Acetylcholine receptor-binding peptide

11472840 · 2022-10-18

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to an acetylcholine receptor-binding peptide and, more particularly, to novel peptides which exhibit a wrinkle amelioration effect by binding the peptides to an acetylcholine receptor on which acetylcholine acts, thereby blocking secretion of acetylcholine. Peptides according to the present disclosure suppress secretion of acetylcholine by having a high binding strength with the acetylcholine receptor, thereby strongly binding the peptides to acetylcholine. Therefore, a cosmetic composition and a pharmaceutical composition comprising the peptides according to the present disclosure as an active ingredient exhibit an excellent wrinkle ameliorating effect.

Claims

1. An acetylcholine receptor-binding peptide consisting of an amino acid sequence represented by one selected from the group consisting of SEQ ID NO: 12 to SEQ ID NO: 22.

2. A cosmetic composition for wrinkle amelioration comprising the peptide of claim 1 as an active ingredient.

3. A pharmaceutical composition for wrinkle amelioration comprising the peptide of claim 1 as an active ingredient.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is results of preparing random peptide DNA libraries according to an embodiment of the present disclosure.

(2) FIG. 2 is results of checking if specificity for an acetylcholine receptor has been increased in a biopanning step according to an embodiment of the present disclosure.

(3) FIG. 3 illustrates ELISA results for the acetylcholine receptor compared to streptavidin, i.e., a negative control group of a recombinant phage recovered in the biopanning step according to an embodiment of the present disclosure.

(4) FIG. 4 is multiple alignment results of peptides selected by sequencing of a recombinant phage having 1.5 time or more of a signal ratio of the acetylcholine receptor to streptavidin in the ELISA results according to an embodiment of the present disclosure.

(5) FIG. 5 is results of measuring binding ability values of the selected peptides and Synake and Vialox which are a positive control group according to an embodiment of the present disclosure.

(6) FIG. 6 is results of measuring binding ability values of Synake which is a positive control group according to an embodiment of the present disclosure.

(7) FIG. 7 is results of measuring binding ability values of the selected peptides according to an embodiment of the present disclosure.

(8) FIG. 8 is results of comparing binding ability values of deleted peptides for optimization according to an embodiment of the present disclosure.

(9) FIG. 9 is results of measuring binding ability values of the deleted peptides according to an embodiment of the present disclosure.

(10) FIG. 10 is results of measuring affinity values of the deleted peptides according to an embodiment of the present disclosure.

DESCRIPTION OF EXEMPLARY EMBODIMENTS

(11) Hereinafter, the present disclosure will be described in more detail through Examples. It will be obvious to a person having ordinary skill in the art that these examples are illustrative purposes only and are not to be construed to limit the scope of the present disclosure.

Example 1. Preparing Random Peptide Phage Libraries

1-1. Preparing 4 Mer, 5 Mer and 6 Mer Random Peptides and Inserting the Prepared Random Peptides into Vector

(12) In order to prepare random peptide libraries (WTWKG(SEQ ID NO:32)(X).sub.n, X=random amino acids, DNA libraries 4mer (TTCTATGCGGCCCAGCTGGCCTGGACATGGAAGGGANNKNNKNNKNNKGC GGCCGCAGAAACTGTT (SEQ ID NO:34)), 5mer (TTCTATGCGGCCCAGCTGGCCTGGACATGGAAGGGANNKNNKNNKNKKNN KGCGGCCGCAGAAACTGTT (SEQ ID NO:35)), and 6mer (TTCTATGCGGCCCAGCTGGCCTGGACATGGAAGGGANNKNNKNNKNNKNK KNNKGCGGCCGCAGAAACTGTT (SEQ ID NO:36)) were synthesized (Bioneer, Daejeon, Korea).

(13) Double strand insert was amplified by using PCR as two single strand primers (TTCTATGCGGCCCAG(SEQ ID NO:37) and AACAGTTTCTGCGGC(SEQ ID NO:38)). Preparation results of random peptide DNA libraries are illustrated in FIG. 1.

(14) In order to insert the random peptide DNA libraries into a phagemid vector (pIGT), insert DNA amplified using the phagemid vector and PCR was treated with restriction enzymes.

(15) After reacting about 10 μg of the insert DNA with SfiI (New England Biolab (NEB)), Ipswich) and NotI (NEB, Ipswich) for 8 hours, a purified DNA was obtained by using a PCR purification kit. Further, after treating about 10 μg of the phagemid vector with SfiI and NotI for 8 hours and injecting CIAP (Calf Intestinal Alkaline Phosphate) (NEB, Ipswich) into the phagemid vector treated with SfiI and NotI to react CIAP with the phagemid vector treated with SfiI and NotI, a reaction product was purified by using the PCR purification kit. Purification results are illustrated in FIG. 1, and 1.8×10.sup.9 of 4 mer peptide library DNAs, 3.2×10.sup.8 of 5 mer peptide library DNAs and 5.9×10.sup.8 of 6 mer peptide library DNAs were respectively prepared.

(16) After connecting an insert DNA (3 μg) to a phagemid vector (10 μg) at 18° C. for 15 hours by using a T4 DNA ligase (Bioneer, Daejeon, Korea), the DNAs were dissolved in 100 custom character of a TE buffer by precipitating the phagemid vector connected to the T4 DNA ligase with ethanol.

1.2 Electroporation

(17) After dividing 100 custom character of a phagemid vector including the respective 4 mer, 5 mer and 6 mer random insert DNAs that had been prepared in the Example 1.1 into 25 phagemid vectors each having 4 custom character, an electroporation process was performed on the 25 phagemid vectors each having 4 custom character.

(18) More specifically, after melting a competent cell on ice, mixing 200 custom character of the competent cell with each of 4custom character of phagemid vector solutions including the insert DNAs, and injecting the mixed solutions into a 0.2 cm cuvette that had been cooled and prepared, the resulting materials were put on ice for 1 minute.

(19) After programming an electroporator (BioRAD, Hercules, Calif.) under conditions of 25 μF and 2.5 kV at 25Ω, removing water of the prepared cuvette, and positioning the cuvette in the electric perforator, a pulse was applied to the electroporator (time constant was 4.5 to 5 msec). Then, after immediately inserting the electroporated materials into a LB (Luria Bertani) liquid culture medium including 20 mM of glucose that had been prepared at 37° C. to obtain cells with the total amount of 25 ml, the obtained cells with the total amount of 25 ml were moved to 100 ml test tubes. After culturing the cells while mixing the cells by a speed of 200 rpm at 37° C. for one hour, dividing the cultured cells into 10 custom character of the cultured cells, and diluting 10 custom character of the divided cultured cells, 10custom character of the diluted cultured cells was spread on an ampicillin agar medium to measure the number of libraries. After injecting cells remained after performing the dividing process along with 20 mM of glucose and 50 μg/ml of ampicillin into 1 L of LB, the cells were cultured at 30° C. for one day. After centrifuging the culture solution to a speed of 4,000 rpm at 4° C. for 20 minutes to remove a supernatant except settled cells from the centrifuged culture solution, re-suspending the supernatant-removed centrifuged culture solution with 40 ml of LB, and injecting glycerol with a final concentration of 20% or more into the re-suspension, the glycerol-injected re-suspension was stored at −80° C.

1.3 Producing Recombinant Phages from Random Peptide Libraries

(20) Recombinant phages were produced from 4 mer, 5 mer and 6 mer random peptide libraries stored at −80° C. in Example 1.2.

(21) After adding 1 ml of the libraries that had been stored at −80° C. to 30 ml of an SB liquid culture medium, a culturing process was performed to obtain culture solutions by mixing the libraries with the SB liquid culture medium to a speed of 200 rpm at 37° C. for 20 minutes. After injecting a helper phage (1010 pfu) and ampicillin (final concentration of 50 μg/ml) into the culture solutions, and a culturing process was performed again under the same conditions for 1 hour. Recombinant phages were produced by moving the culture solutions to 30 ml of an SB liquid culture medium including ampicillin (50 μg/ml) and kanamycin (10 μg/ml) and culturing mixed solutioned of the culture solutions and the SB liquid culture medium under the same conditions for 16 hours or more. After centrifuging the produced recombinant phages to a speed of 5,000 rpm at 4° C. for 10 minutes to obtain supernatants, mixing PEG/NaCl with the supernatants at a volume ratio (v/v) of 5:1, leaving along the mixed solutions on ice for 1 hour, and centrifuging the mixed solutions to a speed of 13,000 rpm at 4° C. for 20 minutes to carefully remove the supernatants, pellets were resuspended in the supernatant-removed centrifuged solutions with 1 ml of PBS (phosphate buffered saline).

Example 2. Method of Screening Peptides to be Linked to an Acetylcholine Receptor

2.1 Biopanning of Acetylcholine Receptor

(22) After putting acetylcholine receptor (AchR) alpha 1 (10 μg/ml) into 8 wells of 96 well high binding plates in an amount as much as 50 custom character, leaving alone the acetylcholine receptor (AchR) alpha 1 put into the 8 wells at 4° C. overnight, washing the acetylcholine receptor (AchR) alpha 1 put into the 8 wells with 200 custom character of PBS once the next day, putting 200 custom character of 2% BSA (Bovine Serum Albumin) into the acetylcholine receptor (AchR) alpha 1 washed with PBS to obtain a mixture, blocking the mixture at room temperature for 2 hours, and removing all solution from the mixture, a resulting material was washed with 200 custom character of PBS three times.

(23) After mixing the washed resulting material with 400 custom character of a solution including the 4 mer, 5 mer and 6 mer random peptide recombinant phages each prepared in Example 1.3 and 400 custom character of 2% BSA to obtain a mixture, putting the mixture into 8 wells in an amount of 100 custom character per well, the mixture put into the wells was left alone at room temperature for 1 hour, removing all solution from the mixture in the 8 wells, washing the solution-removed mixture with 0.1% PBST (tween-20) three times, putting 0.2 M glycine (pH 2.2) into the washed mixture in an amount of 100 custom character per well to elute the phages for 10 minutes, and collecting the eluted phages in 800 custom character of an E-tube, 200 custom character of 1 M Tris (pH 9.0) was put into the eluted phages collected in the E-tube to obtain a neutralized material.

(24) In order to measure the number of input phages and the number of output phages per each of biopannings, after mixing the neutralized material with E. coli with OD=0.7, the mixture was spread on an agar culture medium including ampicillin. In order to repeatedly perform a panning process, after mixing 500 custom character of the output phages with 5 ml of E. coli to a rotation speed of 200 rpm at 4° C. for 30 minutes, and culturing the output phages mixed with E. coli to obtain a culture medium, a culturing process was performed in the same manner for 30 minutes by adding ampicillin (50 μg/ml) and helper phage (1×10.sup.10 pfu) to the culture medium. Then, after moving a culture solution to 50 ml of an SB culture medium including ampicillin (50 μg/ml) and kanamycin (10 μg/ml), the culturing process was performed in the same manner for 1 day to obtain a culture solution. After centrifuging the culture solution to a speed of 5,000 rpm at 4° C. for 10 minutes and adding PEG/NaCl [20% PEG(w/v) and 15% NaCl(w/v)] to a supernatant of the centrifuged culture solution at a ratio of 5:1, the mixed solution was settled on ice for 1 hour. After centrifuging the settled solution to a speed of 13,000 rpm at 4° C. for 20 minutes, completely removing a supernatant from the centrifuged solution, and suspending phage pellets with 1 ml of a PBS solution to obtain a suspension, the suspension was used in a second biopanning process. The same method was used in each panning step as described above, the washing processes were performed 3 times, 5 times, 7 times and 10 times respectively, and conditions at which the process of biopanning 6 mer libraries (S6) was performed over 5 times with respect to an acetylcholine receptor protein and results of the input phages and the output phages are shown in the following Table 1.

(25) TABLE-US-00005 TABLE 1 S6 Biopanning Conditions Name Input Output Output/Input AchR 10 μg/ml 1.sup.st S6 28 * 400 * 10.sup.6 = 1.12 * 10.sup.10 21 * 1000 * 10.sup.2 = 2.1 * 10.sup.6 18.75 * 10.sup.−5  Binding 30° C. Incubation 1 h PBST 0.1% Washing 3 times AchR 10 μg/ml 2.sup.nd S6 9 * 400 * 10.sup.6 = 3.6 * 10.sup.9 4 * 1000 * 10.sup.2 = 4 * 10.sup.5 11.1 * 10.sup.−5 Binding 30+ C. Incubation 1 h PBST 0.1% Washing 5 times AchR 10 μg/ml 3.sup.rd S6 128 * 400 * 10.sup.6 = 5.12 * 10.sup.10 20 * 1000 * 10.sup.2 = 2.0 * 10.sup.6  3.9 * 10.sup.−5 Binding 30° C. Incubation 1 h PBST 0.1% Washing 7 times AchR 10 μg/ml 4.sup.th S6 79 * 400 * 10.sup.6 = 3.16 * 10.sup.10 75 * 1000 * 10.sup.2 = 7.5 * 10.sup.6 23.7 * 10.sup.−5 Binding 30° C. Incubation 1 h PBST 0.1% Washing 10 times AchR 10 μg/ml 5.sup.th S6 104 * 400 * 10.sup.6 = 4.16 * 10.sup.10 82 * 1000 * 10.sup.2 =8.2 * 10.sup.6 19.7 * 10.sup.−5 Binding 30° C. Incubation 1 h PBST 0.1% Washing 10 times

2.2 ELISA of Input Phages of Acetylcholine Receptor (AchR)

(26) ELISA of respective input phages of the above-mentioned libraries was performed on streptavidin and acetylcholine receptor (AchR).

(27) After putting 10 μg/ml of the acetylcholine receptor into 96 well ELISA plates and putting streptavidins into 10 wells in an amount of 50 custom character per well, the acetylcholine receptor put into the 96 well ELISA plates and streptavidins put into the 10 wells were left alone at 4° C. for 1 day. Then, after washing all wells with 0.05% PBST three times, blocking the washed wells at room temperature for 2 hours by using 2% BSA diluted by PBS, and removing all of solution from a blocked material, the solution-removed material was washed with 0.05% PBST three times.

(28) After mixing 800 custom character of third (3.sup.rd S6), fourth (4.sup.th S6) and fifth (5.sup.th S6) input phages, i.e., recombinant phages in Table 1 with 200 custom character of 10% BSA to obtain mixtures and dividing 3 wells of the mixtures into acetylcholine receptor and streptavidin well in an amount of 100 custom character, the resulting materials were settled at 30° C. for 1 hour. After washing the settled materials with a 0.05% PBST solution three times and diluting HRP-conjugate anti-M13 antibody (GE Healthcare) to 1:1,000 to obtain a diluted solution, and the washed materials were reacted with the diluted solution at 30° C. for 1 hour. After washing reaction products with 0.05% PBST three times and dividing 100 custom character of a solution of tetramethylbenzidine (TMB) (BD Science), i.e., a substrate of peroxidase into the washed reaction products to induce a chromogenic reaction, the reaction was stopped by adding 100 custom character of 1M HCl to the chromogenic reaction-induced materials. Thereafter, absorbance values of the resulting materials were measured at 450 nm. Results of measuring the absorbance values are illustrated in FIG. 2.

2.3 Specific Phage Searching in Acetylcholine Receptor (Colony ELISA)

(29) After inoculating fourth (4.sup.th S6) and fifth (5.sup.th S6) output phages in Table 1 into E. coli, the fourth (4.sup.th S6) and fifth (5.sup.th S6) output phages inoculated into E. coli were spread to obtain about 100 to 200 plaques per plate. After inoculating 50 plaques into 1 ml of an SB-ampicillin (50 μg/ml) culture solution using a sterilized tip, performing a process of shake-culturing the plaque-inoculated culture solutions at 37° C. for 5 hours, and adding 30 custom character of a helper phage to the shake-cultured solutions, the mixed solutions were cultured to a speed of 200 rpm at 37° C. for 1 day to obtain culture solutions. After centrifuging the culture solutions to a speed of 12,000 rpm for 2 minutes to recover supernatants from the centrifuged culture solutions, and putting 2% BSA into the recovered supernatants, the supernatants having the 2% BSA put thereinto were used for searching the phages.

(30) After putting 5 μg/ml of the acetylcholine receptor into the 96 well ELISA plates and putting streptavidins into 50 wells in an amount of 50 custom character per well, the acetylcholine receptor put into the 96 well ELISA plates and streptavidins put into the 50 wells were left alone at 4° C. for 1 day. On the next day, after removing proteins of all wells, blocking the removed proteins at room temperature for 2 hours by using 2% BSA, and throwing away solutions from the blocked proteins, resulting materials were washed with 0.05% PBST. After dividing phage solutions amplified per each of clones into all wells in an amount of 100 custom character, the divided phage solutions were settled at 30° C. for 1 hour. After washing the settled materials with a 0.05% PBST solution three times, diluting HRP-conjugate anti-M13 antibody (GE Healthcare) to 1:2,000 to obtain a diluted solution, and dividing the washed materials into the diluted solution in an amount of 100 custom character, the washed materials were reacted with the diluted solution at 30° C. for 1 hour. After washing reaction products with 0.05% PBST three times and dividing 100 custom character of the TMB solution into the washed reaction products to induce a chromogenic reaction, the reaction was stopped by adding 100 custom character of 1M H.sub.2SO.sub.4 to the chromogenic reaction-induced materials. Thereafter, results are illustrated in FIG. 3.

(31) Referring to FIG. 3, sequencing was requested by purifying plasmids of phages having 1.5 time or more of an acetylcholine receptor signal compared to streptavidin (Bioneer, Deajon, Korea). GATTACGCCAAGCTTTGGAGC(SEQ ID NO:39) was used as a sequencing primer.

(32) Peptide sequences having specific binding abilities in the acetylcholine receptor through sequencing are shown FIG. 4 and the following Table 2.

(33) TABLE-US-00006 TABLE 2 Peptide sequences Duplication Name Sequences number S6_1 WTWKGKGTLNR 6/16 S6_2 WTWKGRKSLLR 1/16 S6_3 WTWKGEDKGKN 1/16 S6_4 WTWKGRDKLQM 1/16 S6_5 WTWKGQLGQLS 1/16 S6_6 WTWKGGRLSAS 1/16 S6_7 WTWKGRQLNNQ 1/16 S6_8 WTWKGDNLQNN 1/16 S6_9 WTWKGLYQRLG 1/16 S6_10 WTWKGNKQVKF 1/16 S6_11 WTWKGETYDSK 1/16

Example 3. Experiment of Comparing Acetylcholine Binding Forces of Discovered Peptides

(34) S6_1 (SEQ ID NO:23, WTWKGKGTLNR), S6_2 (SEQ ID NO: 2 4, WTWKGRKSLLR), S6_3 (SEQ ID NO: 25, WTWKGEDKGKN), S6_4 (SEQ ID NO: 26, WTWKGRDKLQM) showing sequence similarities through multiple alignments among the peptides in Table 2 were synthesized.

(35) A surface plasmon resonance (SPR) experiment was progressed using a biosensor chip to compare binding forces for the acetylcholine receptors thereof (Biacore 3000, Biacore AB, Uppsala, Sweden). After fixing selected acetylcholine receptor proteins to a CMS chip (Biacore) using EDC/NHS, association and dissociation were observed for up to 500 seconds. A binding force comparing experiment was carried out under observation conditions of a running buffer of 20 mM Tris (pH 7.4), a speed of 30 custom character/min, and a peptide concentration of 10 μM (S6_1, S6_2, S6_3, S6_4). Results of the binding force comparing experiment are shown in FIG. 5.

Example 4. Experiment of Comparing Binding Forces of Discovered Peptides S6_1 and a Positive Control Group

(36) A surface plasmon resonance (SPR) experiment was progressed using a biosensor chip to compare binding forces for acetylcholine receptors of S6_1 (SEQ ID NO: 23, WTWKGKGTLNR), i.e., discovered peptides and S6_1_C6 (SEQ ID NO: 31, KGTLNR), i.e., a deleted form, and Synake and Vialox, i.e., a positive control group (Biacore 3000, Biacore AB, Uppsala, Sweden).

(37) After fixing selected acetylcholine receptor proteins to a CMS chip (Biacore) using EDC/NHS, association and dissociation were observed for up to 500 seconds. A binding force comparing experiment was carried out under observation conditions of a running buffer of 20 mM Tris (pH 7.4), a speed of 30 custom character/min, and a peptide concentration of 10 μM (Synake, Vialox, S6_1, S6_1_C6). Results of the binding force comparing experiment are shown in FIG. 6.

Example 5. Measuring Affinity Values of S6_1 Peptides and Synake Peptides

(38) A surface plasmon resonance (SPR) experiment was progressed using a biosensor chip to check affinity values for acetylcholine receptors of S6_1 (SEQ ID NO: 23, WTWKGKGTLNR), i.e., discovered peptides and Synake, i.e., a positive control group (Biacore 3000, Biacore AB, Uppsala, Sweden). After fixing the acetylcholine receptors to a CMS chip (Biacore) using EDC/NHS, association and dissociation were observed for up to 500 seconds. A binding ability comparing experiment was carried out under observation conditions of a running buffer of 20 mM Tris (pH 7.4), a speed of 30 custom character/min, a concentration of 10 to 50 μM (Synake), and a concentration of 0.1 to 10 μM (peptides S6_1). Respective results of the binding ability comparing experiment are shown in FIG. 7 (Synake) and FIG. 8 (peptides S6_1).

Example 6. Experiment of Comparing Optimizations and Binding Forces of Peptides of S6_1

(39) S6_1_C10 (SEQ ID NO: 27, TWKGKGTLNR), S6_1_C9 (SEQ ID NO: 28, WKGKGTLNR), S6_1_C10 end (SEQ ID NO: 29, WTWKGKGTLN), and S6_1_C9 end (SEQ ID NO: 30, WTWKGKGTL), i.e., peptides which each have one amino acid and two amino acids respectively removed from N-terminal and C-terminal thereof were synthesized to optimize S6_1.

(40) A surface plasmon resonance (SPR) experiment was progressed using a biosensor chip to compare binding forces for acetylcholine receptors of these peptides (Biacore 3000, Biacore AB, Uppsala, Sweden).

(41) After fixing selected acetylcholine receptor proteins to a CMS chip (Biacore) using EDC/NHS, association and dissociation were observed for up to 500 seconds. An experiment of comparing optimizations and binding forces of the peptides was carried out under observation conditions of a running buffer of 20 mM Tris (pH 7.4), a speed of 30 custom character/min, and a peptide concentration of 10 μM (Synake, Vialox, S6_1, S6_1_C10, S6_1_C9, S6_1_C10 end, S6_1_C9 end, and S6_1_C6). Experiment results of comparing the optimizations and binding forces of the peptides are shown in FIG. 9.

Example 7. Measuring Affinity Values of S6_1_C9 Peptides

(42) A surface plasmon resonance (SPR) experiment was progressed using a biosensor chip to check affinity values for acetylcholine receptors of optimized S6_1_C9 peptides (SEQ ID NO: 28, WKGKGTLNR) prepared in Example 6 (Biacore 3000, Biacore AB, Uppsala, Sweden).

(43) After fixing selected acetylcholine receptor proteins to a CMS chip (Biacore) using EDC/NHS, association and dissociation were observed for up to 500 seconds. An experiment of measuring affinity values of the peptides was carried out under observation conditions of a running buffer of 20 mM Tris (pH 7.4), a speed of 30 custom character/min, and a concentration of 0.1 to 0.5 μM (peptides S6_1_C9).

(44) Experiment results of measuring the affinity values of the peptides are shown in FIG. 10. Referring to FIG. 10, it can be confirmed that the S6_1_C9 peptides (SEQ ID NO: 28, WKGKGTLNR) exhibit about 100 times higher binding abilities than Synake for acetylcholine.

(45) Peptides according to the present disclosure suppress secretion of acetylcholine by having a high binding strength with an acetylcholine receptor, thereby strongly binding the peptides to acetylcholine. Therefore, a cosmetic composition and a pharmaceutical composition comprising peptides according to the present disclosure as an active ingredient exhibit an excellent wrinkle ameliorating effect.

(46) Although the present disclosure has been described along with the accompanying drawings, this is only one of various examples including the gist of the present disclosure and has an object of enabling a person having ordinary skill in the art to easily practice the invention. Accordingly, it is evident that the present disclosure is not limited to the aforementioned examples. Accordingly, the range of protection of the present disclosure should be interpreted based on the following claims, and all of technological spirits within the equivalents of the present disclosure may fall within the range of right of the present disclosure by changes, substitutions and replacements without departing from the gist of the present disclosure. Furthermore, it is evident that the configurations of some drawings have been provided to more clearly describe configurations and have been more exaggerated or reduced than actual configurations.