyces marxiamus (K. Kourkoutas et al., 2008), Pichia stipitis (Almeida et al., 2008), Candida shehatae (Ayhan Demirbas, 2003), or Candida tropicalis (Jamai et al., 2006), Yarrowia lipolytica (Biryukova E. N., 2009), Brettanomyces custersii (Spindler D. D. et al., 1992), and Zygosaccharomyces roux.
(87) Examples of suitable plant cells include, without limitation, cells from plant species of the Family Gramineae, including Sorghum bicolor and Zea mays; species of the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale, and Triticum.
(88) The host cells of the present disclosure may be genetically modified in that a transgene containing a P5SM of the present disclosure has been introduced into the host cells, and as such the genetically modified host cells do not occur in nature.
(89) In certain embodiments, protein expression of a transgene containing a P5SM element of the present disclosure is inhibited in the host cell by the presence of the P5SM. In other embodiments, protein expression of the transgene in the host cell is activated by inducing excision of the P5SM from the mRNA of the transgene. This may be accomplished by expressing an L5 ribosomal protein in the host cell. Accordingly, in certain embodiments, the host cell further contains a second vector containing a recombinant nucleotide encoding an L5 ribosomal protein, where the second vector is operably linked to an inducible promoter sequence. Any suitable inducible promoter sequence known in the art may be used.
(90) In other embodiments, excision of the P5SM element is induced by a chemical inducer, such as theophylline or tetracycline. Thus in certain embodiments, addition of a chemical inducer to the host cell allows protein expression of the transgene.
(91) In embodiments where the P5SM element is constitutively excised from the mRNA of the transgene, excision of the P5SM element can be inhibited by a chemical inducer, such as theophylline or tetracycline. Thus in certain embodiments, addition of a chemical inducer to the host cell inhibits protein expression of the transgene.
(92) Plants of the Present Disclosure
(93) Certain aspects of the present disclosure relate to transgenic plants containing a vector that expresses a transgene of interest containing a P5SM element of the present disclosure.
(94) As used herein, a plant refers to any of various photosynthetic, eukaryotic multi-cellular organisms of the kingdom Plantae, characteristically producing embryos, containing chloroplasts, having cellulose cell walls and lacking locomotion. As used herein, a plant includes any plant or part of a plant at any stage of development, including seeds, suspension cultures, plant cells, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, microspores, and progeny thereof. Also included are cuttings, and cell or tissue cultures. As used in conjunction with the present disclosure, plant tissue includes, without limitation, whole plants, plant cells, plant organs, e.g., leafs, stems, roots, meristems, plant seeds, protoplasts, callus, cell cultures, and any groups of plant cells organized into structural and/or functional units.
(95) As disclosed herein, a broad range of plant types may be modified to incorporate a transgene of interest containing a P5SM element of the present disclosure. Suitable plants that may be modified include both monocotyledonous (monocot) plants and dicotyledonous (dicot) plants.
(96) Examples of suitable plants include, without limitation, species of the Family Gramineae, including Sorghum bicolor and Zea mays; species of the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale, and Triticum.
(97) In certain embodiments, plants may also include, without limitation, those from canola (Brassica napus, Brassica rapa ssp.), Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), duckweed (Lemna), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucijra), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia spp.), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.
(98) Examples of suitable vegetables plants include, without limitation, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
(99) Examples of suitable ornamental plants include, without limitation, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbiapulcherrima), and chrysanthemum.
(100) Examples of suitable conifer plants include, without limitation, loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii), Western hemlock (Isuga canadensis), Sitka spruce (Picea glauca), redwood (Sequoia sempervirens), silver fir (Abies amabilis), balsam fir (Abies balsamea), Western red cedar (Thuja plicata), and Alaska yellow-cedar (Chamaecyparis nootkatensis).
(101) Examples of suitable leguminous plants include, without limitation, guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, peanuts (Arachis sp.), crown vetch (Vicia sp.), hairy vetch, adzuki bean, lupine (Lupinus sp.), trifolium, common bean (Phaseolus sp.), field bean (Pisum sp.), clover (Melilotus sp.) Lotus, trefoil, lens, and false indigo.
(102) Examples of suitable forage and turf grass include, without limitation, alfalfa (Medicago s sp.), orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.
(103) Examples of suitable crop plants and model plants include, without limitation, Arabidopsis, corn, rice, alfalfa, sunflower, canola, soybean, cotton, peanut, sorghum, wheat, tobacco, and lemna.
(104) The plants of the present disclosure may be genetically modified in that recombinant nucleic acids have been introduced into the plants, and as such the genetically modified plants do not occur in nature. A suitable plant of the present disclosure is one capable of expressing a transgene of interest containing a P5SM element of the present disclosure.
(105) As used herein, the terms transgenic plant and genetically modified plant are used interchangeably and refer to a plant that contains within its genome a recombinant nucleic acid. Generally, the recombinant nucleic acid is stably integrated within the genome such that the polynucleotide is passed on to successive generations. However, in certain embodiments, the recombinant nucleic acid is transiently expressed in the plant. The recombinant nucleic acid may be integrated into the genome alone or as part of a recombinant expression cassette. Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of exogenous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
(106) Expression of P5SM-Regulated Transgenes in Plants
(107) Transgenes containing a P5SM element of the present disclosure may be introduced into plant cells via any suitable methods known in the art. For example, a vector containing a transgenes containing a P5SM element of the present disclosure can be expressed in a plant with any suitable plant expression vector. Typical vectors useful for expression of recombinant nucleic acids in higher plants are well known in the art and include, without limitation, vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens (e.g., see Rogers et al., Meth. in Enzymol. (1987) 153:253-277). These vectors are plant integrating vectors in that on transformation, the vectors integrate a portion of vector DNA into the genome of the host plant. Exemplary A. tumefaciens vectors useful herein are plasmids pKYLX6 and pKYLX7 (e.g., see of Schardl et al., Gene (1987) 61:1-11; and Berger et al., Proc. Natl. Acad. Sci. USA (1989) 86:8402-8406); and plasmid pBI 101.2 that is available from Clontech Laboratories, Inc. (Palo Alto, Calif.). The vectors are operably linked to any of plant promoters known in the art or described above in the section entitled Vectors and Host Cells of the Present Disclosure.
(108) Plant transformation protocols as well as protocols for introducing vectors of the present disclosure containing a P5SM-regulated transgene into plants may vary depending on the type of plant or plant cell, e.g., monocot or dicot, targeted for transformation. Suitable methods of introducing vectors of the present disclosure into plant cells and subsequent insertion into the plant genome include, without limitation, microinjection (Crossway et al., Biotechniques (1986) 4:320-334), electroporation (Riggs et al., Proc. Natl. Acad. Sci. USA (1986) 83:5602-5606), Agrobacterium-mediated transformation (U.S. Pat. No. 5,563,055), direct gene transfer (Paszkowski et al., EMBO J. (1984) 3:2717-2722), and ballistic particle acceleration (U.S. Pat. No. 4,945,050; Tomes et al. (1995). Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment, in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al., Biotechnology (1988) 6:923-926).
(109) Additionally, vectors of the present disclosure containing a P5SM-regulated transgene can be targeted to a specific organelle within a plant cell. Targeting can be achieved by providing the vectors with an appropriate targeting peptide sequence. Examples of such targeting peptides include, without limitation, secretory signal peptides (for secretion or cell wall or membrane targeting), plastid transit peptides, chloroplast transit peptides, mitochondrial target peptides, vacuole targeting peptides, nuclear targeting peptides, and the like (e.g., see Reiss et al., Mol. Gen. Genet. (1987) 209(1):116-121; Settles and Martienssen, Trends Cell Biol (1998) 12:494-501; Scott et al., J Biol Chem (2000) 10:1074; and Luque and Correas, J Cell Sci (2000) 113:2485-2495).
(110) The modified plant may be grown into plants in accordance with conventional ways (e.g., see McCormick et al., Plant Cell. Reports (1986) 81-84.). These plants may then be grown, and pollinated with either the same transformed strain or different strains, with the resulting hybrid having the desired phenotypic characteristic. Two or more generations may be grown to ensure that the subject phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure the desired phenotype or other property has been achieved.
(111) In addition, seed of the transgenic plant may also be obtained by any method known in the art for obtaining seed.
(112) Methods of Regulating Gene Expression
(113) Certain aspects of the present disclosure relate to methods of regulating expression of one or more transgenes in a eukaryotic cell or plant by utilizing P5SM elements of the present disclosure to regulate the expression of the transgene by alternative splicing. In one aspect, the present disclosure provides a method of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing a first vector and a second vector, where the first vector is the vector of any of the above embodiments, and the second vector contains a recombinant polynucleotide encoding an L5 ribosomal protein, where the second vector is operably linked to an inducible promoter sequence; culturing the eukaryotic cell under conditions whereby the first vector is expressed to produce mRNA comprising the P5SM; and inducing expression of the L5 ribosomal protein in the eukaryotic cell, where the L5 ribosomal protein induces excision of the P5SM from the mRNA, thereby allowing transgene protein expression. The eukaryotic cell may be a fungal cell, a yeast cell, a plant cell, an insect cell, or a mammalian cell. In another aspect, the present disclosure provides a method of regulating transgene expression in a plant, by providing a plant containing a first vector and a second vector, where the first vector is the vector of any of the above embodiments, and the second vector contains a recombinant polynucleotide encoding an L5 ribosomal protein, where the second vector is operably linked to an inducible promoter sequence; growing the plant under conditions whereby the first vector is expressed to produce mRNA comprising the P5SM; and inducing the expression of the L5 ribosomal protein in the plant, where the L5 ribosomal protein induces excision of the P5SM from the mRNA, thereby allowing transgene protein expression.
(114) Culturing or growing conditions sufficient for the expression of the vector containing the transgene having the P5SM element and for the induction of the L5 ribosomal protein are well known in the art and include any suitable culturing or growing conditions disclosed herein. In certain embodiments, expression of the transgene is inhibited by the presence of the P5SM. In other embodiments, the L5 ribosomal protein is derived from monocotyledonous plant species, such as Oryza sativa. In further embodiments, the L5 ribosomal protein is a transgenic L5 ribosomal protein.
(115) In another aspect, the present disclosure provides a method of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of binding to an L5 ribosomal protein and excising from a gene transcript in response to L5 ribosomal protein binding when the modified P5SM is incorporated into a gene in a host organism; culturing the eukaryotic cell under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the eukaryotic cell, where the chemical inducer binds the nucleotide aptamer resulting in excision of the modified P5SM from the mRNA, thereby allowing transgene protein expression. The eukaryotic cell may be a fungal cell, a yeast cell, a plant cell, an insect cell, or a mammalian cell. In a further aspect, the present disclosure provides a method of regulating transgene expression in a plant, by providing a plant containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of binding to an L5 ribosomal protein and excising from a gene transcript in response to L5 ribosomal protein binding when the modified P5SM is incorporated into a gene in a host organism; growing the plant under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the plant, where the chemical inducer binds the nucleotide aptamer resulting in excision of the modified P5SM from the mRNA, thereby allowing transgene protein expression. Culturing or growing conditions sufficient for the expression of the vector containing the transgene having the modified P5SM element are well known in the art and include any suitable culturing or growing conditions disclosed herein. In certain embodiments, transgene protein expression is inhibited by the presence of the modified P5SM. In other embodiments, the chemical inducer is theophylline or tetracycline
(116) In another aspect, the present disclosure provides a method of regulating transgene expression in a eukaryotic cell, by providing a eukaryotic cell containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of responding to an L5 ribosomal protein resulting in constitutive excision from a gene transcript when the modified P5SM is incorporated into a gene in a host organism; culturing the eukaryotic cell under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the eukaryotic cell, where the chemical inducer binds the nucleotide aptamer resulting in inhibition of P5SM excision from the mRNA, thereby inhibiting transgene protein expression. The eukaryotic cell may be a fungal cell, a yeast cell, a plant cell, an insect cell, or a mammalian cell. The present disclosure also relates to methods of regulating transgene expression in a plant, by providing a plant containing the vector of any of the above embodiments, where the vector contains a modified P5SM that is incapable of responding to an L5 ribosomal protein resulting in constitutive excision from a gene transcript when the modified P5SM is incorporated into a gene in a host organism; growing the plant under conditions whereby the vector is expressed to produce mRNA comprising the modified P5SM and the nucleotide aptamer; and adding a chemical inducer to the plant, where the chemical inducer binds the nucleotide aptamer resulting in inhibition of P5SM excision from the mRNA, thereby inhibiting transgene protein expression. Culturing or growing conditions sufficient for the expression of the vector containing the transgene having the modified P5SM element are well known in the art and include any suitable culturing or growing conditions disclosed herein. In certain embodiments, the chemical inducer is theophylline or tetracycline
(117) It is to be understood that while the present disclosure has been described in conjunction with the preferred specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the present disclosure. Other aspects, advantages, and modifications within the scope of the present disclosure will be apparent to those skilled in the art to which the present disclosure pertains.
(118) The following examples are offered to illustrate provided embodiments and are not intended to limit the scope of the present disclosure.
EXAMPLES
Example 1
(119) The following Example relates to the characterization of a natural splicing cassette containing a plant 5S rRNA mimic (P5SM) suicide exon, and an engineered splicing cassette containing a hybrid P5SM (HyP5SM) suicide exon as regulators of gene expression.
(120) Materials and Methods
(121) Oligonucleotides and DNA Constructs
(122) Sequences of all synthetic primers used for making and mutagenizing DNA constructs, performing overlap extension PCR, RT-PCR, and RT-qPCR are described in Table 1. TFIIIA-eGFP (formerly called Pre-EGFP), LUC (used as a control except when assaying the fLUC reporter), AtL5, and DsRed2 constructs were described previously (23). The coding sequence of OsL5 (Os01g0896800) also was previously isolated and cloned into the pBinAR vector (23). The fLUC coding sequence was derived from the pGL3 vector (Promega). Arabidopsis thaliana coding sequences were amplified by PCR from cDNA (see RNA isolation methods) and cloned using the TOPO TA Cloning kit (Invitrogen). Mutations to TFIIIA-eGFP were made using the QuikChange II Site-Directed Mutagenesis (Stratagene) or QuikChange Lightning Site-Directed Mutagenesis kits (Stratagene) according to the manufacturer's instructions.
(123) The P5SM splicing cassette sequence was inserted into constructs by overlap extension PCR (24). Briefly, the coding sequence to be modified was amplified as two DNA fragments using PCR primers that introduce a region that overlaps with the sequence of the P5SM splicing cassette. For the front fragment, the overlapping region is at the 3 end, and for the back fragment, the overlapping region is at the 5 end. The P5SM splicing cassette was amplified by PCR using TFIIIA-eGFP as the DNA template, generating a third DNA fragment. The DNA fragments were purified by agarose gel electrophoresis and then mixed in a 1:1:1 ratio as partial templates for overlap extension PCR, which uses forward and reverse primers that anneal to the 5 and 3 ends of the desired full-length construct. The PCR product containing the P5SM cassette was purified by agarose gel electrophoresis before being cloned into the TOPO vector for sequence confirmation. To generate constructs for use in plant infiltration experiments, they were re-amplified to introduce restriction sites at the ends (see Table 1), digested with the appropriate restriction enzymes, and ligated using T4 DNA ligase (NEB) into the binary vector pBinAR (25).
(124) The sequence encoding the P5SM RNA element from O. sativa was derived from the genomic fragment of Os02g0116000 previously cloned into the TOPO vector (23). To generate the eGFP-OsP5SM construct, overlap extension PCR was performed to insert OsP5SM in place of the original P5SM from A. thaliana. To generate eGFP-HyP5SM, the purine-rich insertion was introduced directly into the primers used to amplify eGFP-OsP5SM as two DNA fragments, then the two overlapping pieces were extended by PCR. After sequence confirmation of these constructs in the TOPO vector, they were cloned into pBinAR as described above.
(125) Leaf-Based Fluorescence Assay
(126) In vivo reporter fluorescence assays were performed by Agrobacterium-mediated leaf infiltration in Nicotiana benthamiana as previously described (19). Briefly, each leaf half was infiltrated with a 1:1:1 mixture of Agrobacterium transformed with pBinAR plasmids carrying the reporter construct, inducer (AtL5 or OsL5) or the control (LUC), and DsRed2 as a normalization standard. For assaying the fLUC reporter, untransformed Agrobacterium was used as the control instead. In vivo fluorescence was measured 3 days post infiltration using the Typhoon laser-based scanning system (GE Healthcare) using excitation and emission wavelength settings of 488 nm/520 nm for eGFP and 532 nm/580 nm for DsRed2. The ratios of eGFP/DsRed2 fluorescence readings were taken for each leaf half in order to normalize differences in transformation efficiency. On average, 15% difference was observed between DsRed2 fluorescence for leaf halves from the same leaf sample.
(127) To calculate relative fold induction by AtL5 or OsL5, the eGFP/DsRed2 ratio for the leaf half co-expressing the inducer was divided by the other half co-expressing the control. The average relative fold induction was calculated from these values for several leaf samples, and the number of independent leaf samples analyzed (n) and standard deviations are as indicated. No more than two leaf samples were analyzed from the same plant. Autofluorescence (defined as fluorescence measured for uninfiltrated, or blank, leaves) was not measured, and so was not subtracted from the eGFP fluorescence readings for all experiments except for the one showing relative fluorescence of HyP5SM without DsRed2. For this experiment, autofluorescence was measured and subtracted from the eGFP fluorescence readings of both leaf halves, and fold induction for each individual leaf was calculated by taking the ratio of the half co-expressing OsL5 versus the other co-expressing LUC (control).
(128) RNA Isolation and RT-PCR Analyses
(129) Total RNA was isolated from 100 mg N. benthamiana leaf tissue collected 2 days post infiltration using the Universal RNA Purification Kit (CHIMERX) according to the manufacturer's instructions. Leaf tissue samples were immediately frozen in liquid nitrogen after being placed in microtubes, then pulverized using a bead mill (TissueLyser, Qiagen) prior to RNA extraction. The samples were kept frozen during the milling process by being placed in an adapter rack that was pre-chilled at 80 C. The entire procedure was performed as quickly as possible, and the integrity of the RNA after isolation was checked by analysis on an agarose gel.
(130) cDNA was generated from 1 ng RNA samples that had been treated with RQ1 DNase (Promega) using iSCRIPT reverse transcriptase (Bio-rad) and oligo d(T) primers following the manufacturer's instructions. Spliced products were amplified from cDNA samples by PCR with Taq polymerase (NEB) using target-specific primers (Table 1).
(131) In Table 1, lowercase nucleotides represent random nucleotides; bolded lowercase nucleotides represent restriction sites; uppercase nucleotides represent primer sequences; and bolded and italicized uppercase nucleotides represent overlap with P5SM element.
(132) TABLE-US-00001 TABLE1 SequenceofDNAPrimers SEQ ID R.E. NAME EXPERIMENT NO USED RT-PCRanalysis TFIIIA-eGFP DNA1 5-atgcggatccGTGCGGCGTCTTGATGGA 41 For,BamHI DNA2 5-agcttctagaATCCACATAGCAAGTAAAAGA 42 Rev,XbaI eGFP-P5SME/R;eGFP- sP5SME/R;eGFP-
P5SME/R DNA3 5-CACCCTGACCTACGGCGT 43 For DNA4 5-CGATGCCCTTCAGCTCG 44 Rev fLUC-P5SME/R DNA5 5-GACATCACTTACGCTGAGTACT 45 For DNA6 5-TGCAACCCCTTTTTGGAAAC 46 Rev fLUC-P5SMK/R DNA7 5-CATAAAGAAAGGCCCGGC 47 For DNA8 5-ACTGCAACTCCGATAAATAACG 48 Rev CYP707A3-P5SME/R DNA9 5-ACCCTAATGTGTTCTTTGCAGCAA 49 For DNA10 5-TTGAGTTCCATCCCAAGAATTGA 50 Rev CYP707A3-P5SME/S DNA11 5-GATGATCTCGAGCCCTGAAG 51 For DNA12 5-AACCTTTCTCTAGAATGTAGTAGCA 52 Rev CYP707A3-P5SMK/R DNA13 5-TGCCTGATGCAATCAGAAACATGGT 53 For DNA14 5-AGGAGATCTGTGTGTGATGATGGGT 54 Rev PSY-P5SME/R;PSY-P5SMC/R DNA15 5-CTTGATGTGAAGAAACCACAAGATG 55 For DNA16 5-AAGCATATCGAAAGGACGACCA 56 Rev NCED3-P5SME/R DNA17 5-AACTTCCCGATTCCATCAAAGG 57 For DNA18 5-AAATAGACCAAACCGGCGTTAG 58 Rev CYP707A2-P5SME/R DNA19 5-ACACTCCGCCTCTACACAGAAAAT 59 For DNA20 5-TTTCATGTATTCGAGGGTGTTGAT 60 Rev qRT-PCRanalysis eGFP-P5SME/Rtranscriptsretainingexon(SP-II) DNA21 5-CGTCCAGGAGAGAACCATCTTC 61 For DNA22 5-CTGCTTGTCGGCCATGATATAG 62 Rev eGFP-P5SME/Rtranscriptsskippingexon(SP-I) DNA23 5-CGTCCAGGAGGAAATAAATAGCC 63 For DNA24 5-CTTGAAGAAGATGGTTCTCTCAAACA 64 Rev fLUC-P5SME/Rtranscriptsretainingexon(SP-II) DNA5 5-GACATCACTTACGCTGAGTACT 65 For DNA25 5-GGCTATTTATTTCCTCATTATAAATGTC 66 Rev DNA26 5-CGACATTTATAATGAGGAAATAAATAGCC 67 For2 DNA27 5-CAATTCTCTCTCAAACATTTTGCG 68 Rev2 DNA28 5-CAAAATGTTTGAGAGAGAATTGCTC 69 For3 DNA29 5-GAGGTAGATGAGATGTGACGA 70 Rev3 fLUC-P5SME/Rtranscriptsskippingexon(SP-I) DNA5 5-GACATCACTTACGCTGAGTACT 71 For DNA30 5-TTGAGCAATTCTCTCTCATTATAAATG 72 Rev DNA31 5-CGACATTTATAATGAGAGAGAATTGC 73 For2 DNA32 5-GTAGATGAGATGTGACGAACGT 74 Rev2 fLUC-P5SMK/Rtranscriptsretainingexon(SP-II) DNA7 5-CATAAAGAAAGGCCCGGC 75 For DNA33 5-GGCTATTTATTTCCTTCATAGCTTCT 76 Rev fLUC-P5SMK/Rtranscriptsskippingexon(SP-I) DNA7 5-CATAAAGAAAGGCCCGGC 77 For DNA34 5-CAGCCCATATCTCTTCATAGCTT 78 Rev DsREDtranscripts(reference) DNA35 5-CCGAGAACGTCATCACCG 79 For DNA36 5-CTTGGAGCCGTACTGGAACTG 80 Rev Cloningofreporterconstructs P5SMinsert DNA37 5-GTAGATTTATGCATCCTCTTGTCATGAG 81 For DNA38 5-CTACACACCAAAAGAGTGAAAACCAT 82 Rev eGFP-P5SME/R3-pieceligation DNA39 5-gacagatctATGTCTAGAGTGAGCAAGGGCG(5-eGFP) 83 For,BglII DNA40 5-CTCATGACAAGAGGATGCATAAATCTAC 84 Rev CTCCTGGACGTAGCCTTCGG(5-P5SMoverlap) DNA41 5-ATGGTTTTCACTCTTTTGGTGTGTAG 85 For AGAACCATCTTCTTCAAGGACGAC(3-P5SMoverlap) DNA42 5-gacgtcgacTTACTTGTACAGCTCGTCCATGC(3-eGFP) 86 Rev,SalI fLUC-P5SME/R3-pieceligation DNA43 5-acgtagatctATGGAAGACGCCAAAAACATAA(5-fLUC) 87 For,BglII DNA44 5-CTCATGACAAGAGGATGCATAAATCTAC 88 Rev CTCATTATAAATGTCGTTCGCGG(5-P5SMoverlap) DNA45 5-ATGGTTTTCACTCTTTTGGTGTGTAG 89 For AGAGAATTGCTCAACAGTATGGGC(3-P5SMoverlap) DNA46 5-acgtgtcgacTTACACGGCGATCTTTCCG(3-fLUC) 90 Rev,SalI fLUC-P5SMK/R3-pieceligation DNA43 5-acgtagatctATGGAAGACGCCAAAAACATAA(5-fLUC) 91 For,BglII DNA47 5-CTCATGACAAGAGGATGCATAAATCTAC 92 Rev CTTCATAGCTTCTGCCAACCG(5-P5SMoverlap) DNA48 5-ATGGTTTTCACTCTTTTGGTGTGTAG 93 For AGATATGGGCTGAATACAAATCACAG(3-P5SMoverlap) DNA46 5-acgtgtcgacTTACACGGCGATCTTTCCG(3-fLUC) 94 Rev,SalI NCED3-P5SME/R3-pieceligation DNA49 5-tgatagatctATGGCTTCTTTCACGGCAAC(5-NCED3) 95 For,BglII DNA50 5-CTCATGACAAGAGGATGCATAAATCTAC 96 Rev CTCCTGAACAAACCGGTTAGTCTG(5-P5SMoverlap) DNA51 5-ATGGTTTTCACTCTTTTGGTGTGTAG 97 For AGACAATTGGGTCGACCGGTTT(3-P5SMoverlap) DNA52 5-atcactcgagGAACTCACACGACCTGCTTCG(3-NCED3) 98 Rev,XhoI CYP707A3-P5SME/R3-pieceligation DNA53 5-tgattgatcaATGGATTTCTCCGGTTTGTTTC(5-CYP707A3) 99 For,BclI DNA54 5-CTCATGACAAGAGGATGCATAAATCTAC 100 Rev CTCTTTACTGGCCGGAAAAGTC(5-P5SMoverlap) DNA55 5-ATGGTTTTCACTCTTTTGGTGTGTAG 101 For AGAATGCTTGGAAAACAAGCC(3-P5SMoverlap) DNA56 5-atcagtcgacCTATGGTTTTCGTTCCAAGGC(3-CYP707A3) 102 Rev,SalI CYP707A2-P5SME/R3-pieceligation DNA57 5-tgatagatctATGCAAATCTCATCTTCATCGTC(5-CYP707A2) 103 For,BglII DNA58 5- 104 Rev CTCATGACAAGAGGATGCATAAATCTACCTCTTTGCTTGGAG GATAAGTTGG(5-P5SMoverlap) DNA59 5- 105 For ATGGTTTTCACTCTTTTGGTGTGTAGAGAATGATTGGACCAG AGGCTC(3-P5SMoverlap) DNA60 5-atcagtcgacCTTAAATCGGGGTTACTCTTATTGG(3-CYP707A2) 106 Rev,SalI PSY-P5SME/R3-pieceligation DNA61 5-tgattgatcaATGTCTTCTTCTGTAGCAGTGTTATGG(5-PSY) 107 For,BclI DNA62 5-CTCATGACAAGAGGATGCATAAATCTAC 108 Rev CTCGGGTGTCATAAGCAAAGTTC(5-P5SMoverlap) DNA63 5-ATGGTTTTCACTCTTTTGGTGTGTAG 109 For AGACGAAAGGCGATTTGGG(3-P5SMoverlap) DNA64 5-atcagtcgacCGCTCTCATATCGATAGTCTTGAAC(3-PSY) 110 Rev,SalI CYP707A3-P5SME/S3-pieceligation DNA53 5-tgattgatcaATGGATTTCTCCGGTTTGTTTC(5-CYP707A3) 111 For,BclI DNA65 5-CTCATGACAAGAGGATGCATAAATCTAC 112 Rev CTCAATGTGAGGGACCATGTTTCTGATTGC(5-P5SMoverlap) DNA66 5-ATGGTTTTCACTCTTTTGGTGTGTAG 113 For AGTATTGCTCAAGAATCACTCAATTCTTGGGAT(3-P5SM overlap) DNA56 5-atcagtcgacCTATGGTTTTCGTTCCAAGGC(3-CYP707A3) 114 Rev,SalI CYP707A3-P5SMK/R3-pieceligation DNA53 5-tgattgatcaATGGATTTCTCCGGTTTGTTTC(5-CYP707A3) 115 For,BclI DNA67 5-CTCATGACAAGAGGATGCATAAATCTAC 116 Rev CTTTAGATCTTCTCGGTAATAAACTTCGTCTT(5-P5SMoverlap) DNA68 5-ATGGTTTTCACTCTTTTGGTGTGTAG 117 For AGATGCTACTACATTCTAGAGAAAGGTTACAATT(3-P5SM overlap) DNA56 5-atcagtcgacCTATGGTTTTCGTTCCAAGGC(3-CYP707A3) 118 Rev,SalI PSY-P5SMC/R3-pieceligation DNA61 5-tgattgatcaATGTCTTCTTCTGTAGCAGTGTTATGG(5-PSY) 119 For,BclI DNA69 5-CTCATGACAAGAGGATGCATAAATCTAC 120 Rev GCACCAAACGTAGATTGCCCA(5-P5SMoverlap) DNA70 5-ATGGTTTTCACTCTTTTGGTGTGTAG 121 For AGAAGAACTGATGAACTTGTGGAT(3-P5SMoverlap) DNA64 5-atcagtcgacCGCTCTCATATCGATAGTCTTGAAC(3-PSY) 122 Rev,SalI eGFP-OsP5SM3-pieceligation DNA39 5-gacagatctATGTCTAGAGTGAGCAAGGGCG(5-eGFP) 123 For,BglII 5-TGGGATCCAATGCTTCACACTAACATAGGTAAGAC 124 Rev CTTTTGATTTAAACAAAAG(overhang5-P5SMandOsP5SMP1) DNA71 5-GTGTGAAGCATTGGATCCCA(OsP5SMP1insert) 125 For DNA72 5-GCGTGAGGAGGCAATCCTG(OsP5SMP1insert) 126 Rev DNA73 5-CAGGATTGCCTCCTCACGCAATGTTTGAGGTCTG 127 For ATGTTCAATAGC(overhang3-P5SMandOsP5SMP1) DNA42 5-gacgtcgacTTACTTGTACAGCTCGTCCATGC(3-eGFP) 128 Rev,SalI eGFP-HyP5SM3-pieceligation DNA39 5-gacagatctATGTCTAGAGTGAGCAAGGGCG(5-eGFP) 129 For,BglII DNA74 5-TTTTGGAGTTCTCTCTTTGGGATCCAA(OsP5SML2mutation) 130 Rev DNA75 5-GGCATTGGATCCCAAAGAGAGAACTC(OsP5SML2mutation) 131 For DNA42 5-gacgtcgacTTACTTGTACAGCTCGTCCATGC(3-eGFP) 132 Rev,SalI P5SMmutantconstructsbyQuikChangemutagenesis M1 DNA76 5- 133 For TATGCAGAGTCATTCGCTCAAGGTAGATTTATGCATCCTCTTG DNA77 5- 134 Rev CAAGAGGATGCATAAATCTACCTTGAGCGAATGACTCTGCATA M2 DNA78 5- 135 For TATGCAGAGTCATTCGCTCCAGGTAGATTTATGCATCCTCTTG DNA79 5- 136 Rev CAAGAGGATGCATAAATCTACCTGGAGCGAATGACTCTGCATA M3 DNA80 5- 137 For ATATGCAGAGTCATTCGCTCGTGGTAGATTTATGCATCCTCTT DNA81 5- 138 Rev AAGAGGATGCATAAATCTACCACGAGCGAATGACTCTGCATAT M4 DNA82 5- 139 For ATATGCAGAGTCATTCGCTCGCGGTAGATTTATGCATCCTCTT DNA83 5- 140 Rev AAGAGGATGCATAAATCTACCGCGAGCGAATGACTCTGCATAT M5 DNA84 5- 141 For ATATGCAGAGTCATTCGCTCGGGGTAGATTTATGCATCCTCTT DNA85 5- 142 Rev AAGAGGATGCATAAATCTACCCCGAGCGAATGACTCTGCATAT M6 DNA86 5- 143 For CATATGCAGAGTCATTCGCTCTTGGTAGATTTATGCATCCTCTT G DNA87 5- 144 Rev CAAGAGGATGCATAAATCTACCAAGAGCGAATGACTCTGCATA TG M7 DNA88 5- 145 For CATATGCAGAGTCATTCGCTCTCGGTAGATTTATGCATCCTCTT G DNA89 5- 146 Rev CAAGAGGATGCATAAATCTACCGAGAGCGAATGACTCTGCATA TG M8 DNA90 5- 147 For CATATGCAGAGTCATTCGCTCTGCGTAGATTTATGCATCCTCTT G DNA91 5- 148 Rev CAAGAGGATGCATAAATCTACGCAGAGCGAATGACTCTGCATA TG M9;M14 DNA92 5-TTTCACTCTTTTGGTGTGTAGAGTTCTTTTACTTGCTATGTGG 149 For DNA93 5- 150 Rev CCACATAGCAAGTAAAAGAACTCTACACACCAAAAGAGTGAA A M10 DNA94 5-TTTCACTCTTTTGGTGTGTAGAGCTCTTTTACTTGCTATGTGG 151 For DNA95 5- 152 Rev CCACATAGCAAGTAAAAGAGCTCTACACACCAAAAGAGTGAA A M11 DNA96 5- 153 For GTTTTCACTCTTTTGGTGTGTAGGTATCTTTTACTTGCTATGTGG DNA97 5- 154 Rev CCACATAGCAAGTAAAAGATACCTACACACCAAAAGAGTGAA AAC M12 DNA98 5- 155 For GTTTTCACTCTTTTGGTGTGTAGCCATCTTTTACTTGCTATGTGG DNA99 5- 156 Rev CCACATAGCAAGTAAAAGATGGCTACACACCAAAAGAGTGAA AAC M15;M17 DNA10 5- 157 For 0 GTTTTCACTCTTTTGGTGTGTAGCTATCTTTTACTTGCTATGTGG DNA10 5- 158 Rev 1 CCACATAGCAAGTAAAAGATAGCTACACACCAAAAGAGTGAA AAC
(133) Spliced products were visualized by agarose gel electrophoresis and confirmed by sequencing after gel purification and TOPO cloning. RT-qPCR analysis was performed on the Bio-Rad CFX96 instrument using spliced product-specific primers (see Table 1) and SsoFast EvaGreen Supermix (Bio-Rad). The specificity of spliced product amplification was confirmed by melting curve analysis and visualization of PCR products on an agarose gel. Control samples in which no reverse transcriptase was added to the reaction also were analyzed after PCR to confirm the absence of DNA contamination. Transcript abundances for different samples were calculated using standard curves determined for each target. Primer efficiencies were determined to be within the range of 1005%. Relative transcript amounts were normalized to the relative amount of DsRed2 transcript and the sample with the control LUC was set to 1. For biological replicates, no more than two leaf samples were taken from the same plan.
(134) Luciferase Assay
(135) Firefly luciferase enzyme activity was measured using the Luciferase Assay System (Promega) according to the manufacturer's instructions. N. benthamiana leaf tissue samples were collected and analyzed 3 days post infiltration. Tissue lysate samples were normalized to total protein content determined by Bradford assay, and relative luminescence was measured in triplicate using a GloMax 96 Microplate Luminometer (Promega). Fold induction was determined relative to samples without co-expression of inducer.
(136) Bioinformatics
(137) The TAIR9 release of 33,201 annotated protein coding sequences for A. thaliana was inputted into a MySQL database table. A database query was made for each pair of amino acids (corresponding to the bordering codons) within the first half of protein coding sequences. Next, a database query was made counting the number of protein entries not containing any of the amino acid pairs within the first half of the coding sequence. This number was subtracted from and divided by the total number of protein coding sequences to calculate the proteome coverage percentage. Similar queries were used to calculate the percentage of protein entries containing an E, K, or Q amino acid within the first half of the coding sequence.
(138) Western Blots
(139) Crude protein was extracted from 100 mg N. benthamiana leaf tissue collected 2 days post infiltration as previously described (23). After centrifugation, the total protein concentration of the supernatant was determined using the Coomassie Plus Protein Assay (Pierce) following standard protocols. 2 g of total protein for each sample was loaded and run on an SDS-PAGE gel along with a pre-stained molecular weight marker. Semi-dry transfer to the PVDF membrane (Millipore) was performed following standard procedures using an Owl HEP-1 electroblotter. After overnight incubation with SuperBlock blocking buffer (Pierce) with 1% Tween-20, the membrane was probed with 1:20,000 anti-GFP (Millipore) in SuperBlock for 1 hr. Following three washes with TBST (TBS with 0.1% Tween-20), the membrane was incubated with 1:10,000 goat anti-mouse HRP conjugate (Pierce) in SuperBlock for 1 hr. After three more washes with TBST, protein was detected using the SuperSignal West Pico chemiluminescent substrate (Pierce) following standard procedures. Shown is the film image after a 20 min exposure. The membrane was subsequently incubated with GelCode Blue reagent (Pierce) for 5 min before destaining following standard procedures.
(140) Results
(141) A Natural Splicing Cassette Bearing a Suicide Exon can be Employed to Regulate Other Genes
(142) We and others have previously reported the discovery of the plant 5S rRNA mimic (P5SM), an RNA element residing within a highly conserved, alternatively spliced suicide exon that controls expression of transcription factor IIIA (TFIIIA) in land plants (23, 26). We have shown that TFIIIA expression is activated by skipping of the suicide exon, which is induced by ribosomal protein L5 binding to the P5SM RNA element (23). Our initial design for a splicing cassette conservatively included not only the P5SM exon (175 nt in length) and flanking intronic regions (150 and 98 nt in length) from the Arabidopsis thaliana TFIIIA gene, but also the two bordering codons, which encode amino acids Glu (E) and Arg (R), respectively (
(143) Using the overlap extension PCR method (24), the above splicing cassette, called P5SM.sub.E/R, was inserted in place of the codons for E-96 and R-97 within the coding sequence for enhanced green fluorescent protein to generate the reporter construct eGFP-P5SM.sub.E/R (
(144) The function of the splicing cassette in this non-native gene context was compared to that for the control construct, TFIIIA-eGFP, in which the cassette remains in the native TFIIIA context with eGFP fused to the C-terminal end (
(145) Consistent with the RT-PCR analysis, increases in protein fluorescence with AtL5 induction were comparable between eGFP-P5SM.sub.E/R and TFIIIA-eGFP (
(146) We further inserted P5SM.sub.E/R into several A. thaliana protein-coding sequences, in place of E/R sequences naturally present within the first half of each ORF. In each of these constructs, splicing fidelity and regulation appear to be maintained, although some splicing intermediates were observed that correspond to unspliced and partially spliced pre-mRNA (
(147) Determination of the Minimal Gene Context Requirements for the P5SM Splicing Cassette Expands its General Utility
(148) Expanding the repertoire of gene contexts beyond the wild-type E/R sequence would enable more facile design of splicing-regulated transgenes. Thus, to define the minimal context required for cassette function, we analyzed the effects of systematically mutating the bordering codons. Mutations upstream of the 5 splice site (ss) at positions 1 to 3 and downstream of the 3 splice site at positions +1 to +3 were performed on the TFIIIA-eGFP reporter (
(149) The effect of mutations to the bordering codons on splicing was analyzed by RT-PCR and the effect on gene expression was quantified by fluorescence leaf scanning (
(150) Mutations at the more highly conserved positions 2 and 1 lead to partial or full loss of splicing fidelity and regulation. M3-M7 constructs harboring various mutations at position 2 were characterized as semi-functional. These mutants exhibit aberrant splicing but still some splicing to SP-I and SP-II, which leads to overall lower fluorescence induction relative to WT. Sequence analysis of the observed aberrant spliced products, SP-III and SP-IV, showed that they are generated by improper usage of an upstream 5 ss or intron retention, respectively (
(151) In contrast, alterations near the 3 ss do not appear to affect splicing activity, as evidenced by the M9-M12 constructs. Even the M12 construct, in which positions +1 and +2 are substituted with the least frequently observed nucleotides, maintains full splicing activity. We did not rigorously test mutations to position +3 because no nucleotide conservation was observed at this position (28). In addition, M13-M17 constructs confirm that double mutations to the bordering codons are tolerated as well as the corresponding single mutations (
(152) Taken together, these mutagenesis results suggest that full splicing activity for the splicing cassette requires a 5 context that extends to positions 1 and 2, but that there is no apparent requirement for the 3 context past the canonical 3 ss. In order to validate these surprisingly minimal exonic sequence requirements, we further analyzed the activity of the splicing cassette in ORF contexts corresponding to several of the tested mutations. The predicted functional contexts E/R, K/R, and E/S were tested in the ORFs for firefly luciferase (fLUC) or abscissic acid 8-hydroxylase (CYP707A3) as a representative plant gene. In good agreement with the results for WT, M1, and M9 constructs, the splicing cassette in these ORFs displayed full splicing activity and (analyzed by enzyme activity for fLUC only) increased protein expression in response to AtL5 (
(153) These data provide strong evidence that the mutagenesis results can reliably predict splicing activity for the P5SM cassette in other ORF contexts. If predicted functional contexts are limited to the 12 amino acid pairs that have been validated as giving full splicing activity (
(154) Rational Adaptation of a Species-Divergent P5SM Element Gives Robust, Orthogonal Gene Activation
(155) The natural P5SM cassette appears to maintain splicing fidelity and regulation within diverse coding sequences. However, one potential drawback is that basal activation from endogenous L5 contributes to background fluorescence and leads to relatively modest (4-7 fold) levels of gene induction by AtL5 (
(156) Alternatively, we reasoned that the P5SM RNA element from a more divergent plant species might be less responsive to the endogenous L5 as compared to the A. thaliana P5SM RNA element. Both A. thaliana and Nicotiana benthamiana, the model species in which the transient expression assays have been performed, are dicots. Thus, we replaced the P5SM RNA element in the reporter construct eGFP-P5SM.sub.E/R with the one derived from the monocot O. sativa, which was termed OsP5SM. We found that splicing activity is maintained for the new construct eGFP-OsP5SM.sub.E/R, which also exhibits a higher level of induction by OsL5 than AtL5 (
(157) This unexpected result can be rationalized in light of the proposed regulatory mechanism for how the P5SM-L5 interaction influences alternative splicing (23). Previous data have suggested that L5 protein binding to the P5SM RNA element acts to displace an exon-defining splice factor from the L2 loop, which results in exon skipping. The L2 loop of the A. thaliana P5SM RNA element has an extended purine-rich sequence that is shortened in the rice element (
(158) Loss of exon definition due to a reduction in splice factor binding or another mechanism involving the L2 loop could explain the increase in SP-I and high background fluorescence. To address this possibility, we converted the sequence of the OsP5SM L2 loop to match the purine-rich A. thaliana sequence and tested a construct containing the hybrid P5SM (HyP5SM) sequence, eGFP-HyP5SM (
(159) Furthermore, it was determined that DsRed2, the fluorescent protein used as a normalization standard in all of the experiments, contributed to the residual background fluorescence. In the absence of DsRed2, little to no background above autofluorescence was observed for eGFP-HyP5SM in the absence of OsL5 induction (
(160) Discussion
(161) Our construct designs and the associated bioinformatics estimates for genome coverage include two simplifying assumptions which impose conservative restrictions on gene context. First, we artificially limit the site of cassette insertion to within the first half of ORFs, so that even in the absence of NMD mechanisms, the exon-retained spliced product would not generate functional protein. However, premature termination codons have been shown to activate NMD as long as they are upstream of an exon junction by some distance. In N. benthamiana, introduction of the well-characterized Ls intron within the 3 UTR of an otherwise stable mRNA triggers NMD when the stop codon is 99 nt but not 28 nt upstream of the location of intron placement (12). This observation is consistent with the general rule established in mammals, which is that NMD is usually triggered if a stop codon is 50-55 nt upstream of an exon junction (29). The premature termination codon in the P5SM suicide exon is 121 nt upstream of the exon junction, and the exon-retained spliced product of A. thaliana TFIIIA is subject to NMD (27). Regardless of gene context, the splicing cassette maintains the suicide exon at the same distance upstream of the exon junction, so its location does not necessarily need to be within the first half of the ORF to trigger NMD. However, cassette insertion at a roughly central location may help ensure that each ORF section is of sufficient length to be recognized as an exon.
(162) Second, we only consider in-frame cassette insertion sites which allow us to generate proper splice site contexts via synonymous codon substitutions. It is very likely that the conserved AG sequence upstream of the 5 ss does not have to be in-frame with the ORF, although this remains to be tested. Our observation that mutations in the extended 3 ss context have no effect is consistent with the spliceosome cycle as elucidated in mammalian systems, in which the 5 ss and branchpoint are first recognized (30). The branchpoint region of the 3 intron can be readily identified, as it is 27 nt upstream of the 3 ss and conforms to the plant consensus, CURAY (31). Thus, it appears that maintenance of the distance between the 3 ss and the strong branchpoint signal is sufficient for proper splice site recognition. Taken together, it is believed that the P5SM splicing cassette will regulate the expression of any gene with the dinucleotide AG in its coding sequence, which effectively would mean that any gene can be regulated in a traceless fashion.
(163) The splicing cassette was reliably engineered into three different ORFs, eGFP, fLUC, and CYP707A3. The targeted ORFs did not originally possess introns at the site of cassette insertion, but in each case the suicide exon was spliced with no observable loss of fidelity. All of the predicted functional contexts we have tested maintain activation of alternative splicing by L5, demonstrating that the splicing cassette retains the necessary cis regulatory elements. A 2-fold difference in expression level was observed between the E/R and K/R contexts in the fLUC gene, regardless of the presence or absence of AtL5 (
(164) Essentially no fluorescence was measured for the eGFP-HyP5SM reporter in the absence of OsL5 induction (
(165) It is not immediately obvious which nucleotide changes to the RNA element are responsible for the discrimination in binding of OsL5 versus AtL5. There are very few differences in sequence between the original and hybrid P5SM in the regions that are homologous to 5S rRNA (the L2/P2 and P3c/L3 regions,
(166) Because L5 is not a general splice factor and instead interacts specifically with the P5SM element, the activation of transgene expression by alternative splicing is highly robust and selective. Co-expression of OsL5 increases the levels of the reporter protein 97-fold (
(167) In conclusion, we have adapted a natural splicing cassette to serve as a portable regulatory element that robustly controls gene expression via alternative splicing. Gene regulation by the suicide exon is effectively traceless, as induced exon skipping affords the original ORF with at most one or two synonymous codon substitutions. This, along with the minimal requirements for sequence context, makes the regulation of any gene of interest quite facile using the P5SM splicing cassette. Thus, we have shown that conditional splicing can be a general and effective mechanism for transgene regulation. It is envisioned that the ability to combine DNA- and RNA-level regulation will enable novel strategies for controlling the expression of single genes with multiple promoters and for coordinating the expression of genes without the use of homologous promoters (
Example 2
(168) The following Example relates to the generation and characterization of a chemical-inducible P5SM suicide exon cassette that can activate or inhibit expression of a transgene.
(169) Chemically Activatable Splicing Cassette
(170) We have shown that mutations to the P2 stem (M4/M5) of HyP5SM eliminate binding to the L5 ribosomal protein and lead to constitutive exon retention within a transgene, i.e., default gene expression is off (
(171) Chemically Repressible Splicing Cassette
(172) We have shown that mutations to the L2 stem (M8) or the dinucleotide bulge of the P2 stem (M3) of HyP5SM eliminate responsiveness to the L5 ribosomal protein and lead to constitutive excision of the exon from a transgene via exon skipping, i.e., default gene expression is on (
(173)
Example 3
(174) The following Example relates to the use of the engineered HyP5SM suicide exon cassette to regulate expression of the pathogen effector protein AvrBs2.
(175) Introduction
(176) Effector-triggered immunity (ETI) is a plant innate immune pathway that is activated when plants that possess disease resistance (R) genes recognize specific pathogen effector proteins. The ETI response includes a defensive hypersensitive response (HR) that involves localized cell death at the site of pathogen recognition, thereby quarantining the pathogen. Although many R protein and effector protein pairs are known to trigger HR when co-expressed, the immediate and far downstream signaling events remain unclear. Generating transgenic plants that inducibly express effector proteins is problematic due to the very sensitive HR phenotype triggered by low levels of the effector protein.
(177) AvrBs2 is a conserved bacterial effector protein from Xanthomonas euvesicatoria, the agent responsible for black spot disease in tomatoes and pepper plants. Mutations of the avrBs2 gene reduce virulence, and supplementation with a plasmid carrying wild-type avrBs2 restores full virulence (36).
(178) Bs2 is a disease resistance protein that recognizes AvrBs2 and initiates the hypersensitive response. Bs2 was found in pepper plants immune to black spot disease and has been shown to function in tomatoes and Nicotiana benthamiana (38). Bs2, like almost all discovered disease resistance proteins in plants, has a nucleotide binding (NB) and leucine rich repeat (LRR) domains. Similar domains are also found in the NOD-like receptors of animal innate immune systems.
(179) In the following Example, a dual regulation strategy was used to tightly regulate the bacterial effector protein AvrBs2 by utilizing a chemically-inducible promoter and the alternatively spliced cassette exon called HyP5SM. We engineered the HyP5SM to highly favor a non-productive splice product by default, thus reducing background protein levels. We also engineered the HyP5SM to switch to a productive splice product upon co-expression of the rice L5 protein (OsL5), thus recovering protein expression. The following results demonstrate that, in transiently transformed Nicotiana benthamiana, the dual regulation strategy reduces or eliminates detectable background HR. This result is mediated by the splicing of HyP5SM, and by the reduction in AvrBs2 protein levels. Furthermore, plants recovered the HR phenotype when the promoter and HyP5SM exon skipping were induced.
(180) Alternatively Spliced HyP5SM Exon
(181) The HyP5SMexon was generated as described in Example 1. As shown in
(182) Dual Regulation Strategy
(183) In order to achieve tight gene regulation, the dexamethasone-inducible promoter system from Aoyama and Chua (23) was used in combination with the HyP5SM exon (
(184) As shown in
(185) Results
(186) As shown in
(187) RT-PCR for avrBs2-HyP5SM-HA Demonstrates Clear Splice Factor Ratio Shift
(188) Using Agrobacterium-mediated transient transformations of Nicotiana benthamiana leaves, the avrBs2-HyP5SM-HA gene was co-transformed with the constitutive Luciferase (control) or constitutive OsL5 (to induce HyP5SM skipping) promoters, or the dexamethasone-inducible promoter. The experiment was performed with six leaf halves, three without OsL5 and three with OsL5. As shown in
(189) The radical shift in splice factor ratios was evident even when avrBs2-HyP5SM-HA was constitutively expressed (
(190) RT-PCR Also Demonstrates Leaky Transcription
(191) In the leaf samples tested, the dexamethasone-inducible promoters should be off, since the leaf was not exposed to the inducer. However, as seen in lanes 9 and 10 of
(192) Leaky Protein Expression is Undetectable
(193) As shown in
(194) While leaky transcription from the inducible promoter was not eliminated (
(195) As shown in
(196) Chemically Inducible AvrB2 Protein Expression in Mock Transgenic Plant
(197) In order to make a transgenic plant to specifically study effector-triggered immunity (ETI), rather than pathogen-associated molecular pattern (PAMP)-triggered immunity, it was necessary to make AvrBs2 protein completely chemically inducible. Using Agrobacterium, mock transgenic plant leaves were transiently transformed with the avrBs2-HyP5SM-HA and OsL5, which were both driven by the dexamethasone-inducible promoter.
(198) As shown in
(199) As shown in
REFERENCES
(200) 1. Chen, M. and Manley, J. L. (2009) Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nat Rev Mol Cell Bio, 10, 741-754. 2. Lopez, A. J. (1998) Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu Rev Genet, 32, 279-305. 3. Terzi, L. C. and Simpson, G. G. (2008) Regulation of flowering time by RNA processing. Curr Top Microbiol, 326, 201-218. 4. Ali, G. S, and Reddy, A. S. (2008) Regulation of alternative splicing of pre-mRNAs by stresses. Curr Top Microbiol, 326, 257-275. 5. Gassmann, W. (2008) Alternative splicing in plant defense. Curr Top Microbiol, 326, 219-233. 6. Kojima, S., Shingle, D. L., and Green, C. B. (2011) Post-transcriptional control of circadian rhythms. J Cell Sci, 124, 311-320. 7. Campbell, M. A., Haas, B. J., Hamilton, J. P., Mount, S. M., and Buell, C. R. (2006) Comprehensive analysis of alternative splicing in rice and comparative analyses with Arabidopsis. BMC Genomics, 7, 327. 8. Wang, B. B. and Brendel, V. (2006) Genomewide comparative analysis of alternative splicing in plants. P Natl Acad Sci USA, 103, 7175-7180. 9. Padidam, M. (2003) Chemically regulated gene expression in plants. Curr Opin Plant Biol, 6, 169-177. 10. Singer, S. D., Cox, K. D., and Liu, Z. (2011) Enhancer-promoter interference and its prevention in transgenic plants. Plant Cell Rep, 30, 723-731. 11. Halpin, C. (2005) Gene stacking in transgenic plantsthe challenge for 21st century plant biotechnology. Plant Biotechnol J, 3, 141-155. 12. Kertesz, S., Kerenyi, Z., Merai, Z., Bartos, I., Palfy, T., Barta, E., and Silhavy, D. (2006) Both introns and long 3-UTRs operate as cis-acting elements to trigger nonsense-mediated decay in plants. Nucleic Acids Res, 34, 6147-6157. 13. Kerenyi, Z., Merai, Z., Hiripi, L., Benkovics, A., Gyula, P., Lacomme, C., Barta, E., Nagy, F., and Silhavy, D. (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay. EMBO J, 27, 1585-1595. 14. Weigand, J. E. and Suess, B. (2007) Tetracycline aptamer-controlled regulation of pre-mRNA splicing in yeast. Nucleic Acids Res, 35, 4179-4185. 15. Culler, S. J., Hoff, K. G., and Smolke, C. D. (2010) Reprogramming cellular behavior with RNA controllers responsive to endogenous proteins. Science, 330, 1251-1255. 16. Kim, D. S., Gusti, V., Dery, K. J., and Gaur, R. K. (2008) Ligand-induced sequestering of branchpoint sequence allows conditional control of splicing. BMC Mol Biol, 9, 23. 17. Cooper, T. A. (2005) Use of minigene systems to dissect alternative splicing elements. Methods, 37, 331-340. 18. Croft, M. T., Moulin, M., Webb, M. E., and Smith, A. G. (2007) Thiamine biosynthesis in algae is regulated by riboswitches. Proc Natl Acad Sci USA, 104, 20770-20775. 19. Wachter, A., Tunc-Ozdemir, M., Grove, B. C., Green, P. J., Shintani, D. K., and Breaker, R. R. (2007) Riboswitch control of gene expression in plants by splicing and alternative 3 end processing of mRNAs. Plant Cell, 19, 3437-3450. 20. Bocobza, S., Adato, A., Mandel, T., Shapira, M., Nudler, E., and Aharoni, A. (2007) Riboswitch-dependent gene regulation and its evolution in the plant kingdom. Gene Dev, 21, 2874-2879. 21. Sudarsan, N., Barrick, J. E., and Breaker, R. R. (2003) Metabolite-binding RNA domains are present in the genes of eukaryotes. RNA, 9, 644-647. 22. Cooper, T. A., Wan, L., and Dreyfuss, G. (2009) RNA and disease. Cell, 136, 777-793. 23. Hammond, M. C., Wachter, A., and Breaker, R. R. (2009) A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs. Nat Struct Mol Biol, 16, 541-549. 24. Horton, R. M., Cai, Z. L., Ho, S. N., and Pease, L. R. (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques, 8, 528-535. 25. Hofgen, R. and Willmitzer, L. (1990) Biochemical and Genetic-Analysis of Different Patatin Isoforms Expressed in Various Organs of Potato (Solanum-Tuberosum). Plant Sci, 66, 221-230. 26. Fu, Y., Bannach, O., Chen, H., Teune, J. H., Schmitz, A., Steger, G., Xiong, L., and Barbazuk, W. B. (2009) Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA. Genome Res, 19, 913-921. 27. Yoine, M., Ohto, M. A., Onai, K., Mita, S., and Nakamura, K. (2006) The lbal mutation of UPF1 RNA helicase involved in nonsense-mediated mRNA decay causes pleiotropic phenotypic changes and altered sugar signalling in Arabidopsis. Plant J, 47, 49-62. 28. Schwartz, S. H., Silva, J., Burstein, D., Pupko, T., Eyras, E., and Ast, G. (2008) Large-scale comparative analysis of splicing signals and their corresponding splicing factors in eukaryotes. Genome Res, 18, 88-103. 29. Maquat, L. E., Tarn, W. Y., and Isken, O. (2010) The pioneer round of translation: features and functions. Cell 142, 368-374. 30. Burge, C. B., Tuschl, T., Sharp, P. A. (1999) Splicing of precursors to mRNAs by the spliceosomes. The RNA World, ed Gesteland, R. F., Cech, T. R., Atkins, J. F. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor), 2nd Ed, pp 525-560. 31. Schuler, M. A. (2008) Splice site requirements and switches in plants. Curr Top Microbiol, 326, 39-59. 32. Egoavil, C., Marton, H. A., Baynton, C. E., McCullough, A. J., and Schuler, M. A. (1997) Structural analysis of elements contributing to 5 splice site selection in plant pre-mRNA transcripts. Plant J, 12, 971-980. 33. Aoyama, T. and Chua, N. H. (1997) A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J, 11, 605-612. 34. Weigand, J. E. and Suess, B. (2007) Tetracycline aptamer-controlled regulation of pre-mRNA splicing in yeast. Nucleic acids research, 35, 4179-4185. 35. Gusti, V., Kim, D. S, and Gaur, R. K. (2008) Sequestering of the 3 splice site in a theophylline-responsive riboswitch allows ligand-dependent control of alternative splicing. Oligonucleotides, 18, 93-99. 36. Kearney, B. and Staskawicz, B. J. Widespread distribution and fitness contribution of Xanthomonas campestris avirulence gene avrBs2. Nature. 1990, 346(6282), 385-6. 37. Hickey, S. F., Sridhar, M., Westermann, A. J., Qin, Q., Vijayendra, P., Liou, G., and Hammond, M. C. Transgene regulation in plants by alternative splicing of a suicide exon. Nucleic Acids Res. 2012, 40(10), 4701-10. 38. Tai, T. H., Dahlbeck, D., Clark, E. T., Gajiwala, P., Pasion, R., Whalen, M. C., Stall, R. E., and Staskawicz, B. J. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc Natl Acad Sci USA. 1999, 96(24), 14153-14158.