Method for detection of viable endophyte in plants
09631242 ยท 2017-04-25
Assignee
Inventors
Cpc classification
International classification
Abstract
The invention provides a method and compositions for detecting the presence of viable endophyte in a plant, the method comprising germinating seed and excising a young leaf, optionally preparing an extract from the young leaf, and performing antibody, nucleic acid, or preferably PCR-based methods to detect the viable endophyte, wherein at least one primer hybridizes to the intergenic region (IGS) of the ribosomal repeat region of a specific endophyte when used in a PCR-based method. The invention provides a new method for rapid identification of both viable beneficial endophytes and any viable contaminating endophytes, as opposed to any non-viable endophytes, by detecting the presence of endophytes in the first leaf of germinated plants.
Claims
1. A method for detecting the presence of viable fungal endophyte in a plant, the method comprising detecting the presence of a fungal endophyte in a young leaf or extract thereof, from the plant, wherein detecting the presence of the fungal endophyte in the young leaf or extract is indicative of the presence of viable fungal endophyte in the plant, wherein the endophyte is detected by a method that identifies the presence of a particular species or strain of endophyte, wherein at least one primer that hybridizes to a species-specific or strain-specific part of the intergenic region (IGS) of the ribosomal repeat region of a fungal endophyte is used in a PCR-based method to detect the presence of the endophyte, and wherein the fungal endophyte is from the genus Neotyphodium.
2. The method of claim 1 in which the young leaf is one of the first 5 leaves produced by the plant after germination of a seed of the plant.
3. The method of claim 1 in which the young leaf is the first leaf produced by the plant after germination of a seed of the plant.
4. The method of claim 1 in which the young leaf is a leaf from a seedling of the plant that is produced within 4 weeks after germination of a seed of the plant.
5. The method of claim 1 in which the young leaf is from a seedling of the plant that is produced less than 14 days after germination of a seed of the plant.
6. The method of claim 1 in which the young leaf is from a seedling that has grown sufficiently for the leaf to have separated from the coleoptile.
7. The method of claim 1 in which the young leaf is excised, to substantially separate it from other tissues or organs of the plant, before use in the method.
8. The method of claim 1 in which the young leaf is excised, to substantially separate it from the coleoptile, as well as from other tissues or organs, of the plant, before use in the method.
9. The method of claim 1 in which the young leaf is excised, to substantially separate it from the coleoptile and any attached seed, as well as from other tissues or organs, of the plant, before use in the method.
10. The method of claim 1 in which the PCR-based method is quantitative PCR or real time PCR.
11. The method of claim 1 in which the PCR-based method is High Resolution Melting (HRM) real time PCR.
12. The method of claim 1 in which PCR is performed using primers that hybridise to nucleic acid in the endophyte.
13. The method of claim 1 in which at least one primer used in the PCR-based method, is specific for the strain detected, and presence or absence of an amplification product is indicative of presence or absence of the endophyte.
14. The method of claim 1 in which detection is specific for the species or strain detected and in which specificity is determined by the size of the amplified product.
15. The method of claim 1 in which detection is specific for the species or strain detected and in which specificity is determined by the kinetics of production of amplified product.
16. The method of claim 15 in which specificity is determined by the melting profile of the amplified product.
17. The method of claim 16 in which different melting profiles are produced in different species and strains, as a result of differences in sequences to which the primer hybridizes, in different endophyte species or strains.
18. The method of claim 1 in which a seed of the plant is germinated under conditions to maximize hyphal biomass in the young leaves, before the plant is used in the method.
19. The method of claim 1 in which the seed is germinated under conditions to maximize hyphal biomass in the seed in the first emerging leaf, before the plant is used in the method.
20. The method of claim 18 in which the seed is germinated in the temperature range 18 to 26 C.
21. The method of claim 18 in which the seed is germinated at about 22 C.
22. The method of claim 18 in which the seed is germinated in a 16/8 hour light/dark regime.
23. The method of claim 18 in which the seed is germinated in a 12/12 hour light/dark regime.
24. The method of claim 1 in which presence of the endophyte is detected in an extract from the young leaf.
25. The method of claim 24 in which the method includes the step of preparing an extract from the young leaf.
26. The method of claim 1 in which the method includes the step of excising the young leaf.
27. The method of claim 1 which includes the steps of excising the young leaf and making an extract.
28. The method of claim 1 in which the method includes the steps of germinating the seed, and excising the young leaf.
29. The method of claim 1 in which the method includes the steps of germinating the seed, excising the young leaf, and making an extract.
30. The method of claim 1 which is used to screen batches of seed to assess which endophyte species, strain, or strains, is or are present in the batch.
31. The method of claim 30 in which a small sample of seeds is taken from the larger batch and the method is performed on a young leaf after germination of the seeds from the small sample.
32. The method of claim 31 in which the method is used to measure the proportion or percentage of seeds in the small sample that contain viable endophytes of a particular species or strain, in order to estimate the proportion or percentage of seeds in the large batch that contain the viable endophytes.
33. The method of claim 31 in which the method is used to measure the proportion or percentage of seeds in the small sample that contain viable contaminating endophytes, in order to estimate the proportion or percentage of seeds in the large batch that contain viable contaminating endophytes.
34. The method of claim 1 in which at least one step is automated.
35. The method of claim 1 in which the primer has at least 80% identity to any one of the sequences of SEQ ID NO:1 to SEQ ID NO:8.
36. The method of claim 1 in which the primer has the sequence of any one of SEQ ID NO:1 to SEQ ID NO:8.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) ). The HRM curve for AR37 is shown with a solid line (
). The HRM curve for the common toxic wild type N. lolii is shown with a dashed line (
). The HRM curve for AR42 is shown with a dot/dashed line (
).
(2)
(3)
(4)
EXAMPLES
Example 1
Identifying Endophyte Strain Specific Sequences as Targets for PCR Amplification
(5) Materials and Methods
(6) The universal primers (below) were synthesized based on IGS sequences (see Figure) from Duke University (available on the world wide web at http://www.biology.duke.edu/fungi/mycolab/primers.htm).
(7) TABLE-US-00002 (SEQIDNO:17) RJ243F(IGSF,LR12R)GAACGCCTCTAAGTCAGAAATCC (SEQIDNO:18) RJ243R(IGSR,invSRIR)ACTGGCAGAATCAACCAGGTA
(8) PCR was performed on genomic DNA extracted from the following endophyte strains:
(9) Common toxic wild type
(10) AR1
(11) AR42 (similar to wild type strain)
(12) Common toxic wild type N. lolii
(13) AR37
(14) AR542
(15) AR584
(16) AR601
(17) FL1
(18) E. ciliarus
(19) PCR reactions and cycling conditions were:
(20) TABLE-US-00003 20 ul reaction mix using 5 prime PCR Extender Kit 2 ul 10 Tuning Buffer 0.4 ul 25 mM dNTP's 0.8 ul 10 uM Primers (each) 0.2 ul 5 U/ul PCR Extender polymerase MQ up to 20 ul total volume 40 ng genomic DNA as template
PCR Cycling Conditions
(21) TABLE-US-00004 93 C. 3 min 93 C. 15 sec 62 C. 30 sec {close oversize brace} 10 68 C. 5 min 93 C. 15 sec 62 C. 30 sec {close oversize brace} 17 68 C. 5 min = 20 sec/cycle
(22) For AR37 annealing temperatures of 60 C. and 58 C. were also tried.
(23) Results
(24) Approximate products based on gel ladder:
(25) TABLE-US-00005 AR1 ~2.8 Kb AR37 ~1.8 Kb AR42 ~1.8 Kb AR542 ~2.2 Kb AR584 ~2.2 Kb AR601 ~2.8 Kb FL1 ~2.8 Kb E. ciliarus ~1.6 Kb
(26) PCR products were gel purified and sequenced to provide IGS sequences for subsequent alignment between strains. The sequences of the amplified IGS sequences are shown in SEQ ID NO: 9 to 16.
Example 2
PCR Primer Design and Optimisation of PCR Methodology and Conditions to Distinguish Between Endophyte Strains
(27) Materials and Methods
(28) IGS sequences were aligned using clustalW as shown in
(29) Primers that flanked regions unique to specific endophyte strains were designed (Table 1)
(30) Results
(31) The primer pairs listed in Table 1 were designed to IGS sequences and trialled by High Resolution Melting (HRM) PCR to select those useful for providing distinct High Resolution Melting (HRM) profiles for the three endophyte strains (wild type, AR1 and AR37).
(32) TABLE-US-00006 TABLE1 Primer Sequence SEQIDNO: DH008F gaagagttactagctgatgc 1 AR1F gaagagttactagctgatg 2 endoph_F1 tagctgatgcgctgttgttc 3 DH004F ctcatgtgcgggcagtgtag 4 DH004R ctacactgcccgcacatgag 5 DH_IGS_F cctaacctatacctgcccg 6 AR1R cgcgggcaggtataggtt 7 DH007R cctacatataatagcattgc 8
(33) The expected amplicon, the number of Single Nucleotide Polymorphisms (SNPs) and the presence of deletions within a particular strain IGS sequence is also listed in Table 2 below, for the primer pairs shown.
(34) TABLE-US-00007 TABLE 2 Deletions Primer pair Endophyte Size SNP's (BP) DH008F/DH004R AR1 145 5 21 AR37 145 21 WT 166 DH008F/AR1R AR1 174 5 21 AR37 174 21 WT 195 AR1F/DH004R AR1 145 5 21 AR37 145 21 WT 166 AR1F/AR1R AR1 174 5 21 AR37 174 21 WT 195 endoph_F1/DH004R AR1 135 3 21 AR37 135 21 WT 156 endoph_F1/AR1R AR1 164 3 21 AR37 164 21 WT 185 DH004F/DH007R AR1 336 24 AR37 275 10 40, 24 & 21 WT 360 DH_IGSF/DH007R AR1 307 10 24 AR37 246 40, 24 & 21 WT 331 AR1 461 21 & 24 21, 40, 24 & AR37 400 15 21 WT 506 B11F/B11R AR1 148 N/A N/A AR37 130 N/A N/A ctWT 177 N/A N/A AR42 181 N/A N/A
(35) Control DNA extracted from endophyte grown in culture was used to perform HRM on the primer pairs listed in Table 2.
(36) Primer pair DH008F/DH007R was found to give distinct HRM profiles as shown in
(37) PCR conditions for primer pair DH008F/DH007R were:
(38) 94 C. 4 min,
(39) 94 C. 30 sec, 55C 30 sec, 72C 45 sec40
(40) 72 C. 7 min
(41) Used amplitaq Gold Polymerase
(42) 25 ng genomic DNA
(43) 10PCR Buffer gold 1.5 ul/15 ul reaction
(44) 50 mM MgCl2 0.45 ul
(45) 25 mM dNTP's 0.12 ul
(46) 10 uM DH008F/DH007R 0.75 ul
(47) 5 U/ul Ampli Taq Gold 0.12 ul
(48) MQ 9.06 ul
(49) Note that the endophytes are distinguished based on a melting profile rather than on a peak size basis.
Example 3
Optimising Seedling Germination/Growth Conditions from Maximum Hyphal Biomass in Young Leaves
(50) Materials and Methods
(51) Optimisation was performed on ryegrass cultivar Samson infected with the endophyte AR1. (Accession number A10735). A sample of the seeds was heat treated to simulate non-viable endophyte-infected seed. Endophyte viability tests were conducted by Western blotting tillers squashed onto nitrocellulose membrane using standard techniques. The Blotting tests were conducted to determine the % viability of AR1-infected seed in the accession for comparison with PCR results, and to confirm that the endophyte in the heat-treated seed was non-viable. The seed of this accession contained 95% viable endophyte and confirmed that all endophytes in the heat-treated seed were non-viable (
(52) To determine the impact of temperature on fungal biomass in planta, seeds were germinated for 13 days at 19, 22, and 28 C. and seedlings were assessed for endophyte infection by PCR using primers designed to 18S rRNA gene.
(53) TABLE-US-00008 RJ240F/18SrRNA(E.festucae): (SEQIDNO:19) ATCTCTTGGTTCTGGCATCG RJ240R/18SrRNA(E.festucae): (SEQIDNO:20) TGGTTGCGAGGTGGTATGTT
Results
(54) PCR analysis on seedlings demonstrated by blotting to have >95% viability showed that no PCR products were obtained for seeds germinated at either 19 or 28 C. On the contrary all seedlings tested from the 22 C. germinated seeds amplified PCR products of the expected size. The results demonstrate that endophyte biomass in planta is insufficient in seedlings grown either at lower (19 C.) or higher (28 C.) temperatures. On the basis of this result all future DNA extractions and subsequent PCRs (either genotyping or HRM) were performed on seedlings grown at 22 C.
Example 4
Assessing Percentage of Beneficial and Non-Beneficial Endophyte in Seed Batches
(55) Materials and Methods
(56) Fresh seed was provided and sown into compost as described above. After 14 days growth at 22 C. the first leaf of 92 seedlings were harvested into a 96 well robotics microtitre tray. The remaining 4 wells comprised control DNA to assess endophyte type (wt, AR1, AR37) and PCR conditions.
(57) DNA was extracted robotically by Slipstream Automation and transferred robotically into a 96 well HRM plate. HRM PCR was performed using primers DH008F/DH007R and the conditions described above. The HRM software determines the high resolution melting profile for each well and automatically assigns a viability status (product detected) and endophyte type (AR1, AR37 or wt). The percent viability and percent off type is a straight forward calculation of the number of positives out of 92 multiplied by 100.
(58) Initial proof of concept experiments retained the original seedlings from which the first leaf was harvested and seedlings were grown for a further 4 weeks (6 weeks total) and then immuno blotted to determine their infection status by an independent (non-molecular) method. Blotting results were compared to the results obtained for HRM with the same seedlings.
(59) Additionally seed lines comprising different ryegrass cultivars and different endophyte strains were provided by GTL for assessment by HRM and these were also compared to blotting results (Table 2)
(60) Results
(61) There was a high correlation between the blotting results and the HRM results, as shown in Table 3 below.
(62) TABLE-US-00009 TABLE 3 AgResearch Extracted DNA Slipstream Automation Extracted DNA Seedling Blotted Results Blotted Results SSA HRM Line Age HRM Results Actual HRM Results Actual Results No Endophyte Cultivar (days) Actual % blotted % Actual % blotted % Actual % A16360 AR1 5773 AR1 10 87/91 96% 89/91 98% 74/90 82% 90/90 100% 88/91 97% 12 88/90 98% 88/90 98% 87/81 96% 90/91 99% 14 89/92 97% 91/92 99% 86/87 99% 87/87 100% A15403 AR37 Samson 10 83/92 90% 85/92 92% 55/89 62% 81/89 91% 77/90 86% AR37 12 84/91 92% 83/91 91% 74/90 82% 81/90 90% 14 76/89 85% 76/89 85% 80/92 87% 81/92 88% A15862 AR37 Commando 10 69/92 75% 70/92 76% 66/91 73% 79/91 87% 68/88 77% AR37 12 85/92 92% 84/92 91% 72/88 82% 73/88 83% 14 79/91 87% 79/91 87% 72/91 79% 73/91 80% N1892 AR1 Marsden 10 80/84 95% 82/84 98% 62/89 70% 84/89 94% 85/91 93% AR1 12 84/90 93% 88/90 98% 84/91 92% 89/91 98% 14 86/91 95% 88/91 97% 86/92 93% 89/92 97%
REFERENCES
(63) Fletcher, L. R. 1999: Non-toxic endophytes in ryegrass and their effect on livestock health and production. In Ryegrass endophyte: an essential New Zealand symbiosis. Fletcher, L. R.; Easton, H. S. 2000: Using Endophytes for Pasture Improvement in New Zealand. In Proceedings of The Grassland Conference 2000, 4th International Neotyphodium/Grass Interactions Symposium. Eds. Paul, V. H.; Dapprich, P. D. Universtat, Paderborn, pp 149-162. Leuchtmann, A. 1997: Ecological diversity in Neotyphodium-infected grasses as influenced by host and fungus characteristics. In Neotyphodium/Grass Interactions, Eds. Bacon, C. W.; Hill, N. S. Plenum Press, New York, pp 93-108. Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser Newton C R, Graham A, Heptinstall L E, Powell S J, Summers C, Kalsheker N, Smith J C, and Markham A F (1989). Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Research 17 (7): 2503-2516. Rowan, D D.; Latch, G. C. M. 1994: Utilization of endophyte-infected perennial ryegrasses for increased insect resistance. In Biotechnology of endophyte fungi in grasses. Eds. Bacon, C. W. White, J. CRC Press, pp 169-183. Stuedemann, J. A.; Hoveland. C. 1988: Fescue endophyte: History and impact on animal agriculture. Journal of Production Agriculture 1: 39-44. Zietkiewicz E., Rafalski A., and Labuda D. (1994). Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20 (2): 176-83.
SUMMARY OF SEQUENCES
(64) TABLE-US-00010 SEQ ID NO Sequence Type Reference 1 Polynucleotide Artificial, primer DH008F 2 Polynucleotide Artificial, primer AR1F 3 Polynucleotide Artificial, primer endoph_Fl 4 Polynucleotide Artificial, primer DH004F 5 Polynucleotide Artificial, primer DH004R 6 Polynucleotide Artificial, primer DH_IGS_F 7 Polynucleotide Artificial, primer AR1R 8 Polynucleotide Artificial, primer DH007R 9 Polynucleotide Endophyte IGS region ctWT 10 Polynucleotide Endophyte IGS region AR42 11 Polynucleotide Endophyte IGS region AR37 12 Polynucleotide Endophyte IGS region AR1 13 Polynucleotide Endophyte IGS region AR601 14 Polynucleotide Endophyte IGS region AR584 15 Polynucleotide Endophyte IGS region AR542 16 Polynucleotide Endophyte IGS region AR1501 [FL1] 17 Polynucleotide Artificial, primer RJ243F (IGSF, LR12R 18 Polynucleotide Artificial, primer RJ243R (IGSR, invSRIR) 19 Polynucleotide 18S rRNA Primer RJ240F 20 Polynucleotide 18S rRNA Primer RJ240R