INHIBITORS OF THE WNT SIGNALLING PATHWAYS

20170114070 · 2017-04-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to inhibitors of the Wnt signalling pathways of general formula (I) as described and defined herein, to methods of preparing said compounds, to intermediate compounds useful for preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds and to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease, in particular of a hyper-proliferative disorder, as a sole agent or in combination with other active ingredients.

    ##STR00001##

    Claims

    1. A compound of general formula (I): ##STR00197## in which: L.sup.A represents a methylene or ethylene group, said methylene or ethylene group being optionally substituted, one or more times, identically or differently, with a substituent selected from: hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-; or, when two substituents are present at the same carbon atom, the two substituents, together with the carbon atom they are attached to, may form a C.sub.3-C.sub.6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said ring is optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-; L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; R.sup.1 represents a group selected from: 5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, and N(R.sup.7)(C.sub.1-C.sub.6-alkyl); wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, and N(R.sup.7)(C.sub.1-C.sub.6-alkyl) group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-; R.sup.2 represents a group selected from: ##STR00198## wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; R.sup.3 represents a group selected from: ##STR00199## wherein * indicates the point of attachment to R.sup.2; wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sub.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; R.sup.4 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- group; R.sup.5 represents a hydrogen atom or a halogen atom or a group selected from: cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-; R.sup.6 represents a group selected from: C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; R.sup.9, R.sup.10, R.sup.11 represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; or R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group; or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    2. A compound according to claim 1, wherein L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5), ##STR00200## wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-.

    3. A compound according to claim 1 or 2, wherein R.sup.1 represents a group selected from: ##STR00201## wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl.

    4. A compound according to claim 1, 2 or 3, wherein R.sup.4 represents a hydrogen atom.

    5. A compound according to claim 1, 2, 3 or 4, wherein R.sup.5 represents a hydrogen atom.

    6. A compound according to claim 1, 2, 3, 4 or 5, wherein R.sup.6 represents a group selected from: C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, fluoro-C.sub.1-C.sub.6-alkyl-, fluoro-C.sub.1-C.sub.6-alkoxy-, phenyl-, 5- to 6-membered heteroaryl-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; said C.sub.1-C.sub.6-alkyl- or C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9.

    7. A compound according to claim 1, 2, 3, 4, 5 or 6, wherein L.sup.B represents *N(H)C(O)**; wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group.

    8. A compound according to claim 1, which is selected from the group consisting of: N-[6-(6-aminopyridin-3-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[6-(pyrimidin-5-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide, N-[6-(2-aminopyrimidin-5-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[6-(pyridin-3-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide, 3-({[4-(2,2-difluoroethyl)piperazin-1-yl]acetyl}amino)-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide, N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-5-phenylpyrazine-2-carboxamide, 3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide, 3-{[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-ylacetyl]amino}-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide, N-[6-(2-fluoropyridin-3-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[6-(2-aminopyrimidin-5-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[6-(pyridin-3-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[6-(pyrimidin-5-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide, N-[6-(6-aminopyridin-3-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[6-(2-fluoropyridin-3-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(6-phenyl-1,2,4-triazin-3-yl)-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrimidin-2-yl)-4-(trifluoromethoxy)benzamide, 3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide, 4-(cyclopropyloxy)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrazin-2-yl)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, N-[5-(6-aminopyridin-3-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(2-fluorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyrimidin-5-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyrimidin-5-yl)pyrazin-2-yl]benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-4-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, N-[5-(2-fluoro-6-methylphenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(4-methylpyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, N-[5-(3,5-difluorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(3-methylphenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(2-chlorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrimidin-2-yl)benzamide, N-[5-(3-chlorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(2-fluoropyridin-3-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide hydrochloride, N-[5-(2-aminopyrimidin-5-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrazin-2-yl)benzamide, N-[5-(2-methylphenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-2-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, N-[5-(2-fluorophenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(2-methylphenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(3,5-difluorophenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(2-chlorophenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-[5-(4-methylpyridin-3-yl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(6-aminopyridin-3-yl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(3-methylphenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(3-chlorophenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyrimidin-5-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyridin-2-yl)pyrazin-2-yl]benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyridin-4-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, N-(2,2-bipyrazin-5-yl)-4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzamide, N-[5-(2-aminopyrimidin-5-yl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-(2,2-bipyrazin-5-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide N-[5-(2-aminopyridin-4-yl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(2-aminopyridin-4-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-(2,2-bipyrazin-5-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide N-[5-(2-fluoro-6-methylphenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, N-[5-(3-fluorophenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, N-(5-amino-2,2-bipyrazin-5-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, 3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyridin-2-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide, 3-{[(1-imino-1-oxido-1lambda4,4-thiazinan-4-yl)acetyl]amino}-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide, and N-[5-(3-fluorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    9. A compound of general formula (I), or a stereoisomer, a tautomer, an N oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 8, for use in the treatment or prophylaxis of a disease.

    10. A pharmaceutical composition comprising a compound of general formula (I), or a stereoisomer, a tautomer, an N oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 8, and a pharmaceutically acceptable diluent or carrier.

    11. A pharmaceutical combination comprising: one or more first active ingredients selected from a compound of general formula (I) according to any of claims 1 to 8, and one or more second active ingredients selected from chemotherapeutic anti cancer agents.

    12. Use of a compound of general formula (I), or a stereoisomer, a tautomer, an N oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 8, for the prophylaxis or treatment of a disease.

    13. Use of a compound of general formula (I), or a stereoisomer, a tautomer, an N oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, according to any one of claims 1 to 8, for the preparation of a medicament for the prophylaxis or treatment of a disease.

    14. Use according to claim 9, 12 or 13, wherein said disease is a disease in which aberrant Wnt signalling is implicated in a patient.

    15. Use according to claim 9, 12, 13 or 14, wherein the disease is a genetic disease caused by mutations in Wnt signaling components, wherein the genetic disease is chosen from: polyposis coli, osteoporosispseudoglioma syndrome, familial exudative vitreoretinopathy, retinal angiogenesis, early coronary disease, tetra-amelia syndrome, Mllerian-duct regression and virilization, SERKAL syndrome, diabetes mellitus type 2, Fuhrmann syndrome, Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome, odonto-onycho-dermal dysplasia, obesity, splithand/foot malformation, caudal duplication syndrome, tooth agenesis, Wilms tumor, skeletal dysplasia, focal dermal hypoplasia, autosomal recessive anonychia, neural tube defects, alpha-thalassemia (ATRX) syndrome, fragile X syndrome, ICF syndrome, Angelman syndrome, Prader-Willi syndrome, Beckwith-Wiedemarm Syndrome and Rett syndrome.

    16. Use according to claim 9, 12, 13 or 14, wherein the disease is a disease of uncontrolled cell growth, proliferation and/or survival, an inappropriate cellular immune response, or an inappropriate cellular inflammatory response, particularly in which the uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune response, or inappropriate cellular inflammatory response is mediated by the Wnt pathway, more particularly in which the disease of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune response, or inappropriate cellular inflammatory response is a haematological tumour, a solid tumour and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.

    17. Use of an intermediate compound of general formula (VI): ##STR00202## in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XI): ##STR00203## in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XIa): ##STR00204## in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XVII): ##STR00205## in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XXII): ##STR00206## in which L.sup.A, R, R.sup.5 and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XXIV): ##STR00207## in which R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or an intermediate compound of general formula (XXV): ##STR00208## in which L.sup.A, R.sup.1, R.sup.2, R.sup.5 and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, and X represents a group enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof, for the preparation of a compound according to any one of claims 1 to 8.

    18. An intermediate compound of general formula (VI): ##STR00209## in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or of general formula (XVII): ##STR00210## in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or of general formula (XXIV): ##STR00211## in which R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, or of general formula (XXV): ##STR00212## in which L.sup.A, R.sup.1, R.sup.2, R.sup.5 and R.sup.6 are as defined for general formula (I) in any one of claims 1 to 8, and X represents a group enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof.

    Description

    DETAILED DESCRIPTION

    [0061] The terms as mentioned in the present text have preferably the following meanings:

    [0062] The term halogen atom or halo- is to be understood as meaning a fluorine, chlorine, bromine or iodine atom.

    [0063] The term C.sub.1-C.sub.6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, e.g. a methyl, ethyl, propyl, butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl, iso-pentyl, 2-methylbutyl, 1-methyl butyl, 1-ethyl propyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-dimethylpropyl, 4-methyl pentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpentyl, 2-ethyl butyl, 1-ethyl butyl, 3,3-dimethyl butyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 2,3-dimethylbutyl, 1,3-dimethylbutyl, or 1,2-dimethylbutyl group, or an isomer thereof. Particularly, said group has 1, 2, 3 or 4 carbon atoms (C.sub.1-C.sub.4-alkyl), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl group, more particularly 1, 2 or 3 carbon atoms (C.sub.1-C.sub.3-alkyl), e.g. a methyl, ethyl, n-propyl- or iso-propyl group.

    [0064] The term halo-C.sub.1-C.sub.6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term C.sub.1-C.sub.6-alkyl is defined supra, and in which one or more of the hydrogen atoms is replaced, identically or differently, by a halogen atom.

    [0065] Particularly, said halogen atom is F. Said halo-C.sub.1-C.sub.6-alkyl group is, for example, CF.sub.3, CHF.sub.2, CH.sub.2F, CF.sub.2CF.sub.3, or CH.sub.2CF.sub.3.

    [0066] The term C.sub.1-C.sub.6-alkoxy is to be understood as preferably meaning a linear or branched, saturated, monovalent group of formula O(C.sub.1-C.sub.6-alkyl), in which the term C.sub.1-C.sub.6-alkyl is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-butoxy, tert-butoxy, sec-butoxy, pentoxy, iso-pentoxy, or n-hexoxy group, or an isomer thereof.

    [0067] The term halo-C.sub.1-C.sub.6-alkoxy is to be understood as preferably meaning a linear or branched, saturated, monovalent C.sub.1-C.sub.6-alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said halo-C.sub.1-C.sub.6-alkoxy group is, for example, OCF.sub.3, OCHF.sub.2, OCH.sub.2F, OCF.sub.2CF.sub.3, or OCH.sub.2CF.sub.3.

    [0068] The term C.sub.1-C.sub.6-alkoxy-C.sub.1-C.sub.6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent C.sub.1-C.sub.6-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, identically or differently, by a C.sub.1-C.sub.6-alkoxy group, as defined supra, e.g. methoxyalkyl, ethoxyalkyl, propyloxyalkyl, iso-propoxyalkyl, butoxyalkyl, iso-butoxyalkyl, tert-butoxyalkyl, sec-butoxyalkyl, pentyloxyalkyl, iso-pentyloxyalkyl, hexyloxyalkyl group, or an isomer thereof.

    [0069] The term halo-C.sub.1-C.sub.6-alkoxy-C.sub.1-C.sub.6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent C.sub.1-C.sub.6-alkoxy-C.sub.1-C.sub.6-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said halo-C.sub.1-C.sub.6-alkoxy-C.sub.1-C.sub.6-alkyl group is, for example, CH.sub.2CH.sub.2OCF.sub.3, CH.sub.2CH.sub.2OCHF.sub.2, CH.sub.2CH.sub.2OCH.sub.2F, CH.sub.2CH.sub.2OCF.sub.2CF.sub.3, or CH.sub.2CH.sub.2OCH.sub.2CF.sub.3.

    [0070] The term C.sub.1-C.sub.6-alkoxy-C.sub.2-C.sub.6-alkoxy is to be understood as preferably meaning a saturated, monovalent C.sub.2-C.sub.6-alkoxy group, as defined supra, in which one of the hydrogen atoms is replaced by a C.sub.1-C.sub.6-alkoxy group, as defined supra, e.g. methoxyalkoxy, ethoxyalkoxy, pentoxyalkoxy, hexoxyalkoxy group or methoxyethoxy, ethoxyethoxy, iso-propoxyhexoxy group, in which the term alkoxy is defined supra, or an isomer thereof.

    [0071] The term C.sub.2-C.sub.6-alkenyl is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group, which contains one or more double bonds, and which has 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (C.sub.2-C.sub.3-alkenyl), it being understood that in the case in which said alkenyl group contains more than one double bond, then said double bonds may be isolated from, or conjugated with, each other. Said alkenyl group is, for example, a vinyl, allyl, (E)-2-methylvinyl, (Z)-2-methylvinyl, homoallyl, (E)-but-2-enyl, (Z)-but-2-enyl, (E)-but-1-enyl, (Z)-but-1-enyl, pent-4-enyl, (E)-pent-3-enyl, (Z)-pent-3-enyl, (E)-pent-2-enyl, (Z)-pent-2-enyl, (E)-pent-1-enyl, (Z)-pent-1-enyl, hex-5-enyl, (E)-hex-4-enyl, (Z)-hex-4-enyl, (E)-hex-3-enyl, (Z)-hex-3-enyl, (E)-hex-2-enyl, (Z)-hex-2-enyl, (E)-hex-1-enyl, (Z)-hex-1-enyl, iso-propenyl, 2-methyl prop-2-enyl, 1-methyl prop-2-enyl, 2-methyl prop-1-enyl, (E)-1-methylprop-1-enyl, (Z)-1-methylprop-1-enyl, 3-methyl but-3-enyl, 2-methyl but-3-enyl, 1-methyl but-3-enyl, 3-methyl but-2-enyl, (E)-2-methyl but-2-enyl, (Z)-2-methyl but-2-enyl, (E)-1-methyl but-2-enyl, (Z)-1-methyl but-2-enyl, (E)-3-methyl but-1-enyl, (Z)-3-methyl but-1-enyl, (E)-2-methyl but-1-enyl, (Z)-2-methyl but-1-enyl, (E)-1-methyl but-1-enyl, (Z)-1-methyl but-1-enyl, 1,1-dimethylprop-2-enyl, 1-ethyl prop-1-enyl, 1-propylvinyl, 1-isopropylvinyl, 4-methyl pent-4-enyl, 3-methyl pent-4-enyl, 2-methyl pent-4-enyl, 1-methyl pent-4-enyl, 4-methyl pent-3-enyl, (E)-3-methyl pent-3-enyl, (Z)-3-methyl pent-3-enyl, (E)-2-methyl pent-3-enyl, (Z)-2-methyl pent-3-enyl, (E)-1-methyl pent-3-enyl, (Z)-1-methyl pent-3-enyl, (E)-4-methyl pent-2-enyl, (Z)-4-methyl pent-2-enyl, (E)-3-methyl pent-2-enyl, (Z)-3-methyl pent-2-enyl, (E)-2-methyl pent-2-enyl, (Z)-2-methyl pent-2-enyl, (E)-1-methyl pent-2-enyl, (Z)-1-methyl pent-2-enyl, (E)-4-methyl pent-1-enyl, (Z)-4-methyl pent-1-enyl, (E)-3-methyl pent-1-enyl, (Z)-3-methyl pent-1-enyl, (E)-2-methyl pent-1-enyl, (Z)-2-methyl pent-1-enyl, (E)-1-methyl pent-1-enyl, (Z)-1-methyl pent-1-enyl, 3-ethyl but-3-enyl, 2-ethyl but-3-enyl, 1-ethyl but-3-enyl, (E)-3-ethyl but-2-enyl, (Z)-3-ethyl but-2-enyl, (E)-2-ethyl but-2-enyl, (Z)-2-ethyl but-2-enyl, (E)-1-ethyl but-2-enyl, (Z)-1-ethyl but-2-enyl, (E)-3-ethyl but-1-enyl, (Z)-3-ethyl but-1-enyl, 2-ethyl but-1-enyl, (E)-1-ethyl but-1-enyl, (Z)-1-ethyl but-1-enyl, 2-propyl prop-2-enyl, 1-propyl prop-2-enyl, 2-isopropyl prop-2-enyl, 1-isopropyl prop-2-enyl, (E)-2-propyl prop-1-enyl, (Z)-2-propyl prop-1-enyl, (E)-1-propyl prop-1-enyl, (Z)-1-propyl prop-1-enyl, (E)-2-isopropyl prop-1-enyl, (Z)-2-isopropylprop-1-enyl, (E)-1-isopropylprop-1-enyl, (Z)-1-isopropyl prop-1-enyl, (E)-3,3-dimethylprop-1-enyl, (Z)-3,3-dimethyl prop-1-enyl, 1-(1,1-dimethylethyl)ethenyl, buta-1,3-dienyl, penta-1,4-dienyl, hexa-1,5-dienyl, or methylhexadienyl group. Particularly, said group is vinyl or allyl.

    [0072] The term C.sub.2-C.sub.6-alkynyl is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group which contains one or more triple bonds, and which contains 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (C.sub.2-C.sub.3-alkynyl). Said C.sub.2-C.sub.6-alkynyl group is, for example, ethynyl, prop-1-ynyl, prop-2-ynyl, but-1-ynyl, but-2-ynyl, but-3-ynyl, pent-1-ynyl, pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1-ynyl, hex-2-ynyl, hex-3-ynyl, hex-4-ynyl, hex-5-ynyl, 1-methyl prop-2-ynyl, 2-methyl but-3-ynyl, 1-methyl but-3-ynyl, 1-methyl but-2-ynyl, 3-methyl but-1-ynyl, 1-ethyl prop-2-ynyl, 3-methylpent-4-ynyl, 2-methyl pent-4-ynyl, 1-methyl-pent-4-ynyl, 2-methyl pent-3-ynyl, 1-methylpent-3-ynyl, 4-methyl pent-2-ynyl, 1-methylpent-2-ynyl, 4-methyl pent-1-ynyl, 3-methyl pent-1-ynyl, 2-ethyl but-3-ynyl, 1-ethyl but-3-ynyl, 1-ethyl but-2-ynyl, 1-propyl prop-2-ynyl, 1-isopropyl prop-2-ynyl, 2,2-dimethyl but-3-ynyl, 1,1-dimethyl but-3-ynyl, 1,1-dimethylbut-2-ynyl, or 3,3-dimethylbut-1-ynyl group. Particularly, said alkynyl group is ethynyl, prop-1-ynyl, or prop-2-ynyl.

    [0073] The term C.sub.3-C.sub.7-cycloalkyl is to be understood as meaning a saturated, monovalent, monocyclic hydrocarbon ring which contains 3, 4, 5, 6 or 7 carbon atoms. Said C.sub.3-C.sub.7-cycloalkyl group is for example a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl ring. Particularly, said ring contains 3, 4, 5 or 6 carbon atoms (C.sub.3-C.sub.6-cycloalkyl).

    [0074] The term C.sub.4-C.sub.8-cycloalkenyl is to be understood as preferably meaning a monovalent, monocyclic hydrocarbon ring which contains 4, 5, 6, 7 or 8 carbon atoms and one or two double bonds, in conjugation or not, as the size of said cycloalkenyl ring allows. Particularly, said ring contains 4, 5 or 6 carbon atoms (C.sub.4-C.sub.6-cycloalkenyl). Said C.sub.4-C.sub.8-cycloalkenyl group is for example a cyclobutenyl, cyclopentenyl, or cyclohexenyl group.

    [0075] The term C.sub.3-C.sub.6-cycloalkoxy is to be understood as meaning a saturated, monovalent, monocyclic group of formula O(C.sub.3-C.sub.6-cycloalkyl), in which the term C.sub.3-C.sub.6-cycloalkyl is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy group.

    [0076] The term 3- to 10-membered heterocycloalkyl, is to be understood as meaning a saturated, monovalent, mono- or bicyclic hydrocarbon ring which contains 2, 3, 4, 5, 6, 7, 8 or 9 carbon atoms, and one or more heteroatom-containing groups selected from C(O), O, S, S(O), S(O).sub.2, NH; it being possible for said heterocycloalkyl group to be attached to the rest of the molecule via any one of the carbon atoms or, if present, a nitrogen atom.

    [0077] Particularly, said 3- to 10-membered heterocycloalkyl can contain 2, 3, 4, 5 or 6 carbon atoms, and one or more of the above-mentioned heteroatom-containing groups (a 3- to 7-membered heterocycloalkyl), more particularly said heterocycloalkyl can contain 4, 5 or 6 carbon atoms, and one or more of the above-mentioned heteroatom-containing groups (a 4- to 6-membered heterocycloalkyl).

    [0078] Particularly, without being limited thereto, said heterocycloalkyl can be a 4-membered ring, such as an azetidinyl, oxetanyl, or a 5-membered ring, such as tetrahydrofuranyl, dioxolinyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, pyrrolinyl, or a 6-membered ring, such as tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or trithianyl, or a 7-membered ring, such as a diazepanyl ring, for example.

    [0079] The term 4- to 10-membered heterocycloalkenyl, is to be understood as meaning an unsaturated, monovalent, mono- or bicyclic hydrocarbon ring which contains 3, 4, 5, 6, 7, 8 or 9 carbon atoms, and one or more heteroatom-containing groups selected from C(O), O, S, S(O), S(O).sub.2, NH; it being possible for said heterocycloalkenyl group to be attached to the rest of the molecule via any one of the carbon atoms or, if present, a nitrogen atom. Examples of said heterocycloalkenyl may contain one or more double bonds, e.g. 4H-pyranyl, 2H-pyranyl, 2,5-dihydro-1H-pyrrolyl, [1,3]dioxolyl, 4H-[1,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-dihydrofuranyl, 2,5-dihydrothiophenyl, 2,3-dihydrothiophenyl, 4,5-dihydrooxazolyl, or 4H-[1,4]thiazinyl group.

    [0080] The term aryl is to be understood as preferably meaning a monovalent, aromatic or partially aromatic, mono-, or bi- or tricyclic hydrocarbon ring having 6, 7, 8, 9, 10, 11, 12, 13 or 14 carbon atoms (a C.sub.6-C.sub.14-aryl group), particularly a ring having 6 carbon atoms (a C.sub.6-aryl group), e.g. a phenyl group; or a ring having 9 carbon atoms (a C.sub.9-aryl group), e.g. an indanyl or indenyl group, or a ring having 10 carbon atoms (a C.sub.10-aryl group), e.g. a tetralinyl, dihydronaphthyl, or naphthyl group, or a biphenyl group (a C.sub.12-aryl group), or a ring having 13 carbon atoms, (a C.sub.13-aryl group), e.g. a fluorenyl group, or a ring having 14 carbon atoms, (a C.sub.14-aryl group), e.g. an anthracenyl group. Preferably, the aryl group is a phenyl group.

    [0081] The term heteroaryl is understood as preferably meaning a monovalent, monocyclic-, bicyclic- or tricyclic aromatic ring system having 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 ring atoms (a 5- to 14-membered heteroaryl group), particularly 5 or 6 or 9 or 10 atoms, and which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen or sulfur, and in addition in each case can be benzocondensed. Particularly, heteroaryl is selected from thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl, thia-4H-pyrazolyl etc., and benzo derivatives thereof, such as, for example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, benzotriazolyl, indazolyl, indolyl, isoindolyl, etc.; or pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc., and benzo derivatives thereof, such as, for example, quinolinyl, quinazolinyl, isoquinolinyl, etc.; or azocinyl, indolizinyl, purinyl, etc., and benzo derivatives thereof; or cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, naphthpyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, xanthenyl, or oxepinyl, etc.

    [0082] In general, and unless otherwise mentioned, the heteroarylic or heteroarylenic radicals include all the possible isomeric forms thereof, e.g. the positional isomers thereof. Thus, for some illustrative non-restricting example, the term pyridyl includes pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl; or the term thienyl includes thien-2-yl and thien-3-yl. Preferably, the heteroaryl group is a pyridinyl group.

    [0083] The term C.sub.1-C.sub.6, as used throughout this text, e.g. in the context of the definition of C.sub.1-C.sub.6-alkyl, C.sub.1-C.sub.6-haloalkyl, C.sub.1-C.sub.6-alkoxy, or C.sub.1-C.sub.6-haloalkoxy is to be understood as meaning an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1, 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term C.sub.1-C.sub.6 is to be interpreted as any sub-range comprised therein, e.g. C.sub.1-C.sub.6, C.sub.2-C.sub.5, C.sub.3-C.sub.4, C.sub.1-C.sub.2, C.sub.1-C.sub.3, C.sub.1-C.sub.4, C.sub.1-C.sub.5, C.sub.1-C.sub.6, particularly C.sub.1-C.sub.2, C.sub.1-C.sub.3, C.sub.1-C.sub.4, C.sub.1-C.sub.5, C.sub.1-C.sub.6; more particularly C.sub.1-C.sub.4; in the case of C.sub.1-C.sub.6-haloalkyl or C.sub.1-C.sub.6-haloalkoxy even more particularly C.sub.1-C.sub.2.

    [0084] Similarly, as used herein, the term C.sub.2-C.sub.6, as used throughout this text, e.g. in the context of the definitions of C.sub.2-C.sub.6-alkenyl and C.sub.2-C.sub.6-alkynyl, is to be understood as meaning an alkenyl group or an alkynyl group having a finite number of carbon atoms of 2 to 6, i.e. 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term C.sub.2-C.sub.6 is to be interpreted as any sub-range comprised therein, e.g. C.sub.2-C.sub.6, C.sub.3-C.sub.5, C.sub.3-C.sub.4, C.sub.2-C.sub.3, C.sub.2-C.sub.4, C.sub.2-C.sub.6, particularly C.sub.2-C.sub.3.

    [0085] Further, as used herein, the term C.sub.3-C.sub.7, as used throughout this text, e.g. in the context of the definition of C.sub.3-C.sub.7-cycloalkyl, is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 7, i.e. 3, 4, 5, 6 or 7 carbon atoms. It is to be understood further that said term C.sub.3-C.sub.7 is to be interpreted as any sub-range comprised therein, e.g. C.sub.3-C.sub.6, C.sub.4-C.sub.5, C.sub.3-C.sub.5, C.sub.3-C.sub.4, C.sub.4-C.sub.6, C.sub.5-C.sub.7; particularly C.sub.3-C.sub.6.

    [0086] The term substituted means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.

    [0087] The term optionally substituted means that the number of substituents can be zero. Unless otherwise indicated, optionally substituted groups may be substituted with as many optional substituents as can be accommodated by replacing a hydrogen atom with a non-hydrogen substituent on any available carbon or nitrogen atom. Commonly, the number of optional substituents (when present) ranges from 1 to 3.

    [0088] Ring system substituent means a substituent attached to an aromatic or nonaromatic ring system which, for example, replaces an available hydrogen on the ring system.

    [0089] As used herein, the term one or more times, e.g. in the definition of the substituents of the compounds of the general formulae of the present invention, is understood as meaning one, two, three, four or five times, particularly one, two, three or four times, more particularly one, two or three times, even more particularly one or two times.

    [0090] As used herein, the term leaving group refers to an atom or a group of atoms that is displaced in a chemical reaction as stable species taking with it the bonding electrons. Preferably, a leaving group is selected from the group comprising: halo, in particular chloro, bromo or iodo, methanesulfonyloxy, p-toluenesulfonyloxy, trifluoromethanesulfonyloxy, nonafluorobutanesulfonyloxy, (4-bromo-benzene)sulfonyloxy, (4-nitro-benzene)sulfonyloxy, (2-nitro-benzene)-sulfonyloxy, (4-isopropyl-benzene)sulfonyloxy, (2,4,6-tri-isopropyl-benzene)-sulfonyloxy, (2,4,6-trimethyl-benzene)sulfonyloxy, (4-tertbutyl-benzene)sulfonyloxy, benzenesulfonyloxy, and (4-methoxy-benzene)sulfonyloxy.

    [0091] Where the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like, is used herein, this is taken to mean also a single compound, salt, polymorph, isomer, hydrate, solvate or the like.

    [0092] The compounds of this invention contain one or more asymmetric centres, depending upon the location and nature of the various substituents desired. Asymmetric carbon atoms may be present in the (R) or (S) configuration. In certain instances, asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.

    [0093] Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations are included within the scope of the present invention.

    [0094] Preferred compounds are those which produce the more desirable biological activity. Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention. The purification and the separation of such materials can be accomplished by standard techniques known in the art.

    [0095] The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers. Examples of appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid. Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation. The optically active bases or acids are then liberated from the separated diastereomeric salts. A different process for separation of optical isomers involves the use of chiral chromatography (e.g., chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers. Suitable chiral HPLC columns are manufactured by Diacel, e.g., Chiracel OD and Chiracel OJ among many others, all routinely selectable. Enzymatic separations, with or without derivatisation, are also useful. The optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.

    [0096] In order to limit different types of isomers from each other reference is made to IUPAC Rules Section E (Pure Appl Chem 45, 11-30, 1976).

    [0097] The invention also includes all suitable isotopic variations of a compound of the invention. An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature. Examples of isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as .sup.2H (deuterium), .sup.3H (tritium), .sup.11C, .sup.13C, .sup.14C, .sup.15N, .sup.17O, .sup.18O, .sup.32P, .sup.33P, .sup.33S, .sup.34S, .sup.35S, .sup.36S, .sup.18F, .sup.36Cl, .sup.82Br, .sup.123I, .sup.124I, .sup.129I and .sup.131I respectively. Certain isotopic variations of a compound of the invention, for example, those in which one or more radioactive isotopes such as .sup.3H or .sup.14C are incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated and carbon-14, i.e., .sup.14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents.

    [0098] The present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, in any ratio. Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention may be achieved by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.

    [0099] Further, the compounds of the present invention may exist as tautomers. For example, any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, or a triazole moiety for example can exist as a 1H tautomer, a 2H tautomer, or a 4H tautomer, or even a mixture in any amount of said 1H, 2H and 4H tautomers, viz.:

    ##STR00005##

    [0100] The present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.

    [0101] Further, the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised. The present invention includes all such possible N-oxides.

    [0102] The present invention also relates to useful forms of the compounds as disclosed herein, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and co-precipitates.

    [0103] The compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example as structural element of the crystal lattice of the compounds. The amount of polar solvents, in particular water, may exist in a stoichiometric or non-stoichiometric ratio. In the case of stoichiometric solvates, e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri-, tetra-, penta- etc. solvates or hydrates, respectively, are possible. The present invention includes all such hydrates or solvates.

    [0104] Further, the compounds of the present invention can exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or can exist in the form of a salt. Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, customarily used in pharmacy.

    [0105] The present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.

    [0106] Furthermore, the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorphs, or as a mixture of more than one polymorphs, in any ratio.

    [0107] In accordance with a first aspect, the present invention covers compounds of general formula (I):

    ##STR00006##

    in which: [0108] L.sup.A represents a methylene or ethylene group, said methylene or ethylene group being optionally substituted, one or more times, identically or differently, with a substituent selected from: [0109] hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-; [0110] or, when two substituents are present at the same carbon atom, the two substituents, together with the carbon atom they are attached to, may form a C.sub.3-C.sub.6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said ring is optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-; [0111] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0112] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0113] R.sup.1 represents a group selected from: [0114] 5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, and N(R.sup.7)(C.sub.1-C.sub.6-alkyl); [0115] wherein said 5- to 8-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, and N(R.sup.7)(C.sub.1-C.sub.6-alkyl) group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-; [0116] R.sup.2 represents a group selected from:

    ##STR00007## [0117] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0118] R.sup.3 represents a group selected from:

    ##STR00008## [0119] wherein * indicates the point of attachment to R.sup.2; [0120] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0121] R.sup.4 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- group; [0122] R.sup.5 represents a hydrogen atom or a halogen atom or a group selected from: [0123] cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-; [0124] R.sup.6 represents a group selected from: [0125] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0126] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, [0127] heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0128] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0129] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0130] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, [0131] aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0132] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0133] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0134] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0135] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0136] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0137] R.sup.9, R.sup.10, R.sup.11 [0138] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0139] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0140] In an embodiment, the present invention relates to compounds of the general formula (I), supra, in which L.sup.A represents a methylene group, said methylene group being optionally substituted, one or more times, identically or differently, with a substituent selected from:

    hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-;
    or, when two substituents are present at the same carbon atom, the two substituents, together with the carbon atom they are attached to, may form a C.sub.3-C.sub.6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said ring is optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-.

    [0141] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which L.sup.A represents a methylene group, said methylene group being optionally substituted, one or more times, identically or differently, with a substituent selected from:

    hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkyl-;
    or, when two substituents are present at the same carbon atom, the two substituents, together with the carbon atom they are attached to, may form a C.sub.3-C.sub.6-cycloalkyl- or 3- to 6-membered heterocycloalkyl- ring; wherein said ring is optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-.

    [0142] In a preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents a methylene group, said methylene group being optionally substituted one or two times, identically or differently, with C.sub.1-C.sub.3-alkyl-, wherein, if said methylene is substituted with two C.sub.1-C.sub.3-alkyl- groups, these may, together with the carbon atom they are attached to, form a C.sub.3-C.sub.6-cycloalkyl- ring.

    [0143] In a particularly preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00009##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-.

    [0144] In another particularly preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2 or

    ##STR00010##

    [0145] In another particularly preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents CH.sub.2.

    [0146] In another particularly preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents CH(CH.sub.3).

    [0147] In another particularly preferred embodiment, the present invention relates to compounds of general formula (I), supra, in which L.sup.A represents

    ##STR00011##

    [0148] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which L.sup.B represents *N(H)C(O)**; wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group.

    [0149] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which L.sup.B represents *C(O)N(H)**; wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group.

    [0150] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.1 represents a group selected from:

    ##STR00012##

    wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl.

    [0151] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.1 represents a group selected from:

    ##STR00013##

    wherein * indicates the point of attachment to L.sup.A.

    [0152] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.2 represents

    ##STR00014##

    wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B.

    [0153] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.2 represents

    ##STR00015##

    wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B.

    [0154] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.2 represents

    ##STR00016##

    wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B.

    [0155] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.2 represents

    ##STR00017##

    wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B.

    [0156] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.3 represents

    ##STR00018##

    wherein * indicates the point of attachment to R.sup.2; and wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-.

    [0157] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.3 represents

    ##STR00019##

    wherein * indicates the point of attachment to R.sup.2; and wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-,
    halo-C.sub.1-C.sub.3-alkoxy-.

    [0158] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.3 represents

    ##STR00020##

    wherein * indicates the point of attachment to R.sup.2; and wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-,
    halo-C.sub.1-C.sub.3-alkoxy-.

    [0159] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.4 represents a hydrogen atom.

    [0160] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.5 represents a hydrogen atom.

    [0161] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2;
    said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-,
    3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9.

    [0162] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, C.sub.1-C.sub.6-alkoxy-, halo-, hydroxy-, halo-C.sub.1-C.sub.6-alkyl-, halo-C.sub.1-C.sub.6-alkoxy-, cyano-, -aryl, -heteroaryl, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10);
    said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl- or C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-,
    3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, S(O)(NR.sup.10)R.sup.9, S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9.

    [0163] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, halo-, hydroxy-, fluoro-C.sub.1-C.sub.6-alkyl-, fluoro-C.sub.1-C.sub.6-alkoxy-, phenyl-, 5- to 6-membered heteroaryl-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10);
    said C.sub.1-C.sub.6-alkyl- or C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from:
    C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9.

    [0164] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, fluoro-C.sub.1-C.sub.6-alkyl-, fluoro-C.sub.1-C.sub.6-alkoxy-, phenyl-, 5- to 6-membered heteroaryl-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2;
    said C.sub.1-C.sub.6-alkyl- or C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9.

    [0165] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, halo-, hydroxy-, fluoro-C.sub.1-C.sub.6-alkyl-, fluoro-C.sub.1-C.sub.6-alkoxy-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10);
    said C.sub.1-C.sub.6-alkyl- or C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from:
    C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9.

    [0166] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2;
    said C.sub.1-C.sub.6-alkyl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from:
    halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, C(O)R.sup.9, C(O)OR.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9,
    N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9.

    [0167] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2;
    said C.sub.1-C.sub.6-alkyl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from:
    halo-, C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, C(O)R.sup.9, C(O)OR.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9.

    [0168] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.6-alkyl-, C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2;
    said C.sub.1-C.sub.6-alkyl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from:
    halo-, C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, C.sub.3-C.sub.7-cycloalkyl-.

    [0169] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from:

    C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-, hydroxy-, cyano-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10); said C.sub.1-C.sub.3-alkyl- and C.sub.1-C.sub.3-alkoxy- group being optionally substituted, one or more times, identically or differently, with halo-, cyano-, C.sub.1-C.sub.3-alkoxy-, R.sup.9S(O).sub.2.

    [0170] In a preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents halogen, C.sub.1-C.sub.4-alkyl-, fluoro-C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.4-alkoxy- or fluoro-C.sub.1-C.sub.3-alkoxy-.

    [0171] In a preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from: methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-butyl-, chloro-, bromo-, cyano-, methoxymethyl-, C(O)NH.sub.2, CH.sub.2S(O).sub.2CH.sub.3.

    [0172] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents halogen.

    [0173] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents fluoro-C.sub.1-C.sub.3-alkyl-.

    [0174] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents fluoro-C.sub.1-C.sub.3-alkoxy-.

    [0175] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents C.sub.1-C.sub.4-alkoxy-.

    [0176] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents cyclopropyloxy-.

    [0177] In another preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents cyclopropylmethoxy-.

    [0178] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents chloro, C.sub.1-C.sub.4-alkyl-, methoxy-, difluoromethoxy-, trifluoromethoxy-, trifluoromethyl-, C(O)NH.sub.2, CH.sub.2OCH.sub.3 or CH.sub.2S(O).sub.2CH.sub.3.

    [0179] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents difluoromethoxy- or trifluoromethoxy-.

    [0180] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents chloro, C.sub.1-C.sub.4-alkyl-, methoxy-, trifluoromethoxy- or trifluoromethyl-.

    [0181] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents chloro.

    [0182] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents C.sub.1-C.sub.4-alkyl-.

    [0183] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents methoxy.

    [0184] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents trifluoromethyl.

    [0185] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents trifluoromethoxy.

    [0186] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents difluoromethoxy-.

    [0187] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents tert-butyl.

    [0188] In another particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents C(O)N(R.sup.9)(R.sup.10).

    [0189] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents C(O)NH.sub.2.

    [0190] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents CH.sub.2OCH.sub.3.

    [0191] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents CH.sub.2S(O).sub.2CH.sub.3.

    [0192] In a particularly preferred embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.6 represents a group selected from: R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, wherein R.sup.9 represents a C.sub.1-C.sub.3-alkyl- group, preferably a methyl- group.

    [0193] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.7 represents H, C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl-.

    [0194] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.7 represents H or C.sub.1-C.sub.3-alkyl-.

    [0195] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.9 represents H or C.sub.1-C.sub.3-alkyl-.

    [0196] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.9 represents H.

    [0197] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.10 represents H or C.sub.1-C.sub.3-alkyl-.

    [0198] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.10 represents H.

    [0199] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.11 represents H or C.sub.1-C.sub.3-alkyl-.

    [0200] In another embodiment, the present invention relates to compounds of the general formula (I), supra, in which R.sup.11 represents H.

    [0201] It is to be understood that the present invention relates also to any combination of the preferred embodiments described above.

    [0202] Some examples of combinations are given hereinafter. However, the invention is not limited to these combinations.

    [0203] In a preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00021##

    in which: [0204] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00022##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-; [0205] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0206] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0207] R.sup.1 represents a group selected from:

    ##STR00023## [0208] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0209] R.sup.2 represents

    ##STR00024## [0210] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0211] R.sup.3 represents a group selected from:

    ##STR00025## [0212] wherein * indicates the point of attachment to R.sup.2; [0213] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0214] R.sup.4 represents a hydrogen atom; [0215] R.sup.5 represents a hydrogen atom; [0216] R.sup.6 represents a group selected from: [0217] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0218] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, [0219] heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0220] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0221] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0222] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0223] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0224] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0225] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0226] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0227] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0228] R.sup.9, R.sup.10, R.sup.11 [0229] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0230] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0231] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00026##

    in which: [0232] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00027##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-; [0233] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0234] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0235] R.sup.1 represents a group selected from:

    ##STR00028## [0236] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0237] R.sup.2 represents

    ##STR00029## [0238] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0239] R.sup.3 represents a group selected from:

    ##STR00030## [0240] wherein * indicates the point of attachment to R.sup.2; [0241] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0242] R.sup.4 represents a hydrogen atom; [0243] R.sup.5 represents a hydrogen atom; [0244] R.sup.6 represents a group selected from: [0245] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0246] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0247] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0248] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0249] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, [0250] aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0251] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0252] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0253] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0254] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0255] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0256] R.sup.9, R.sup.10, R.sup.11 [0257] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0258] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0259] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00031##

    in which: [0260] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00032##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-; [0261] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0262] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0263] R.sup.1 represents a group selected from:

    ##STR00033## [0264] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0265] R.sup.2 represents:

    ##STR00034## [0266] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0267] R.sup.3 represents a group selected from:

    ##STR00035## [0268] wherein * indicates the point of attachment to R.sup.2; [0269] wherein said group is optionally substituted, one or more times, identically or differently, % with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0270] R.sup.4 represents a hydrogen atom; [0271] R.sup.5 represents a hydrogen atom; [0272] R.sup.6 represents a group selected from: [0273] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0274] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, [0275] heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0276] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0277] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0278] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, [0279] aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0280] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0281] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0282] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0283] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0284] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0285] R.sup.9, R.sup.10, R.sup.11 [0286] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0287] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0288] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00036##

    in which: [0289] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00037##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-; [0290] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0291] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0292] R.sup.1 represents a group selected from:

    ##STR00038## [0293] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0294] R.sup.2 represents:

    ##STR00039## [0295] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0296] R.sup.3 represents a group selected from:

    ##STR00040## [0297] wherein * indicates the point of attachment to R.sup.2; [0298] wherein said group is optionally substituted, one or more times, identically or differently, % with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0299] R.sup.4 represents a hydrogen atom; [0300] R.sup.5 represents a hydrogen atom; [0301] R.sup.6 represents a group selected from: [0302] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0303] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, [0304] heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0305] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0306] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0307] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, [0308] N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0309] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0310] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0311] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0312] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0313] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0314] R.sup.9, R.sup.10, R.sup.11 [0315] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0316] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0317] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00041##

    in which: [0318] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00042##

    wherein the cyclobutyl- and the cycloproypl- ring are optionally substituted one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, cyano-, C.sub.1-C.sub.3-alkyl-, and C.sub.1-C.sub.3-alkoxy-; [0319] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0320] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0321] R.sup.1 represents a group selected from:

    ##STR00043## [0322] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0323] R.sup.2 represents:

    ##STR00044## [0324] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0325] R.sup.3 represents a group selected from:

    ##STR00045## [0326] wherein * indicates the point of attachment to R.sup.2; [0327] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0328] R.sup.4 represents a hydrogen atom; [0329] R.sup.5 represents a hydrogen atom; [0330] R.sup.6 represents a group selected from: [0331] C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, [0332] C.sub.1-C.sub.6-alkoxy-, C.sub.3-C.sub.6-cycloalkoxy-, halo-, hydroxy-, cyano-, aryl-, [0333] heteroaryl-, N(R.sup.9)(R.sup.10), C(O)OC.sub.1-C.sub.4-alkyl, C(O)N(R.sup.9)(R.sup.10), R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2; [0334] said C.sub.1-C.sub.6-alkyl-, C.sub.2-C.sub.6-alkenyl-, C.sub.2-C.sub.6-alkynyl-, aryl-, heteroaryl-, and C.sub.1-C.sub.6-alkoxy- group being optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, cyano-, nitro-, hydroxy-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkoxy-, hydroxy-C.sub.1-C.sub.3-alkoxy-, C.sub.1-C.sub.3-alkoxy-C.sub.2-C.sub.3-alkoxy-, [0335] C.sub.3-C.sub.7-cycloalkyl-, C.sub.4-C.sub.7-cycloalkenyl-, [0336] 3- to 10-membered heterocycloalkyl-, 4- to 10-membered heterocycloalkenyl-, [0337] aryl-, heteroaryl-, C(O)R.sup.9, C(O)O(C.sub.1-C.sub.4-alkyl), OC(O)R.sup.9, N(H)C(O)R.sup.9, N(R.sup.10)C(O)R.sup.9, N(H)C(O)NR.sup.10R.sup.9, N(R.sup.11)C(O)NR.sup.10R.sup.9, N(H)R.sup.9, NR.sup.10R.sup.9, [0338] C(O)N(H)R.sup.9, C(O)NR.sup.10R.sup.9, R.sup.9S, R.sup.9S(O), R.sup.9S(O).sub.2, [0339] N(H)S(O)R.sup.9, N(R.sup.10)S(O)R.sup.9, S(O)N(H)R.sup.9, S(O)NR.sup.10R.sup.9, [0340] N(H)S(O).sub.2R.sup.9, N(R.sup.9)S(O).sub.2R.sup.10, S(O).sub.2N(H)R.sup.9, S(O).sub.2NR.sup.10R.sup.9, [0341] S(O)(NR.sup.10)R.sup.9, NS(O)(R.sup.10)R.sup.9; [0342] R.sup.7 represents a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group; [0343] R.sup.9, R.sup.10, R.sup.11 [0344] represent, independently from each other, a hydrogen atom or a C.sub.1-C.sub.3-alkyl- or C.sub.1-C.sub.3-alkoxy-C.sub.1-C.sub.3-alkyl- group;
    or [0345] R.sup.9R.sup.10 together with the atom or the group of atoms they are attached to, form a 3- to 10-membered heterocycloalkyl- or 4- to 10-membered heterocycloalkenyl- group;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0346] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00046##

    in which: [0347] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2, CH(C.sub.2H.sub.5),

    ##STR00047## [0348] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0349] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0350] R.sup.1 represents a group selected from:

    ##STR00048## [0351] wherein * indicates the point of attachment to L.sup.A; and wherein R.sup.12 represents methyl, ethyl or cyclopropyl; [0352] R.sup.2 represents:

    ##STR00049## [0353] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0354] R.sup.3 represents a group selected from:

    ##STR00050## [0355] wherein * indicates the point of attachment to R.sup.2; [0356] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0357] R.sup.4 represents a hydrogen atom; [0358] R.sup.5 represents a hydrogen atom; [0359] R.sup.6 represents a group selected from: methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-butyl-, chloro-, bromo-, cyano-, methoxymethyl-, C(O)NH.sub.2, CH.sub.2S(O).sub.2CH.sub.3; [0360] R.sup.9 represents H or C.sub.1-C.sub.3-alkyl-; [0361] R.sup.10 represents H or C.sub.1-C.sub.3-alkyl-;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0362] In another preferred embodiment, the present invention relates to compounds of general formula (I):

    ##STR00051##

    in which: [0363] L.sup.A represents CH.sub.2, CH(CH.sub.3), C(CH.sub.3).sub.2 or

    ##STR00052## [0364] L.sup.B represents *N(H)C(O)** or *C(O)N(H)**; [0365] wherein * indicates the point of attachment to R.sup.2, and ** indicates the point of attachment to the phenyl group; [0366] R.sup.1 represents a group selected from:

    ##STR00053## [0367] wherein * indicates the point of attachment to L.sup.A. [0368] R.sup.2 represents:

    ##STR00054## [0369] wherein * indicates the point of attachment to R.sup.3, and ** indicates the point of attachment to L.sup.B; [0370] R.sup.3 represents a group selected from:

    ##STR00055## [0371] wherein * indicates the point of attachment to R.sup.2; [0372] wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, hydroxy-, N(R.sup.9)(R.sup.10), N(H)C(O)R.sup.9, cyano-, nitro-, C.sub.1-C.sub.3-alkyl-, C.sub.1-C.sub.3-alkoxy-, halo-C.sub.1-C.sub.3-alkyl-, hydroxy-C.sub.1-C.sub.3-alkyl-, amino-C.sub.1-C.sub.3-alkyl-, halo-C.sub.1-C.sub.3-alkoxy-; [0373] R.sup.4 represents a hydrogen atom; [0374] R.sup.5 represents a hydrogen atom; [0375] R.sup.6 represents a group selected from: methoxy-, difluoromethoxy-, trifluoromethoxy-, methyl-, trifluormethyl-, tert-butyl-, chloro-, bromo-, cyano-, methoxymethyl-, C(O)NH.sub.2, CH.sub.2S(O).sub.2CH.sub.3; [0376] R.sup.9 represents H or C.sub.1-C.sub.3-alkyl-; [0377] R.sup.10 represents H or C.sub.1-C.sub.3-alkyl-;
    or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.

    [0378] It is to be understood that the present invention relates also to any combination of the preferred embodiments described above.

    [0379] More particularly still, the present invention covers compounds of general formula (I) which are disclosed in the Examples section of this text, infra.

    [0380] In accordance with another aspect, the present invention covers methods of preparing compounds of the present invention, said methods comprising the steps as described in the Experimental Section herein.

    [0381] In a preferred embodiment, the present invention relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (VI):

    ##STR00056##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I), supra;
    to react with a carboxylic acid HO.sub.2C-L.sup.A-R.sup.1 or the corresponding acyl chloride ClC(O)-L.sup.A-R.sup.1, wherein L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra; or alternatively
    to react with suitable reagents, such as ClC(O)-L.sup.A-LG, in which L.sup.A is as defined for the compounds of general formula (I), and LG stands for a leaving group, preferably chloro or bromo, and subsequently with agents suitable for the introduction of R.sup.1, exemplified by but not limited to cyclic secondary amines;
    thereby giving, upon optional deprotection, a compound of general formula (Ia):

    ##STR00057##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0382] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XI):

    ##STR00058##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for general formula (I), supra;
    to react with a compound of general formula R.sup.3R.sup.2NH.sub.2, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra;
    thereby giving, upon optional deprotection, a compound of general formula (Ia):

    ##STR00059##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0383] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XIa):

    ##STR00060##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for general formula (I), supra;
    to react with a compound of general formula R.sup.3R.sup.2NH.sub.2, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra;
    thereby giving, upon optional deprotection, a compound of general formula (Ia):

    ##STR00061##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0384] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XVII):

    ##STR00062##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I), supra;
    to react with a carboxylic acid HO.sub.2C-L.sup.A-R.sup.1 or the corresponding acyl chloride ClC(O)-L.sup.A-R.sup.1, wherein L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra; or alternatively
    to react with suitable reagents, such as ClC(O)-L.sup.A-LG, in which L.sup.A is as defined for the compounds of general formula (I), and LG stands for a leaving group, preferably chloro or bromo, and subsequently with agents suitable for the introduction of R, exemplified by but not limited to cyclic secondary amines;
    thereby giving, upon optional deprotection, a compound of general formula (Ib):

    ##STR00063##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0385] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XXII):

    ##STR00064##

    in which L.sup.A, R.sup.1, R.sup.5 and R.sup.6 are as defined for general formula (I), supra;
    to react with a carboxylic acid HO.sub.2CR.sup.2R.sup.3, wherein R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra; or alternatively
    to react with a carboxylic acid XR.sup.2CO.sub.2H, in which R.sup.2 is as defined for the compounds of general formula (I), supra, and subsequently subjected to a palladium catalysed coupling reaction, such as a Suzuki coupling, with R.sup.3X, in which R.sup.3 is as defined for the compounds of general formula (I), supra. In XR.sup.2CO.sub.2H and R.sup.3X, both X and X represent groups enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof, with the proviso that if X represents a boronic acid or an ester thereof, X stands for chloro, bromo, iodo, trifluoromethylsulfonyloxy or nonafluorobutylsulfonyloxy and the like, or vice versa;
    thereby giving, upon optional deprotection, a compound of general formula (Ib):

    ##STR00065##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0386] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XXIV):

    ##STR00066##

    in which R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for general formula (I), supra;
    to react with a carboxylic acid HO.sub.2C-L.sup.A-R.sup.1 or the corresponding acyl chloride ClC(O)-L.sup.A-R.sup.1, wherein L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra;
    thereby giving, upon optional deprotection, a compound of general formula (Ic):

    ##STR00067##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0387] In accordance with another embodiment, the present invention also relates to a method of preparing a compound of general formula (I), supra, said method comprising the step of allowing an intermediate compound of general formula (XXV):

    ##STR00068##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.5 and R.sup.6 are as defined for general formula (I), supra;
    to react with a compound of general formula R.sup.3X, wherein R.sup.3 is as defined for the compounds of general formula (I), supra;
    wherein both, X and X represent groups enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof, with the proviso that if X represents a boronic acid or an ester thereof, X stands for chloro, bromo, iodo, trifluoromethylsulfonyloxy or nonafluorobutylsulfonyloxy and the like, or vice versa.
    thereby giving, upon optional deprotection, a compound of general formula (Ia):

    ##STR00069##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0388] In accordance with a further aspect, the present invention covers intermediate compounds which are useful in the preparation of compounds of the present invention of general formula (I), particularly in the method described herein. In particular, the present invention covers intermediate compounds of general formula (VI):

    ##STR00070##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I), supra.

    [0389] The present invention also covers intermediate compounds of general formula (XI):

    ##STR00071##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra.

    [0390] The present invention also covers intermediate compounds of general formula (XIa):

    ##STR00072##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for general formula (I), supra.

    [0391] The present invention also covers intermediate compounds of general formula (XVII):

    ##STR00073##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I), supra.

    [0392] The present invention also covers intermediate compounds of general formula (XXII):

    ##STR00074##

    in which L.sup.A, R.sup.1, R.sup.5 and R.sup.6 are as defined for general formula (I), supra.

    [0393] The present invention also covers intermediate compounds of general formula (XXIV):

    ##STR00075##

    in which R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for general formula (I), supra.

    [0394] The present invention also covers intermediate compounds of general formula (XXV):

    ##STR00076##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.5 and R.sup.6 are as defined for general formula (I), supra, and X represents a group enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof.

    [0395] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (VI):

    ##STR00077##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0396] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XI):

    ##STR00078##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0397] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XIa):

    ##STR00079##

    in which L.sup.A, R.sup.1, R.sup.5, and R.sup.6 are as defined for general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0398] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XVII):

    ##STR00080##

    in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0399] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XXII):

    ##STR00081##

    in which L.sup.A, R.sup.1, R.sup.5 and R.sup.6 are as defined for general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0400] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XXIV):

    ##STR00082##

    in which R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for general formula (I) supra,
    for the preparation of a compound of general formula (I) as defined supra.

    [0401] In accordance with yet another aspect, the present invention covers the use of the intermediate compounds of general formula (XXV):

    ##STR00083##

    in which L.sup.A, R.sup.1, R.sup.2, R.sup.5 and R.sup.6 are as defined for general formula (I), supra, and X represents a group enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof;
    for the preparation of a compound of general formula (I) as defined supra.

    General Synthesis of the Compounds of the Invention

    [0402] The following paragraphs outline a variety of synthetic approaches suitable to prepare compounds of formulae (Ia), (Ib), (Ic), and (Id), in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra. Formulae (Ia) and (Ib), in which R.sup.4 represents hydrogen, both constitute subsets of formula (I) in that they feature different orientations of the amide linker L.sup.B, which stands for NHC(O) in formula (Ia) whilst representing C(O)NH in formula (Ib), as shown in Scheme A. In formula (Ic), L.sup.B represents C(O)NH, alike formula (Ib), and R.sup.4 is as defined for the compounds of general formula (I), supra, but different from hydrogen. In formula (Id), L.sup.B represents NHC(O), alike formula (Ia), and R.sup.4 is as defined for the compounds of general formula (I), supra, but different from hydrogen.

    ##STR00084##

    [0403] In addition to the routes described below, also other routes may be used to synthesise the target compounds, in accordance with common general knowledge of a person skilled in the art of organic synthesis. The order of transformations exemplified in the following Schemes is therefore not intended to be limiting, and suitable synthesis steps from various schemes can be combined to form additional synthesis sequences. In addition, interconversion of any of the substituents R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5 and/or R.sup.6, can be achieved before and/or after the exemplified transformations. These modifications can be such as the introduction of protective groups, cleavage of protective groups, reduction or oxidation of functional groups, halogenation, metallation, metal catalysed coupling reactions, substitution or other reactions known to a person skilled in the art. These transformations include those which introduce a functionality allowing for further interconversion of substituents. Appropriate protective groups and their introduction and cleavage are well-known to a person skilled in the art (see for example T. W. Greene and P. G. M. Wuts in Protective Groups in Organic Synthesis, 3.sup.rd edition, Wiley 1999). Specific examples are described in the subsequent paragraphs. Further, it is possible that two or more successive steps may be performed without work-up being performed between said steps, e.g. in a one-pot reaction, as it is well-known to a person skilled in the art.

    [0404] Scheme B outlines the preparation of compounds of the formula (Ia), in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra, starting from meta-nitrobenzoic acid derivatives (II), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), which can be converted into the corresponding benzoyl chlorides (III), by treatment with a suitable chlorinating agent, such as oxalyl chloride. Benzoic acid derivatives of the formula (II) are well known to the person skilled in the art, and are often commercially available. Said benzoyl chlorides of the formula (III) can be subsequently converted into amides of the general formula (V), e.g. directly by aminolysis with amines R.sup.3R.sup.2NH.sub.2, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I). Alternatively, amides of the formula (V) can be accomplished in two steps by aminolysis of (III) using an amine XR.sup.2NH.sub.2, in which R.sup.2 is as defined for the compounds of general formula (I), giving rise to amides of the formula (IV). Said amides can be subsequently coupled with R.sup.3X, in which R.sup.3 is as defined for the compounds of general formula (I), in a palladium catalysed coupling reaction such as a Suzuki coupling to furnish amides of general formula (V). In XR.sup.2NH.sub.2 and R.sup.3X, both X and X represent groups enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, OS(O).sub.2C.sub.4F.sub.9 (nonafluorobutylsulfonyloxy) or a boronic acid or an ester thereof, with the proviso that if X represents a boronic acid or an ester thereof, X stands for chloro, bromo, iodo, trifluoromethylsulfonyloxy or nonafluorobutylsulfonyloxy and the like, or vice versa.

    [0405] The nitro group present in said amides (V) is then reduced by treatment with a suitable reducing agent, such as titanium(III)chloride, or hydrogenation in the presence of a suitable catalyst, e.g. palladium on charcoal, to give anilines of the formula (VI). Said anilines of the formula (VI) are then elaborated into compounds of the formula (Ia). This can be accomplished directly by reacting a compound of the formula (VI) with a carboxylic acid HO.sub.2C-L.sup.A-R.sup.1, wherein L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), in an amide coupling reaction, for example in the presence of a tertiary aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-tripropyl-1,3,5,2,4,6-trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable solvent such as N,N-dimethylformamide. Alternatively, the transformation of anilines (VI) into compounds of the formula (Ia) can be performed by reaction of anilines (VI) with suitable reagents such as ClC(O)-L.sup.A-R.sup.1, or, in a two step synthesis firstly with ClC(O)-L.sup.A-LG, in which L.sup.A is as defined for the compounds of general formula (I), and LG stands for a leaving group, preferably chloro or bromo, to give the corresponding compounds of formula (VII), which are subsequently reacted with agents suitable for the introduction of R.sup.1, exemplified by but not limited to cyclic secondary amines, to give compounds of the formula (Ia).). As depicted in Scheme B there are more synthetic routes to compounds of formula (Ia). Benzoyl chlorides (III) can be reacted in an amide coupling reaction, as describe supra, with XR.sup.2NH.sup.2, X and R.sup.2 are defined as supra, giving compound of formula (IV), which can be reduced by treatment with a suitable reducing agent, such as titanium(III)chloride, to compounds of formula (IVa). Additionally, compounds of the formula (IV) can be prepared directly from meta-nitrobenzoic acids of formula (II) in a amide coupling reaction, as described supra, R.sup.2, R.sup.5, R.sup.6, X are as defined as supra. The anilines of formula (IVa) can be reacted with ClC(O)-L.sup.A-LG, in which L.sup.A and LG are as defined as supra, giving compounds of the formula (Vila), which are subsequently reacted with agents suitable for the introduction of R.sup.1, defined as supra, leading to compounds of formula (XXV). Afterwards, compounds of the general formula (XXV) can be reacted in a palladium catalysed coupling reaction, such as a Suzuki reaction, described as supra, to give compounds of the formula (Ia). The compounds of formula (V) can be coupled directly with R.sup.3R.sup.2NH.sub.2, R.sup.2 and R.sup.3 are as defined as supra, in an amide coupling reaction, described supra, starting from compounds of formula (II).

    ##STR00085##

    [0406] Alternatively, compounds of the formula (Ia) can be prepared starting from meta-aminobenzoic acid derivatives of formula (VIII), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra, as outlined in Scheme C. Said meta-aminobenzoic acid derivatives of formula (VIII) are well known to the person skilled in the art and are commercially available in many cases. Compounds of formula (VIII) can be reacted with an amine R.sup.3R.sup.2NH.sub.2, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra, in a standard amide coupling reaction, described in context with Scheme B, to give amide derivatives of formula (VI). Said compounds of formula (VI) can also be obtained by coupling the aformentioned acids of formula (VIII) with an amine XR.sup.2NH.sub.2, in which R.sup.2 is as defined for the compounds of general formula (I), supra, giving rise to amides of the formula (IX). These are subsequently subjected to a palladium catalysed coupling reaction, such as a Suzuki coupling, with R.sup.3X, in which R.sup.3 is as defined for the compounds of general formula (I), in order to furnish amides of general formula (VI), respectively. In XR.sup.2NH.sub.2 and R.sup.3X, both X and X represent groups enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof, with the proviso that if X represents a boronic acid or an ester thereof, X stands for chloro, bromo, iodo, trifluoromethylsulfonyloxy or nonafluorobutylsulfonyloxy and the like, or vice versa. Amides of the formula (VI) are subsequently converted into compounds of formula (Ia) as described supra in context with Scheme B. As depicted in Scheme C there are more synthetic routes to the compounds of formula (Ia). The compounds of formula (IX) can be coupled with a carboxylic acid HOOC-L.sup.A-R.sup.1, L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra, in an amide coupling reaction, as described supra in context with Scheme B, to afford compounds of the formula (XXV), which are reacted in a palladium catalysed coupling reaction, as described in context with Scheme B, supra, to yield compounds of the formula (Ia).

    ##STR00086##

    [0407] The sequence of synthetic steps can be varied as outlined in Scheme D, in order to convert meta-aminobenzoic acid derivatives of formula (VIII), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), into compounds of the formula (Ia). Said benzoic acid derivatives of the formula (VIII) can be converted into compounds of the formula (X), in which LG stands for a leaving group, preferably chloro or bromo, followed e.g. by aminolysis of compounds of the formula (X) using reagents suitable for the introduction of R.sup.1, exemplified by but not limited to suitable cyclic secondary amines, to give compounds of the formula (XI). Compounds of the formula (XI) can be synthesised directly from meta-aminobenzoic acids of formula (VIII) by reacting with carboxylic acids of the formula HOOC-L.sup.A-R.sup.1, L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra, in a standard amide coupling reaction, as described in the context with Scheme B, or with the corresponding carboxylic acid chloride Cl(CO)-L.sup.A-R.sup.1, R.sup.1 and L.sup.A are defined as supra. Subsequently, the carboxy group present in compounds of the formula (XI) can be coupled with an amine R.sup.3R.sup.2NH.sub.2, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra, in an amide coupling reaction, for example in the presence of a tertiary aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-tripropyl-1,3,5,2,4,6-trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable solvent such as N,N-dimethylformamide, to afford compounds of the formula (Ia). Additionally, compounds of the formula (XI) can be reacted with amines of the formula XR.sup.2NH.sub.2, X and R.sup.2 are as defined as described in the context with Scheme B, supra, in an amide coupling reaction, as described supra, to yield compounds of the formula (XXV), which can be transformed by a palladium catalysed coupling reaction, as described in context with Scheme B, affording the compounds of formula (Ia).

    ##STR00087##

    [0408] Instead of said benzoic acid derivatives of formula (VIII), also the corresponding ester analogues of formula (XII), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), and in which R.sup.E stands for a C.sub.1-C.sub.6-alkyl group, preferably methyl or ethyl, can be employed in a similar fashion in order to prepare compounds of the formula (Ia), as outlined in Scheme E. Esters of the formula (XII) are well known to the person skilled in the art, and are commercially available in many cases. Elaboration of said benzoic acid esters of formula (XII) into compounds of formula (XIV), in which L.sup.A and R.sup.1 is as defined for the compounds of general formula (I), supra, can proceed via compounds of formula (XIII), in which LG stands for a leaving group, preferably chloro or bromo, and can be performed analogously as described in context with Scheme D. Alternatively, conversion of (XII) into (XIV) can be performed via standard amide coupling reactions, as described in context with Scheme D, supra, of carboxylic acids of the formula R.sup.1-L.sup.A-COOH, R.sup.1 and L.sup.A are as defined for the compounds in general formula (I), supra. Subsequently, the ester group present in compounds of formula (XIV) can be saponified by reaction with e.g. lithium hydroxide to yield the lithium salt of the formula (XIa). Said lithium salt of formula (XIa) or the corresponding carboxylic acid is then converted into compounds of formula (Ia), R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra. This can be performed in different ways as described in the context with Scheme D, supra, starting with compounds of formula (XI).

    ##STR00088##

    [0409] A first approach to compounds of the formula (Ib) from meta-nitroaniline derivatives of formula (XV), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra, is outlined in Scheme F. Said meta-nitroaniline derivatives of formula (XV) are well known to the person skilled in the art, and are often commercially available. They can be converted into amide derivatives of formula (XVI) e.g. by a reacting with a carboxylic acid chloride R.sup.3R.sup.2C(O)Cl, in which R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra, in the presence of a suitable base, such as potassium carbonate, and in a suitable solvent, such as acetonitrile. Basic solvents, such as pyridine, can take over both the role of a base and of a solvent, respectively. Alternatively, conversion of (XV) into (XVI) can be performed via standard amide coupling reactions. In addition, nitro compounds of formula (XV) can be converted into compounds of the formula (XVI) in a two step sequence. This can be performed via amide coupling reactions, methods are described in the context with Scheme B, supra, of (XV) with XR.sup.2NH.sub.2, R.sup.2 is as defined for the compounds of general formula (I) and X is as defined as described in context with Scheme B for performing a palladium catalysed coupling reaction, which can be performed in the subsequent step with R.sup.3X, R.sup.3 is as defined for the compounds of general formula (I), and X is as defined as described in context with Scheme B for performing the palladium catalysed coupling reaction. After the palladium catalysed coupling reaction, the nitro group present in amides of the formula (XVI) can be subsequently reduced e.g. by hydrogenation in the presence of a suitable catalyst, e.g. palladium on charcoal, to give the corresponding aniline derivatives of formula (XVII). Said anilines of the formula (XVII) can then be elaborated into compounds of the formula (Ib). This can be accomplished directly by reacting a compound of the formula (XVII) with a carboxylic acid HO.sub.2C-L.sup.A-R.sup.1, wherein L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), in an amide coupling reaction, for example in the presence of a tertiary aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-tripropyl-1,3,5,2,4,6-trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable solvent such as N,N-dimethylformamide. Alternatively, the transformation of anilines (XVII) into compounds of the formula (Ib) can be performed by reaction of anilines (XVII) with suitable reagents, such as ClC(O)-L.sup.A-LG, in which L.sup.A is as defined for the compounds of general formula (I), and LG stands for a leaving group, preferably chloro or bromo, to give the corresponding compounds of formula (XVIII), which are subsequently reacted with agents suitable for the introduction of R.sup.1, R.sup.1 is as defined for the compounds of general formula (I), supra, exemplified by but not limited to cyclic secondary amines, to give compounds of the formula (Ib).

    ##STR00089##

    [0410] Scheme G outlines an approach complimentary to Scheme F as an alternative synthesis route for compounds of the formula (Ib), from meta-nitroaniline derivatives of formula (XIX), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra, and which differ from the compounds of formula (XV) by the inverse arrangement of their nitro and amino groups, respectively. Said meta-nitroaniline derivatives of formula (XIX) are well known to the person skilled in the art, and are often commercially available. They can be converted into amide derivatives of formula (XX), in which L.sup.A is as defined for the compounds of general formula (I), supra, and in which LG stands for a leaving group, preferably chloro or bromo, by reacting with a carboxylic acid LG-L.sup.A-CO.sub.2H, in a standard amide coupling reaction. Said amides of the formula (XX) can be subsequently converted into compounds of the formula (XXI), in which R.sup.1 is as defined for the compounds of general formula (I), supra, using reagents suitable for the introduction of R.sup.1, exemplified by but not limited to cyclic secondary amines. Alternatively, converting compounds (XIX) into compounds of formula (XXI) can be accomplished directly by reacting compounds of the formula R.sup.1-L.sup.A-COOH, wherein R.sup.1 and L.sup.A are as defined for the compounds of general formula (I), supra, or the corresponding carboxylic acid chloride in an amide coupling reaction, supra. The nitro group present in amides of the formula (XXI) is then reduced e.g. by hydrogenation in the presence of a suitable catalyst, e.g. palladium on charcoal, to give the corresponding aniline derivatives of formula (XXII). Compounds of formula (XXII) can be reacted with a carboxylic acid R.sup.3R.sup.2CO.sub.2H, wherein R.sup.2 and R.sup.3 are as defined for the compounds of general formula (I), supra, in an amide coupling reaction, for example in the presence of a tertiary aliphatic amine, such as N,N-diisopropylethylamine, and 2,4,6-tripropyl-1,3,5,2,4,6-trioxaphosphinane 2,4,6-trioxide (also known as T3P), in a suitable solvent such as N,N-dimethylformamide, to give compounds of the formula (Ib). The compounds of formula (Ib) can also be obtained by coupling the aformentioned anilines of formula (XXII) with a carboxylic acid XR.sup.2CO.sub.2H, in which R.sup.2 is as defined for the compounds of general formula (I), supra, giving rise to amides of the formula (XXIII). These can be subsequently subjected to a palladium catalysed coupling reaction, such as a Suzuki coupling, with R.sup.3X, in which R.sup.3 is as defined for the compounds of general formula (I), in order to furnish compounds of the formula (Ib), respectively. In XR.sup.2CO.sub.2H and R.sup.3X, both X and X represent groups enabling palladium catalysed coupling reactions, such as chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy or a boronic acid or an ester thereof, with the proviso that if X represents a boronic acid or an ester thereof, X stands for chloro, bromo, iodo, trifluoromethylsulfonyloxy or nonafluorobutylsulfonyloxy and the like, or vice versa.

    ##STR00090##

    [0411] Instead of benzoic acid ester derivatives of formula (XII), as depicted in Scheme E, also the corresponding meta-substituted analogues of formula (XXVI), in which R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), and in which A stands for a chloro, bromo, iodo, trifluoromethylsulfonyloxy, nonafluorobutylsulfonyloxy, preferably bromo, can be employed in a similar fashion in order to prepare compounds of the formula (XIa), as outlined in Scheme H. Compounds of the formula (XXVI) are well known to the person skilled in the art, and are commercially available in many cases. Elaboration of said compounds of formula (XXVI) into compounds of formula (XXVIII), in which L.sup.A and R.sup.1 are as defined for the compounds of general formula (I), supra, can proceed via compounds of formula (XXVII), in which LG stands for a leaving group, preferably chloro or bromo, and can be performed analogously as described in context with Scheme D. Alternatively, conversion of (XXVI) into (XXVIII) can be performed via standard amide coupling reactions, as described supra, of carboxylic acids of the formula R.sup.1-L.sup.A-COOH, R.sup.1 and L.sup.A are as defined for the general formula (I), supra. The compounds of formula (XXVIII) are transformed into the corresponding esters of the formula (XIV), wherein R.sup.E stands for a C.sub.1-C.sub.6-alkyl, preferably methyl or ethyl. This kind of reaction can be performed under palladium catalysis, for example dichloropalladium-propane-1,3-diylbis(diphenylphosphine), in an alcohol R.sup.EOH, R.sup.E is as defined as supra, e.g. ethanol, with an aliphatic amine, e.g. triethylamine, at elevated temperatures ranging from 50-150 C., e.g. 100 C., and with pressurised carbon monoxide, e.g. 10-20 bar, affording compounds of the formula (XIV). Subsequently, the ester group present in compounds of formula (XIV) can be saponified by reaction with e.g. lithium hydroxide to yield the lithium salt of the formula (XIa).

    ##STR00091##

    [0412] Scheme I illustrates the introduction of R.sup.4 groups different from hydrogen. In order to do so, primary anilines of the formula (XVII), in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra, and which can be prepared for example according to Scheme F, can be converted into secondary anilines of the formula (XXIX), in which R.sup.4 is as defined for the compounds of general formula (I), supra, but different from hydrogen. This can be accomplished by various methods known to the person skilled in the art, such as a reductive amination with an aldehyde suitable to confer R.sup.4, e.g. benzaldehyde for R.sup.4=benzyl, in the presence of a suitable borohydride reagent, such as sodium triacetoxyborohydride, and in the presence of a suitable acid, such as acetic acid, in a suitable solvent, such as a chlorinated hydrocarbon, preferably dichloromethane. The resulting compounds of the formula (XXIX) are subsequently elaborated into compounds of the formula (Ic), in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra, with the proviso that R.sup.4 is different from hydrogen.

    ##STR00092##

    [0413] Scheme J illustrates the introduction of R.sup.4 groups different from hydrogen. In order to do so, primary anilines of the formula (VI), in which R.sup.2, R.sup.3, R.sup.5, and R.sup.6 are as defined for the compounds of general formula (I), supra, and which can be prepared for example according to Scheme C, can be converted into secondary anilines of the formula (XXX), in which R.sup.4 is as defined for the compounds of general formula (I), supra, but different from hydrogen. This can be accomplished by various methods known to the person skilled in the art, such as a reductive amination with an aldehyde suitable to confer R.sup.4, e.g. benzaldehyde for R.sup.4=benzyl, in the presence of a suitable borohydride reagent, such as sodium triacetoxyborohydride, and in the presence of a suitable acid, such as acetic acid, in a suitable solvent, such as a chlorinated hydrocarbon, preferably dichloromethane. The resulting compounds of the formula (XXX) are subsequently elaborated into compounds of the formula (Id), in which L.sup.A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 are as defined for the compounds of general formula (I), supra, with the proviso that R.sup.4 is different from hydrogen.

    ##STR00093##

    [0414] Further details (reaction conditions, suitable solvents etc.) can be obtained from the experimental section below.

    [0415] In the present text, in particular in the Experimental Section, for the synthesis of intermediates and of examples of the present invention, when a compound is mentioned as a salt form with the corresponding base or acid, the exact stoichiometric composition of said salt form, as obtained by the respective preparation and/or purification process, is, in most cases, unknown.

    [0416] Unless specified otherwise, suffixes to chemical names or structural formulae such as hydrochloride, trifluoroacetate, sodium salt, or x HCl, x CF3COOH, x Na+, for example, are to be understood as not a stoichiometric specification, but solely as a salt form.

    [0417] This applies analogously to cases in which synthesis intermediates or example compounds or salts thereof have been obtained, by the preparation and/or purification processes described, as solvates, such as hydrates with (if defined) unknown stoichiometric composition.

    EXPERIMENTAL SECTION

    [0418] The following table lists the abbreviations used in this paragraph, and in the examples section.

    TABLE-US-00001 Abbreviation Meaning anh anhydrous br. broad signal (in NMR data) d day(s) DAD Diode Array Detector DCM dichloromethane DME 1,2-dimethoxyethane DMF N,N-dimethylformamide DMSO dimethyl sulfoxide ELSD Evaporative Light Scattering Detector ESI electrospray ionisation EtOAc ethyl acetate h hour HPLC, LC high performance liquid chromatography m/z mass-to-charge ratio (in mass spectrum) mc multiplet centred MeOH methanol min Minute MPLC medium pressure liquid chromatography MS mass spectroscopy neg negative NMR nuclear magnetic resonance PE petroleum ether pos positive ppm Chemical shift in parts per million PYBOP (1H-benzotriazol-1-yloxy) (tripyrrolidin-1-yl)phosphonium hexafluorophosphate R.sub.t retention time rt room temperature THF tetrahydrofurane TLC thin layer chromatography T3P 2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphinane 2,4,6-trioxide

    Methods:

    Method 1:

    [0419] Instrument: Waters Acquity UPLC-MS SQD; column: Acquity UPLC BEH C18 1.7 502.1 mm; Eluent A: water+0.05% vol. formic acid (98%), Eluent B: acetonitrile+0.05% vol. formic acid (98%); gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; rate 0.8 mL/min; temperature: 60 C.; DAD scan: 210-400 nm; ELSD.

    Method 2:

    [0420] Instrument: Waters Auto purification system SQD; column: Waters XBrigde C18 5 10030 mm; water+0.1% vol. formic acid (99%)/acetonitrile gradient; temperature: room temperature; injection: 2500 L; DAD scan: 210-400 nm.

    Method 3:

    [0421] Instrument: Waters Acquity UPLC-MS SQD; column: Acquity UPLC BEH C18 1.7 502.1 mm; Eluent A: water+0.2% vol. ammonia (32%), Eluent B: acetonitrile; gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; rate 0.8 mL/min; temperature: 60 C.; DAD scan: 210-400 nm; ELSD.

    Method 4:

    [0422] Instrument: Waters Acquity UPLC-MS SQD; column: Acquity UPLC BEH C18 1.7 502.1 mm; Eluent A: water+0.1% vol. formic acid (99%), Eluent B: acetonitrile; gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; rate 0.8 mL/min; temperature: 60 C.; DAD scan: 210-400 nm; ELSD.

    Method 5:

    [0423] Instrument: Waters Auto purification system SQD; column: Waters XBrigde C18 5 10030 mm; water+0.2% vol. ammonia (32%)/acetonitrile gradient; temperature: room temperature; injection: 2500 L; DAD scan: 210-400 nm.

    Method 6:

    [0424] Instrument: JASCO P2000 Polarimeter; wavelength 589 nm; temperature: 20 C.; integration time 10 s; path length 100 mm.

    Method 7:

    [0425] Instrument: Acquity UPLC from Waters; mass detector: LCT from Micromass (now Waters); column: Kinetex C18 from Phenomenex, 502.1 mm, 2.6 m particle, 60 C.; solvent: A: water+0.05% formic acid; B: acetonitrile+0.05% formic acid; injection: 0.5 L; rate: 1.3 mL/min; gradient 99% A, 1% B until 1.9 min linear to 1% A, 99% B; 1.9-2.10 min unchanged; until 2.20 min back to 99% A, 1% B.

    [0426] The .sup.1H-NMR data of selected examples are listed in the form of .sup.1H-NMR peaklists. For each signal peak the value in ppm is given, followed by the signal intensity, reported in round brackets. The value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: .sub.1 (intensity.sub.1), .sub.2 (intensity.sub.2), . . . , .sub.i (intensity.sub.i), . . . , .sub.n (intensity.sub.n).

    [0427] The intensity of a sharp signal correlates with the height (in cm) of the signal in a printed NMR spectrum. When compared with other signals, this data can be correlated to the real ratios of the signal intensities. In the case of broad signals, more than one peak, or the center of the signal along with their relative intensity, compared to the most intense signal displayed in the spectrum, are shown. A .sup.1H-NMR peaklist is similar to a classical .sup.1H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical .sup.1H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of target compounds (also the subject of the invention), and/or peaks of impurities. The peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compounds (e.g., with a purity of >90%). Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify the reproduction of our manufacturing process on the basis of by-product fingerprints. An expert who calculates the peaks of the target compounds by known methods (MestReC, ACD simulation, or by use of empirically evaluated expectation values), can isolate the peaks of target compounds as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical .sup.1H-NMR interpretation. A detailed description of the reporting of NMR data in the form of peaklists can be found in the publication Citation of NMR Peaklist Data within Patent Applications (cf. Research Disclosure Database Number 605005, 2014, 1 Aug. 2014, or http://www.researchdisclosure.com/searching-disclosures). In the peak picking routine, as described in the Research Disclosure Database Number 605005, the parameter MinimumHeight can be adjusted between 1% and 4%. Depending on the chemical structure and/or depending on the concentration of the measured compound it may be reasonable to set the parameter MinimumHeight<1%.

    Intermediates

    Intermediate 1

    3-amino-N-(6-bromopyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0428] ##STR00094##

    [0429] To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (known from WO2007/31791, 5.00 g, 22.6 mmol) and 6-bromopyridazin-3-amine (5.51 g, 31.7 mmol) in DMF (80 mL) was added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 17.7 g, 33.9 mmol) and diisopropylethylamine (11.8 mL, 67.8 mmol). The resulting mixture was stirred at 60 C. over night, was concentrated under reduced pressure, was then dissolved in dichloromethane, was washed with 1N aqueous hydrogen chloride solution and saturated, aqueous sodium bicarbonate solution, was dried over sodium sulfate and concentrated under reduced pressure. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient). 880 mg (10% of theory) of the title compound were obtained.

    [0430] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=5.67 (s, 2H), 7.20-7.28 (m, 2H), 7.44 (d, 1H), 8.02 (d, 1H), 8.33 (d, 1H), 11.48 (s, 1H).

    [0431] LC-MS (Method 4): R.sub.t=1.07 min; MS (ESIpos): m/z=377 [M+H].sup.+.

    Intermediate 2

    3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzoic acid

    [0432] ##STR00095##

    [0433] To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (2.50 g, 11.3 mmol) and pyridine (1.92 mL, 23.7 mmol, 2.1 equiv) in CH.sub.2Cl.sub.2 (50 mL) at 0 C. was added chloroacetyl chloride (0.95 mL, 11.9 mmol, 1.05 equiv) dropwise. The resulting mixture was allowed to warm to room temperature and was stirred at that temperature for 5 h. The resulting solution was treated with a CH.sub.2Cl.sub.2/isopropanol mixture (4:1, 50 mL). The resulting solution was washed with an aqueous 1N HCl solution (50 mL), dried (MgSO.sub.4 anh), and concentrated under reduced pressure to give impure 3-[(chloroacetyl)amino]-4-(trifluoromethyl)benzoic acid (3.52 g). This material was used in subsequent reactions without further purification.

    [0434] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=4.35 (s, 2H), 7.52 (ddm, J=1.5, 8.7 Hz, 1H), 7.80 (dd, J=2.1, 8.7 Hz, 1H), 8.47 (d, J=2.1 Hz, 1H), 10.17 (s, 1H), 13.28 (br s, 1H).

    [0435] LC-MS (Method 3): R.sub.t=0.95 min; MS (ESIpos): m/z=298 ([M+H].sup.+, 100%); MS (ESIneg): m/z=296 ([MH].sup., 100%), 593 ([2MH].sup., 100%).

    Intermediate 3

    3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic acid

    [0436] ##STR00096##

    [0437] To a solution of 3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzoic acid (prepared in a manner analogous to that described in intermediate 2, 3.52 g, 11.8 mmol) in DMF (50 mL) was added morpholine (2.2 mL, 24.8 mmol, 2.1 equiv), triethylamine (3.5 mL, 24.8 mmol, 2.1 equiv) and potassium iodide (0.30 g, 1.83 mmol, 0.16 equiv). The reaction mixture was stirred at room temperature for 16 h. The resulting mixture was diluted with water (75 mL). The aqueous solution was extracted with a CH.sub.2Cl.sub.2/isopropanol solution (4:1, 550 mL). The combined organic phases were washed with saturated brine (50 mL), dried (Na.sub.2SO.sub.4 anh), and concentrated under reduced pressure to give impure 3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic acid (2.87 g). This material was used in subsequent reactions without further purification.

    [0438] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.54-2.59 (m, 4H), 3.20 (s, 2H), 3.61-3.66 (m, 4H), 7.49-7.54 (m, 1H), 7.76 (dd, J=2.1, 8.6 Hz, 1H), 8.80 (d, J=2.1 Hz, 1H), 9.81 (s, 1H).

    [0439] LC-MS (Method 3): R.sub.t=0.58 min; MS (ESIpos): m/z=349 ([M+H].sup.+, 100%); MS (ESIneg): m/z=347 ([MH].sup., 100%).

    Intermediate 4

    2-chloro-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide

    [0440] ##STR00097##

    [0441] To a solution of 5-nitro-2-(trifluoromethoxy)aniline (17.3 g, 77.7 mmol) and pyridine (6.60 mL, 81.5 mmol, 1.05 equiv) in CH.sub.2Cl.sub.2 (250 mL) at 0 C. was added chloroacetyl chloride (6.50 mL, 81.5 mmol, 1.05 equiv) dropwise. The resulting mixture was warmed to room temperature and was stirred at that temperature for 12 h. The resulting mixture was diluted with CH.sub.2Cl.sub.2 (250 mL), washed with water (200 mL) followed by a saturated NaCl solution (250 mL), dried (MgSO.sub.4 anh), and concentrated under reduced pressure to give impure 2-chloro-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide (23.8 g). This material was used in subsequent reactions without further purification.

    [0442] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=4.40 (s, 2H), 7.69 (dd, J=1.7, 9.0 Hz, 1H), 8.09 (dd, J=3.0, 9.2 Hz, 1H), 8.88 (d, J=2.8 Hz, 1H), 10.41 (s, 1H).

    [0443] LC-MS (Method 3): R.sub.t=1.09 min; MS (ESIneg): m/z=297 ([MH].sup., 100%).

    Intermediate 5

    2-(morpholin-4-yl)-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide

    [0444] ##STR00098##

    [0445] To a solution of 2-chloro-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide (prepared in a manner analogous to that described in intermediate 4, 20.6 g, 69.0 mmol) in DMF (300 mL) was added morpholine (9.0 mL, 103.5 mmol, 1.5 equiv), triethylamine (14.4 mL, 103.5 mmol, 1.5 equiv) and potassium iodide (1.78 g, 10.7 mmol, 0.16 equiv). The reaction mixture was stirred at room temperature for 16 h. The resulting mixture was poured onto water (300 mL). The resulting mixture was extracted with ethyl acetate (3100 mL). The combined organic phases were washed with half-saturated NaCl solution, dried (Na.sub.2SO.sub.4 anh) and concentrated under reduced pressure to give 2-(morpholin-4-yl)-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide (20.0 g, 83%).

    [0446] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.53-2.56 (m, 4H), 3.22 (s, 2H), 3.59-3.62 (m, 4H), 7.72 (dq, J=1.7, 9.1 Hz, 1H), 8.05 (dd, J=2.8, 9.1 Hz, 1H), 9.11 (d, J=2.8 Hz, 1H), 10.05 (s, 1H).

    [0447] LC-MS (Method 3): R.sub.t=1.15 min; MS (ESIpos): m/z=350 ([M+H].sup.+, 100%); MS (ESIneg): m/z=348 ([MH].sup., 100%).

    Intermediate 6

    N-[5-amino-2-(trifluoromethoxy)phenyl]-2-(morpholin-4-yl)acetamide

    [0448] ##STR00099##

    [0449] To a solution of 2-(morpholin-4-yl)-N-[5-nitro-2-(trifluoromethoxy)phenyl]acetamide (prepared in a manner analogous to that described in intermediate 5, 20.0 g, 57.1 mmol) in ethyl acetate (500 mL) was added 10% palladium on carbon (6.1 g, 5.72 mmol Pd, 10 mol % Pd). The resulting slurry was stirred under a hydrogen atmosphere for 3.25 h. The resulting slurry was filtered and concentrated under reduced pressure to afford N-[5-amino-2-(trifluoromethoxy)phenyl]-2-(morpholin-4-yl)acetamide (17.8 g, 98%).

    [0450] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.49-2.52 (m, 4H), 3.10 (s, 2H), 3.57-3.60 (m, 4H), 5.37 (s, 2H), 6.26 (dd, J=2.5, 8.8 Hz, 1H), 6.99 (dd, J=1.3, 8.8 Hz, 1H), 7.51 (d, J=2.5 Hz, 1H), 9.50 (s, 1H).

    [0451] LC-MS (Method 4): R.sub.t=0.99 min; MS (ESIpos): m/z=320 ([M+H].sup.+, 90%); MS (ESIneg): m/z=318 ([MH].sup., 100%).

    Intermediate 7

    5-phenylpyrazine-2-carboxylic acid

    [0452] ##STR00100##

    [0453] A solution of 3-aminoalanine hydrochloride (5.13 g, 36.2 mmol) in methanol (304 mL) was treated with sodium hydroxide (5.79 g, 145 mmol) and phenylglyoxal monohydrate (5.00 g, 36.2 mmol) and was stirred over night at room temperature. Afterwards nitrogen was bubbled through the mixture for 5 h, and then the mixture was stirred for 2 days at room temperature. The reaction mixture was concentrated in vacuum. The residue was suspended into a small amount of water; insoluble material was collected by filtration and was carefully washed with water. The precipitate was dissolved in water at 50 C., the pH of the solution was adjusted to 2 by the addition of concentrated HCl. After cooling to room temperature the precipitate was filtered off and dried at 60 C. over night in vacuum to provide 766 mg of an approximately 3:1 mixture of the desired compound 7 and its regioisomer (6-phenylpyrazine-2-carboxylic acid). The volume of the filtrate out of the first separation was reduced to half by evaporation of the solvent, at 50 C. the pH of the solution was adjusted to 7. The resulting precipitate was collected and washed with water. After drying, additional 4.34 g of the mixture of the desired product with its regioisomer were obtained (in total 5.11 g, 13.7 mmol, 38% related to compound 7).

    [0454] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=7.53-7.62 (m, 3H), 8.18-8.27 (m, 2H), 9.24 (d, 1H), 9.39 (d, 1H), 13.72 (br. s, 1H).

    [0455] LC-MS (Method 4): R.sub.t=0.83/0.86 min; MS (ESIpos): m/z=201 [M+H].sup.+.

    Intermediate 8

    3-amino-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0456] ##STR00101##

    [0457] To a solution of 3-amino-4-(trifluormethoxy)benzoic acid (known from WO2007/31791, 581 mg, 2.63 mmol) and 6-phenylpyridazin-3-amine (630 mg, 3.68 mmol) in DMF (10.1 mL) were added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 2.05 g, 3.94 mmol) and diisopropylethylamine (1.37 mL, 7.89 mmol). The reaction mixture was stirred over night at 60 C. After cooling to room temperature the mixture was poured into water. The precipitate was collected by filtration, washed with water and dried at 60 C. under reduced pressure to yield the desired crude product 8 (893 mg, 84%).

    [0458] .sup.1H-NMR (300 MHz, DMSO-d.sub.6) [ppm]=5.69 (s, 2H), 7.21-7.33 (m, 2H), 7.47 (d, 1H), 7.50-7.61 (m, 3H), 8.13 (dd, 2H), 8.29 (d, 1H), 8.41-8.47 (m, 1H), 11.42 (s, 1H).

    [0459] LC-MS (Method 4): R.sub.t=1.21 min; MS (ESIpos): m/z=375 [M+H].sup.+.

    Intermediate 9

    3-[(chloroacetyl)amino]-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0460] ##STR00102##

    [0461] Chloroacetyl chloride (461 L, 5.67 mmol) was added dropwise under argon to a solution of intermediate 8 (1.06 g, 2.84 mmol) in toluene (14.2 mL). The mixture was stirred over night at 100 C. The mixture was concentrated to obtain the desired crude material 9 (1.42 g, 96%) which was used in the next step without any further purification.

    [0462] .sup.1H-NMR (300 MHz, DMSO-d.sub.6) [ppm]=4.41 (s, 2H), 7.65-7.48 (m, 4H), 8.03 (dd, 1H), 8.11-8.15 (m, 2H), 8.33 (d, 1H), 8.48 (d, 1H), 8.59 (d, 1H), 10.29 (s, 1H), 11.76 (s, 1H).

    [0463] LC-MS (Method 4): R.sub.t=1.19 min; MS (ESIpos): m/z=453 [M+H].sup.+.

    Intermediate 10

    3-nitro-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0464] ##STR00103##

    [0465] 488 mg (1.95 mmol) of 3-nitro-4-(trifluoromethoxy)benzoic acid were dissolved in 6 mL of anh DMF and 1.53 mL (8.76 mmol) of N-ethyl-N-isopropylpropan-2-amine. To the solution 400 mg (2.34 mmol) of 5-phenylpyrazin-2-amine and 3.4 mL (5.84 mmol) of propanephosphonic acid cyclic anhydride solution (50% in ethyl acetate) were added. It was stirred over night at rt. 67 mg (0.39 mmol) of 5-phenylpyrazin-2-amine, 0.17 mL (0.97 mmol) of N-ethyl-N-isopropylpropan-2-amine and 0.57 mL (0.97 mmol) of propanephosphonic acid cyclic anhydride solution (50% in ethyl acetate) were added. It was stirred 2 h at rt. Water was added and the precipitate was filtered off under suction and washed three times with water. The residue was treated with methanol and the solvent was removed under vacuum affording 750 mg of the title product which was used without further purification.

    [0466] LC-MS (Method 4): R.sub.t=1.38 min; MS (ESIpos): m/z=405 [M+H].sup.+.

    Intermediate 11

    3-amino-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0467] ##STR00104##

    [0468] 730 mg (1.81 mmol) of 3-nitro-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 10) were dissolved in 73 mL of methanol/THF 1:1. 115 mg of palladium on charcoal (10% Pd) and one drop of water were added. It was hydrogenated under an atmosphere of hydrogen over night. 30 mg of palladium on charcoal (10% Pd) were added. It was hydrogenated for 3 h. The catalyst was filtered off over celite and washed with methanol. The filtrate was concentrated. The residue was triturated with methanol at 50 C. for 30 minutes yielding 300 mg of the title compound which was used without further purification.

    [0469] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): [ppm]=5.66 (s, 2H), 7.21-7.27 (m, 2H), 7.43-7.49 (m, 2H), 7.50-7.55 (m, 2H), 8.09-8.15 (m, 2H), 9.06 (d, 1H), 9.43 (d, 1H), 11.07 (s, 1H).

    [0470] LC-MS (Method 4): R.sub.t=1.29 min; MS (ESIpos): m/z=375 [M+H].sup.+.

    Intermediate 12

    3-nitro-4-(trifluoromethoxy)benzoyl chloride

    [0471] ##STR00105##

    [0472] 5.00 g (19.9 mmol) of 3-nitro-4-(trifluoromethoxy)benzoic acid were stirred in 90 mL of dichloromethane at room temperature. 0.15 mL (1.99 mmol) of DMF and 2.08 mL (23.9 mmol) of oxalyl chloride were added, and the mixture was stirred for additional 5 h at 50 C. after the gas formation had stopped. After concentration, 5.37 g of raw material were obtained, which were used without further purification.

    Intermediate 13

    N-(6-bromopyridazin-3-yl)-3-nitro-4-(trifluoromethoxy)benzamide

    [0473] ##STR00106##

    [0474] 2.13 g of the compound of intermediate 12 were added to a suspension of 2.06 g (11.9 mmol) of 6-bromopyridazin-3-amine and 5.5 mL (39.5 mmol) of triethylamine in a mixture of 30 mL of dichloromethane and 30 mL of THF. The resulting mixture was stirred at room temperature over night, water was added, and the mixture was extracted with dichloromethane. The combined organic phases were dried over sodium sulfate and concentrated under reduced pressure. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient) to give 1.77 g of the title compound.

    [0475] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]=7.93 (dd, 1H), 8.07 (d, 1H), 8.37 (d, 1H), 8.48 (dd, 1H), 8.83 (d, 1H), 12.06 (s, 1H).

    [0476] LC-MS (Method 4): R.sub.t=1.17 min; MS (ESIpos): m/z=407 [M+H].sup.+.

    Intermediate 14

    3-nitro-N-(6-phenyl-1,2,4-triazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0477] ##STR00107##

    [0478] 2.35 g of the compound of intermediate 12 were added to a suspension of 1.00 g (5.81 mmol) of 6-phenyl-1,2,4-triazin-3-amine and 4.05 mL (29.0 mmol) of triethylamine in a mixture of 20 mL of dichloromethane and 20 mL of THF. The resulting mixture was stirred at room temperature over night, water was added, and the mixture was extracted with dichloromethane. The combined organic phases were dried over sodium sulfate and concentrated under reduced pressure. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient) to give 1.21 g of the title compound with 75% purity.

    [0479] LC-MS (Method 3): R.sub.t=0.76 min; MS (ESIpos): m/z=406 [M+H].sup.+.

    Intermediate 15

    3-amino-N-(6-phenyl-1,2,4-triazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0480] ##STR00108##

    [0481] In a first experiment, to a solution of the compound of intermediate 14 (100 mg, 0.19 mmol) in 4 mL of tetrahydrofuran was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride dropwise (0.6 mL, 1.48 mmol, 8 equiv) at 0 C. The reaction mixture was allowed to warm up to room temperature and was stirred over night. A 15% solution of titanium(III) chloride in 10% hydrogen chloride was added dropwise (0.6 mL, 1.48 mmol, 8 equiv). The reaction mixture was allowed to warm up to room temperature and was stirred over night. In a second experiment, to a solution of the compound of intermediate 14 (810 mg, 1.50 mmol) in 20 mL of tetrahydrofuran was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride dropwise (8.8 mL, 22.5 mmol, 15 equiv) at 0 C. The reaction mixture was allowed to warm up to room temperature and was stirred over night. The reaction mixtures of both experiments were combined and the pH of the mixture was adjusted under stirring with solid sodium bicarbonate to 7. The suspension was saturated with solid sodium chloride and stirred with 60 mL of a mixture of tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the filtrate was washed with brine, dried over sodium sulfate and concentrated under reduced pressure. Purification by HPLC (Waters Auto purification system, column: XBrigde C18 5 m 10030 mm, solvent: water/acetonitrile+0.2% ammonia gradient, rate: 70 mL/min, temperature: room temperature) yielded 81.0 mg (14% of theory) of the title compound.

    [0482] .sup.1H-NMR (300 MHz, DMSO-d.sub.6) [ppm]=5.70 (s, 2H), 7.18-7.30 (m, 2H), 7.43 (d, 1H), 7.54-7.65 (m, 3H), 8.15-8.23 (m, 2H), 9.34 (s, 1H), 11.53 (s, 1H).

    [0483] LC-MS (Method 3): R.sub.t=0.97 min; MS (ESIpos): m/z=376 [M+H].sup.+.

    Intermediate 16

    3-[(chloroacetyl)amino]-N-(6-phenyl-1,2,4-triazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0484] ##STR00109##

    [0485] Chloroacetyl chloride (24 L, 0.30 mmol) was added dropwise under argon to a solution of intermediate 15 (75.0 g, 0.20 mmol) in toluene (2 mL). The mixture was stirred for 2 h at 100 C. The mixture was concentrated to obtain the title compound (50 mg), which was used in the next step without further purification.

    [0486] LC-MS (Method 3): R.sub.t=0.94 min; MS (ESIpos): m/z=452 [M+H].sup.+.

    Intermediate 17

    3-nitro-N-(5-phenylpyrimidin-2-yl)-4-(trifluoromethoxy)benzamide

    [0487] ##STR00110##

    [0488] 1.11 g of the compound of intermediate 12 were added to a suspension of 470 mg (2.75 mmol) of 5-phenylpyrimidin-2-amine and 1.9 mL (13.7 mmol) of triethylamine in a mixture of 10 mL of dichloromethane and 10 mL of THF. The resulting mixture was stirred at room temperature over night, diluted with ethyl acetate, washed with water and a saturated aqueous solution of ammonium chloride, dried over sodium sulfate and concentrated under reduced pressure. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient) to give 186 mg of the title compound.

    [0489] .sup.1H-NMR (300 MHz, DMSO-d.sub.6) [ppm]=7.42-7.59 (m, 3H), 7.79-7.86 (m, 2H), 7.91 (dd, 1H), 8.42 (dd, 1H), 8.75 (d, 1H), 9.11 (s, 2H), 11.56 (s, 1H).

    [0490] LC-MS (Method 4): R.sub.t=1.20 min; MS (ESIpos): m/z=405 [M+H].sup.+.

    Intermediate 18

    3-amino-N-(5-phenylpyrimidin-2-yl)-4-(trifluoromethoxy)benzamide

    [0491] ##STR00111##

    [0492] 180 mg (0.45 mmol) of the compound of intermediate 17 were dissolved in 20 mL of a 3:2 mixture of methanol and THF. 23.7 mg of palladium on charcoal (10% Pd) were added and it was hydrogenated under an atmosphere of hydrogen for 5 h. The catalyst was filtered off over celite and washed with THF. The filtrate was concentrated. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient). 38 mg of the title compound were obtained.

    [0493] LC-MS (Method 1): R.sub.t=1.19 min; MS (ESIpos): m/z=375 [M+H].sup.+.

    Intermediate 19

    3-[(chloroacetyl)amino]-N-(5-phenylpyrimidin-2-yl)-4-(trifluoromethoxy)benzamide

    [0494] ##STR00112##

    [0495] Chloroacetyl chloride (11 L, 0.14 mmol) was added dropwise under argon to a solution of the compound of intermediate 18 (35.0 mg) in toluene (2 mL). The mixture was stirred for 2 h at 100 C. The mixture was concentrated to obtain the title compound (25 mg), which was used in the next step without further purification.

    [0496] LC-MS (Method 1): R.sub.t=1.14 min; MS (ESIpos): m/z=451 [M+H].sup.+.

    Intermediate 20

    1-(morpholin-4-yl)cyclopropanecarboxylic acid hydrochloride (1:1)

    [0497] ##STR00113##

    [0498] The title compound is known from WO2010/136778.

    Intermediate 21

    4-(cyclopropyloxy)-3-nitro-N-(5-phenylpyrazin-2-yl)benzamide

    [0499] ##STR00114##

    [0500] 452 mg (2.03 mmol) of 4-(cyclopropyloxy)-3-nitrobenzoic acid and 416 mg (2.43 mmol) of 5-phenylpyrazin-2-amine were dissolved in 11.3 mL of anh dichloromethane. 2.47 mL (14.19 mmol) of N-ethyl-N-isopropylpropan-2-amine and 3.55 mL (6.08 mmol) of T3P (50% in DMF) were added. It was stirred at rt over night. 1.18 mL (2.03 mmol) of T3P (50% in DMF) and 1.06 mL (6.08 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred at rt over night. The reaction mixture was poured slowly into 40 mL of water. It was extracted three times with 20 mL of dichloromethane. The combined organic phases were washed once with 1N aqueous hydrochloric acid and 2N aqueous sodium carbonate solution. The aqueous wash of the second step was extracted with dichloromethane twice. The combined organic phases were washed with water, dried over magnesium sulfate and concentrated to obtain 434 mg (57% of theory) of the title compound.

    [0501] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.752 (0.42), 0.755 (0.41), 0.774 (0.43), 0.781 (0.41), 0.787 (0.77), 0.793 (1.40), 0.800 (1.03), 0.804 (0.85), 0.813 (0.53), 0.895 (0.49), 0.906 (0.62), 0.910 (1.23), 0.916 (0.81), 0.925 (0.93), 0.928 (0.93), 0.931 (0.92), 1.174 (0.45), 1.191 (0.44), 1.198 (0.41), 1.213 (0.45), 1.229 (0.53), 1.231 (0.53), 1.259 (0.53), 1.275 (0.45), 2.523 (1.69), 2.529 (1.09), 2.534 (0.95), 2.538 (0.83), 2.543 (0.69), 2.556 (0.46), 2.729 (11.12), 2.889 (16.00), 2.964 (0.45), 4.215 (0.57), 4.223 (0.79), 4.231 (0.55), 4.238 (0.41), 7.478 (1.12), 7.492 (0.55), 7.496 (1.08), 7.500 (0.59), 7.520 (1.51), 7.535 (0.96), 7.539 (1.96), 7.556 (0.83), 7.560 (0.53), 7.773 (1.68), 7.795 (1.73), 7.951 (1.91), 8.132 (1.31), 8.135 (1.82), 8.140 (0.89), 8.148 (0.60), 8.153 (1.92), 8.157 (1.36), 8.397 (1.03), 8.403 (1.06), 8.419 (0.90), 8.425 (0.99), 8.653 (1.92), 8.660 (1.86), 9.102 (2.19), 9.105 (2.25), 9.481 (2.04), 9.485 (2.07), 11.418 (1.72).

    [0502] LC-MS (Method 4): R.sub.t=1.32 min; MS (ESIpos): m/z=377 [M+H].sup.+.

    Intermediate 22

    3-amino-4-(cyclopropyloxy)-N-(5-phenylpyrazin-2-yl)benzamide

    [0503] ##STR00115##

    [0504] 400 mg (1.06 mmol) of 4-(cyclopropyloxy)-3-nitro-N-(5-phenylpyrazin-2-yl)benzamide (intermediate 21) were dissolved in 43 mL of MeOH/THF 1:1. 68 mg of palladium (10%) on charcoal were added and it was hydrogenated for 1 day under an atmosphere of hydrogen. This batch and a 30 mg batch which was reacted analogously were combined and filtered through celite. The filtrate was concentrated. The residue was dissolved in dichloromethane and washed with water. The aqueous phase was back extracted twice with dichloromethane. The combined organic phases were concentrated to give 387 mg (98% of theory) of the title compound.

    [0505] .sup.1H-NMR (600 MHz, DMSO-d.sub.6) [ppm]: 0.699 (1.22), 0.704 (1.79), 0.707 (1.95), 0.712 (2.11), 0.717 (1.54), 0.729 (2.76), 0.734 (2.84), 0.738 (7.31), 0.742 (12.02), 0.747 (7.80), 0.749 (5.93), 0.755 (3.57), 0.778 (1.06), 0.783 (1.22), 0.790 (1.46), 0.793 (1.71), 0.803 (2.03), 0.809 (1.54), 0.814 (1.38), 0.819 (1.22), 0.824 (0.97), 0.830 (0.97), 0.836 (3.41), 0.846 (9.58), 0.849 (7.88), 0.855 (7.72), 0.859 (8.53), 0.868 (2.44), 0.873 (1.22), 0.885 (1.87), 0.890 (0.73), 0.896 (0.97), 1.139 (0.73), 1.152 (1.06), 1.163 (1.14), 1.170 (0.97), 1.174 (1.38), 1.181 (0.97), 1.185 (1.38), 1.196 (1.54), 1.202 (1.71), 1.207 (2.36), 1.213 (1.62), 1.219 (1.38), 1.231 (2.52), 1.237 (2.76), 1.242 (2.60), 1.249 (2.76), 1.266 (5.04), 1.291 (1.71), 1.296 (1.95), 1.306 (1.71), 1.330 (0.81), 1.367 (0.49), 1.387 (13.24), 2.007 (0.41), 2.017 (0.41), 2.028 (0.57), 2.040 (0.65), 2.052 (0.41), 2.161 (0.41), 2.190 (0.65), 2.214 (1.71), 2.412 (3.57), 2.415 (5.12), 2.418 (3.65), 2.474 (0.49), 2.477 (0.57), 2.479 (0.57), 2.483 (0.57), 2.486 (0.41), 2.496 (0.57), 2.509 (1.71), 2.546 (10.56), 2.550 (10.80), 2.553 (9.10), 2.571 (0.57), 2.575 (0.41), 2.618 (0.57), 2.637 (1.54), 2.641 (3.74), 2.644 (5.12), 2.647 (3.57), 2.747 (1.62), 2.755 (1.62), 2.922 (0.49), 2.955 (8.12), 2.966 (0.49), 2.972 (7.15), 2.978 (0.81), 3.014 (0.49), 3.308 (0.41), 3.314 (0.49), 3.360 (0.41), 3.366 (0.89), 3.889 (0.41), 3.899 (0.41), 3.904 (0.49), 3.909 (0.49), 3.914 (0.57), 3.948 (1.79), 3.953 (3.17), 3.958 (4.71), 3.963 (6.25), 3.968 (4.47), 3.973 (3.17), 3.978 (1.54), 4.765 (0.57), 4.793 (0.65), 4.909 (15.59), 5.356 (0.41), 5.784 (14.62), 6.565 (0.57), 6.693 (0.73), 6.697 (0.73), 6.863 (0.41), 6.902 (0.97), 7.048 (0.57), 7.052 (0.57), 7.069 (0.41), 7.072 (0.49), 7.087 (0.65), 7.094 (0.89), 7.100 (0.65), 7.107 (0.57), 7.145 (1.06), 7.149 (1.30), 7.158 (0.49), 7.162 (0.97), 7.191 (10.88), 7.205 (12.35), 7.218 (0.41), 7.247 (0.57), 7.262 (0.65), 7.339 (0.57), 7.358 (14.21), 7.362 (15.68), 7.426 (8.12), 7.430 (7.23), 7.440 (6.90), 7.444 (6.58), 7.460 (0.73), 7.484 (1.71), 7.486 (3.09), 7.494 (2.11), 7.498 (8.53), 7.511 (6.09), 7.512 (3.90), 7.526 (0.49), 7.529 (0.49), 7.548 (10.15), 7.561 (16.00), 7.573 (6.66), 7.746 (0.57), 7.750 (1.14), 7.930 (0.57), 7.932 (0.65), 7.944 (0.65), 7.987 (0.81), 7.990 (0.89), 8.149 (12.18), 8.162 (14.38), 8.164 (9.58), 8.171 (0.81), 8.364 (1.14), 8.368 (1.14), 8.442 (0.57), 8.445 (0.57), 8.525 (0.65), 8.528 (0.65), 9.074 (15.11), 9.077 (14.46), 9.086 (0.97), 9.089 (0.97), 9.482 (15.68), 9.484 (15.43), 9.497 (0.65), 9.499 (0.65), 10.219 (0.89), 10.828 (12.67), 10.985 (0.49).

    [0506] LC-MS (Method 1): R.sub.t=1.16 min; MS (ESIpos): m/z=347 [M+H].sup.+.

    Intermediate 23

    3-nitro-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0507] ##STR00116##

    [0508] 1094 mg (4.36 mmol) of 3-nitro-4-(trifluoromethoxy)benzoic acid were dissolved in 10 mL of anh DMF. 7.4 mL (42.48 mmol) of N-ethyl-N-isopropylpropan-2-amine, 900 mg (5.23 mmol) of 5-(pyridin-3-yl)pyrazin-2-amine, and 6.4 mL (10.96 mmol) of T3P (50% in DMF) were added. It was stirred at rt over night. Water was added and the precipitate was filtered off by suction and washed three times with water. The solid material was dried yielding 1.4 g (79% of theory) of the title compound.

    [0509] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.882 (0.55), 0.918 (0.70), 0.937 (0.67), 1.135 (1.64), 1.188 (2.74), 1.204 (3.01), 1.214 (2.15), 1.221 (2.00), 1.227 (1.96), 1.244 (1.56), 1.263 (2.35), 1.279 (2.19), 1.479 (0.43), 1.908 (1.56), 2.317 (0.70), 2.322 (1.64), 2.327 (2.31), 2.332 (1.68), 2.336 (0.78), 2.523 (8.06), 2.660 (0.86), 2.665 (2.07), 2.669 (2.46), 2.674 (1.68), 2.679 (0.90), 2.731 (0.63), 2.890 (0.82), 2.917 (0.43), 3.008 (0.47), 3.062 (0.55), 3.081 (0.63), 3.155 (0.70), 3.175 (0.70), 3.357 (3.21), 7.533 (0.63), 7.551 (4.81), 7.553 (5.12), 7.565 (5.36), 7.571 (5.09), 7.573 (5.09), 7.585 (5.12), 7.902 (0.47), 7.923 (1.96), 7.928 (5.05), 7.932 (5.28), 7.949 (5.67), 7.953 (5.52), 7.958 (2.27), 7.982 (0.51), 7.989 (0.51), 8.228 (0.55), 8.240 (0.55), 8.254 (0.51), 8.435 (0.67), 8.454 (1.06), 8.459 (1.02), 8.465 (0.67), 8.483 (4.46), 8.489 (12.01), 8.495 (9.08), 8.503 (4.97), 8.507 (6.73), 8.511 (9.19), 8.516 (7.67), 8.580 (0.55), 8.586 (0.51), 8.644 (0.82), 8.648 (0.78), 8.655 (0.94), 8.660 (1.10), 8.668 (7.75), 8.672 (7.47), 8.680 (7.90), 8.684 (6.89), 8.713 (0.47), 8.855 (13.34), 8.860 (13.50), 8.874 (0.67), 9.071 (1.10), 9.075 (1.17), 9.207 (15.53), 9.211 (16.00), 9.269 (1.06), 9.273 (1.06), 9.278 (0.94), 9.283 (0.82), 9.324 (8.92), 9.331 (9.00), 9.521 (14.59), 9.526 (15.02), 9.546 (0.70), 11.727 (2.00).

    [0510] LC-MS (Method 4): R.sub.t=1.12 min; MS (ESIpos): m/z=406 [M+H].sup.+.

    Intermediate 24

    3-amino-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0511] ##STR00117##

    [0512] 940 mg (2.32 mmol) of 3-nitro-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide (intermediate 23) were dissolved in 90 mL of MeOH/THF 1:1. 470 mg of palladium (10%) on charcoal were added and it was hydrogenated under an atmosphere of hydrogen. The reaction mixture was filtered off through celite. It was washed with MeOH and the filtrate was concentrated. The residue was stirred at 50 C. for 30 minutes with MeOH. It was allowed to reach rt. The precipitate was filtered off and dried yielding 358 mg (33% of theory) of the title compound. The filtrate was purified by HPLC (method 5) to afford 45 mg (5% of theory) of the title compound.

    [0513] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.127 (0.44), 1.233 (0.67), 1.907 (1.11), 2.069 (2.44), 2.317 (0.67), 2.322 (1.78), 2.327 (2.44), 2.331 (1.78), 2.336 (0.89), 2.523 (8.44), 2.539 (2.22), 2.660 (0.89), 2.664 (1.78), 2.669 (2.44), 2.674 (1.78), 2.678 (0.89), 3.258 (1.11), 3.282 (2.67), 3.288 (3.56), 3.366 (5.33), 3.607 (0.44), 5.668 (16.00), 7.227 (1.78), 7.249 (9.78), 7.255 (14.44), 7.260 (11.78), 7.276 (1.78), 7.281 (2.22), 7.453 (11.56), 7.458 (11.56), 7.543 (4.89), 7.555 (5.11), 7.562 (4.89), 7.563 (5.33), 7.575 (5.33), 8.462 (4.00), 8.467 (5.78), 8.472 (4.44), 8.482 (4.22), 8.487 (5.78), 8.492 (4.22), 8.656 (7.56), 8.660 (7.56), 8.667 (7.56), 8.672 (7.56), 9.148 (15.33), 9.152 (16.00), 9.304 (9.11), 9.310 (9.78), 9.476 (15.33), 9.480 (15.56), 11.145 (9.33).

    [0514] LC-MS (Method 4): R.sub.t=0.99 min; MS (ESIpos): m/z=376 [M+H].sup.+.

    Intermediate 25

    3-[(chloroacetyl)amino]-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0515] ##STR00118##

    [0516] 150 mg (0.40 mmol) of 3-amino-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide (intermediate 24) were suspended in 6 mL of anh toluene. 64 L (0.80 mmol) of chloroacetyl chloride were added and it was stirred for 3 h at 100 C. The reaction mixture was concentrated, tert-butyl methyl ether was added, and it was sonicated in the ultrasonic bath. The solid was filtered off and dried under vacuum at 45 C. obtaining 168 mg (93% of theory) of the title compound.

    [0517] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.103 (0.67), 1.206 (0.82), 1.222 (0.82), 1.907 (1.08), 2.317 (0.49), 2.322 (1.10), 2.326 (1.51), 2.331 (1.08), 2.336 (0.49), 2.522 (3.28), 2.659 (0.51), 2.664 (1.15), 2.668 (1.56), 2.673 (1.13), 2.678 (0.51), 3.166 (2.67), 3.286 (0.51), 3.300 (0.64), 3.339 (0.85), 3.352 (1.00), 3.749 (0.92), 4.271 (12.36), 4.410 (16.00), 7.600 (0.56), 7.604 (1.51), 7.608 (1.56), 7.621 (0.79), 7.626 (1.77), 7.630 (1.64), 7.786 (1.13), 7.799 (1.23), 7.804 (1.18), 7.806 (1.26), 7.819 (1.18), 7.996 (2.15), 8.002 (2.28), 8.018 (1.90), 8.023 (2.08), 8.583 (3.44), 8.588 (3.46), 8.758 (1.36), 8.764 (1.18), 8.778 (3.54), 8.782 (2.90), 8.791 (2.74), 8.795 (1.82), 9.248 (4.44), 9.252 (4.67), 9.420 (2.77), 9.426 (3.00), 9.537 (4.56), 9.541 (4.56), 10.275 (3.46), 11.533 (4.13).

    [0518] LC-MS (Method 3): R.sub.t=1.08 min; MS (ESIpos): m/z=452 [M+H].sup.+.

    Intermediate 26

    N-(5-bromopyrazin-2-yl)-3-nitro-4-(trifluoromethoxy)benzamide

    [0519] ##STR00119##

    [0520] 3.00 g (11.95 mmol) of 3-nitro-4-(trifluoromethoxy)benzoic acid and 2.50 g (14.34 mmol) of 5-bromopyrazin-2-amine were dissolved in 50 mL of anh DMF. 12.5 mL (71.77 mmol) of N-ethyl-N-isopropylpropan-2-amine and 10.46 mL (17.92 mmol) of T3P (50% in DMF) were added. It was stirred for 2 days at rt. 2 mL (3.43 mmol) of T3P (50% in DMF) and 2 mL (11.48 mmol) of N-ethyl-N-isopropylpropan-2-amine were added and it was stirred for 1 day at rt. 2 mL (3.43 mmol) of T3P (50% in DMF) and 2 mL (11.48 mmol) of N-ethyl-N-isopropylpropan-2-amine were added and it was stirred at rt over the weekend. It was concentrated and water was added. It was extracted three times with dichloromethane. The combined organic phases were washed twice with water, dried over magnesium sulfate and concentrated. Ethanol was added to the residue and it was stirred for several minutes. It was filtered off under suction and the solid material was dried at 50 C. yielding 2.35 g (48% of theory) of the title compound.

    [0521] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.523 (1.50), 7.911 (4.96), 7.915 (5.11), 7.928 (2.38), 7.932 (5.43), 7.937 (5.16), 8.447 (7.14), 8.452 (7.39), 8.469 (6.52), 8.475 (6.77), 8.728 (15.88), 8.732 (15.98), 8.816 (13.16), 8.821 (13.08), 9.243 (16.00), 9.247 (14.79), 11.733 (8.60).

    [0522] LC-MS (Method 3): R.sub.t=1.15 min; MS (ESIpos): m/z=407 [M+H].sup.+.

    Intermediate 27

    3-amino-N-(5-bromopyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0523] ##STR00120##

    [0524] 1.10 g (2.70 mmol) of N-(5-bromopyrazin-2-yl)-3-nitro-4-(trifluoromethoxy)benzamide (intermediate 26) were dissolved in 22 mL of anh THF. At 0 C. 26.9 mL (31.65 mmol) of a 15% solution of titanium(III) chloride in 10% hydrogen chloride were added dropwise. It was stirred at rt over night. Two such batches were combined and solid sodium hydrogen carbonate was added carefully until the pH became basic. Then, solid sodium chloride was added. 300 mL of THF/ethyl acetate 1:1 were added and it was stirred for 2 h. It was filtered off and the filtrate was washed with water, dried over magnesium sulfate and concentrated. The residue was dried at 50 C. under vacuum to afford 2.00 g (98% of theory) of the title compound.

    [0525] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.145 (0.50), 1.155 (0.50), 1.173 (0.82), 1.191 (0.43), 1.353 (6.90), 1.987 (1.46), 2.182 (0.85), 2.317 (0.68), 2.322 (1.60), 2.326 (2.20), 2.331 (1.53), 2.336 (0.71), 2.522 (5.19), 2.659 (0.71), 2.664 (1.64), 2.668 (2.24), 2.673 (1.56), 2.678 (0.71), 5.680 (12.48), 6.868 (0.53), 7.201 (0.89), 7.206 (0.68), 7.222 (11.24), 7.226 (16.00), 7.249 (0.78), 7.409 (8.25), 7.411 (8.89), 7.415 (7.57), 8.674 (13.72), 8.678 (13.72), 8.691 (0.53), 8.695 (0.43), 9.207 (12.87), 9.211 (13.65), 9.239 (0.46), 9.242 (0.46), 11.189 (6.08).

    [0526] LC-MS (Method 4): R.sub.t=1.15 min; MS (ESIpos): m/z=377 [M+H].sup.+.

    Intermediate 28

    N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0527] ##STR00121##

    [0528] Step 1: 240 mg (0.64 mmol) of 3-amino-N-(5-bromopyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 27) and 104 L (1.28 mmol) of chloroacetyl chloride in 14.4 mL of anh toluene were stirred for 2 h at 100 C. The reaction mixture was cooled down and concentrated on the rotavap. Toluene was added and it was concentrated again on the rotavap. This procedure was repeated. The residue was dried under vacuum to give 289 mg of N-(5-bromopyrazin-2-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide which was used without further purification in the next step.

    [0529] Step 2: 289 mg (0.64 mmol) of N-(5-bromopyrazin-2-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide were dissolved in 7.2 mL of anh DMF. 133 L (0.96 mmol) of N,N-diethylethanamine and 106 L (0.96 mmol) of 1-methylpiperazine were added and it was stirred at rt over night. The reaction mixture was concentrated, water and saturated aqueous sodium hydrogen carbonate solution were added and it was extracted four times with ethyl acetate. The combined organic phases were washed twice with water, dried over magnesium sulfate and concentrated to obtain 205 mg (62% of theory) of the title compound.

    [0530] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.173 (0.66), 1.232 (0.44), 1.987 (1.23), 2.176 (16.00), 2.317 (0.59), 2.322 (0.97), 2.326 (1.23), 2.331 (1.08), 2.336 (0.78), 2.387 (0.90), 2.522 (2.18), 2.581 (2.05), 2.586 (1.98), 2.664 (0.74), 2.668 (0.96), 2.673 (0.70), 3.205 (10.63), 7.602 (1.28), 7.606 (1.27), 7.619 (0.66), 7.623 (1.54), 7.627 (1.39), 7.871 (2.01), 7.877 (1.99), 7.893 (1.65), 7.899 (1.69), 8.644 (0.41), 8.648 (0.42), 8.701 (4.35), 8.705 (4.22), 8.896 (3.06), 8.902 (3.11), 9.239 (4.44), 9.242 (4.51), 9.933 (3.03), 11.486 (1.46).

    [0531] LC-MS (Method 4): R.sub.t=0.81 min; MS (ESIpos): m/z=517 [M+H].sup.+.

    Intermediate 29

    N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0532] ##STR00122##

    [0533] Step 1: 970 mg (2.57 mmol) of 3-amino-N-(5-bromopyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 27) and 418 L (5.14 mmol) of chloroacetyl chloride in 47.1 mL of anh toluene were stirred for 2 h at 100 C. The reaction mixture was cooled down and concentrated on the rotavap. Toluene was added and it was concentrated again on the rotavap. This procedure was repeated. The residue was dried under vacuum to give 1166 mg of N-(5-bromopyrazin-2-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide which was used without further purification in the next step.

    [0534] Step 2: 1166 mg (2.57 mmol) of N-(5-bromopyrazin-2-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide were dissolved in 28.3 mL of anh DMF. 538 L (3.86 mmol) of N,N-diethylethanamine and 336 L (3.86 mmol) of morpholine were added and it was stirred at rt over night. The reaction mixture was concentrated, water and saturated aqueous sodium hydrogen carbonate solution were added and it was extracted four times with ethyl acetate. The combined organic phases were washed twice with water, dried over magnesium sulfate and concentrated. The residue was treated with diisopropyl ether, filtered off and dried under vacuum at 45 C. to give 1130 mg of the title compound containing 19 mol % of N-(5-chloropyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide.

    [0535] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.173 (0.83), 1.191 (0.41), 1.987 (1.51), 2.323 (0.44), 2.327 (0.59), 2.332 (0.44), 2.462 (0.50), 2.467 (0.56), 2.472 (0.68), 2.523 (2.12), 2.531 (0.78), 2.536 (0.68), 2.541 (0.64), 2.546 (0.77), 2.563 (5.46), 2.575 (7.71), 2.586 (5.85), 2.665 (0.49), 2.669 (0.64), 2.673 (0.48), 3.199 (0.42), 3.225 (16.00), 3.281 (0.46), 3.299 (0.54), 3.343 (0.44), 3.351 (0.42), 3.636 (5.95), 3.648 (8.17), 3.659 (5.78), 7.602 (1.91), 7.606 (2.00), 7.624 (2.27), 7.628 (2.12), 7.889 (2.60), 7.895 (2.74), 7.911 (2.20), 7.917 (2.30), 8.644 (1.20), 8.648 (1.18), 8.702 (5.31), 8.706 (4.85), 8.828 (4.18), 8.834 (4.44), 9.239 (5.46), 9.242 (6.32), 9.912 (4.56), 11.486 (2.40).

    [0536] LC-MS (Method 4): R.sub.t=0.96 min; MS (ESIpos): m/z=460 [M+H].sup.+.

    [0537] LC-MS (Method 4): R.sub.t=0.99 min; MS (ESIpos): m/z=504 [M+H].sup.+.

    Intermediate 30

    3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzoic acid

    [0538] ##STR00123##

    [0539] To a solution of 3-amino-4-(trifluoromethoxy)benzoic acid (10.0 g, 45.2 mmol, known from WO2008/75064A1) and pyridine (4.02 mL, 49.7 mmol, 1.1 equiv) in DCM (200 mL) at 0 C. was added chloroacetyl chloride (3.78 mL, 47.5 mmol, 1.05 equiv) dropwise. The resulting mixture was allowed to warm to room temperature and was stirred at that temperature for 3 h. The reaction mixture was treated with water and the phases were separated. The aqueous phase was extracted with a DCM/isopropanol mixture (4:1). The combined organic phases were washed with brine, dried and concentrated under reduced pressure to give 13.5 g of raw material which was used without further purification.

    [0540] LC-MS (Method 4): R.sub.t=0.95 min; MS (ESIpos): m/z=298 [M+H].sup.+.

    Intermediate 31

    3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic acid

    [0541] ##STR00124##

    [0542] To a solution of the compound of intermediate 30 (13.5 g, 45.2 mmol) in DMF (200 mL) was added morpholine (7.9 mL, 90.5 mmol, 2.0 equiv), triethylamine (12.6 mL, 90.5 mmol, 2.0 equiv) and potassium iodide (1.50 g, 9.05 mmol, 0.2 equiv). The reaction mixture was stirred at room temperature for 2 days. The resulting mixture was concentrated, and the remaining material was treated with water and extracted with a DCM/isopropanol solution (4:1). The combined organic phases were washed with saturated brine, dried (Na.sub.2SO.sub.4 anh), and concentrated under reduced pressure to give 15.9 g (91% of theory) of the title compound.

    [0543] LC-MS (Method 4): R.sub.t=0.74 min; MS (ESIpos): m/z=349 [M+H].sup.+.

    Intermediate 32

    methyl 4-(cyclopropyloxy)-3-nitrobenzoate

    [0544] ##STR00125##

    [0545] 10.00 g (44.81 mmol) of 4-(cyclopropyloxy)-3-nitrobenzoic acid and 880 L (16.18 mmol) of sulfuric acid (98%) in 27 mL of methanol were stirred for 24 h under reflux. 100 L (1.84 mmol) of sulfuric acid (98%) were added and it was stirred for 3 h under reflux. The reaction mixture was allowed to cool down. 40 mL of methanol was added and it was concentrated on a rotavap at 60 C. to ca. 20 mL. The reaction mixture was allowed to reach rt under stirring. The solid material was filtered off under suction and washed with ice cold methanol. It was dried under vacuum to obtain 7.6 g (72% of theory) of the title compound. The filtrate was concentrated and treated with 10 mL of methanol at 60 C. It was cooled down, filtered off and dried to obtain a second crop of 945 mg (9% of theory) of the title compound.

    [0546] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.756 (1.14), 0.764 (1.42), 0.769 (3.09), 0.776 (6.71), 0.780 (5.59), 0.783 (4.44), 0.787 (3.44), 0.795 (1.98), 0.830 (0.51), 0.835 (0.61), 0.839 (0.51), 0.849 (0.47), 0.875 (1.79), 0.890 (5.44), 0.896 (3.44), 0.901 (2.87), 0.905 (4.28), 0.908 (4.06), 0.911 (4.20), 0.924 (1.06), 0.926 (1.01), 3.319 (16.00), 4.175 (0.97), 4.182 (2.03), 4.190 (2.91), 4.198 (4.08), 4.205 (2.84), 4.213 (2.03), 4.220 (0.92), 7.744 (8.03), 7.766 (8.80), 8.224 (4.98), 8.229 (5.46), 8.245 (4.37), 8.251 (5.13), 8.370 (8.59), 8.376 (7.87).

    [0547] LC-MS (Method 4): R.sub.t=1.16 min; MS (ESIpos): m/z=238 [M+H].sup.+.

    Intermediate 33

    methyl 3-amino-4-(cyclopropyloxy)benzoate

    [0548] ##STR00126##

    [0549] 760 mg (3.20 mmol) of methyl 4-(cyclopropyloxy)-3-nitrobenzoate (intermediate 32) in 120 mL of methanol/THF 1:1 and 397 mg of palladium on calcium carbonate (10%) were hydrogenated under an atmosphere of hydrogen for ca. 16 h. It was filtered off through celite, washed with methanol and concentrated to afford 630 mg (95% of theory) of the title compound.

    [0550] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.666 (1.83), 0.672 (2.13), 0.679 (4.68), 0.685 (9.55), 0.688 (9.38), 0.692 (7.37), 0.696 (6.70), 0.704 (3.68), 0.733 (1.17), 0.738 (1.16), 0.746 (1.17), 0.748 (1.21), 0.773 (2.88), 0.783 (4.19), 0.787 (7.58), 0.802 (6.94), 0.806 (6.85), 0.807 (7.00), 0.822 (2.32), 0.842 (0.42), 1.354 (0.49), 2.522 (4.27), 2.668 (0.41), 3.322 (13.87), 3.739 (2.23), 3.813 (0.59), 3.870 (1.48), 3.877 (3.08), 3.884 (4.44), 3.892 (6.34), 3.899 (4.73), 3.907 (3.41), 3.914 (1.74), 3.948 (0.52), 4.907 (13.14), 7.132 (8.23), 7.152 (14.47), 7.200 (9.16), 7.205 (11.66), 7.221 (4.50), 7.226 (7.43), 7.234 (0.96), 7.252 (16.00), 7.257 (13.57).

    [0551] LC-MS (Method 3): R.sub.t=1.03 min; MS (ESIpos): m/z=208 [M+H].sup.+.

    Intermediate 34

    methyl 3-[(chloroacetyl)amino]-4-(cyclopropyloxy)benzoate

    [0552] ##STR00127##

    [0553] 2.5 mL (31.4 mmol) of chloroacetyl chloride were added to 3.26 g (15.73 mmol) of methyl 3-amino-4-(cyclopropyloxy)benzoate (intermediate 33) in 50 mL of anh toluene. It was stirred for 2 h at 100 C. It was concentrated and the residue was stirred with methanol. The solid material was filtered off under suction and dried at 45 C. under vacuum to obtain 2.93 g (66% of theory) of the title compound.

    [0554] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.763 (0.67), 0.772 (1.74), 0.778 (2.02), 0.786 (1.50), 0.794 (0.74), 0.844 (0.67), 0.853 (1.04), 0.858 (1.86), 0.868 (1.29), 0.872 (1.47), 0.875 (1.35), 0.877 (1.24), 2.523 (0.57), 3.825 (16.00), 4.026 (0.62), 4.034 (0.92), 4.041 (1.23), 4.049 (0.91), 4.056 (0.64), 4.384 (8.25), 7.440 (2.58), 7.462 (2.82), 7.772 (1.64), 7.777 (1.63), 7.793 (1.43), 7.798 (1.42), 8.586 (1.62), 8.592 (1.52), 9.466 (1.58).

    [0555] LC-MS (Method 3): R.sub.t=1.15 min; MS (ESIpos): m/z=282 [MH].sup.+.

    Intermediate 35

    methyl 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoate

    [0556] ##STR00128##

    [0557] 4.89 g (17.24 mmol) of methyl 3-[(chloroacetyl)amino]-4-(cyclopropyloxy)benzoate (intermediate 34 were suspended in 95 mL of anh DMF. 4.5 mL (25.9 mmol) of N-ethyl-N-isopropylpropan-2-amin, 3.77 mL (43.1 mmol) of morpholine and 443 mg (2.67 mmol) of potassium iodide were added. It was stirred at rt over night. It was concentrated on the rotavap. Methanol was added and it was concentrated again. This step was repeated. The residue was dried obtaining 5.63 g (98% of theory) of the title compound.

    [0558] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.744 (0.48), 0.751 (0.61), 0.757 (1.56), 0.764 (2.63), 0.770 (1.77), 0.775 (1.22), 0.783 (0.70), 0.889 (0.61), 0.904 (2.10), 0.909 (1.56), 0.918 (1.67), 0.924 (1.76), 0.939 (0.41), 2.528 (2.83), 2.539 (3.94), 2.551 (2.88), 3.143 (8.83), 3.638 (3.02), 3.650 (4.14), 3.661 (2.92), 3.823 (16.00), 4.082 (0.65), 4.090 (0.96), 4.097 (1.29), 4.104 (0.94), 4.112 (0.66), 7.428 (2.69), 7.450 (3.03), 7.726 (1.74), 7.732 (1.77), 7.748 (1.50), 7.754 (1.51), 8.831 (2.62), 8.837 (2.61), 9.699 (2.01).

    [0559] LC-MS (Method 3): R.sub.t=1.13 min; MS (ESIpos): m/z=335 [M+H].sup.+.

    Intermediate 36

    4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoic acid

    [0560] ##STR00129##

    [0561] 2.00 g (5.98 mmol) of methyl 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoate (intermediate 35) were dissolved in 20 mL of THF. 10 mL of methanol and 9 mL (18 mmol) of aqueous sodium hydroxide solution (2M) were added. It was stirred at rt over night. The volatiles were removed under vacuum and 20 mL of water were added. 9 mL of aqueous hydrochloric acid (2M) were added to adjust the pH to 3. The precipitate was filtered off under suction, washed twice with water and dried under vacuum at 45 C. obtaining 1.58 g (82% of theory) of the title compound.

    [0562] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.738 (0.87), 0.745 (1.13), 0.751 (2.67), 0.757 (4.53), 0.764 (3.18), 0.769 (2.10), 0.776 (1.27), 0.884 (1.07), 0.898 (3.68), 0.904 (2.77), 0.910 (2.15), 0.913 (2.94), 0.918 (3.13), 0.933 (0.73), 2.527 (4.90), 2.539 (6.85), 2.551 (5.08), 2.669 (0.41), 3.138 (16.00), 3.640 (5.23), 3.652 (7.23), 3.662 (5.26), 4.058 (0.58), 4.066 (1.17), 4.073 (1.70), 4.081 (2.28), 4.088 (1.65), 4.096 (1.18), 4.103 (0.56), 7.396 (4.81), 7.418 (5.37), 7.697 (3.44), 7.702 (3.20), 7.718 (2.84), 7.723 (2.94), 8.805 (5.10), 8.810 (4.88), 9.677 (3.82).

    [0563] LC-MS (Method 4): R.sub.t=0.67 min; MS (ESIpos): m/z=321 [M+H].sup.+.

    Intermediate 37

    N-[5-bromo-2-(trifluoromethoxy)phenyl]-2-chloroacetamide

    [0564] ##STR00130##

    [0565] 240 g (0.937 mol) of 5-bromo-2-(trifluoromethoxy)aniline were dissolved in 2400 mL of anh toluene. 112 mL (1.406 mol) of chloroacetyl chloride were added. It was stirred for 2 h at 100 C. The reaction mixture was concentrated on the rotavap. The residue was treated with 600 mL of cyclopentyl methyl ether and concentrated again. This procedure was performed twice yielding 324 g of the title compound.

    [0566] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=4.39 (s, 2H), 7.40-7.44 (m, 1H), 7.49 (dd, 1H), 8.20 (d, 1H), 10.23 (s, 1H).

    [0567] LC-MS (Method 4): R.sub.t=1.27 min; MS (ESIpos): m/z=332 [M+H].sup.+.

    Intermediate 38

    N-[5-bromo-2-(trifluoromethoxy)phenyl]-2-(4-methylpiperazin-1-yl)acetamide

    [0568] ##STR00131##

    [0569] 162 g (0.487 mol) of N-[5-bromo-2-(trifluoromethoxy)phenyl]-2-chloroacetamide (intermediate 37) were dissolved in 1620 mL of anh DMF. 136 mL (0.974 mol) of N,N-diethylethanamine and 16.2 g (97.44 mmol) of potassium iodide were added. It was stirred over night at rt. A second batch of the same size was prepared under analogous conditions. The two batches were combined. The reaction mixtures were concentrated and the residue was stirred with 3 L of water and 700 mL of ethanol for 1 h. The solid was filtered off with suction and dried at 50 C. under vacuum to afford 317 g (82% of theory) of the title compound.

    [0570] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.21-2.48 (m, 4H), 2.52-2.64 (m, 4H), 3.19 (s, 2H), 7.39-7.47 (m, 2H), 8.54 (d, 1H), 9.92 (s, 1H).

    [0571] LC-MS (Method 1): R.sub.t=0.81 min; MS (ESIpos): m/z=396 [M+H].sup.+.

    Intermediate 39

    ethyl 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoate

    [0572] ##STR00132##

    [0573] 60 g (0.151 mol) of N-[5-bromo-2-(trifluoromethoxy)phenyl]-2-(4-methylpiperazin-1-yl)acetamide (intermediate 38) were dissolved in 600 mL of ethanol. 450 mg (0.76 mmol) of dichloropalladium-propane-1,3-diylbis(diphenylphosphine) (1:1) and 53 mL (0.380 mol) of N,N-diethylethanamine were added. The 2000 mL autoclave was charged with 12.5 bar of carbon monoxide and was stirred for 16 h at 100 C. The reaction mixture was concentrated under vacuum and the residue was treated with dichloromethane. The insoluble material was filtered off and washed with dichloromethane. The filtrate was concentrated under vacuum and purified on silica gel (gradient dichloromethane/methanol) to yield 54 g (92% of theory) of the title compound, which contained approximately 0.5 mole of N,N-diethylethanamine.

    [0574] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=1.31 (t, 3H), 2.24 (s, 3H), 2.37-2.53 (m, 4H and DMSO signal), 2.60 (br. s, 4H), 3.20 (s, 2H), 4.32 (q, 2H), 7.55-7.60 (m, 1H), 7.78 (dd, 1H), 8.86 (d, 1H), 9.89 (s, 1H).

    [0575] LC-MS (Method 4): R.sub.t=0.81 min; MS (ESIpos): m/z=390 [M+H].sup.+.

    Intermediate 40

    lithium 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoate

    [0576] ##STR00133##

    [0577] 20 g (51.36 mmol) of ethyl 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoate (intermediate 39) were dissolved in 50 mL of dioxane and 2 mL of water. 3.23 g (77.05 mmol) of lithium hydroxide monohydrate were added and it was stirred for 24 h at rt. The precipitate was filtered off and washed with dioxane to yield 17.0 g (90% of theory) of the title compound, which was used without further treatment.

    [0578] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.15 (s, 3H), 2.36 (br. s, 4H), 2.54 (br. s, 4H), 3.13 (s, 2H), 7.28 (dd, 1H), 7.67 (dd, 1H), 8.70 (s, 1H), 9.70 (br. s, 1H).

    [0579] LC-MS (Method 1): R.sub.t=0.61 min; MS (ESIpos): m/z=362 [M+2HLi].sup.+.

    EXAMPLES

    Example 1

    N-[6-(6-aminopyridin-3-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0580] ##STR00134##

    [0581] 900 mg (2.39 mmol) of the compound of intermediate 1 were provided in 20 mL of toluene, 0.29 mL (3.58 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 1.05 g of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To a suspension of this raw material in 17 mL of DMF were added 0.65 mL of triethylamine (4.63 mmol), 0.51 mL of methylpiperazine (4.63 mmol), and 77 mg of potassium iodide (0.46 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with 500 mL of water and 300 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 540 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 100 mg of this raw material, 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-amine (64.0 mg, 0.29 mmol), cesium carbonate (126 mg, 0.39 mmol) and a DMF/water mixture (2:1, 3 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The precipitate was removed by filtration and dried under reduced pressure to give 52.0 mg (51% of theory) of the title compound.

    [0582] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.31-2.45 (m, 4H), 2.55-2.64 (m, 4H), 3.21 (s, 2H), 6.38 (s, 2H), 6.58 (d, 1H), 7.61 (dd, 1H), 7.94 (d, 1H), 8.11-8.19 (m, 2H), 8.35 (d, 1H), 8.68 (d, 1H), 8.92 (d, 1H), 9.92 (s, 1H), 11.59 (s, 1H).

    [0583] LC-MS (Method 3): R.sub.t=1.00 min; MS (ESIpos): m/z=531 [M+H].sup.+.

    Example 2

    [0584] 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[6-(pyrimidin-5-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide

    ##STR00135##

    [0585] 900 mg (2.39 mmol) of the compound of intermediate 1 were provided in 20 mL of toluene, 0.29 mL (3.58 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 1.05 g of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To a suspension of this raw material in 17 mL of DMF were added 0.65 mL of triethylamine (4.63 mmol), 0.51 mL of methylpiperazine (4.63 mmol), and 77 mg of potassium iodide (0.46 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with 500 mL of water and 300 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 540 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 100 mg of this raw material, pyrimidin-5-ylboronic acid (36.0 mg, 0.29 mmol), cesium carbonate (126 mg, 0.39 mmol) and a DMF/water mixture (2:1, 3 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. Pyrimidin-5-ylboronic acid (36.0 mg, 0.29 mmol) and cesium carbonate (126 mg, 0.39 mmol) were added. The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 10.0 mg (10% of theory) of the title compound.

    [0586] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.32-2.45 (m, 4H), 2.56-2.64 (m, 4H), 3.22 (s, 2H), 7.63 (dd, 1H), 7.96 (dd, 1H), 8.43-8.57 (m, 2H), 8.95 (d, 1H), 9.33 (s, 1H), 9.50 (s, 2H), 9.94 (s, 1H), 11.80 (s, 1H).

    [0587] LC-MS (Method 3): R.sub.t=0.97 min; MS (ESIpos): m/z=517 [M+H].sup.+.

    Example 3

    N-[6-(2-aminopyrimidin-5-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0588] ##STR00136##

    [0589] 900 mg (2.39 mmol) of the compound of intermediate 1 were provided in 20 mL of toluene, 0.29 mL (3.58 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 1.05 g of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To a suspension of this raw material in 17 mL of DMF were added 0.65 mL of triethylamine (4.63 mmol), 0.51 mL of methylpiperazine (4.63 mmol), and 77 mg of potassium iodide (0.46 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with 500 mL of water and 300 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 540 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 100 mg of this raw material, (2-aminopyrimidin-5-yl)boronic acid (40.0 mg, 0.29 mmol), cesium carbonate (126 mg, 0.39 mmol) and a DMF/water mixture (2:1, 3 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The precipitate was removed by filtration and dried under reduced pressure to give 72.0 mg (70% of theory) of the title compound.

    [0590] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.34-2.46 (m, 4H), 2.55-2.64 (m, 4H), 3.21 (s, 2H), 7.09 (s, 2H), 7.61 (d, 1H), 7.94 (dd, 1H), 8.20 (d, 1H), 8.38 (d, 1H), 8.93 (d, 1H), 8.97 (s, 2H), 9.92 (s, 1H), 11.64 (s, 1H).

    [0591] LC-MS (Method 3): R.sub.t=0.96 min; MS (ESIpos): m/z=532 [M+H].sup.+.

    Example 4

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[6-(pyridin-3-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide

    [0592] ##STR00137##

    [0593] 900 mg (2.39 mmol) of the compound of intermediate 1 were provided in 20 mL of toluene, 0.29 mL (3.58 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 1.05 g of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To a suspension of this raw material in 17 mL of DMF were added 0.65 mL of triethylamine (4.63 mmol), 0.51 mL of methylpiperazine (4.63 mmol), and 77 mg of potassium iodide (0.46 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with 500 mL of water and 300 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 540 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 100 mg of this raw material, pyridin-3-ylboronic acid (36.0 mg, 0.29 mmol), cesium carbonate (126 mg, 0.39 mmol) and a DMF/water mixture (2:1, 3 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. Pyridin-3-ylboronic acid (36.0 mg, 0.29 mmol) and cesium carbonate (126 mg, 0.39 mmol) were added. The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 7.9 mg (8% of theory) of the title compound.

    [0594] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.32-2.45 (m, 4H), 2.56-2.65 (m, 4H), 3.22 (s, 2H), 7.56-7.67 (m, 2H), 7.96 (dd, 1H), 8.37-8.44 (m, 1H), 8.48-8.54 (m, 2H), 8.72 (dd, 1H), 8.94 (d, 1H), 9.31 (d, 1H), 9.94 (s, 1H), 11.66 (s, 1H).

    [0595] LC-MS (Method 3): R.sub.t=0.70 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    Example 5

    3-({[4-(2,2-difluoroethyl)piperazin-1-yl]acetyl}amino)-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0596] ##STR00138##

    [0597] To a suspension of 99.0 mg (0.22 mmol) of the compound of intermediate 9 in 1.3 mL of DMF were added 0.06 mL of triethylamine (0.44 mmol, 2 equiv), 0.06 mL of 1-(2,2-difluoroethyl)piperazine (0.44 mmol, 2 equiv), and 7.0 mg of potassium iodide (0.04 mmol, 0.2 equiv). The reaction mixture was stirred at room temperature over night. After filtration, purification by HPLC (method 2) yielded 13.5 mg (10% of theory) of the title compound.

    [0598] .sup.1H-NMR (500 MHz, DMSO-d.sub.6): [ppm]=2.56-2.63 (m, 8H), 2.75 (td, 2H), 3.22 (s, 2H), 6.14 (tt, 1H), 7.49-7.59 (m, 3H), 7.61 (d, 1H), 7.97 (dd, 1H), 8.11-8.16 (m, 2H), 8.25-8.32 (m, 1H), 8.45 (d, 1H), 8.91 (d, 1H), 9.89 (s, 1H), 11.71 (s, 1H).

    [0599] LC-MS (Method 3): R.sub.t=1.32 min; MS (ESIpos): m/z=565 [M+H].sup.+.

    Example 6

    N-{3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)phenyl}-5-phenylpyrazine-2-carboxamide

    [0600] ##STR00139##

    [0601] A solution of the regioisomeric mixture 7 (200 mg, 1.00 mmol as approx. 1:1 mixture of regioisomers) and the compound of intermediate 6 (319 mg, 1.00 mmol) in DMF (6.00 mL) was treated with diisopropylethylamine (522 L, 3.00 mmol) and (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 780 mg, 1.50 mmol). The mixture was stirred over night at room temperature and afterwards poured into water. The water was removed by decantation and the residue was suspended in a mixture of ethanol/methanol. The resulting fine precipitate was collected by filtration and dried to yield the desired product 6 (125 mg, 50% with respect to 500 mol of starting material 7). The filtrate was concentrated and proceeded further to provide the corresponding regioisomer.

    [0602] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): [ppm]=2.54-2.63 (m, 4H), 3.21 (s, 2H), 3.64-3.68 (m, 4H), 7.46 (dd, 1H), 7.57-7.64 (m, 3H), 7.76 (dd, 1H), 8.27 (dd, 2H), 8.89 (d, 1H), 9.35 (dd, 2H), 9.80 (s, 1H), 10.97 (s, 1H).

    [0603] LC-MS (Method 1): R.sub.t=1.18 min; MS (ESIpos): m/z=502 [M+H].sup.+.

    Example 7

    3-[(morpholin-4-ylacetyl)amino]-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0604] ##STR00140##

    [0605] To a solution of the compound of intermediate 3 (113 mg, 324 mol) and 6-phenylpyridazin-3-amine (83.3 mg, 487 mol) in DMF (1.2 mL) were added (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PYBOP, 253 mg, 487 mol) and N,N-diisopropylethylamine (170 L, 0.97 mmol). The reaction mixture was stirred over night at room temperature. The mixture was poured into water. The resulting precipitate was collected by filtration, washed with water and dried at 40 C. under reduced pressure to yield the title compound 7 (62.0 mg, 37%).

    [0606] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.55-2.61 (m, 4H), 3.24 (s, 2H), 3.62-3.71 (m, 4H), 7.0-7.64 (m, 4H), 7.90-8.01 (m, 1H), 8.13-8.15 (m, 2H), 8.31 (d, 1H), 8.47 (d, 1H), 8.87 (d, 1H), 9.91 (s, 1H), 11.71 (m, 1H).

    [0607] LC-MS (Method 1): R.sub.t=1.05 min; MS (ESIpos): m/z=502 [M+H].sup.+.

    Example 8

    3-{[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]hept-5-ylacetyl]amino}-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0608] ##STR00141##

    [0609] A solution of the compound of intermediate 9 (150 mg, 333 mol) in DMF (1.43 mL) was treated with (1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptane (55 L, 499 mol), triethylamine (139 L, 998 mol) and potassium iodide (11.0 mg, 67 mol). The reaction mixture was stirred over night at room temperature. The precipitate was collected by filtration, washed with ethyl acetate and dried in vacuum to provide the desired product 8 (33.5 mg, 70 mol, 20%).

    [0610] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=1.65-1.72 (m, 1H), 1.77-1.84 (m, 1H), 2.65-2.71 (m, 1H), 2.87-2.94 (m, 1H), 3.46 (s, 2H), 3.63 (s, 2H), 3.81-3.86 (m, 1H), 4.42-4.46 (m, 1H), 7.49-7.66 (m, 4H), 7.93-7.99 (m, 1H), 8.13 (s, 2H), 8.33 (s, 1H), 8.50-8.45 (m, 1H), 8.89 (d, 1H), 9.99-10.04 (m, 1H), 11.71-11.76 (m, 1H).

    [0611] LC-MS (Method 4): R.sub.t=0.93 min; MS (ESIpos): m/z=514 [M+H].sup.+.

    Example 9

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(6-phenylpyridazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0612] ##STR00142##

    [0613] A solution of the compound of intermediate 9 (150 mg, 333 mol) in DMF (1.43 mL) was treated with 1-methylpiperazine (50.0 mg, 499 mol), triethylamine (139 L, 998 mol) and potassium iodide (11.0 mg, 67 mol). The reaction mixture was stirred over night at room temperature. The precipitate was collected by filtration, washed with ethyl acetate and dried in vacuum. The crude material was triturated with ethanol and subsequently purified by flash-chromatography on silica gel (eluent: hexane/ethyl acetate) to provide the desired product 9 (47.4 mg, 28%).

    [0614] .sup.1H-NMR (300 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.35-2.44 (m, 4H), 2.56-2.63 (m, 4H), 3.22 (s, 2H), 7.49-7.60 (m, 3H), 7.61-7.65 (m, 1H), 7.93-8.00 (m, 1H), 8.12-8.15 (m, 2H), 8.31 (d, 1H), 8.47 (d, 1H), 8.94 (d, 1H), 9.94 (s, 1H), 11.67-11.76 (m, 1H).

    [0615] LC-MS (Method 4): R.sub.t=0.94 min; MS (ESIpos): m/z=515 [M+H].sup.+.

    Example 10

    3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0616] ##STR00143##

    [0617] mg (0.134 mmol) of 3-amino-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 11) were dissolved in 0.5 mL of anh DMF and 0.105 mL (0.601 mmol) of N-ethyl-N-isopropylpropan-2-amine. To this solution 23 mg (0.160 mmol) of morpholin-4-ylacetic acid and 255 mg (0.401 mmol) of propanephosphonic acid cyclic anhydride solution (50% in DMF) were added. It was stirred 4 h at rt and over night at 40 C. The reaction mixture was concentrated. The residue was dissolved in 30 mL dichloromethane and washed twice with water. The organic layer was concentrated and purified by HPLC (Chromatorex RP C-18 10 m; 12530 mm; 60 mL/min; gradient: acetonitrile/water with 0.1 vol % formic acid (99%)) to give 17 mg (25%) of the title compound.

    [0618] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.57-2.62 (m, 4H), 3.25 (s, 2H), 3.64-3.69 (m, 4H), 7.46-7.57 (m, 3H), 7.61-7.65 (m, 1H), 7.95 (dd, 1H), 8.13-8.17 (m, 2H), 8.86 (d, 1H), 9.10 (d, 1H), 9.48 (d, 1H), 9.93 (s, 1H), 11.40 (s, 1H).

    [0619] LC-MS (Method 4): R.sub.t=1.10 min; MS (ESIpos): m/z=502 [M+H].sup.+.

    Example 11

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0620] ##STR00144##

    [0621] 100 mg (0.267 mmol) of 3-amino-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 11) were dissolved in 1 mL of anh DMF and 0.209 mL (1.202 mmol) of N-ethyl-N-isopropylpropan-2-amine. 51 mg (0.321 mmol) of (4-methylpiperazin-1-yl)acetic acid and 510 mg (0.801 mmol) of propanephosphonic acid cyclic anhydride solution (50% in DMF) were added. It was stirred 3 h at rt and over night at 40 C. 43 mg (0.267 mmol) of (4-methylpiperazin-1-yl)acetic acid, 0.046 mL (0.267 mmol) of N-ethyl-N-isopropylpropan-2-amine and 170 mg (0.267 mmol) of propanephosphonic acid cyclic anhydride solution (50% in DMF) were added. It was stirred 4 h at 40 C. The volatiles were removed under vacuum. The residue was dissolved in 30 mL dichloromethane and washed twice with water. The organic layer was concentrated and purified by HPLC (Chromatorex RP C-18 10 m; 12530 mm; 60 mL/min; gradient: acetonitrile/water with 0.1 vol % formic acid (99%)) to yield 34 mg (24%) of the title compound.

    [0622] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.17 (s, 3H), 2.29-2.45 (m, 4H), 2.54-2.62 (m, 4H), 3.20 (s, 2H), 7.44-7.49 (m, 1H), 7.50-7.56 (m, 2H), 7.58-7.63 (m, 1H), 7.91 (dd, 1H), 8.11-8.15 (m, 2H), 8.92 (d, 1H), 9.08 (d, 1H), 9.46 (d, 1H), 9.92 (s, 1H), 11.37 (s br., 1H).

    [0623] LC-MS (Method 4): R.sub.t=0.91 min; MS (ESIpos): m/z=515 [M+H].sup.+.

    Example 12

    N-[6-(2-fluoropyridin-3-yl)pyridazin-3-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0624] ##STR00145##

    [0625] 900 mg (2.39 mmol) of the compound of intermediate 1 were provided in 20 mL of toluene, 0.29 mL (3.58 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 1.05 g of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To a suspension of this raw material in 17 mL of DMF were added 0.65 mL of triethylamine (4.63 mmol), 0.51 mL of methylpiperazine (4.63 mmol), and 77 mg of potassium iodide (0.46 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with 500 mL of water and 300 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 540 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 100 mg of this raw material, 2-fluoro-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (65.0 mg, 0.29 mmol), cesium carbonate (126 mg, 0.39 mmol) and a DMF/water mixture (2:1, 3 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. 2-Fluoro-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (65.0 mg, 0.29 mmol) and cesium carbonate (126 mg, 0.39 mmol) were added. The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. 2-Fluoro-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (65.0 mg, 0.29 mmol) and cesium carbonate (126 mg, 0.39 mmol) were added. The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 6.8 mg, 0.01 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (Waters Auto purification system, column: XBrigde C18 5 m 10030 mm, solvent: water/acetonitrile+0.1% formic acid gradient, rate: 70 mL/min, temperature: room temperature) yielded 25.0 mg (24% of theory) of the title compound.

    [0626] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): [ppm]=2.19 (s, 3H), 2.55-2.64 (m, 4H), 3.22 (s, 2H), 7.59 (ddd, 1H), 7.63 (dd, 1H), 7.94-7.97 (m, 1H), 8.20 (dd, 1H), 8.41 (d, 1H), 8.51-8.60 (m, 2H), 8.94 (d, 1H), 9.94 (s, 1H), 11.82 (s, 1H).

    [0627] LC-MS (Method 4): R.sub.t=0.81 min; MS (ESIpos): m/z=534 [M+H].sup.+.

    Example 13

    N-[6-(2-aminopyrimidin-5-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0628] ##STR00146##

    [0629] To a solution of the compound of intermediate 13 (1.00 g, 2.46 mmol) in 32 mL of tetrahydrofuran was added a 15% solution of titanium(III) chloride in 10% hydrogen chloride dropwise (21 mL, 24.6 mmol, 10 equiv) at 0 C. The reaction mixture was allowed to warm up to room temperature and was stirred for 3 h. The pH of the mixture was adjusted under stirring with solid sodium bicarbonate to 7. The suspension was saturated with solid sodium chloride and stirred with 60 mL of a 1:1 mixture of tetrahydrofuran/ethyl acetate for 2 h. The suspension was filtered and the filtrate was washed with brine, dried over sodium sulfate and concentrated under reduced pressure. The residue was purified using MPLC (Biotage Isolera; silica gel; hexane/EtOAc gradient) to give 700 mg of a 2:1 mixture of 3-amino-N-(6-bromopyridazin-3-yl)-4-(trifluoromethoxy)benzamide and 3-amino-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide. This material was provided in 16 mL of toluene, 0.22 mL (2.78 mmol) of chloroacetyl chloride were added, and the mixture was stirred for 2 h at 100 C. After concentration 804 mg of a mixture of N-(6-bromopyridazin-3-yl)-3-[(chloroacetyl)amino]-4-(trifluoromethoxy)benzamide and 3-[(chloroacetyl)amino]-N-(6-chloropyridazin-3-yl)-4-(trifluoromethoxy)benzamide were obtained, which were used without further purification. To this material in 15 mL of DMF were added 0.52 mL of triethylamine (3.70 mmol), 0.32 mL of morpholine (3.70 mmol), and 61 mg of potassium iodide (0.37 mmol). The reaction mixture was stirred at room temperature over night. After concentration, the remaining material was triturated with a mixture of 20 mL of water and 10 mL of ethanol and stirred for 30 minutes. The precipitate was removed by filtration, washed with ethanol and dried under reduced pressure to yield 790 mg of a 1:3 mixture of N-(6-bromopyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide, which were used without further purification. To a microwave vial was added 150 mg of this material, (2-aminopyrimidin-5-yl)boronic acid (74.0 mg, 0.54 mmol), cesium carbonate (194 mg, 0.60 mmol) and a DMF/water mixture (2:1, 4.5 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2C.sub.12, 10.4 mg, 0.02 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the precipitate in the aqueous phase was collected by filtration, washed with ethyl acetate and dried to give 83.0 mg of the title compound.

    [0630] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.55-2.61 (m, 4H), 3.23 (s, 2H), 3.61-3.69 (m, 4H), 7.10 (s, 2H), 7.61 (dd, 1H), 7.96 (dd, 1H), 8.20 (d, 1H), 8.38 (d, 1H), 8.86 (d, 1H), 8.96 (s, 2H), 9.91 (s, 1H), 11.66 (s, 1H).

    [0631] LC-MS (Method 4): R.sub.t=0.75 min; MS (ESIpos): m/z=519 [M+H].sup.+.

    Example 14

    3-[(morpholin-4-ylacetyl)amino]-N-[6-(pyridin-3-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide

    [0632] ##STR00147##

    [0633] To a microwave vial was added 150 mg of a 1:3 mixture of N-(6-bromopyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide described in example 13, pyridin-3-ylboronic acid (66.0 mg, 0.54 mmol), cesium carbonate (194 mg, 0.60 mmol) and a DMF/water mixture (2:1, 4.5 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 10.4 mg, 0.02 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 31.5 mg (20% of theory) of the title compound.

    [0634] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.56-2.61 (m, 4H), 3.24 (s, 2H), 3.63-3.69 (m, 4H), 7.57-7.66 (m, 2H), 7.98 (dd, 1H), 8.40 (d, 1H), 8.49-8.54 (m, 2H), 8.72 (dd, 1H), 8.88 (d, 1H), 9.29-9.33 (m, 1H), 9.92 (s, 1H), 11.77 (s, 1H).

    [0635] LC-MS (Method 4): R.sub.t=0.79 min; MS (ESIpos): m/z=503 [M+H].sup.+.

    Example 15

    3-[(morpholin-4-ylacetyl)amino]-N-[6-(pyrimidin-5-yl)pyridazin-3-yl]-4-(trifluoromethoxy)benzamide

    [0636] ##STR00148##

    [0637] To a microwave vial was added 150 mg of a 1:3 mixture of N-(6-bromopyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide described in example 13, pyrimidin-5-ylboronic acid (66.0 mg, 0.54 mmol), cesium carbonate (194 mg, 0.60 mmol) and a DMF/water mixture (2:1, 4.5 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 10.4 mg, 0.02 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 11.5 mg (8% of theory) of the title compound.

    [0638] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.56-2.62 (m, 4H), 3.24 (s, 2H), 3.62-3.69 (m, 4H), 7.63 (dd, 1H), 7.98 (dd, 1H), 8.45 (d, 1H), 8.53 (d, 1H), 8.88 (d, 1H), 9.32 (s, 1H), 9.50 (s, 2H), 9.92 (s, 1H), 11.85 (s, 1H).

    [0639] LC-MS (Method 4): R.sub.t=0.78 min; MS (ESIpos): m/z=504 [M+H].sup.+.

    Example 16

    N-[6-(6-aminopyridin-3-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0640] ##STR00149##

    [0641] To a microwave vial was added 150 mg of a 1:3 mixture of N-(6-bromopyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide described in example 13, 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-amine (118 mg, 0.54 mmol), cesium carbonate (194 mg, 0.60 mmol) and a DMF/water mixture (2:1, 4.5 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 10.4 mg, 0.02 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 14.5 mg (9% of theory) of the title compound.

    [0642] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.56-2.60 (m, 4H), 3.23 (s, 2H), 3.62-3.69 (m, 4H), 6.40 (s, 2H), 6.57 (d, 1H), 7.62 (dd, 1H), 7.96 (dd, 1H), 8.12-8.20 (m, 2H), 8.35 (d, 1H), 8.68 (s, 1H), 8.86 (d, 1H), 9.91 (s, 1H), 11.60 (s, 1H).

    [0643] LC-MS (Method 1): R.sub.t=0.75 min; MS (ESIpos): m/z=518 [M+H].sup.+.

    Example 17

    N-[6-(2-fluoropyridin-3-yl)pyridazin-3-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0644] ##STR00150##

    [0645] To a microwave vial was added 150 mg of a 1:3 mixture of N-(6-bromopyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide and N-(6-chloropyridazin-3-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide described in example 13, 2-fluoro-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (119 mg, 0.54 mmol), cesium carbonate (194 mg, 0.60 mmol) and a DMF/water mixture (2:1, 4.5 mL). The resulting suspension was purged with argon, treated with dichloro[bis(triphenylphosphoranyl)]palladium (Pd(PPh.sub.3).sub.2Cl.sub.2, 10.4 mg, 0.02 mmol) and sealed. The resulting mixture was heated with a microwave apparatus at 100 C. for 0.5 h, was then cooled to room temperature. The reaction mixture was diluted with water and ethyl acetate. The phases were separated and the aqueous phase was extracted with ethyl acetate. The combined organic phases were washed with water, dried over sodium sulfate and concentrated. Purification by HPLC (method 2) yielded 44.0 mg (28% of theory) of the title compound.

    [0646] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.56-2.61 (m, 4H), 3.24 (s, 2H), 3.62-3.70 (m, 4H), 7.56-7.67 (m, 2H), 7.98 (dd, 1H), 8.20 (dd, 1H), 8.39-8.43 (m, 1H), 8.51-8.61 (m, 2H), 8.88 (d, 1H), 9.92 (s, 1H), 11.83 (s, 1H).

    [0647] LC-MS (Method 1): R.sub.t=1.00 min; MS (ESIpos): m/z=521 [M+H].sup.+.

    Example 18

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(6-phenyl-1,2,4-triazin-3-yl)-4-(trifluoromethoxy)benzamide

    [0648] ##STR00151##

    [0649] To a solution of the compound of intermediate 16 (45 mg, 0.10 mmol) in DMF (1 mL) was added 1-methylpiperazine (0.02 mL, 0.20 mmol, 2 equiv), triethylamine (0.03 mL, 0.20 mmol, 2 equiv) and potassium iodide (3.3 mg, 0.02 mmol, 0.2 equiv). The reaction mixture was stirred at room temperature for 3 days. The resulting mixture was concentrated, triturated with water and extracted with ethyl acetate. The combined organic phases were dried over sodium sulfate and concentrated under reduced pressure. Purification by HPLC (method 5) yielded 4.6 mg (8% of theory) of the title compound.

    [0650] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.28-2.50 (m, 4H), 2.55-2.71 (m, 4H), 3.21 (s, 2H), 7.55-7.64 (m, 4H), 7.88 (dd, 1H), 8.15-8.22 (m, 2H), 8.90 (d, 1H), 9.31 (s, 1H), 9.93 (s, 1H).

    [0651] LC-MS (Method 1): R.sub.t=0.94 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    Example 19

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrimidin-2-yl)-4-(trifluoromethoxy)benzamide

    [0652] ##STR00152##

    [0653] To a solution of the compound of intermediate 19 (23 mg, 0.05 mmol) in DMF (1 mL) was added 1-methylpiperazine (11 L, 0.10 mmol, 2 equiv), triethylamine (14 L, 0.10 mmol, 2 equiv) and potassium iodide (1.7 mg, 0.01 mmol, 0.2 equiv). The reaction mixture was stirred at room temperature over night. The resulting mixture was filtered. Purification by HPLC (method 5) yielded 6.1 mg (22% of theory) of the title compound.

    [0654] .sup.1H-NMR (400 MHz, DMSO-d.sub.6): [ppm]=2.18 (s, 3H), 2.29-2.47 (m, 4H), 2.54-2.65 (m, 4H), 3.20 (s, 2H), 7.43-7.48 (m, 1H), 7.51-7.56 (m, 2H), 7.57-7.62 (m, 1H), 7.79-7.85 (m, 3H), 8.85 (d, 1H), 9.07 (s, 2H), 9.92 (s, 1H), 11.28 (s, 1H).

    [0655] LC-MS (Method 4): R.sub.t=0.82 min; MS (ESIpos): m/z=515 [M+H].sup.+.

    Example 20

    3-({[1-(morpholin-4-yl)cyclopropyl]carbonyl}amino)-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide

    [0656] ##STR00153##

    [0657] 292 mg (1.41 mmol) of 1-(morpholin-4-yl)cyclopropanecarboxylic acid hydrochloride (intermediate 20) were suspended in 5 mL of anh dichloromethane. 465 L (3.51 mmol) of 1-chloro-N,N,2-trimethylprop-1-en-1-amine were added and it was stirred for 2 h at rt. The reaction mixture was concentrated, treated with anh dichloromethane and concentrated again. The residue was dissolved in 2 mL of anh dichloromethane. 436 L (5.39 mmol) of anh pyridine and 87.7 mg (0.23 mmol) of 3-amino-N-(5-phenylpyrazin-2-yl)-4-(trifluoromethoxy)benzamide (intermediate 11) were added. It was stirred at rt over night. The reaction mixture was concentrated and purified by HPLC (method 5) to give 3.5 mg (3% of theory) of the title compound.

    [0658] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.149 (3.57), 1.162 (9.15), 1.169 (11.31), 1.179 (5.58), 1.220 (0.97), 1.232 (1.12), 1.272 (5.06), 1.282 (11.01), 1.290 (8.63), 1.302 (3.80), 1.376 (0.52), 1.404 (0.52), 1.901 (0.89), 2.317 (1.34), 2.322 (2.75), 2.327 (3.80), 2.331 (2.75), 2.336 (1.49), 2.460 (11.31), 2.471 (16.00), 2.523 (13.10), 2.539 (2.90), 2.659 (1.12), 2.664 (2.68), 2.669 (3.72), 2.674 (2.83), 2.678 (1.34), 3.690 (10.64), 3.702 (14.81), 3.713 (10.79), 5.501 (0.45), 5.662 (0.82), 7.252 (0.74), 7.257 (0.74), 7.295 (0.67), 7.455 (1.64), 7.459 (2.16), 7.463 (1.27), 7.470 (1.79), 7.477 (7.00), 7.483 (2.46), 7.491 (3.80), 7.495 (6.62), 7.499 (3.65), 7.519 (10.12), 7.533 (7.00), 7.538 (13.17), 7.555 (5.43), 7.559 (3.27), 7.622 (3.94), 7.626 (4.32), 7.639 (2.01), 7.644 (4.91), 7.648 (4.39), 7.898 (6.25), 7.903 (6.10), 7.919 (5.21), 7.925 (5.43), 8.127 (8.71), 8.131 (12.06), 8.135 (5.95), 8.143 (3.57), 8.148 (11.83), 8.152 (8.63), 8.989 (10.79), 8.995 (11.09), 9.063 (0.74), 9.067 (0.74), 9.085 (12.73), 9.089 (13.17), 9.437 (0.67), 9.441 (0.82), 9.461 (13.40), 9.465 (13.25), 10.547 (9.38).

    [0659] LC-MS (Method 4): R.sub.t=1.45 min; MS (ESIpos): m/z=528 [M+H].sup.+.

    Example 21

    4-(cyclopropyloxy)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-(5-phenylpyrazin-2-yl)benzamide

    [0660] ##STR00154##

    [0661] 75.0 mg (0.22 mmol) of 3-amino-4-(cyclopropyloxy)-N-(5-phenylpyrazin-2-yl)benzamide (intermediate 22) were dissolved in 0.81 mL of anh DMF. 60.0 mg (0.26 mmol) of (4-methylpiperazin-1-yl)acetic acid dihydrochloride, 379 L (0.65 mmol) of T3P (50% in DMF), and 170 L (0.97 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred at rt over night. The reaction mixture was poured into water. The precipitate was filtered off and purified by HPLC (method 2) yielding 12.4 mg (12% of theory) of the title compound.

    [0662] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.787 (0.81), 0.794 (1.03), 0.800 (2.12), 0.807 (3.55), 0.814 (2.52), 0.818 (1.96), 0.826 (1.09), 0.915 (0.87), 0.928 (2.74), 0.934 (1.96), 0.943 (2.27), 0.947 (2.30), 0.949 (2.15), 0.963 (0.56), 1.205 (0.53), 1.222 (0.75), 1.232 (1.71), 2.216 (16.00), 2.318 (0.62), 2.323 (1.09), 2.327 (1.40), 2.331 (1.12), 2.337 (0.72), 2.380 (0.90), 2.412 (1.18), 2.523 (3.36), 2.540 (4.36), 2.558 (2.65), 2.659 (0.47), 2.665 (0.93), 2.669 (1.25), 2.674 (0.87), 2.678 (0.47), 3.145 (10.21), 3.667 (0.50), 4.115 (0.44), 4.123 (0.84), 4.130 (1.25), 4.137 (1.62), 4.145 (1.18), 4.153 (0.84), 4.160 (0.40), 6.546 (0.47), 7.306 (0.50), 7.325 (0.56), 7.327 (0.50), 7.415 (0.56), 7.432 (3.49), 7.453 (4.17), 7.464 (0.75), 7.471 (2.65), 7.477 (0.90), 7.485 (1.37), 7.489 (2.33), 7.493 (1.28), 7.516 (3.74), 7.530 (2.52), 7.535 (4.89), 7.547 (0.81), 7.552 (1.93), 7.555 (1.28), 7.895 (0.53), 7.902 (2.24), 7.908 (2.15), 7.915 (0.68), 7.924 (1.90), 7.930 (1.93), 7.954 (0.56), 7.957 (0.56), 8.125 (3.58), 8.128 (4.51), 8.132 (2.30), 8.140 (1.40), 8.145 (4.30), 8.149 (3.08), 8.495 (0.50), 8.499 (0.47), 8.905 (3.64), 8.911 (3.77), 9.069 (5.14), 9.073 (5.20), 9.477 (5.42), 9.481 (5.26), 9.761 (3.30), 11.109 (2.12).

    [0663] LC-MS (Method 4): R.sub.t=0.98 min; MS (ESIpos): m/z=487 [M+H].sup.+.

    Example 22

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0664] ##STR00155##

    [0665] 100.0 mg (0.22 mmol) of 3-[(chloroacetyl)amino]-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide (intermediate 25) and 77 L (0.44 mmol) of N-ethyl-N-isopropylpropan-2-amine were dissolved in 2 mL of anh DMF. 35.0 mg (0.33 mmol) of 1-methylpiperazine and 6 mg (0.034 mmol) of potassium iodide were added and it was stirred for 5 h at rt. It was concentrated and purified by HPLC (method 5) to give 30.5 mg (27% of theory) of the title compound.

    [0666] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.903 (0.61), 2.183 (16.00), 2.317 (0.57), 2.322 (0.90), 2.327 (1.12), 2.331 (0.95), 2.336 (0.73), 2.385 (1.24), 2.523 (2.77), 2.539 (1.81), 2.592 (2.50), 2.664 (0.66), 2.669 (0.84), 2.674 (0.63), 3.215 (10.60), 7.547 (1.31), 7.558 (1.36), 7.560 (1.37), 7.566 (1.39), 7.568 (1.40), 7.580 (1.45), 7.611 (1.33), 7.615 (1.40), 7.620 (0.59), 7.628 (0.71), 7.632 (1.61), 7.637 (1.50), 7.914 (2.06), 7.920 (2.05), 7.935 (1.73), 7.941 (1.80), 8.475 (1.15), 8.480 (1.60), 8.485 (1.29), 8.495 (1.16), 8.500 (1.53), 8.505 (1.17), 8.661 (2.24), 8.666 (2.23), 8.673 (2.32), 8.678 (2.11), 8.927 (3.33), 8.933 (3.39), 9.177 (4.58), 9.180 (4.78), 9.316 (2.56), 9.317 (2.83), 9.323 (2.73), 9.510 (4.95), 9.514 (4.99), 9.937 (3.04), 11.439 (0.57).

    [0667] LC-MS (Method 3): R.sub.t=1.07 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    Example 23

    3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0668] ##STR00156##

    [0669] 100.0 mg (0.27 mmol) of 3-amino-N-[5-(pyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide (intermediate 24) and 371 L (2.13 mmol) of N-ethyl-N-isopropylpropan-2-amine were suspended in 2 mL of anh DMF. 81.0 mg (0.53 mmol) of morpholin-4-ylacetic acid and 311 L (0.53 mmol) of T3P (50% in DMF) were added and it was stirred at 50 C. over night. 156 L (0.27 mmol) of T3P (50% in DMF), 39.0 mg (0.27 mmol) of morpholin-4-ylacetic acid and 186 L (1.07 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred for 1 day at 50 C. It was concentrated and purified by HPLC (method 2, method 5, Waters XBridge C18 5 m 10030 mm, eluent A: water+0.2 vol % ammonia (32%), eluent B: MeOH, gradient, rt) to afford 15 mg (11% of theory) of the title compound.

    [0670] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.968 (0.45), 1.108 (1.34), 1.232 (1.21), 2.137 (0.45), 2.142 (1.02), 2.168 (1.02), 2.318 (0.51), 2.323 (1.02), 2.327 (1.34), 2.332 (0.96), 2.337 (0.51), 2.523 (4.33), 2.571 (5.86), 2.583 (8.10), 2.594 (5.93), 2.659 (0.51), 2.665 (1.08), 2.669 (1.40), 2.674 (1.02), 2.678 (0.51), 3.214 (1.02), 3.234 (16.00), 3.288 (1.21), 3.643 (6.31), 3.655 (8.48), 3.666 (5.93), 3.737 (1.59), 3.876 (1.08), 5.229 (0.51), 7.549 (2.04), 7.561 (2.17), 7.567 (1.85), 7.569 (2.17), 7.580 (2.17), 7.614 (2.10), 7.618 (2.17), 7.631 (1.08), 7.635 (2.36), 7.640 (2.23), 7.932 (2.93), 7.937 (2.87), 7.953 (2.55), 7.959 (2.49), 8.367 (0.38), 8.477 (1.85), 8.482 (2.68), 8.487 (1.78), 8.496 (1.78), 8.501 (2.55), 8.507 (1.78), 8.661 (2.93), 8.665 (3.06), 8.673 (3.06), 8.677 (2.87), 8.859 (4.97), 8.865 (4.84), 9.178 (5.86), 9.183 (5.99), 9.317 (4.21), 9.323 (4.14), 9.509 (6.18), 9.513 (5.93), 9.922 (4.84), 11.457 (1.08).

    [0671] LC-MS (Method 4): R.sub.t=0.86 min; MS (ESIpos): m/z=503 [M+H].sup.+.

    Example 24

    N-[5-(6-aminopyridin-3-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0672] ##STR00157##

    [0673] 80.0 mg (0.16 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 51.1 mg (0.23 mmol) of 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-amine, 42.7 mg (0.31 mmol) of potassium carbonate, 133 L of DMF, 533 L of water, 733 L of DME and 6.3 mg (7.71 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 1 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to afford 41 mg (50% of theory) of the title compound.

    [0674] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.180 (16.00), 2.318 (0.61), 2.322 (1.13), 2.327 (1.20), 2.332 (0.96), 2.337 (0.70), 2.343 (0.58), 2.387 (0.92), 2.457 (0.48), 2.523 (2.09), 2.532 (0.52), 2.537 (0.52), 2.540 (0.56), 2.585 (2.01), 2.587 (2.03), 2.665 (0.73), 2.669 (0.94), 2.674 (0.69), 3.211 (10.40), 6.367 (6.08), 6.542 (2.69), 6.564 (2.74), 7.598 (1.34), 7.602 (1.40), 7.615 (0.70), 7.619 (1.62), 7.624 (1.36), 7.896 (2.14), 7.902 (2.05), 7.918 (1.74), 7.923 (1.77), 8.089 (1.85), 8.095 (1.88), 8.111 (1.70), 8.117 (1.77), 8.704 (2.86), 8.710 (2.89), 8.909 (3.38), 8.914 (3.31), 8.940 (4.32), 8.945 (4.41), 9.354 (4.82), 9.357 (4.73), 9.932 (3.18), 11.262 (2.94).

    [0675] LC-MS (Method 3): R.sub.t=1.05 min; MS (ESIpos): m/z=531 [M+H].sup.+.

    Example 25

    N-[5-(2-fluorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0676] ##STR00158##

    [0677] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide (intermediate 29), 29.1 mg (0.21 mmol) of (2-fluorophenyl)boronic acid, 38.4 mg (0.28 mmol) of potassium carbonate, 120 L of DMF, 479 L of water, 658 L of DME and 5.7 mg (6.98 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to afford 30 mg (42% of theory) of the title compound.

    [0678] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.318 (0.58), 2.323 (1.27), 2.327 (1.74), 2.331 (1.24), 2.337 (0.58), 2.523 (4.19), 2.540 (0.77), 2.565 (5.02), 2.577 (6.95), 2.589 (5.24), 2.659 (0.58), 2.665 (1.30), 2.669 (1.77), 2.674 (1.24), 2.678 (0.61), 2.718 (0.61), 3.189 (0.55), 3.204 (16.00), 3.643 (5.68), 3.655 (7.59), 3.666 (5.46), 7.272 (1.10), 7.275 (1.19), 7.284 (1.35), 7.288 (1.54), 7.295 (2.04), 7.303 (3.97), 7.323 (4.22), 7.363 (0.91), 7.369 (0.99), 7.382 (2.92), 7.388 (2.48), 7.406 (2.29), 7.420 (0.50), 7.936 (1.35), 7.941 (1.35), 7.955 (2.48), 7.963 (4.22), 7.968 (3.50), 7.976 (1.66), 7.985 (3.06), 7.990 (2.95), 8.560 (0.61), 8.592 (2.40), 8.596 (2.70), 8.871 (4.44), 8.876 (4.39), 9.213 (3.03), 9.746 (2.48).

    [0679] LC-MS (Method 3): R.sub.t=1.34 min; MS (ESIpos): m/z=520 [M+H].sup.+.

    Example 26

    3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyrimidin-5-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0680] ##STR00159##

    [0681] Step 1: 54 L (0.62 mmol) of ethanedioyl dichloride were added dropwise to 180 mg (0.52 mmol) of 3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoic acid (intermediate 31) and 4 L (0.05 mmol) of DMF in 2.35 mL of anh dichloromethane. It was stirred for 2 h at 50 C. It was concentrated and used without further purification in the next step.

    [0682] Step 2: 180 mg (0.49 mmol) of 3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzoyl chloride were suspended in 6 mL of anh toluene. 100 mg (0.58 mmol) of 5-(pyrimidin-5-yl)pyrazin-2-amine were added and it was stirred for 7 h at 100 C. The reaction mixture was allowed to reach rt and was sonicated on an ultrasonic bath for several minutes. The residue was filtered off and purified by HPLC (method 5) giving 24 mg (10% of theory) of the title compound.

    [0683] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 1.231 (1.25), 2.322 (0.48), 2.326 (0.64), 2.331 (0.48), 2.522 (3.88), 2.539 (2.57), 2.659 (0.74), 2.664 (0.93), 2.668 (1.06), 2.673 (0.83), 2.678 (0.58), 3.235 (11.19), 3.361 (2.24), 3.367 (2.02), 3.369 (2.02), 3.379 (1.70), 3.402 (1.25), 3.642 (4.39), 3.654 (5.84), 3.666 (4.10), 7.614 (0.67), 7.618 (1.51), 7.622 (1.51), 7.635 (0.87), 7.640 (1.73), 7.644 (1.54), 7.934 (2.12), 7.939 (2.02), 7.955 (1.80), 7.961 (1.80), 8.863 (3.40), 8.869 (3.27), 9.247 (4.75), 9.251 (4.65), 9.282 (7.21), 9.496 (16.00), 9.542 (4.59), 9.546 (4.26), 9.925 (3.33), 11.530 (3.37).

    [0684] LC-MS (Method 3): R.sub.t=1.02 min; MS (ESIpos): m/z=504 [M+H].sup.+.

    Example 27

    4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-[5-(pyrimidin-5-yl)pyrazin-2-yl]benzamide

    [0685] ##STR00160##

    [0686] Step 1: 3 mL of thionyl chloride were added to 200 mg (0.62 mmol) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoic acid (intermediate 36). The precipitate was sonicated on an ultrasonic bath for several minutes. 3 mL of anh toluene were added and it was stirred at 70 C. for 1 h. The reaction mixture was concentrated to obtain 210 mg (99% of theory) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoyl chloride which was used in the next step without further purification.

    [0687] Step 2: 100 mg (0.30 mmol) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoyl chloride were suspended in 3 mL of anh toluene. 76 mg (0.35 mmol) of 5-(pyrimidin-5-yl)pyrazin-2-amine and 48 L (0.59 mmol) of anh pyridine were added and it was stirred for 3 h at 100 C. 1 mL of anh pyridine was added and it was stirred at 100 C. over night. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) affording 28 mg (20% of theory) of the title compound.

    [0688] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.760 (0.45), 0.767 (0.61), 0.773 (1.44), 0.779 (2.35), 0.786 (1.59), 0.791 (1.14), 0.798 (0.68), 0.911 (0.61), 0.925 (1.97), 0.931 (1.44), 0.940 (1.52), 0.944 (1.67), 0.946 (1.59), 2.327 (0.53), 2.523 (1.44), 2.539 (0.99), 2.547 (2.58), 2.558 (3.56), 2.570 (2.73), 2.669 (0.53), 3.157 (0.68), 3.166 (8.04), 3.297 (0.45), 3.370 (0.76), 3.376 (0.53), 3.657 (2.81), 3.669 (3.79), 3.680 (2.81), 4.113 (0.61), 4.121 (0.91), 4.128 (1.21), 4.135 (0.83), 4.143 (0.61), 7.441 (2.65), 7.463 (2.81), 7.915 (1.52), 7.921 (1.52), 7.937 (1.36), 7.942 (1.36), 8.874 (2.65), 8.879 (2.65), 9.217 (4.09), 9.221 (4.17), 9.271 (7.05), 9.485 (16.00), 9.543 (4.17), 9.547 (4.09), 9.701 (2.27), 11.234 (1.67).

    [0689] LC-MS (Method 3): R.sub.t=0.99 min; MS (ESIpos): m/z=476 [M+H].sup.+.

    Example 28

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-4-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0690] ##STR00161##

    [0691] 60.0 mg (0.12 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 35.7 mg (0.17 mmol) of 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine, 32.1 mg (0.23 mmol) of potassium carbonate, 100 L of DMF, 400 L of water, 550 L of DME and 4.7 mg (5.76 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to afford 19.6 mg (21% of theory) of the title compound.

    [0692] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.167 (0.56), 2.180 (16.00), 2.317 (0.57), 2.322 (1.03), 2.326 (1.34), 2.331 (1.08), 2.336 (0.74), 2.343 (0.56), 2.388 (0.90), 2.522 (2.50), 2.539 (0.57), 2.590 (2.03), 2.659 (0.47), 2.664 (0.90), 2.668 (1.14), 2.673 (0.85), 2.678 (0.44), 3.214 (10.54), 7.616 (1.32), 7.620 (1.37), 7.633 (0.67), 7.638 (1.57), 7.642 (1.36), 7.914 (2.12), 7.920 (2.03), 7.935 (1.73), 7.941 (1.75), 8.106 (5.15), 8.111 (3.06), 8.118 (3.12), 8.122 (5.31), 8.725 (5.54), 8.729 (2.84), 8.736 (2.79), 8.740 (5.07), 8.930 (3.28), 8.936 (3.28), 9.244 (4.46), 9.248 (4.48), 9.542 (4.35), 9.546 (4.40), 9.944 (3.11), 11.536 (1.09).

    [0693] LC-MS (Method 3): R.sub.t=1.11 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    Example 29

    N-[5-(2-fluoro-6-methylphenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0694] ##STR00162##

    [0695] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 31.2 mg (0.20 mmol) of (2-fluoro-6-methylphenyl)boronic acid, 37.4 mg (0.27 mmol) of potassium carbonate, 117 L of DMF, 467 L of water, 642 L of DME and 5.5 mg (6.73 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to give 47.5 mg (64% of theory) of the title compound.

    [0696] .sup.1H-NMR (500 MHz, DMSO-d.sub.6) [ppm]: 2.182 (16.00), 2.220 (14.62), 2.354 (0.81), 2.358 (1.28), 2.361 (1.62), 2.365 (1.31), 2.369 (0.91), 2.518 (2.72), 2.522 (2.09), 2.590 (1.53), 2.627 (0.72), 2.631 (1.12), 2.635 (1.41), 2.639 (1.03), 2.642 (0.53), 3.216 (10.31), 3.282 (0.41), 7.175 (0.88), 7.192 (1.53), 7.211 (1.12), 7.212 (1.00), 7.217 (1.81), 7.232 (2.06), 7.400 (0.88), 7.412 (0.97), 7.417 (1.34), 7.429 (1.28), 7.433 (0.84), 7.445 (0.72), 7.621 (1.25), 7.624 (1.28), 7.634 (0.56), 7.638 (1.47), 7.641 (1.34), 7.908 (1.94), 7.913 (2.06), 7.925 (1.75), 7.930 (1.84), 8.582 (2.03), 8.586 (3.72), 8.589 (2.22), 8.924 (3.06), 8.928 (3.06), 9.527 (4.91), 9.530 (4.94), 9.941 (2.78), 11.424 (1.16).

    [0697] LC-MS (Method 3): R.sub.t=1.34 min; MS (ESIpos): m/z=547 [M+H].sup.+.

    Example 30

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(4-methylpyridin-3-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0698] ##STR00163##

    [0699] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 27.8 mg (0.20 mmol) of (4-methylpyridin-3-yl)boronic acid, 37.4 mg (0.27 mmol) of potassium carbonate, 117 L of DMF, 467 L of water, 642 L of DME and 5.5 mg (6.73 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to obtain 24 mg (33% of theory) of the title compound.

    [0700] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.182 (15.34), 2.318 (0.57), 2.323 (1.04), 2.327 (1.36), 2.332 (1.07), 2.337 (0.70), 2.345 (0.50), 2.390 (0.79), 2.432 (16.00), 2.461 (0.48), 2.523 (2.36), 2.539 (0.54), 2.547 (0.52), 2.590 (1.88), 2.659 (0.48), 2.665 (0.93), 2.669 (1.20), 2.674 (0.86), 2.678 (0.45), 3.216 (10.22), 7.395 (2.38), 7.408 (2.49), 7.615 (0.43), 7.619 (1.27), 7.624 (1.25), 7.636 (0.63), 7.641 (1.54), 7.645 (1.34), 7.650 (0.43), 7.909 (2.15), 7.915 (2.13), 7.931 (1.72), 7.936 (1.84), 8.513 (3.69), 8.526 (3.67), 8.667 (5.35), 8.750 (5.46), 8.754 (5.48), 8.927 (3.22), 8.933 (3.24), 9.519 (4.62), 9.523 (4.83), 9.945 (2.81), 11.448 (1.29).

    [0701] LC-MS (Method 3): R.sub.t=1.14 min; MS (ESIpos): m/z=530 [M+H].sup.+.

    Example 31

    N-[5-(3,5-difluorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0702] ##STR00164##

    [0703] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide (intermediate 29), 32.9 mg (0.21 mmol) of (3,5-difluorophenyl)boronic acid, 38.4 mg (0.28 mmol) of potassium carbonate, 120 L of DMF, 479 L of water, 658 L of DME and 5.7 mg (6.98 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 1.5 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to afford 27 mg (36% of theory) of the title compound.

    [0704] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.318 (0.61), 2.323 (1.28), 2.327 (1.72), 2.332 (1.22), 2.337 (0.61), 2.523 (5.33), 2.540 (3.11), 2.570 (5.61), 2.582 (7.83), 2.593 (5.94), 2.659 (0.67), 2.665 (1.33), 2.669 (1.78), 2.674 (1.28), 2.678 (0.67), 3.233 (16.00), 3.642 (6.00), 3.654 (8.17), 3.665 (5.89), 7.336 (0.61), 7.343 (1.28), 7.348 (0.89), 7.359 (1.28), 7.365 (2.44), 7.371 (1.56), 7.382 (0.72), 7.388 (1.28), 7.394 (0.78), 7.613 (2.00), 7.617 (2.17), 7.635 (2.44), 7.639 (2.28), 7.865 (0.61), 7.877 (3.06), 7.882 (4.00), 7.887 (2.39), 7.899 (3.83), 7.905 (2.94), 7.916 (0.72), 7.928 (3.00), 7.934 (2.89), 7.950 (2.50), 7.955 (2.50), 8.858 (4.72), 8.864 (4.72), 9.201 (6.17), 9.204 (6.17), 9.495 (6.50), 9.499 (6.22), 9.921 (4.78), 11.496 (1.78).

    [0705] LC-MS (Method 3): R.sub.t=1.40 min; MS (ESIpos): m/z=538 [M+H].sup.+.

    Example 32

    N-[5-(3-methylphenyl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0706] ##STR00165##

    [0707] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 27.6 mg (0.20 mmol) of (3-methylphenyl)boronic acid, 37.4 mg (0.27 mmol) of potassium carbonate, 117 L of DMF, 467 L of water, 642 L of DME and 5.5 mg (6.73 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to obtain 7 mg (10% of theory) of the title compound.

    [0708] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.181 (16.00), 2.318 (0.55), 2.323 (0.95), 2.327 (1.22), 2.332 (0.99), 2.337 (0.71), 2.344 (0.55), 2.379 (0.99), 2.413 (14.06), 2.523 (2.05), 2.537 (0.43), 2.582 (1.82), 2.589 (1.94), 2.659 (0.43), 2.665 (0.79), 2.669 (1.03), 2.674 (0.75), 3.214 (10.47), 7.282 (1.30), 7.301 (1.74), 7.398 (1.70), 7.417 (2.84), 7.436 (1.34), 7.603 (0.47), 7.607 (1.30), 7.612 (1.34), 7.624 (0.67), 7.629 (1.62), 7.633 (1.42), 7.911 (2.29), 7.916 (3.24), 7.923 (1.15), 7.932 (2.13), 7.938 (3.16), 7.969 (1.62), 7.974 (2.69), 7.980 (1.26), 8.924 (3.24), 8.930 (3.28), 9.070 (4.39), 9.074 (4.35), 9.460 (5.06), 9.464 (5.02), 9.939 (2.92), 11.386 (1.15).

    [0709] LC-MS (Method 3): R.sub.t=1.39 min; MS (ESIpos): m/z=529 [M+H].sup.+.

    Example 33

    N-[5-(2-chlorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0710] ##STR00166##

    [0711] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide (intermediate 29), 32.6 mg (0.21 mmol) of (2-chlorophenyl)boronic acid, 38.4 mg (0.28 mmol) of potassium carbonate, 120 L of DMF, 479 L of water, 658 L of DME and 5.7 mg (6.98 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to afford 25 mg (34% of theory) of the title compound.

    [0712] .sup.1H-NMR (500 MHz, DMSO-d.sub.6) [ppm]: 2.358 (0.73), 2.361 (1.01), 2.365 (0.73), 2.518 (2.06), 2.522 (1.65), 2.540 (0.59), 2.575 (4.11), 2.582 (5.12), 2.585 (5.81), 2.587 (4.98), 2.593 (4.34), 2.631 (0.73), 2.635 (1.05), 2.639 (0.73), 3.235 (16.00), 3.344 (0.41), 3.647 (4.75), 3.654 (5.44), 3.656 (6.35), 3.658 (5.44), 3.665 (4.62), 7.499 (0.55), 7.508 (5.58), 7.514 (2.83), 7.520 (3.11), 7.526 (5.53), 7.535 (0.87), 7.618 (2.06), 7.625 (3.61), 7.631 (2.19), 7.636 (3.29), 7.637 (3.06), 7.644 (2.47), 7.679 (2.79), 7.687 (2.74), 7.692 (1.55), 7.698 (2.24), 7.932 (2.79), 7.937 (2.83), 7.950 (2.47), 7.954 (2.61), 8.770 (6.45), 8.773 (6.86), 8.860 (4.30), 8.864 (4.11), 9.502 (6.77), 9.505 (6.40), 9.918 (3.79), 11.427 (1.01), 11.428 (1.01).

    [0713] LC-MS (Method 3): R.sub.t=1.35 min; MS (ESIpos): m/z=536 [M+H].sup.+.

    Example 34

    4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrimidin-2-yl)benzamide

    [0714] ##STR00167##

    [0715] Step 1: 4 mL of thionyl chloride were added to 900 mg (2.81 mmol) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoic acid (intermediate 36) in 7 mL of anh toluene. It was stirred at 70 C. for 2 h. The reaction mixture was concentrated to obtain 950 mg (99.8% of theory) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoyl chloride which was used in the next step without further purification.

    [0716] Step 2: 140 mg (0.41 mmol) of 4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]benzoyl chloride were suspended in 4 mL of anh toluene. 1 mL of anh pyridine and 85 mg (0.50 mmol) of 5-phenylpyrimidin-2-amine were added and it was stirred for 5 h at 100 C. and at rt over night. The reaction mixture was concentrated and purified by HPLC (method 5) yielding 20 mg (10% of theory) of the title compound.

    [0717] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.762 (1.10), 0.769 (1.40), 0.776 (3.40), 0.782 (5.40), 0.788 (3.70), 0.793 (2.60), 0.800 (1.50), 0.913 (1.20), 0.928 (4.30), 0.933 (3.40), 0.942 (3.50), 0.946 (3.70), 0.948 (3.60), 0.963 (0.90), 2.072 (1.80), 2.318 (0.40), 2.323 (0.90), 2.327 (1.30), 2.332 (0.90), 2.337 (0.50), 2.523 (4.30), 2.547 (5.80), 2.559 (8.20), 2.570 (6.10), 2.659 (0.50), 2.665 (1.00), 2.669 (1.30), 2.674 (1.00), 2.678 (0.50), 3.167 (16.00), 3.282 (0.60), 3.287 (0.80), 3.294 (0.70), 3.369 (1.90), 3.376 (1.20), 3.383 (0.70), 3.402 (0.40), 3.658 (6.10), 3.670 (8.60), 3.681 (6.00), 4.110 (0.70), 4.117 (1.30), 4.124 (1.90), 4.132 (2.50), 4.139 (1.90), 4.147 (1.30), 4.154 (0.70), 7.444 (4.90), 7.466 (5.20), 7.493 (0.50), 7.497 (0.80), 7.500 (0.60), 7.507 (0.60), 7.515 (3.20), 7.522 (1.20), 7.529 (2.20), 7.533 (3.70), 7.536 (2.30), 7.547 (5.60), 7.561 (3.00), 7.566 (6.50), 7.578 (1.20), 7.583 (2.30), 7.587 (1.50), 7.951 (3.10), 7.957 (3.00), 7.973 (2.70), 7.978 (2.70), 8.122 (4.80), 8.126 (6.40), 8.142 (5.90), 8.147 (4.60), 8.276 (5.40), 8.299 (6.60), 8.460 (7.60), 8.484 (5.60), 8.883 (5.30), 8.888 (5.40), 9.704 (5.00), 11.436 (3.50).

    [0718] LC-MS (Method 3): R.sub.t=1.16 min; MS (ESIpos): m/z=474 [M+H].sup.+.

    Example 35

    N-[5-(3-chlorophenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0719] ##STR00168##

    [0720] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide (intermediate 29), 32.6 mg (0.21 mmol) of (3-chlorophenyl)boronic acid, 38.4 mg (0.28 mmol) of potassium carbonate, 120 L of DMF, 479 L of water, 658 L of DME and 5.7 mg (6.98 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to give 45 mg (60% of theory) of the title compound.

    [0721] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.318 (0.47), 2.323 (1.10), 2.327 (1.55), 2.331 (1.12), 2.337 (0.50), 2.523 (3.10), 2.540 (0.45), 2.571 (4.34), 2.583 (6.07), 2.594 (4.62), 2.659 (0.50), 2.665 (1.15), 2.669 (1.57), 2.674 (1.10), 2.678 (0.52), 3.234 (16.00), 3.643 (4.87), 3.655 (6.51), 3.666 (4.69), 7.524 (0.55), 7.528 (1.22), 7.533 (0.90), 7.544 (3.05), 7.549 (5.47), 7.553 (5.94), 7.571 (3.69), 7.590 (1.27), 7.608 (0.70), 7.612 (1.87), 7.616 (1.92), 7.629 (0.92), 7.634 (2.25), 7.638 (1.95), 7.930 (3.07), 7.936 (2.97), 7.952 (2.50), 7.957 (2.60), 8.113 (1.65), 8.117 (3.05), 8.121 (1.85), 8.130 (1.47), 8.135 (2.80), 8.139 (1.62), 8.197 (2.37), 8.201 (4.72), 8.206 (2.60), 8.859 (4.49), 8.864 (4.54), 9.163 (6.12), 9.168 (6.29), 9.488 (6.99), 9.492 (6.71), 9.920 (4.24), 11.460 (3.64).

    [0722] LC-MS (Method 3): R.sub.t=1.43 min; MS (ESIpos): m/z=536 [M+H].sup.+.

    Example 36

    N-[5-(2-fluoropyridin-3-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide hydrochloride

    [0723] ##STR00169##

    [0724] 50.0 mg (0.10 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 18.4 mg (0.13 mmol) of (2-fluoropyridin-3-yl)boronic acid and 11.2 mg (9.67 mmol) of tetrakis(triphenylphosphine)palladium(0) in 1.5 mL of anh DMF were stirred for 2.5 h at 95 C. 18 mg (0.13 mmol) of (2-fluoropyridin-3-yl)boronic acid and mg (12.25 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were added and it was stirred for 8 h at 100 C. 18 mg (0.13 mmol) of (2-fluoropyridin-3-yl)boronic acid and 19 mg (0.14 mmol) of potassium carbonate were added and it was stirred for 4 h at 100 C. The reaction mixture was cooled down, and was concentrated and purified by HPLC (method 5 and Chiralpak IC 5 m 25030 mm No. 009, acetonitrile/diethylamine 1000:1 (v/v), 50 mL/min, rt) yielding 5 mg (9% of theory) of the title compound.

    [0725] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.833 (0.66), 0.852 (1.00), 1.234 (5.70), 1.258 (1.49), 1.298 (0.66), 1.334 (0.61), 1.349 (0.78), 2.318 (1.22), 2.323 (2.60), 2.327 (3.49), 2.332 (2.55), 2.337 (1.27), 2.523 (16.00), 2.659 (2.77), 2.665 (4.10), 2.669 (5.04), 2.674 (4.15), 2.678 (2.93), 2.724 (2.21), 2.763 (2.44), 3.373 (7.53), 3.507 (0.89), 7.561 (1.72), 7.566 (1.83), 7.573 (1.99), 7.579 (2.88), 7.585 (1.99), 7.592 (1.99), 7.597 (1.94), 7.609 (2.60), 7.614 (2.71), 7.631 (2.93), 7.635 (2.71), 7.988 (2.71), 7.993 (2.66), 8.009 (2.38), 8.015 (2.38), 8.354 (2.10), 8.358 (3.10), 8.366 (2.66), 8.370 (2.99), 8.374 (2.16), 8.527 (1.61), 8.532 (1.72), 8.546 (1.83), 8.552 (2.77), 8.558 (1.88), 8.572 (1.66), 8.577 (1.55), 8.654 (1.77), 8.947 (3.93), 8.951 (5.98), 8.957 (3.71), 9.442 (1.16), 9.564 (7.36), 9.568 (7.09), 9.839 (4.04), 11.529 (7.64).

    [0726] LC-MS (Method 3): R.sub.t=1.21 min; MS (ESIpos): m/z=534 [M+H].sup.+.

    Example 37

    N-[5-(2-aminopyrimidin-5-yl)pyrazin-2-yl]-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide

    [0727] ##STR00170##

    [0728] 80.0 mg (0.16 mmol) of N-(5-bromopyrazin-2-yl)-3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzamide (intermediate 28), 32.2 mg (0.23 mmol) of (2-aminopyrimidin-5-yl)boronic acid, 47.7 mg (0.31 mmol) of potassium carbonate, 133 L of DMF, 533 L of water, 733 L of DME and 6.3 mg (7.71 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 1 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to obtain 20 mg (24% of theory) of the title compound.

    [0729] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.179 (14.67), 2.318 (0.52), 2.322 (0.80), 2.327 (1.01), 2.331 (0.90), 2.337 (0.68), 2.343 (0.60), 2.394 (0.96), 2.523 (4.28), 2.582 (2.07), 2.586 (2.11), 2.665 (0.64), 2.669 (0.82), 2.673 (0.62), 3.211 (9.41), 7.071 (6.01), 7.600 (1.19), 7.604 (1.33), 7.608 (0.56), 7.617 (0.66), 7.621 (1.49), 7.626 (1.37), 7.899 (1.85), 7.905 (1.89), 7.921 (1.53), 7.927 (1.65), 8.912 (3.14), 8.918 (3.14), 8.961 (16.00), 8.996 (4.12), 9.000 (4.28), 9.386 (4.48), 9.390 (4.46), 9.933 (2.93), 11.323 (1.75).

    [0730] LC-MS (Method 3): R.sub.t=1.01 min; MS (ESIpos): m/z=532 [M+H].sup.+.

    Example 38

    4-(cyclopropyloxy)-3-[(morpholin-4-ylacetyl)amino]-N-(5-phenylpyrazin-2-yl)benzamide

    [0731] ##STR00171##

    [0732] 75.0 mg (0.22 mmol) of 3-amino-4-(cyclopropyloxy)-N-(5-phenylpyrazin-2-yl)benzamide (intermediate 22) were dissolved in 0.81 mL of anh DMF. 37.7 mg (0.26 mmol) of morpholin-4-ylacetic acid, 379 L (0.65 mmol) of T3P (50% in DMF), and 170 L (0.97 mmol) of N-ethyl-N-isopropylpropan-2-amine were added. It was stirred for 3 h at rt. The reaction mixture was poured into water. The precipitate was filtered off, washed with water and dried under vacuum obtaining 18 mg (18% of theory) of the title compound.

    [0733] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 0.760 (1.43), 0.767 (1.81), 0.773 (3.77), 0.779 (5.54), 0.786 (4.06), 0.790 (3.15), 0.798 (2.15), 0.834 (1.10), 0.851 (1.15), 0.868 (0.81), 0.910 (1.53), 0.925 (4.59), 0.939 (3.77), 0.945 (3.96), 0.959 (1.29), 1.168 (0.91), 1.232 (3.73), 1.258 (1.91), 1.275 (1.05), 1.353 (5.25), 2.181 (0.62), 2.317 (0.91), 2.322 (2.10), 2.326 (2.87), 2.331 (2.20), 2.336 (1.15), 2.523 (11.75), 2.545 (6.93), 2.558 (8.41), 2.569 (6.21), 2.659 (1.00), 2.664 (2.15), 2.669 (2.87), 2.674 (2.15), 2.678 (1.10), 3.167 (16.00), 3.657 (6.07), 3.669 (8.41), 3.679 (6.07), 4.106 (0.67), 4.113 (1.24), 4.121 (1.96), 4.128 (2.48), 4.136 (1.81), 4.143 (1.34), 4.150 (0.72), 6.868 (0.43), 7.437 (5.21), 7.458 (5.78), 7.471 (4.16), 7.477 (1.58), 7.485 (2.10), 7.489 (3.73), 7.493 (2.20), 7.516 (5.78), 7.530 (3.82), 7.535 (7.59), 7.548 (1.67), 7.552 (3.25), 7.556 (2.20), 7.914 (3.10), 7.920 (3.25), 7.935 (2.87), 7.941 (3.01), 8.126 (5.40), 8.129 (7.12), 8.133 (3.87), 8.141 (2.39), 8.146 (6.83), 8.151 (4.97), 8.874 (5.49), 8.880 (5.64), 9.073 (7.36), 9.077 (7.88), 9.478 (7.12), 9.482 (7.31), 9.706 (4.97), 11.123 (6.73).

    [0734] LC-MS (Method 4): R.sub.t=1.09 min; MS (ESIpos): m/z=474 [M+H].sup.+.

    Example 39

    N-[5-(2-methylphenyl)pyrazin-2-yl]-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide

    [0735] ##STR00172##

    [0736] 70.0 mg (0.14 mmol) of N-(5-bromopyrazin-2-yl)-3-[(morpholin-4-ylacetyl)amino]-4-(trifluoromethoxy)benzamide (intermediate 29), 28.3 mg (0.21 mmol) of (2-methylphenyl)boronic acid, 38.4 mg (0.28 mmol) of potassium carbonate, 120 L of DMF, 479 L of water, 658 L of DME and 5.7 mg (6.98 mol) of 1,1-bis(diphenylphosphino)ferrocene-palladium(II)dichloride dichloromethane complex were stirred for 3 h at 95 C. The reaction mixture was allowed to reach rt, and was concentrated and purified by HPLC (method 5) to give 22 mg (31% of theory) of the title compound.

    [0737] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.323 (0.69), 2.327 (0.96), 2.332 (0.65), 2.385 (16.00), 2.523 (2.01), 2.540 (0.78), 2.571 (2.94), 2.583 (4.16), 2.594 (3.20), 2.665 (0.72), 2.669 (0.97), 2.674 (0.69), 3.231 (10.76), 3.643 (3.29), 3.655 (4.49), 3.667 (3.29), 7.322 (0.88), 7.329 (1.19), 7.339 (1.16), 7.346 (1.95), 7.353 (5.48), 7.358 (3.87), 7.369 (1.17), 7.373 (0.79), 7.480 (1.14), 7.483 (1.87), 7.486 (1.31), 7.501 (1.45), 7.504 (1.04), 7.585 (0.44), 7.589 (1.17), 7.594 (1.17), 7.606 (0.59), 7.610 (1.37), 7.615 (1.22), 7.928 (2.10), 7.934 (2.07), 7.950 (1.75), 7.955 (1.81), 8.606 (3.47), 8.610 (3.47), 8.857 (3.15), 8.862 (3.03), 9.436 (3.49), 9.440 (3.47), 9.901 (2.09).

    [0738] LC-MS (Method 3): R.sub.t=1.35 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    Example 40

    3-{[(4-methylpiperazin-1-yl)acetyl]amino}-N-[5-(pyridin-2-yl)pyrazin-2-yl]-4-(trifluoromethoxy)benzamide

    [0739] ##STR00173##

    [0740] Step 1: 4 L (0.05 mmol) of anh DMF and 2 mL of thionyl chloride were added to 200 mg (0.55 mmol) of lithium 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoate (intermediate 40). It was stirred for 2 h at 70 C. The reaction mixture was concentrated to afford 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoyl chloride which was used without further purification in the next step.

    [0741] Step 2: 180 mg (0.47 mmol) of 3-{[(4-methylpiperazin-1-yl)acetyl]amino}-4-(trifluoromethoxy)benzoyl chloride were suspended in 4 mL of anh toluene. 77 L (0.95 mmol) of anh pyridine and 90 mg (0.52 mmol) of 5-(pyridin-2-yl)pyrazin-2-amine were added and it was stirred for 2.5 h at 100 C. and at rt over night. The reaction mixture was concentrated and purified by HPLC (method 5) affording 35 mg (14% of theory) of the title compound.

    [0742] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) [ppm]: 2.166 (0.67), 2.180 (16.00), 2.317 (0.52), 2.322 (0.80), 2.326 (1.01), 2.331 (0.86), 2.336 (0.66), 2.380 (0.96), 2.459 (0.50), 2.464 (0.54), 2.522 (1.57), 2.533 (0.48), 2.539 (0.60), 2.659 (0.41), 2.664 (0.62), 2.668 (0.77), 2.673 (0.58), 3.214 (10.71), 7.476 (1.28), 7.479 (1.27), 7.488 (1.32), 7.491 (1.40), 7.495 (1.48), 7.498 (1.28), 7.507 (1.42), 7.510 (1.26), 7.602 (0.57), 7.606 (1.39), 7.610 (1.39), 7.623 (0.78), 7.627 (1.68), 7.632 (1.48), 7.925 (2.17), 7.930 (2.12), 7.946 (1.86), 7.952 (1.85), 7.968 (1.19), 7.973 (1.20), 7.987 (1.86), 7.992 (1.95), 8.007 (1.18), 8.011 (1.19), 8.304 (1.68), 8.307 (2.65), 8.310 (1.47), 8.324 (1.38), 8.327 (2.29), 8.330 (1.39), 8.707 (1.43), 8.712 (1.84), 8.714 (1.58), 8.719 (1.53), 8.722 (1.67), 8.726 (1.44), 8.937 (3.41), 8.943 (3.39), 9.350 (4.19), 9.355 (4.35), 9.501 (4.71), 9.505 (4.72), 9.937 (3.11), 11.485 (0.40).

    [0743] LC-MS (Method 3): R.sub.t=1.19 min; MS (ESIpos): m/z=516 [M+H].sup.+.

    [0744] The following examples were prepared in analogy to the described methods, supra.

    TABLE-US-00002 TABLE 1 R.sub.t Example [min] No Structure IUPAC Name method 41 [00174]embedded image N-[5-(2- fluorophenyl)pyrazin-2-yl]- 3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.343 42 [00175]embedded image N-[5-(2- methylphenyl)pyrazin-2-yl]- 3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.353 43 [00176]embedded image N-[5-(3,5- difluorophenyl)pyrazin-2- yl]-3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.403 44 [00177]embedded image N-[5-(2- chlorophenyl)pyrazin-2-yl]- 3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.353 45 [00178]embedded image N-[5-(4-methylpyridin-3- yl)pyrazin-2-yl]-3- [(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.133 46 [00179]embedded image N-[5-(6-aminopyridin-3- yl)pyrazin-2-yl]-3- [(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.053 47 [00180]embedded image N-[5-(3- methylphenyl)pyrazin-2-yl]- 3-[(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.393 48 [00181]embedded image N-[5-(3- chlorophenyl)pyrazin-2-yl]- 3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.433 49 [00182]embedded image 3-{[(4-methylpiperazin-1- yl)acetyl]aminol-N-[5- (pyrimidin-5-yl)pyrazin-2-yl]- 4- (trifluoromethoxy)benzamide 1.033 50 [00183]embedded image 4-(cyclopropyloxy)-3- [(morpholin-4- ylacetyl)amino]-N-[5- (pyridin-2-yl)pyrazin-2- yl]benzamide 1.233 51 [00184]embedded image 3-[(morpholin-4- ylacetyl)amino]-N-[5- (pyridin-4-yl)pyrazin-2-yl]-4- (trifluoromethoxy)benzamide 1.103 52 [00185]embedded image N-(2,2-bipyrazin-5-yl)-4- (cyclopropyloxy)-3- [(morpholin-4- ylacetyl)amino]benzamide 1.103 53 [00186]embedded image N-[5-(2-aminopyrimidin-5- yl)pyrazin-2-yl]-3- [(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.013 54 [00187]embedded image N-(2,2-bipyrazin-5-yl)-3- {[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.113 55 [00188]embedded image N-[5-(2-aminopyridin-4- yl)pyrazin-2-yl]-3- [(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.063 56 [00189]embedded image N-[5-(2-aminopyridin-4- yl)pyrazin-2-yl]-3-{[(4- methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.053 57 [00190]embedded image N-(2,2-bipyrazin-5-yl)-3- [(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.113 58 [00191]embedded image N-[5-(2-fluoro-6- methylphenyl)pyrazin-2-yl]- 3-[(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.343 59 [00192]embedded image N-[5-(3- fluorophenyl)pyrazin-2-yl]- 3-{[(4-methylpiperazin-1- yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.353 60 [00193]embedded image N-(5-amino-2,2-bipyrazin- 5-yl)-3-{[(4-methylpiperazin- 1-yl)acetyl]amino}-4- (trifluoromethoxy)benzamide 1.043 61 [00194]embedded image 3-[(morpholin-4- ylacetyl)amino]-N-[5- (pyridin-2-yl)pyrazin-2-yl]-4- (trifluoromethoxy)benzamide 1.139 62 [00195]embedded image 3-{[(1-imino-1-oxido- 1lambda4,4-thiazinan-4- yl)acetyl]aminol-N-(6- phenylpyridazin-3-yl)-4- (trifluoromethoxy)benzamide 1.014 63 [00196]embedded image N-[5-(3- fluorophenyl)pyrazin-2-yl]- 3-[(morpholin-4- ylacetyl)amino]-4- (trifluoromethoxy)benzamide 1.363

    Pharmaceutical Compositions of the Compounds of the Invention

    [0745] This invention also relates to pharmaceutical compositions containing one or more compounds of the present invention. These compositions can be utilised to achieve the desired pharmacological effect by administration to a patient in need thereof. A patient, for the purpose of this invention, is a mammal, including a human, in need of treatment for the particular condition or disease. Therefore, the present invention includes pharmaceutical compositions that are comprised of a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound, or salt thereof, of the present invention. A pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient. A pharmaceutically effective amount of compound is preferably that amount which produces a result or exerts an influence on the particular condition being treated. The compounds of the present invention can be administered with pharmaceutically-acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations, orally, parenterally, topically, nasally, ophthalmically, optically, sublingually, rectally, vaginally, and the like.

    [0746] For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, troches, lozenges, melts, powders, solutions, suspensions, or emulsions, and may be prepared according to methods known to the art for the manufacture of pharmaceutical compositions. The solid unit dosage forms can be a capsule that can be of the ordinary hard- or soft-shelled gelatine type containing, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch.

    [0747] In another embodiment, the compounds of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatine, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, colouring agents, and flavouring agents such as peppermint, oil of wintergreen, or cherry flavouring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient. Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.

    [0748] Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavouring and colouring agents described above, may also be present.

    [0749] The pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils. Suitable emulsifying agents may be (1) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavouring agents.

    [0750] Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol. The suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate; one or more colouring agents; one or more flavouring agents; and one or more sweetening agents such as sucrose or saccharin.

    [0751] Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavouring and colouring agents.

    [0752] The compounds of this invention may also be administered parenterally, that is, subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or interperitoneally, as injectable dosages of the compound in preferably a physiologically acceptable diluent with a pharmaceutical carrier which can be a sterile liquid or mixture of liquids such as water, saline, aqueous dextrose and related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, glycerol ketals such as 2,2-dimethyl-1,1-dioxolane-4-methanol, ethers such as poly(ethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid glyceride, with or without the addition of a pharmaceutically acceptable surfactant such as a soap or a detergent, suspending agent such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agent and other pharmaceutical adjuvants.

    [0753] Illustrative of oils which can be used in the parenteral formulations of this invention are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, sesame oil, cottonseed oil, corn oil, olive oil, petrolatum and mineral oil. Suitable fatty acids include oleic acid, stearic acid, isostearic acid and myristic acid. Suitable fatty acid esters are, for example, ethyl oleate and isopropyl myristate. Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts and suitable detergents include cationic detergents, for example dimethyl dialkyl ammonium halides, alkyl pyridinium halides, and alkylamine acetates; anionic detergents, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates; non-ionic detergents, for example, fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene-oxypropylene)s or ethylene oxide or propylene oxide copolymers; and amphoteric detergents, for example, alkyl-beta-aminopropionates, and 2-alkylimidazoline quarternary ammonium salts, as well as mixtures.

    [0754] The parenteral compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimise or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight. The surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.

    [0755] Illustrative of surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.

    [0756] The pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene sorbitan monooleate.

    [0757] The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.

    [0758] A composition of the invention may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are, for example, cocoa butter and polyethylene glycol.

    [0759] Another formulation employed in the methods of the present invention employs transdermal delivery devices (patches). Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see, e.g., U.S. Pat. No. 5,023,252, issued Jun. 11, 1991, incorporated herein by reference). Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.

    [0760] Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.

    [0761] It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device. The construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art. Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier. One such implantable delivery system, used for the transport of agents to specific anatomical regions of the body, is described in U.S. Pat. No. 5,011,472, issued Apr. 30, 1991.

    [0762] The compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized.

    [0763] Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M. F. et al., Compendium of Excipients for Parenteral Formulations PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-311; Strickley, R. G Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349; and Nema, S. et al., Excipients and Their Use in Injectable Products PDA Journal of Pharmaceutical Science & Technology 1997, 51(4), 166-171.

    [0764] Commonly used pharmaceutical ingredients that can be used as appropriate to formulate the composition for its intended route of administration include:

    acidifying agents (examples include but are not limited to acetic acid, citric acid, fumaric acid, hydrochloric acid, nitric acid);
    alkalinizing agents (examples include but are not limited to ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine);
    adsorbents (examples include but are not limited to powdered cellulose and activated charcoal);
    aerosol propellants (examples include but are not limited to carbon dioxide, CCl.sub.2F.sub.2, F.sub.2ClCCClF.sub.2 and CClF.sub.3)
    air displacement agents (examples include but are not limited to nitrogen and argon);
    antifungal preservatives (examples include but are not limited to benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate);
    antimicrobial preservatives (examples include but are not limited to benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate and thimerosal);
    antioxidants (examples include but are not limited to ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorus acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite);
    binding materials (examples include but are not limited to block polymers, natural and synthetic rubber, polyacrylates, polyurethanes, silicones, polysiloxanes and styrene-butadiene copolymers);
    buffering agents (examples include but are not limited to potassium metaphosphate, dipotassium phosphate, sodium acetate, sodium citrate anhydrous and sodium citrate dihydrate)
    carrying agents (examples include but are not limited to acacia syrup, aromatic syrup, aromatic elixir, cherry syrup, cocoa syrup, orange syrup, syrup, corn oil, mineral oil, peanut oil, sesame oil, bacteriostatic sodium chloride injection and bacteriostatic water for injection)
    chelating agents (examples include but are not limited to edetate disodium and edetic acid)
    colourants (examples include but are not limited to FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel and ferric oxide red);
    clarifying agents (examples include but are not limited to bentonite);
    emulsifying agents (examples include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate);
    encapsulating agents (examples include but are not limited to gelatin and cellulose acetate phthalate)
    flavourants (examples include but are not limited to anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil and vanillin);
    humectants (examples include but are not limited to glycerol, propylene glycol and sorbitol);
    levigating agents (examples include but are not limited to mineral oil and glycerin);
    oils (examples include but are not limited to arachis oil, mineral oil, olive oil, peanut oil, sesame oil and vegetable oil);
    ointment bases (examples include but are not limited to lanolin, hydrophilic ointment, polyethylene glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow ointment, and rose water ointment);
    penetration enhancers (transdermal delivery) (examples include but are not limited to monohydroxy or polyhydroxy alcohols, mono- or polyvalent alcohols, saturated or unsaturated fatty alcohols, saturated or unsaturated fatty esters, saturated or unsaturated dicarboxylic acids, essential oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones and ureas)
    plasticizers (examples include but are not limited to diethyl phthalate and glycerol);
    solvents (examples include but are not limited to ethanol, corn oil, cottonseed oil, glycerol, isopropanol, mineral oil, oleic acid, peanut oil, purified water, water for injection, sterile water for injection and sterile water for irrigation);
    stiffening agents (examples include but are not limited to cetyl alcohol, cetyl esters wax, microcrystalline wax, paraffin, stearyl alcohol, white wax and yellow wax);
    suppository bases (examples include but are not limited to cocoa butter and polyethylene glycols (mixtures));
    surfactants (examples include but are not limited to benzalkonium chloride, nonoxynol 10, oxtoxynol 9, polysorbate 80, sodium lauryl sulfate and sorbitan mono-palmitate);
    suspending agents (examples include but are not limited to agar, bentonite, carbomers, carboxymethylcellulose sodium, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, kaolin, methylcellulose, tragacanth and veegum);
    sweetening agents (examples include but are not limited to aspartame, dextrose, glycerol, mannitol, propylene glycol, saccharin sodium, sorbitol and sucrose);
    tablet anti-adherents (examples include but are not limited to magnesium stearate and talc);
    tablet binders (examples include but are not limited to acacia, alginic acid, carboxymethylcellulose sodium, compressible sugar, ethylcellulose, gelatin, liquid glucose, methylcellulose, non-crosslinked polyvinyl pyrrolidone, and pregelatinized starch);
    tablet and capsule diluents (examples include but are not limited to dibasic calcium phosphate, kaolin, lactose, mannitol, microcrystalline cellulose, powdered cellulose, precipitated calcium carbonate, sodium carbonate, sodium phosphate, sorbitol and starch);
    tablet coating agents (examples include but are not limited to liquid glucose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose, ethylcellulose, cellulose acetate phthalate and shellac);
    tablet direct compression excipients (examples include but are not limited to dibasic calcium phosphate);
    tablet disintegrants (examples include but are not limited to alginic acid, carboxymethylcellulose calcium, microcrystalline cellulose, polacrillin potassium, cross-linked polyvinylpyrrolidone, sodium alginate, sodium starch glycollate and starch);
    tablet glidants (examples include but are not limited to colloidal silica, corn starch and talc);
    tablet lubricants (examples include but are not limited to calcium stearate, magnesium stearate, mineral oil, stearic acid and zinc stearate);
    tablet/capsule opaquants (examples include but are not limited to titanium dioxide);
    tablet polishing agents (examples include but are not limited to carnuba wax and white wax);
    thickening agents (examples include but are not limited to beeswax, cetyl alcohol and paraffin);
    tonicity agents (examples include but are not limited to dextrose and sodium chloride);
    viscosity increasing agents (examples include but are not limited to alginic acid, bentonite, carbomers, carboxymethylcellulose sodium, methylcellulose, polyvinyl pyrrolidone, sodium alginate and tragacanth); and
    wetting agents (examples include but are not limited to heptadecaethylene oxycetanol, lecithins, sorbitol monooleate, polyoxyethylene sorbitol monooleate, and polyoxyethylene stearate).

    [0765] Pharmaceutical compositions according to the present invention can be illustrated as follows:

    Sterile IV Solution:

    [0766] A 5 mg/ml solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1-2 mg/ml with sterile 5% dextrose and is administered as an IV infusion over about 60 minutes.

    Lyophilised Powder for IV Administration:

    [0767] A sterile preparation can be prepared with (i) 100-1000 mg of the desired compound of this invention as a lyophilised powder, (ii) 32-327 mg/ml sodium citrate, and (iii) 300-3000 mg Dextran 40. The formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/ml, which is further diluted with saline or dextrose 5% to 0.2-0.4 mg/ml, and is administered either IV bolus or by IV infusion over 15-60 minutes.

    Intramuscular Suspension:

    [0768] The following solution or suspension can be prepared, for intramuscular injection:

    50 mg/ml of the desired, water-insoluble compound of this invention
    5 mg/ml sodium carboxymethylcellulose
    4 mg/ml TWEEN 80
    9 mg/ml sodium chloride
    9 mg/ml benzyl alcohol

    Hard Shell Capsules:

    [0769] A large number of unit capsules are prepared by filling standard two-piece hard galantine capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.

    Soft Gelatin Capsules:

    [0770] A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil is prepared and injected by means of a positive displacement pump into molten gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are washed and dried. The active ingredient can be dissolved in a mixture of polyethylene glycol, glycerin and sorbitol to prepare a water miscible medicine mix.

    Tablets:

    [0771] A large number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg. of starch, and 98.8 mg of lactose. Appropriate aqueous and non-aqueous coatings may be applied to increase palatability, improve elegance and stability or delay absorption.

    Immediate Release Tablets/Capsules:

    [0772] These are solid oral dosage forms made by conventional and novel processes. These units are taken orally without water for immediate dissolution and delivery of the medication. The active ingredient is mixed in a liquid containing ingredient such as sugar, gelatin, pectin and sweeteners. These liquids are solidified into solid tablets or caplets by freeze drying and solid state extraction techniques. The drug compounds may be compressed with viscoelastic and thermoelastic sugars and polymers or effervescent components to produce porous matrices intended for immediate release, without the need of water.

    Methods of Treatment

    [0773] The compounds and compositions provided herein can be used as inhibitors of one or more members of the Wnt pathway, including one or more Wnt proteins, and thus can be used to treat a variety of disorders and diseases in which aberrant Wnt signaling is implicated, such as cancer and other diseases associated with abnormal angiogenesis, cellular proliferation, and cell cycling. Accordingly, the compounds and compositions provided herein can be used to treat cancer, to reduce or inhibit angiogenesis, to reduce or inhibit cellular proliferation and correct a genetic disorder due to mutations in Wnt signaling components. Non-limiting examples of diseases which can be treated with the compounds and compositions provided herein include a variety of cancers, diabetic retinopathy, neovascular glaucoma, rheumatoid arthritis, psoriasis, mycotic and viral infections, osteochondrodysplasia, Alzheimer's disease, osteoarthritis, polyposis coli, osteoporosis-pseudoglioma syndrome, familial exudative vitreoretinopathy, retinal angiogenesis, early coronary disease, tetra-amelia syndrome, Mllerian-duct regression and virilization, SERKAL syndrome, diabetes mellitus type 2, Fuhrmann syndrome, Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome, odonto-onycho-dermal dysplasia, obesity, split-hand/foot malformation, caudal duplication syndrome, tooth agenesis, Wilms tumor, skeletal dysplasia, focal dermal hypoplasia, autosomal recessive anonychia, neural tube defects, alpha-thalassemia (ATRX) syndrome, fragile X syndrome, ICF syndrome, Angelman syndrome, Prader-Willi syndrome, Beckwith-Wiedemarm Syndrome and Rett syndrome.

    [0774] In accordance with another aspect therefore, the present invention covers a compound of general formula (I), or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, as described and defined herein, for use in the treatment or prophylaxis of a disease, as mentioned supra.

    [0775] Another particular aspect of the present invention is therefore the use of a compound of general formula (I), described supra, or a stereoisomer, a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the prophylaxis or treatment of a disease.

    [0776] Another particular aspect of the present invention is therefore the use of a compound of general formula (I) described supra for manufacturing a pharmaceutical composition for the treatment or prophylaxis of a disease.

    [0777] The term pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention. For example, see S. M. Berge, et al. Pharmaceutical Salts, J. Pharm. Sci. 1977, 66, 1-19.

    [0778] A suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic, persulfuric, 3-phenylpropionic, picric, pivalic, 2-hydroxyethanesulfonate, itaconic, sulfamic, trifluoromethanesulfonic, dodecylsulfuric, ethansulfonic, benzenesulfonic, para-toluenesulfonic, methansulfonic, 2-naphthalenesulfonic, naphthalinedisulfonic, camphorsulfonic acid, citric, tartaric, stearic, lactic, oxalic, malonic, succinic, malic, adipic, alginic, maleic, fumaric, D-gluconic, mandelic, ascorbic, glucoheptanoic, glycerophosphoric, aspartic, sulfosalicylic, hemisulfuric, or thiocyanic acid, for example.

    [0779] Further, another suitably pharmaceutically acceptable salt of a compound of the present invention which is sufficiently acidic, is an alkali metal salt, for example a sodium or potassium salt, an alkaline earth metal salt, for example a calcium or magnesium salt, an ammonium salt or a salt with an organic base which affords a physiologically acceptable cation, for example a salt with N-methyl-glucamine, dimethyl-glucamine, ethyl-glucamine, lysine, dicyclohexylamine, 1,6-hexadiamine, ethanolamine, glucosamine, sarcosine, serinol, tris-hydroxy-methyl-aminomethane, aminopropandiol, sovak-base, 1-amino-2,3,4-butantriol. Additionally, basic nitrogen containing groups may be quaternised with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, and dibutyl sulfate; and diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.

    [0780] Those skilled in the art will further recognise that acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods. Alternatively, alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods.

    Method of Treating Hyper-Proliferative Disorders

    [0781] The present invention relates to a method for using the compounds of the present invention and compositions thereof, to treat mammalian hyper-proliferative disorders. Compounds can be utilized to inhibit, block, reduce, decrease, etc., cell proliferation and/or cell division, and/or produce apoptosis. This method comprises administering to a mammal in need thereof, including a human, an amount of a compound of this invention, or a pharmaceutically acceptable salt, isomer, polymorph, metabolite, hydrate, solvate or ester thereof; etc. which is effective to treat the disorder. Hyper-proliferative disorders include but are not limited, e.g., psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid tumours, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases. Those disorders also include lymphomas, sarcomas, and leukaemias.

    [0782] Examples of breast cancer include, but are not limited to invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.

    [0783] Examples of cancers of the respiratory tract include, but are not limited to small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.

    [0784] Examples of brain cancers include, but are not limited to brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.

    [0785] Tumours of the male reproductive organs include, but are not limited to prostate and testicular cancer. Tumours of the female reproductive organs include, but are not limited to endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.

    [0786] Tumours of the digestive tract include, but are not limited to anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland cancers.

    [0787] Tumours of the urinary tract include, but are not limited to bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.

    [0788] Eye cancers include, but are not limited to intraocular melanoma and retinoblastoma.

    [0789] Examples of liver cancers include, but are not limited to hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.

    [0790] Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.

    [0791] Head-and-neck cancers include, but are not limited to laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell. Lymphomas include, but are not limited to AIDS-related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.

    [0792] Sarcomas include, but are not limited to sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.

    [0793] Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.

    [0794] These disorders have been well characterized in humans, but also exist with a similar etiology in other mammals, and can be treated by administering pharmaceutical compositions of the present invention.

    [0795] The term treating or treatment as stated throughout this document is used conventionally, e.g., the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of, etc., of a disease or disorder, such as a carcinoma.

    Dose and Administration

    [0796] Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of hyper-proliferative disorders and angiogenic disorders, by standard toxicity tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and by comparison of these results with the results of known medicaments that are used to treat these conditions, the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication. The amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.

    [0797] The total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day. Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing. In addition, drug holidays in which a patient is not dosed with a drug for a certain period of time, may be beneficial to the overall balance between pharmacological effect and tolerability. A unit dosage may contain from about 0.5 mg to about 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day. The average daily dosage for administration by injection, including intravenous, intramuscular, subcutaneous and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily. The transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg. The average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.

    [0798] Of course the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.

    [0799] Preferably, the diseases of said method are haematological tumours, solid tumour and/or metastases thereof.

    [0800] The compounds of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.

    [0801] Methods of testing for a particular pharmacological or pharmaceutical property are well known to persons skilled in the art.

    [0802] The example testing experiments described herein serve to illustrate the present invention and the invention is not limited to the examples given.

    Combination Therapies

    [0803] The term combination in the present invention is used as known to persons skilled in the art and may be present as a fixed combination, a non-fixed combination or kit-of-parts.

    [0804] A fixed combination in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present together in one unit dosage or in a single entity. One example of a fixed combination is a pharmaceutical composition wherein the said first active ingredient and the said second active ingredient are present in admixture for simultaneous administration, such as in a formulation. Another example of a fixed combination is a pharmaceutical combination wherein the said first active ingredient and the said second active ingredient are present in one unit without being in admixture.

    [0805] A non-fixed combination or kit-of-parts in the present invention is used as known to persons skilled in the art and is defined as a combination wherein the said first active ingredient and the said second active ingredient are present in more than one unit. One example of a non-fixed combination or kit-of-parts is a combination wherein the said first active ingredient and the said second active ingredient are present separately. The components of the non-fixed combination or kit-of-parts may be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.

    [0806] The compounds of this invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutical agents where the combination causes no unacceptable adverse effects. The present invention relates also to such combinations. For example, the compounds of this invention can be combined with known chemotherapeutic agents or anti-cancer agents, e.g. anti-hyper-proliferative or other indication agents, and the like, as well as with admixtures and combinations thereof. Other indication agents include, but are not limited to, anti-angiogenic agents, mitotic inhibitors, alkylating agents, anti-metabolites, DNA-intercalating antibiotics, growth factor inhibitors, cell cycle inhibitors, enzyme inhibitors, toposisomerase inhibitors, biological response modifiers, or anti-hormones.

    [0807] The term (chemotherapeutic) anti-cancer agents, includes but is not limited to 131I-chTNT, abarelix, abiraterone, aclarubicin, aldesleukin, alemtuzumab, alitretinoin, altretamine, aminoglutethimide, amrubicin, amsacrine, anastrozole, arglabin, arsenic trioxide, asparaginase, azacitidine, basiliximab, BAY 80-6946, BAY 1000394, belotecan, bendamustine, bevacizumab, bexarotene, bicalutamide, bisantrene, bleomycin, bortezomib, buserelin, busulfan, cabazitaxel, calcium folinate, calcium levofolinate, capecitabine, carboplatin, carmofur, carmustine, catumaxomab, celecoxib, celmoleukin, cetuximab, chlorambucil, chlormadinone, chlormethine, cisplatin, cladribine, clodronic acid, clofarabine, crisantaspase, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, darbepoetin alfa, dasatinib, daunorubicin, decitabine, degarelix, denileukin diftitox, denosumab, deslorelin, dibrospidium chloride, docetaxel, doxifluridine, doxorubicin, doxorubicin+estrone, eculizumab, edrecolomab, elliptinium acetate, eltrombopag, endostatin, enocitabine, epirubicin, epitiostanol, epoetin alfa, epoetin beta, eptaplatin, eribulin, erlotinib, estradiol, estramustine, etoposide, everolimus, exemestane, fadrozole, filgrastim, fludarabine, fluorouracil, flutamide, formestane, fotemustine, fulvestrant, gallium nitrate, ganirelix, gefitinib, gemcitabine, gemtuzumab, glutoxim, goserelin, histamine dihydrochloride, histrelin, hydroxycarbamide, I-125 seeds, ibandronic acid, ibritumomab tiuxetan, idarubicin, ifosfamide, imatinib, imiquimod, improsulfan, interferon alfa, interferon beta, interferon gamma, ipilimumab, irinotecan, ixabepilone, lanreotide, lapatinib, lenalidomide, lenograstim, lentinan, letrozole, leuprorelin, levamisole, lisuride, lobaplatin, lomustine, lonidamine, masoprocol, medroxyprogesterone, megestrol, melphalan, mepitiostane, mercaptopurine, methotrexate, methoxsalen, Methyl aminolevulinate, methyltestosterone, mifamurtide, miltefosine, miriplatin, mitobronitol, mitoguazone, mitolactol, mitomycin, mitotane, mitoxantrone, nedaplatin, nelarabine, nilotinib, nilutamide, nimotuzumab, nimustine, nitracrine, ofatumumab, omeprazole, oprelvekin, oxaliplatin, p53 gene therapy, paclitaxel, palifermin, palladium-103 seed, pamidronic acid, panitumumab, pazopanib, pegaspargase, PEG-epoetin beta (methoxy PEG-epoetin beta), pegfilgrastim, peginterferon alfa-2b, pemetrexed, pentazocine, pentostatin, peplomycin, perfosfamide, picibanil, pirarubicin, plerixafor, plicamycin, poliglusam, polyestradiol phosphate, polysaccharide-K, porfimer sodium, pralatrexate, prednimustine, procarbazine, quinagolide, radium-223 chloride, raloxifene, raltitrexed, ranimustine, razoxane, refametinib, regorafenib, risedronic acid, rituximab, romidepsin, romiplostim, sargramostim, sipuleucel-T, sizofiran, sobuzoxane, sodium glycididazole, sorafenib, streptozocin, sunitinib, talaporfin, tamibarotene, tamoxifen, tasonermin, teceleukin, tegafur, tegafur+gimeracil+oteracil, temoporfin, temozolomide, temsirolimus, teniposide, testosterone, tetrofosmin, thalidomide, thiotepa, thymalfasin, tioguanine, tocilizumab, topotecan, toremifene, tositumomab, trabectedin, trastuzumab, treosulfan, tretinoin, trilostane, triptorelin, trofosfamide, tryptophan, ubenimex, valrubicin, vandetanib, vapreotide, vemurafenib, vinblastine, vincristine, vindesine, vinflunine, vinorelbine, vorinostat, vorozole, yttrium-90 glass microspheres, zinostatin, zinostatin stimalamer, zoledronic acid, zorubicin.

    [0808] Generally, the use of cytotoxic and/or cytostatic agents in combination with a compound or composition of the present invention will serve to: [0809] (1) yield better efficacy in reducing the growth of a tumor or even eliminate the tumor as compared to administration of either agent alone, [0810] (2) provide for the administration of lesser amounts of the administered chemotherapeutic agents, [0811] (3) provide for a chemotherapeutic treatment that is well tolerated in the patient with fewer deleterious pharmacological complications than observed with single agent chemotherapies and certain other combined therapies, [0812] (4) provide for treating a broader spectrum of different cancer types in mammals, especially humans, [0813] (5) provide for a higher response rate among treated patients, [0814] (6) provide for a longer survival time among treated patients compared to standard chemotherapy treatments, [0815] (7) provide a longer time for tumor progression, and/or [0816] (8) yield efficacy and tolerability results at least as good as those of the agents used alone, compared to known instances where other cancer agent combinations produce antagonistic effects.

    Biological Assays

    [0817] Examples were tested in selected biological assays one or more times. When tested more than once, data are reported as either average values or as median values, wherein [0818] the average value, also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested, and [0819] the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the median is the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.

    [0820] Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch.

    Measurement of the Inhibitory Activity of Selected Compounds on the Wnt Signaling Cascade

    [0821] In order to discover and characterize small molecules which inhibit the constitutive active colorectal cancer cell (CRC) Wnt pathway, a cellular reporter assay was employed. The corresponding assay cell was generated by transfection of the colorectal cancer cell line HCT116 (ATCC, #CCL-247) with the Super TopFlash vector (Morin, Science 275, 1997, 1787-1790; Molenaar et al., Cell 86 (3), 1996, 391-399). The HCT116 cell line is cultivated at 37 C. and 5% CO.sub.2 in DMEM/F-12 (Life Technologies, #11320-074), supplemented with 2 mM glutamine, 20 mM HEPES, 1.4 mM pyruvate, 0.15% Na-bicarbonate and 10% foetal bovine serum (GIBCO, #10270), this cancer cell line is pathophysiological relevant since it carries a deletion of position S45 in the -catenin gene, leading to constitutive active Wnt signaling. Stable transfectants were generated by cotransfection with pcDNA3 and selection of stable transfected cells with 1 mg/ml G418.

    [0822] In a parallel approach, HCT116 cells were cotransfected with the FOP control vector and pcDNA3. The FOP vector is identical to the TOP construct, but it contains instead of functional TCF elements a randomized, non-functional sequence. For this transfection a stable transfected cell line was generated as well.

    [0823] In preparation of the assay, the two cell lines were plated 24 hours before at 10000 cells per well of a 384 micro titre plate (MTP) in 30 L growth medium. Selective inhibitory activity for small molecules on the mutated Wnt pathway was determined after parallel incubation of both (TOP and FOP) HCT116 reporter cell lines with a compound dilution series from 50 M to 15 nM in steps of 3.16-fold dilutions in CAFTY buffer (130 mM NaCl, 5 mM KCl, 20 mM HEPES, 1 mM MgCl.sub.2, 5 mM NaHCO3, pH 7.4) containing 2 mM Ca.sup.2+ and 0.01% BSA. The compounds were thereby serially prediluted in 100% DMSO and thereafter in addition 50 fold into the CAFTY compound dilution buffer (described above). From this dilution 10 L were added to the cells in 30 L growth medium and incubated for 36 hours at 37 C. and 5% CO.sub.2. Thereafter luciferase assay buffer (1:1 mixture of luciferase substrate buffer (20 mM Tricine, 2.67 mM MgSO.sub.4, 0.1 mM EDTA, 4 mM DTT, 270 M Coenzyme A, 470 M Luciferin, 530 M ATP, ph adjusted to pH 7.8 with a sufficient volume of 5M NaOH) and Triton buffer (30 mL Triton X-100, 115 mL glycerol, 308 mg Dithiothreitol, 4.45 g Na.sub.2HPO.sub.4.2H.sub.2O, 3.03 g TRIS HCl, ad 1 l H.sub.20, pH 7.8) was added as equal volume to the compound solution on the cells to determine luciferase expression as a measure of Wnt signaling activity in a luminometer.

    [0824] In order to determine the inhibitory activity of compounds for the WT Wnt signaling pathway, the Super TopFlash vector respectively FOP vector were cotransfected with pcDNA3 into HEK293 and stable transfected HEK293 cells were isolated by antibiotic selection. In preparation of compound testing, a dose response curve for the Wnt dependent luciferase expression was recorded by stimulating the assay cells with human recombinant Wnt-3a (R&D, #5036-WN-010) at different concentrations for 16 hours at 37 C. and 5% CO.sub.2 followed by subsequent luciferase measurement as described above to determine the Wnt-3a EC50 for the HEK293 TOP cell line on the day of testing. The recombinant human Wnt-3a was thereby used between 2500 and 5 ng/ml in two-fold dilution steps. To determine the inhibitory activity of compounds on the WT Wnt pathway they were prepared and diluted as described above for the constitutive active Wnt pathway and coincubated with the EC.sub.50 concentration of Wnt-3a for 16 hours at 37 C. and 5% CO.sub.2 on the HEK293 TOP respectively control HEK293 FOP cells. Measurement of luciferase expression was done as described for the constitutive active Wnt assay.

    TABLE-US-00003 TABLE 2 HCT116 TOPFlash HCT116 FOPFlash Example No IC.sub.50 [mol/L] IC.sub.50 [mol/L] 1 2.48E8 5.00E5 2 1.62E7 5.00E5 3 9.92E8 5.00E5 4 1.75E8 5.00E5 5 2.05E7 5.00E5 6 8.34E7 5.00E5 7 2.00E8 5.00E5 8 1.25E7 5.00E5 9 2.97E8 5.00E5 10 6.32E8 5.00E5 11 1.30E8 5.00E5 12 1.20E7 5.00E5 13 6.72E8 5.00E5 14 5.40E8 5.00E5 15 6.36E7 5.00E5 16 4.33E8 5.00E5 17 4.18E7 5.00E5 18 1.60E8 .sup.2.00E5 19 3.25E7 5.00E5 20 1.44E8 5.00E5 21 1.68E8 .sup.1.10E5 22 1.70E8 .sup.3.80E5 23 2.97E8 .sup.4.60E5 24 3.55E8 5.00E5 25 4.62E6 .sup.2.31E5 26 5.80E8 5.00E5 27 1.67E5 5.00E5 28 6.40E8 5.00E5 29 1.67E5 5.00E5 30 8.20E8 5.00E5 31 8.85E8 .sup.2.68E5 32 1.67E5 .sup.4.00E5 33 1.15E7 .sup.3.15E5 34 1.26E5 5.00E5 35 1.16E7 5.77E6 36 1.20E7 5.00E5 37 2.23E7 5.00E5 38 1.23E7 5.00E5 39 2.25E7 .sup.2.49E5 40 1.53E7 5.00E5 41 2.25E7 5.00E5 42 1.20E7 5.00E5 43 1.55E7 .sup.2.76E5 44 1.68E5 5.00E5 45 1.67E5 5.00E5 46 1.68E5 5.00E5 47 2.40E7 .sup.4.10E6 48 2.60E7 .sup.7.73E6 49 2.60E7 5.00E5 50 1.69E5 5.00E5 51 4.83E7 5.00E5 52 3.72E7 .sup.4.47E5 53 8.30E7 .sup.9.50E6 54 1.35E6 5.00E5 55 1.72E5 .sup.2.62E5 56 2.00E6 5.00E5 57 2.40E6 5.00E5 58 2.90E6 5.00E5 59 3.00E6 5.00E5 60 4.10E6 5.00E5 61 5.00E5 5.00E5 62 1.25E5 .sup.2.55E5 63 1.60E5 5.00E5 Ref. 1.38E6 .sup.3.10E6 Ref. in Table 2 means the compound niclosamide disclosed in prior art (compound 1-8 on page 36 of WO2011/035321A1) which is less selective than the compounds of the present invention.

    Measurement of the Inhibitory Activity of Selected Compounds on the Wildtype Wnt Signaling Cascade

    [0825] In order to discover and characterize small molecules which inhibit the wildtype Wnt pathway, a cellular reporter assay was employed. The corresponding assay cell was generated by transfection of the mammalian cell line HEK293 (ATCC, #CRL-1573) with the Super TopFlash vector (Morin, Science 275, 1997, 1787-1790; Molenaar et al., Cell 86 (3), 1996, 391-399). The HEK293 cell line is cultivated at 37 C. and 5% CO.sub.2 in DMEM (Life Technologies, #41965-039), supplemented with 2 mM glutamine, 20 mM HEPES, 1.4 mM pyruvate, 0.15% Na-bicarbonate and 10% foetal bovine serum (GIBCO, #10270). Stable transfectants were generated by selection with 300 g/ml Hygromycin.

    [0826] In a parallel approach, HEK293 cells were cotransfected with the FOP control vector and pcDNA3. The FOP vector is identical to the TOP construct, but it contains instead of functional TCF elements a randomized, non-functional sequence. For this transfection a stable transfected cell line was generated as well, based on selection with Geneticin (1 mg/ml).

    [0827] In preparation of the assay, the two cell lines were plated 24 hours before beginning the test at 10000 cells per well in a 384 micro titre plate (MTP) in 30 it growth medium. Before compound testing a dose response curve for the Wnt dependent luciferase expression was recorded by stimulating the assay cell line with human recombinant Wnt-3a (R&D, #5036-WN-010) at different concentrations for 16 hours at 37 C. and 5% CO.sub.2 followed by subsequent luciferase measurement, to determine the Wnt-3a EC.sub.50 for the HEK293 TOP cell line on the day of testing. The recombinant human Wnt-3a was thereby applied between 2500 and 5 ng/ml in two-fold dilution steps.

    [0828] Selective inhibitory activity for small molecules on the wildtype Wnt pathway was determined after parallel incubation of both (TOP and FOP) HEK293 reporter cell lines with a compound dilution series from 50 M to 15 nM in steps of 3.16-fold dilutions in CAFTY buffer (130 mM NaCl, 5 mM KCl, 20 mM HEPES, 1 mM MgCl.sub.2, 5 mM NaHCO3, pH 7.4) containing 2 mM Ca.sup.2+ and 0.01% BSA.

    [0829] The compounds were thereby serially prediluted in 100% DMSO and thereafter 50 fold into the CAFTY compound dilution buffer (described above). From this dilution 10 it were added in combination with the EC.sub.50 concentration of recombinant Wnt3a to the cells in 30 it growth medium and incubated for 16 hours at 37 C. and 5% CO.sub.2. Thereafter luciferase assay buffer (1:1 mixture of luciferase substrate buffer (20 mM Tricine, 2.67 mM MgSO.sub.4, 0.1 mM EDTA, 4 mM DTT, 270 M Coenzyme A, 470 M Luciferin, 530 M ATP, ph adjusted to pH 7.8 with a sufficient volume of 5M NaOH) and Triton buffer (30 ml Triton X-100, 115 ml glycerol, 308 mg Dithiothreitol, 4.45 g Na.sub.2HPO.sub.4.2H.sub.2O, 3.03 g TRIS HCl (CAS Number 1185-53-1), ad 1 l H.sub.20, pH 7.8) was added in an equal volume to determine luciferase expression as a measure of Wnt signaling activity in a luminometer. The Wnt inhibitory activity was determined as IC.sub.50 of resulting dose response curves.

    QPCR Protocol

    [0830] Real-time RT-PCR using a TaqMan fluorogenic detection system is a simple and sensitive assay for quantitative analysis of gene transcription. The TaqMan fluorogenic detection system can monitor PCR in real time using a dual-labeled fluorogenic hybridization probe (TaqMan probe) and a polymerase with 5-3 exonuclease activity.

    [0831] Cells from different cancer cell lines (as HCT116, but not limited to) were grown at 500-1000 cells/well in 384 well cell culture plates. For cell lysis the cell medium was carefully removed. The cells were washed carefully once with 50 L/well PBS. Then 9.75 L/well cell lysis buffer (50 mM TRIS HCl pH 8.0, 40 mM NaCl, 1.5 mM MgCl.sub.2, 0.5% IGEPAL CA 630, 50 mM Guanidium thiocyanate) and 0.25 L RNASeOUT (40 U/l, Invitrogen, 10777-019)) per well were added. The plate was incubated for 5 min at room temperature. Then 30 L DNAse/RNAse-free water per well added and the lysates were mixed. For the One-Step RT-PCR 2 L lysate (each) was transferred to a 384 well PCR plate. The PCR reaction was composed by 5 L 2 One Step RT qPCR MasterMix Plus, 0.05 L Euroscript RT/RNAse Inhibitor (50 U/l, 20 U/l) and 200 nM of the appropriate Primer/Hydrolysis Probe mix (primer sequences of forward, reverse and probe are given below for each analysed gene of interest or house keeping gene). 10 L water were added per well. Seal the plate with an adhesive optical film. The RT-PCR protocol was setup with 30 min 48 C., then 10 min 95 C. followed by 50 cycles of 15 sec 95 C./1 min 60 C. and a cooling step of 40 C. for 30 sec using a Lightcycler L5440 from Roche. Relative expression was calculated using CP values from the gene of interest (e.g. AXIN2, but not limited to) and a house keeping gene (L32).

    TABLE-US-00004 Usedprimers L32 (forwardprimer:AAGTTCATCCGGCACCAGTC; reverseprimer:TGGCCCTTGAATCTTCTACGA; probe:CCCAGAGGCATTGACAACAGGG) AXIN2 (forwardprimer:AGGCCAGTGAGTTGGTTGTC; reverseprimer:AGCTCTGAGCCTTCAGCATC; probe:TCTGTGGGGAAGAAATTCCATACCG) SequenceListings SEQIDNO 1 AAGTTCATCCGGCACCAGTC 2 TGGCCCTTGAATCTTCTACGA 3 CCCAGAGGCATTGACAACAGGG 4 AGGCCAGTGAGTTGGTTGTC 5 AGCTCTGAGCCTTCAGCATC 6 TCTGTGGGGAAGAAATTCCATACCG