Uses of hypoxia-inducible factor inhibitors
09623070 ยท 2017-04-18
Assignee
Inventors
- Yang Liu (Washington, DC)
- Yin Wang (Washington, DC, US)
- Yan Liu (Washington, DC, US)
- Sami N. MALEK (Ann Arbor, MI, US)
- Pan Zheng (Washington, DC)
Cpc classification
A61K31/4355
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/565
HUMAN NECESSITIES
A61K31/498
HUMAN NECESSITIES
A61K31/498
HUMAN NECESSITIES
A61K31/395
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/395
HUMAN NECESSITIES
A61K31/00
HUMAN NECESSITIES
A61K31/565
HUMAN NECESSITIES
International classification
A01N43/00
HUMAN NECESSITIES
Abstract
The present invention relates to treating a hematologic cancer using a Hypoxia-Inducible Factor (HIF inhibitor). The invention also relates to inducing acute myeloid leukemia remission using the HIF inhibitor. The invention further relates to inhibiting a maintenance or survival function of a cancer stem cell (CSC) using the HIF inhibitor.
Claims
1. A method of treating acute myeloid leukemia, comprising administering echinomycin as a sole active agent and a pharmaceutically acceptable carrier to a human in need thereof, at a dose and interval to maintain a serum concentration of echinomycin that kills cancer stem cells without adversely affecting normal hematopoiesis, wherein the maintained serum concentration of echinomycin is less than or equal to 5 nM.
2. A method of treating acute myeloid leukemia, consisting of administering a composition consisting of echinomycin and a pharmaceutically acceptable carrier to a human in need thereof, wherein the echinomycin is administered at a dose and interval to maintain a serum concentration of echinomycin of less than or equal to 5 nM.
3. The method of claim 2, wherein the maintained serum concentration is 0.01 nM to 5 nM.
4. The method of claim 3, wherein the maintained serum concentration is 0.1 nM to 5 nM.
5. The method of claim 1, wherein the maintained serum concentration is 0.01 nM to 5 nM.
6. The method of claim 5, wherein the maintained serum concentration is 0.1 nM to 5 nM.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION
(19) The inventors have made the surprising discovery that the HIF inhibitor echinomycin is capable of treating a hematologic cancer at a non-toxic dose. This indicates a unique susceptibility of lymphoma CSC to echinomycin, and that as little as 30 mcg/m.sup.2 of echinomycin is sufficient to abrogate lymphoma in 100% of the recipients. For example, in vitro, AML-CFUs of all 6 cases of human AML samples tested were highly susceptible to echinomycin.
(20) Echinomycin was brought into clinical trials about 20 years ago based on its antitumor activity against two i.p. implanted murine tumors, the B16 melanoma and the P388 leukemia. However, testing of the efficacy of echinomycin phase 11 clinical trials for a number of solid tumors revealed that echinomycin exhibits significant toxicity, and had minimal or no efficacy. The efficacy of echinomycin for treating hematological cancer had not been tested. Additionally, the body-surface adjusted dose used in previous human clinical trials was about 100-fold higher than the dose the inventors have discovered to be effective for treating hematologic cancer. The toxicity observed in previous human trials was likely due to excess dose used, while the lack of effect may have been due to clinical endpoints that do not reflect the unique requirement for HIF in lymphoma CSC. Thus, echinomycin may be used to treat hematologic cancer associated with CSC, including lymphoma, and in particular, at a non-toxic dose.
1. DEFINITIONS
(21) The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise.
(22) For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
(23) A peptide or polypeptide is a linked sequence of amino acids and may be natural, synthetic, or a modification or combination of natural and synthetic.
(24) Treatment or treating, when referring to protection of an animal from a disease, means preventing, suppressing, repressing, or completely eliminating the disease. Preventing the disease involves administering a composition of the present invention to an animal prior to onset of the disease. Suppressing the disease involves administering a composition of the present invention to an animal after induction of the disease but before its clinical appearance. Repressing the disease involves administering a composition of the present invention to an animal after clinical appearance of the disease.
2. HYPOXIA-INDUCIBLE FACTOR INHIBITOR
(25) Provided herein is an inhibitor of Hypoxia-Inducible Factor protein (HIF). The HIF inhibitor may be echinomycin, 2-methoxyestradiol, or geldanamycin.
(26) a. Echinomycin
(27) The echinomycin may be a peptide antibiotic such as N,N-(2,4,12,15,17,25-hexamethyl-11,24-bis(1-methylethyl)-27-(methylthio)-3,6,10,13,16,19,23,26-octaoxo-9,22-dioxa-28-thia-2,5,12,15,18,25-hexaazabicyclo(12.12.3)nonacosane-7,20-diyl)bis(2-quinoxalinecarboxamide). The echinomycin may be a microbially-derived quinoxaline antibiotic, which may be produced by Streptomyces echinatus. The echinomycin may have the following structure.
(28) ##STR00001##
(29) The echinomycin may have a structure as disclosed in U.S. Pat. No. 5,643,871, the contents of which are incorporated herein by reference. The echinomycin may also be an echinomycin derivative, which may comprise a modification as described in Gauvreau et al., Can J Microbiol, 1984; 30(6):730-8; Baily et al., Anticancer Drug Des 1999; 14(3):291-303; or Park and Kim, Bioorganic & Medicinal Chemistry Letters, 1998; 8(7):731-4, the contents of which are incorporated by reference. The echinomycin may also be a bis-quinoxaline analog of echinomycin
(30) b. HIF
(31) The HIF may be a functional hypoxia-inducible factor, which may comprise a constitutive b subset and an oxygen-regulated a subunit. The HIF may be over-expressed in a broad range of human cancer types, which may be a breast, prostate, lung, bladder, pancreatic or ovarian cancer. While not being bound by theory, the increased HIF expression may be a direct consequence of hypoxia within a tumor mass. Both genetic and environmental factors may lead to the increased HIF expression even under the normoxia condition. Germline mutation of the von Hippel-Lindau gene (VHL), which may be the tumor suppressor for renal cancer, may prevent degradation HIF under normoxia. It may be possible to maintain constitutively HIF activity under normoxia by either upregulation of HIF and/or down regulation of VHL. The HIF may be HIF1 or HIF2.
(32) c. Pharmaceutical Composition
(33) Also provided is a pharmaceutical composition comprising the HIF inhibitor. The pharmaceutical composition may be in the form of tablets or lozenges formulated in a conventional manner. For example, tablets and capsules for oral administration may contain conventional excipients may be binding agents, fillers, lubricants, disintegrants and wetting agents. Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone. Fillers may be lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants may be potato starch and sodium starch glycollate. Wetting agents may be sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.
(34) The pharmaceutical composition may also be liquid formulations such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. The pharmaceutical composition may also be formulated as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain additives such as suspending agents, emulsifying agents, nonaqueous vehicles and preservatives. Suspending agents may be sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats. Emulsifying agents may be lecithin, sorbitan monooleate, and acacia. Nonaqueous vehicles may be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid.
(35) The pharmaceutical composition may also be formulated as suppositories, which may contain suppository bases such as cocoa butter or glycerides. The pharmaceutical composition may also be formulated for inhalation, which may be in a form such as a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. Agents provided herein may also be formulated as transdermal formulations comprising aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
(36) The pharmaceutical composition may also be formulated for parenteral administration such as by injection, intratumor injection or continuous infusion. Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents. The pharmaceutical composition may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.
(37) The pharmaceutical composition may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection. The pharmaceutical composition may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example).
(38) (1) Administration
(39) Administration of the pharmaceutical composition may be orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, or combinations thereof. Parenteral administration includes, but is not limited to, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular. For veterinary use, the agent may be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian can readily determine the dosing regimen and route of administration that is most appropriate for a particular animal. The pharmaceutical composition may be administered to a human patient, cat, dog, large animal, or an avian.
(40) The pharmaceutical composition may be administered simultaneously or metronomically with other treatments. The term simultaneous or simultaneously as used herein, means that the pharmaceutical composition and other treatment be administered within 48 hours, preferably 24 hours, more preferably 12 hours, yet more preferably 6 hours, and most preferably 3 hours or less, of each other. The term metronomically as used herein means the administration of the agent at times different from the other treatment and at a certain frequency relative to repeat administration.
(41) The pharmaceutical composition may be administered at any point prior to another treatment including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr, 16 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins, 10 mins, 9 mins, 8 mins, 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins, and 1 mins. The pharmaceutical composition may be administered at any point prior to a second treatment of the pharmaceutical composition including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr, 16 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins., 10 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins, and 1 mins.
(42) The pharmaceutical composition may be administered at any point after another treatment including about 1 min, 2 mins., 3 mins., 4 mins., 5 mins., 6 mins., 7 mins., 8 mins., 9 mins., 10 mins., 15 mins., 20 mins., 25 mins., 30 mins., 35 mins., 40 mins., 45 mins., 50 mins., 55 mins., 1 hr, 2 hr, 3 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 14 hr, 16 hr, 18 hr, 20 hr, 22 hr, 24 hr, 26 hr, 28 hr, 30 hr, 32 hr, 34 hr, 36 hr, 38 hr, 40 hr, 42 hr, 44 hr, 46 hr, 48 hr, 50 hr, 52 hr, 54 hr, 56 hr, 58 hr, 60 hr, 62 hr, 64 hr, 66 hr, 68 hr, 70 hr, 72 hr, 74 hr, 76 hr, 78 hr, 80 hr, 82 hr, 84 hr, 86 hr, 88 hr, 90 hr, 92 hr, 94 hr, 96 hr, 98 hr, 100 hr, 102 hr, 104 hr, 106 hr, 108 hr, 110 hr, 112 hr. 114 hr, 116 hr, 118 hr, and 120 hr. The pharmaceutical composition may be administered at any point prior after a pharmaceutical composition treatment of the agent including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr, 16 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins., 10 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins. and 1 mins.
(43) d. Dosage
(44) The pharmaceutical composition may be administered in a therapeutically effective amount of the HIF inhibitor to a mammal in need thereof. The therapeutically effective amount required for use in therapy varies with the nature of the condition being treated, the length of time desired to inhibit HIF activity, and the age/condition of the patient.
(45) The dose may be a non-toxic dose. The dose may also be one at which HIF activity is inhibited, but at which c-Myc activity is unaffected. In general, however, doses employed for adult human treatment typically may be in the range of 1-100 mcg/m.sup.2 per day, or at a threshold amount of 1-100 mcg/m.sup.2 per day or less, as measured by a body-surface adjusted dose. The desired dose may be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day. Multiple doses may be desired, or required.
(46) The dosage may be a dosage such as about 1 mcg/m.sup.2, 2 mcg/m, 3 mcg/m.sup.2, 4 mcg/m.sup.2, 5 mcg/m.sup.2, 6 mcg/m.sup.2, 7 mcg/m.sup.2, 8 mcg/m.sup.2, 9 mcg/m.sup.2, 10 mcg/m.sup.2, 15 mcg/m.sup.2, 20 mcg/m.sup.2, 25 mcg/m.sup.2, 30 mcg/m.sup.2, 35 mcg/m.sup.2, 40 mcg/m.sup.2, 45 mcg/m.sup.2, 50 mcg/m.sup.2, 55 mcg/m.sup.2, 60 mcg/m.sup.2, 70 mcg/m.sup.2, 80 mcg/m.sup.2, 90 mcg/m.sup.2, 100 mcg/m.sup.2, 200 mcg/m.sup.2, 300 mcg/m.sup.2, 400 mcg/m, 500 mcg/m.sup.2, 600 mcg/m.sup.2, 700 mcg/m.sup.2, 800 mcg/m.sup.2, 900 mcg/m.sup.2, 1000 mcg/m.sup.2, 1100 mcg/m, or 1200 mcg/m.sup.2, and ranges thereof.
(47) The dosage may also be a dosage less than or equal to about 1 mcg/m.sup.2, 2 mcg/m.sup.2, 3 mcg/m.sup.2, 4 mcg/m.sup.2, 5 mcg/m.sup.2, 6 mcg/m.sup.2, 7 mcg/m.sup.2, 8 mcg/m.sup.2, 9 mcg/m.sup.2, 10 mcg/m.sup.2, 15 mcg/m.sup.2, 20 mcg/m.sup.2, 25 mcg/m.sup.2, 30 mcg/m.sup.2, 35 mcg/m.sup.2, 40 mcg/m.sup.2, 45 mcg/m.sup.2, 50 mcg/m.sup.2, 55 mcg/m.sup.2, 60 mcg/m.sup.2, 70 mcg/m.sup.2, 80 mcg/m.sup.2, 90 mcg/m.sup.2, 100 mcg/m.sup.2, 200 mcg/m.sup.2, 300 mcg/m.sup.2, 400 mcg/m.sup.2, 500 mcg/m.sup.2, 600 mcg/m.sup.2, 700 mcg/m.sup.2, 800 mcg/m.sup.2, 900 mcg/m.sup.2, 1000 mcg/m.sup.2, 1100 mcg/m.sup.2, or 1200 mcg/m.sup.2, and ranges thereof.
(48) e. Coadministration
(49) The HIF inhibitor may be coadministered with another pharmacological agent. The agent may be an inhibitor of the Hedgehog pathway, which may be cyclopamine. The agent may also be a second cancer therapy. The cancer therapy may be a cytotoxic agent or cytostatic agent. The cytotoxic agent may be selected from the group consisting of: alkylating agents (including, without limitation, nitrogen mustards, ethylenimine derivatives, alkyl sulfonates, nitrosoureas and triazenes): uracil mustard, chlormethine, cyclophosphamide (Cytoxan), ifosfamide, melphalan, chlorambucil, pipobroman, triethylene-melamine, triethylenethiophosphoramine, busulfan, carmustine, lomustine, streptozocin, dacarbazine, and temozolomide; antimetabolites (including, without limitation, folic acid antagonists, pyrimidine analogs, purine analogs and adenosine deaminase inhibitors): methotrexate, 5-fluorouracil, floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatine, and gemcitabine; natural products and their derivatives (for example, vinca alkaloids, antitumor antibiotics, enzymes, lymphokines and epipodophyllotoxins): vinblastine, vincristine, vindesine, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, ara-c, paclitaxel (paclitaxel is commercially available as Taxol), mithramycin, deoxyco-formycin, mitomycin-c, 1-asparaginase, interferons (preferably IFN-{umlaut over ()}), etoposide, and teniposide. Other proliferative cytotoxic agents are navelbene, CPT-11, anastrazole, letrazole, capecitabine, reloxafine, cyclophosphamide, ifosamide, and droloxafine.
(50) The cytotoxic agent may be a microtubule affecting agent, which may interfere with cellular mitosis. The microtubule affecting agent may be selected from the group consisting of: allocolchicine (NSC 406042), halichondrin B (NSC 609395), colchicine (NSC 757), colchicine derivatives (e.g., NSC 33410), dolastatin 10 (NSC 376128), maytansine (NSC 153858), rhizoxin (NSC 332598), paclitaxel (Taxol, NSC 125973), Taxol derivatives (e.g., derivatives (e.g., NSC 608832), thiocolchicine (NSC 361792), trityl cysteine (NSC 83265), vinblastine sulfate (NSC 49842), vincristine sulfate (NSC 67574), natural and synthetic epothilones including but not limited to epothilone A, epothilone B, and discodermolide (see Service, (1996) Science, 274:2009) estramustine, nocodazole, and MAP4. The microtubule affecting agent may also be as described in Bulinski (1997) J. Cell Sci. 110:3055 3064; Panda (1997) Proc. Natl. Acad. Sci. USA 94:10560-10564; Muhlradt (1997) Cancer Res. 57:3344-3346; Nicolaou (1997) Nature 387:268-272; Vasquez (1997) Mol. Biol. Cell. 8:973-985; and Panda (1996) J. Biol. Chem 271:29807-29812, the contents of which are incorporated herein by reference.
(51) The cytotoxic agent may also be selected from the group consisting of: epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes such as cis-platin and carboplatin; biological response modifiers; growth inhibitors; antihormonal therapeutic agents; leucovorin; tegafur; and haematopoietic growth factors.
(52) The cytostatic agent may be selected from the group consisting of: hormones and steroids (including synthetic analogs): 17-ethinylestradiol, diethylstilbestrol, testosterone, prednisone, fluoxymesterone, dromostanolone propionate, testolactone, megestrolacetate, methylprednisolone, methyl-testosterone, prednisolone, triamcinolone, hlorotrianisene, hydroxyprogesterone, aminoglutethimide, estramustine, medroxyprogesteroneacetate, leuprolide, flutamide, toremifene, and zoladex. The cytostatic agent may also be an antiangiogenic such as a matrix metalloproteinase inhibitor or a VEGF inhibitor, which may be an anti-VEGF antibody or small molecule such as ZD6474 or SU6668. The agent may also be an Anti-Her2 antibody from Genentech, an EGFR inhibitor such as EKB-569 (an irreversible inhibitor), or an Imclone antibody C225 immunospecific for the EGFR, or a src inhibitor.
(53) The cytostatic agent may also be selected from the group consisting of: Casodex (bicalutamide, Astra Zeneca) which renders androgen-dependent carcinomas non-proliferative; the antiestrogen Tamoxifen which inhibits the proliferation or growth of estrogen dependent breast cancer; and an inhibitor of the transduction of cellular proliferative signals. The inhibitor of the transduction of cellular proliferative signals may be selected from the group consisting of epidermal growth factor inhibitors, Her-2 inhibitors, MEK-1 kinase inhibitors, MAPK kinase inhibitors, PI3 inhibitors, Src kinase inhibitors, and PDGF inhibitors.
3. METHOD
(54) a. Treating a Hematologic Cancer
(55) Provided herein is a method of treating a hematologic cancer. The method may comprise administering a HIF inhibitor to a mammal in need thereof. The mammal may be a human patient. The hematologic cancer may be lymphoma or leukemia. The hematologic cancer may be treated by inhibiting a maintenance or survival function of a CSC. Without being bound by theory inhibiting HIF may target both the cancer stem cell and cancer resistance.
(56) Further without being bound by theory, the CSC in the hematologic cancer may require self-renewal, which may be similar to the requirement in tissue cells. The CSC may require a hypoxic environment, and exposure to a high level of oxygen may reduce CSC function. Self-renewal of CSC function may be strongly inhibited by drugs targeting the HIF pathway. CSC may be addicted to the HIF, which may be associated with over-expression of HIF and down-regulation of VHL. HIF over-expression and VHL down-regulation may be critical in the maintenance of CSC. HIF may work in concert with the Notch pathway to mediate self-renewal of the lymphoma CSC.
(57) (1) Cancer Stem Cell
(58) The cancer stem cell may be chemoresistant or radioresistant. The CSC may also be multiple drug resistant.
(59) (2) Acute Myeloid Leukemia
(60) The leukemia may be acute myeloid leukemia (AML). The AML may be associated with a CSC characterized by the genotype CD38.sup.CD34.sup.+. The AML may also be associated with a patient who carries a cytogenetic alteration. The cytogenetic alteration may be selected from the group consisting of: 47,XY,+21;46,XY; 45,XX,7; 46,XY,t(8;21)(q22;q22); 49,XX,+8,+8,inv(16)(p13.1q22),+21; 46,XX,inv(16)(p13q22)/46,XX; 46,XY,inv(16)(p13q22); 46,XX,t(2;13)(p23;q12)/46,XX; 45,XY,inv(3)(q21q26.2),7/46,XY; 47,XY,+4,inv(5)(p15q13)/47,sl,4,+22; 46,XX,t(11;19)(q23;p13.1); 46,XX,t(6;11)(q27;q23)/46,XX; and 46,XX,t(1;17)(p13;q25),t(9;11)(p22;q23).
(61) The CSC of the AML may be extremely sensitive to the HIF inhibitor. The CFU of AML may be highly susceptible to the HIF inhibitor, with an IC50 between 50-120 pM. The HIF inhibitor may be used to eliminate CSC of AML as part of postremission therapy.
(62) b. Inducing Acute Myeloid Leukemia Remission
(63) Also provided herein is a method for inducing remission of acute myeloid leukemia, which may comprise administering the HIF inhibitor to a mammal in need thereof. The HIF inhibitor may be administered to the mammal during remission of acute myeloid leukemia to prevent future relapse. The HIF inhibitor may be administered as elsewhere disclosed herein.
(64) c. Inhibiting a Maintenance or Survival Function of a CSC
(65) Further provided herein is a method for inhibiting a maintenance or survival function of a CSC. Contacting the CSC with the HIF inhibitor may inhibit the maintenance or survival function. The contacting may comprise administering the HIF inhibitor to a mammal in need of inhibiting the maintenance or survival function of the CSC. The HIF inhibitor may be administered as elsewhere disclosed herein.
(66) The present invention has multiple aspects, illustrated by the following non-limiting examples.
Example 1
Identification of Self-Renewing Lymphoma Initiating Cells in Syngeneic Immune Competent Host
(67) Hundred percent of the transgenic mice (TGB) with insertional mutation of the Epm2a gene succumb to lymphoma. In search for the expression of potential stem cell markers in the TGB lymphoma cells, it was found that a small subset of cells expressed both c-Kit and Sca-1, which partly constitute markers for HSC (
(68) TABLE-US-00001 TABLE 1 Identification of CSC using c-Kit and Sca-1 markers Number of cells injected Expt Donor Recipient 10,000 1,000 500 100 1. c-Kit.sup.+Sca-1.sup.+ B10.BR 3/3 3/3 c-Kit.sup.Sca-1.sup. B10.BR 0/3 2. c-Kit.sup.+Sca-1.sup.+ B10.BR 4/4 3/3 c-Kit.sup.Sca-1.sup. B10.BR 0/3 0/3 3. c-Kit.sup.+Sca-1.sup.+ B10.BR 5/5 5/5 c-Kit.sup.Sca-1.sup. B10.BR 1/5 0/5 4. c-Kit.sup.+Sca-1.sup.+ RAG2.sup./ 5/5 5/5 c-Kit.sup.Sca-1.sup. RAG2.sup./ 1/5 0/5 5. Serial transplantation Round 1 c-Kit.sup.+Sca-1.sup.+ B10.BR 3/3 3/3 c-Kit.sup.Sca-1.sup. B10.BR 1/3 0/3 Round 2 c-Kit.sup.+Sca-1.sup.+ B10.BR 5/5 c-Kit.sup.Sca-1.sup. B10.BR 2/5 Round 3 c-Kit.sup.+Sca-1.sup.+ B10.BR 3/3 c-Kit.sup.Sca-1.sup. B10.BR 0/3 (5000/mouse)
(69) The donor cells were isolated from either ex vivo lymphoma (expt 1 and 2) or those that have been cultured for more than 30 passages in vitro. The routes of injection were intraperitoneal (i.p.) for experiments 1, 3, and 4, and intravenous for experiment 2. There was no tumor growth (0/3) when 10 c-Kit.sup.+Sca-1.sup.+ cells were transplanted into B10.BR mice. In experiment 5, donor cells were isolated from ex vivo lymphoma and injected i.p. The lymphoma cells obtained in round 1 were sorted and injected for the second around, then repeated for the third round. The tumor-free mice were observed for 22-40 weeks to confirm the lack of tumor growth.
(70) TABLE-US-00002 TABLE S1 % marker.sup.+ cells Markers Primary Round 1 Round 2 Round 3 c-Kit.sup.+-Sca-1 3.80 3.92 4.81 1.32 c-Kit.sup.Sca-1.sup.+ 1.52 15.38 19.5 5.14 c-Kit.sup.+Sca1.sup.+ 0.87 0.81 0.97 0.83 CD8.sup.+V8.sup. 3.48 ND 47.39 54.27 CD8.sup.+V8.sup. 92.36 ND 19.30 9.20
(71) Table S1. Conservation and dynamic changes of tumor cell phenotypes. The c-Kit.sup.+Sca-1.sup.+ cells from spontaneous tumors were isolated by FACS sorting and serially transplanted into syngeneic B10.BR mice. Single-cell suspensions of tumors that arose in each round were analyzed by flow cytometry using antibodies specific for CD8, Vb8, c-Kit and Sca-1. The % of cells among spleen cells are presented. N.D., not determined.
(72) Using the medium for assaying the colony-forming units (CFU) of hematopoeitic progenitor cells, it was possible to establish long term cultures of the TGB lymphoma cells. In over 30 passages, the c-Kit.sup.Sca-1.sup.+ cells remained at about 0.5-1.5% of total lymphoma cell population and maintained the CFU in vitro (data not shown) and tumor initiation in vivo (Table 1, expts 3 and 4), with an undiminished efficiency. The fact that the c-Kit+Sca-1.sup.+ cells remained at low % indicates that these markers must have been lost during differentiation that occurred after the initiation of the colony formation. The c-Kit+Sca-1 population usually disappeared during in vitro culture. The loss of the Kit+Sca-1 cells during culture does not accompany the loss of tumor-initiation and CFU (data not shown).
Example 2
Essential Role for Up-Regulation of HIF1 Expression in the Maintenance of CSC
(73) Having established that the c-Kit+Sca-1+ cells are CSCs in the lymphoma model, the molecular program responsible for the self-renewal of CSC activity was identified, using CFU as a surrogate assay. As shown in
(74) In order to monitor the HIF1 activity of the CSC, a lentiviral reporter was generated, consisting of triple HIF1 responsive elements (HRE) in the upstream of a minimum TATA box sequence and an EGFP sequence, as shown in
(75) To substantiate the role of HIF1 activity in CSC function, the effect of HIF inhibitors for both CFU in vitro and tumor-initiating activity in vivo was tested. Since the CFU from the lymphoma CSC and normal hematopoeitic progenitor cells (HPC) can be assayed under similar conditions, the selectivity of echinomycin for HPC vs lymphoma CSC was tested. As shown in
(76) Based on these observations, we explored the therapeutic potential of HIF inhibitors. 110.sup.6 of cultured lymphoma cells were injected i.p. into immune competent B10BR mice. Four or 14 days later, the mice that received lymphoma cells were either treated with vehicle only or 3 (
(77) To determine the molecular mechanism for the high HIF1 activity in the CSC, the lymphoma cells were sorted into c-Kit.sup.+Sca-1.sup.+ or c-Kit.sup.Sca-1.sup. subsets and analyzed HIF1, HIF-2 and HIF-3 expression by RT-PCR. As illustrated in
(78) To test the general significance of HIF1, we analyzed expression and function of the HIF1 in human acute myeloid leukemia (AML)-initiating cells. Leukemia-initiating cells of AML have a phenotype of CD38.sup.CD34.sup.+. To determine whether the HIF1 gene is over-expressed in this subset, the CD38.sup.CD34.sup.+, CD38.sup.+CD34.sup.+, CD38.sup.CD34.sup. and the CD38.sup.+CD34.sup. subsets were sorted by FACS (
(79) The CD38.sup.CD34.sup.+ are also known to form AML-colonies in vitro, which provides us with a simple assay to test the significance of HIF1. As shown in
(80) TABLE-US-00003 TABLE S2 Sample FAB type Age Rx status at Flt3 status exons Cytogenetics enrollment 13-15 and 20 al diagnosis MI-AML-9 M4 64 untreated WT 46,XY[20].sup.b MI-AML-15 M4 58 pre-treated heterozygous point mutation: 46,XY[20] Y572YC in exon 14 MI-AML-32 MO 55 untreated WT 47,XY,+ 21[4]; 46,XY[16] MI-AML-36 M4 55 untreated WI 46,XY,t(11;19)(q23;p13.1)[20] MI-AM L-60 M-1 52 untreated Internal tandem duplication 46,XY[20] MI-AM L-71 AML- 73 pre-treated WT 45,XX,7[20] NOS
(81) Methods
(82) To obtain the data shown in Table S2, primers to amplify exons 5-9 of p53, exons 13-15 and exon 20 of Flt3, exon 12 of NPM1 and exons 2-3 of N-ras and K-ras were designed using the primer3 program (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S. Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386). PCR was used to amplify exons of interest using genomic DNA from FACS-sorted blasts as template. DNA was prepared for direct sequencing using nested sequencing primers and Exo-SAP. Mutations were identified using the Mutation Surveyor program and visual inspection of sequence tracings.
(83) To establish the significance of HIF1 up-regulation in the c-Kit.sup.+Sca-1.sup.+ cells, lentiviruses expressing HIF1 shRNA (see
(84) Consistent with this notion, after drug selection to enrich the transduced cells, the colony formation assay revealed 70-80% reduction in the HIF1 ShRNA-transduced cells (
Example 3
Down-Regulation of Vhl in CSC is Essential for Maintenance of CSC
(85) Since HIF1 is normally degraded under normoxia by a VHL-dependent mechanism, the expression of Vhl in the CSC was also tested. The data demonstrate an approximate 4-fold reduction in the Vhl transcripts of c-Kit.sup.+Sca-1.sup.+ cells (
Example 4
HIF Acts in Concert with the Notch Pathway in Self-Renewal of CSC
(86) In order to determine the underlying molecular mechanisms by which HIF1 activation promotes self-renewal of CSC, the potential involvement of Wnt and Notch pathways was examined. Despite activation of the Wnt signaling in the TGB tumor, the data demonstrate that the dominant negative TCF-1, which was shown to inhibit tumor growth associated with Epm2a down regulation, did not affect the CFU of the TGB CSC (data not shown). In contrast, g-secretase inhibitor, L-685, 458, an inhibitor for Notch, potently blocked the colony forming activity (
(87) Expression of Notch1-4 was analyzed in c-Kit.sup.+Sca-1.sup.+ and the c-Kit.sup.Sca-1.sup. tumor cells. As shown in
(88) Previous studies demonstrated that HIF1 may interact with Notch directly to activate its target gene, Hey2, under hypoxia conditions. Using the reporter for Hes1 promote activity, however, no significant enhancement of Notch signaling by the oxygen-resistant HIF1 mutant was observed (
Example 5
A Role for HIF in CSC Maintenance
(89) The re-emergence of CSC concept relied on transplantation studies to identify a subset of self-renewing tumor initiating cells. Since most studies involved xenogeneic and allogeneic transplantation into immune-deficient host, some have suggested that the CSC concept requires reappraisal. An important feature of the current study is to use syngeneic immune competent mice as recipients. The self-renewing capacity of the CSC identified in this study has been demonstrated by three rounds of serial transplantation, in which as few as 100 c-Kit.sup.+Sca-1.sup.+ cells can give rise to lymphoma in nearly 100% of the recipients. During the process, the number of c-Kit.sup.+Sca-1.sup.+ cells remains around 1%. While maintaining the expression of the CD8 co-receptor, the bulk lymphoma cells appear to gradually lose the expression of the T cell receptor. In addition to giving rise to lymphoma, almost all c-Kit.sup.+Sca-1.sup.+ cells exhibit CFU activity. The data substantiate an increasing list of genetic studies in supporting the notion of CSC, although the potential variation in tumor models with regard to existence of CSC cannot be ruled out.
(90) Both in vitro self-renewal and in vivo tumor initiating properties were used to characterize the molecular mechanism of self-renewal of CSC. In both assays, the role for HIF1 was demonstrated by drug inhibition, shRNA silencing and over-expression of oxygen-dependent HIF inhibitor VHL. Since the expression of transduced vectors leads to almost immediate disappearance of the CSC population, and since the short-term treatment (12 hours) of echinomycin resulted in a specific reduction of the c-Kit.sup.+Sca-1.sup.+ cells by increased apoptosis, the HIF1 is likely necessary for survival of CSC.
(91) The increased HIF activity in the murine lymphoma is caused by both over-expression of HIF1 and down-regulation of Vhl. Since Vhl is responsible for the oxygen-mediated degradation of HIFa, the increased HIFa activity no longer requires hypoxic environment. In addition, it should be noted that in the 6 cases AML samples tested, we have not observed increased expression of VHL (data not shown). Yet the HIF are active based on expression of its target and sensitivity to echinomycin. Therefore, additional mechanisms likely exist to allow oxygen-resistant function of HIF in AML-CFU. The effect of low doses of echinomycin on all AML samples tested suggest that the mechanism described herein may be generally applicable for tumors grown in area with high levels of blood supplies, including leukemia and lymphoma. For areas of solid tumors with poor blood supplies, the mechanism can be operative even without HIF over-expression or VHL down-regulation.
Example 6
A Molecular Pathway for Maintenance of CSC
(92) In investigating the molecular pathway responsible for the maintenance of CSC, enhanced activity of Notch pathway was observed, as revealed by increased expression of Notch target genes, in the CSC in comparison to the bulk tumor cells. The data demonstrate that all three HIF inhibitors tested block Notch activation in the c-Kit.sup.+ subset. Interestingly, the inhibition appear specific for the c-Kit.sup.+ subset of TGB lymphoma, which is enriched for CSC, as the drugs had no effect on the Notch target expression if the total TGB lymphoma cells were used. The significance of Notch in CSC maintenance and tumor development is demonstrated by effective ablation of the CSC and tumorigenesis by an ectopic expression of a dominant inhibitor of Notch signaling, dRdA1-4dOP in the TGB tumor cells. Again, the selective ablation demonstrates that Notch signaling is specifically required for the maintenance of CSC, while the survival of the bulk tumor cells is independent of Notch signaling. Taken together, these data demonstrate that HIF maintains CSC by regulating Notch signaling.
(93) Hes1 is an important Notch target known to be critical for stem/progenitor cell functions. The data described herein indicate that HIF1 potentiated the induction of Hes1 by Notch. In contrast with the previous studies using Hey2 promoter as readout, no direct co-operation between HIF1 and Notch IC in the induction of the Hes1 gene was observed. Rather, it was shown that HIF1 prevents the negative-feedback auto-regulation of the Hes1 gene by inhibiting its binding to the N-boxes in the Hes1 promoter. Given the general, although not necessarily universal, role of Notch in maintenance of a variety of tissue stem cells, the data indicate an important functional conservation between CSC and tissue stem cells.
Example 7
The HIF Pathway Plays a Role in CSC Function
(94) An important way to validate the role for HIF pathway in the CSC function was to test whether HIF inhibitor echinomycin can be used to treat AML in a xenogeneic model. Studies using two AML samples have been performed. 610.sup.6 AML cells (either AML71-PB, which had poor prognosis based on cytogenetics data, or AML-15-PB which had moderate prognosis based on cytogenetics; see Table S2 above) from blood were transplanted into sublethally irradiated NOD-SCID mice. Starting at 2 weeks after transfer, half of the recipient mice received three injections of 200 ng/mouse/injection of echinomycin, once every other day. After two weeks of pause, these mice received 3 more injections. The other half of the mice were left untreated as control. At 7 weeks after transplantation, all untreated mice in both groups (3 mice per group) became moribund, while all echinomycin treated mice were healthy. Analysis of the peripheral blood and bone marrow of AML-71PB recipients is shown provided in
(95) As shown in
Example 8
Therapeutic Elimination of Leukemia Stem Cells for AML
(96) This example demonstrates the therapeutic potential of HIF inhibitors for human hematological malignancies. AML was used as a model because the phenotype of AML leukemia stem cells (AML-LSC) was well-characterized, and because AML-LSC function in vivo can be assayed using an established xenogeneic model. AML-LSC have the phenotype of CD34.sup.+CD38.sup.. To determine whether the HIF1 gene is over-expressed in this subset of cells, CD34.sup.+CD38.sup., CD34.sup.+CD38.sup.+, CD34.sup.CD38.sup. and CD34.sup.CD38.sup.+ subsets were sorted by FACS (
(97) CD34.sup.CD38.sup. cells are also known to form AML-colonies in vitro, thereby providing a simple assay to test the significance of HIF1. As shown in
(98) Conventional cancer therapy appears to enrich cancer stem cells. An NFB inhibitor, dimethylamino analog of parthenolide, showed some selectivity for AML-LSC. Since the HIF1 activity appears to be selectively activated in AML, AML-LSC might be selectively targeted by echinomycin. As shown in
(99) A xenogeneic AML model using human AML samples was established to test whether echinomycin can be used as a potential therapeutic agent for AML. Primary clinical samples from AML patients reconstituted irradiated NOD.SCID mice with immature human myeloid cells were characterized by the expression of human CD45, CD11b, but not mature myeloid markers CD14 and CD15. Remarkably, a short term treatment with echinomycin starting at 15 days after transplantation completely eliminated human cells from sample AML 150 and dramatically reduced the burden of human leukemia of AML 71 (
(100) The incomplete remission of AML71 enabled a determination of whether echinomycin selectively reduces the AML-LSC, using the CD34.sup.+CD38.sup. markers. Echinomycin reduced the percentage of CD34.sup.+CD38.sup. cells in bone marrow by more than 10-fold (
Example 9
Experimental Procedures
(101) Materials and Methods for Examples 1-7 are disclosed below.
(102) AML Samples
(103) AML patients diagnosed at the University of Michigan Comprehensive Cancer Center between 2005 and 2009 were enrolled into this study. The study was approved by the University of Michigan Institutional Review Board. Written informed consent was obtained from all patients prior to enrollment. The same AML diagnostic criteria (>=20% myeloblasts in the bone marrow or peripheral blood) were used and determined FAB subclassification through review of both laboratory and pathology reports dated at the time of diagnosis and interpreted by hematopathologists. Cytogenetic risk stratification was determined according to SWOG/ECOG criteria.
(104) Antibodies, Flow Cytometry, and Immunofluorescence
(105) Fluorochrome-conjugated antibodies specific for CD1117 (c-kit) and Ly-6A/E (Sca-1) were purchased from either e-Bioscience (Ja Jolla, Calif.), while those specific for CD8 and V8 were purchased from Becton Dickinson-Pharmingen (Ja Jalla, Calif.). The cell surface markers were analyzed by flow cytometry using LSRII (Becton Dickinson, Mountain View, Calif.). The specific subsets were sorted by FACSAria.
(106) RT-PCR and Real-Time PCR
(107) Expression of HIF1, HIF-2, HIF-3, VHL, and Glut1 was determined by RT-PCR and real-time PCR. The primers used were HIF1, forward, 5-agtctagagatgcagcaagatctc-3 (SEQ ID NO: 1); reverse, 5-tcatatcgaggctgtgtcgactga-3 (PCR)(SEQ ID NO: 2), 5-ttcctcatggtcacatggatgagt-3 (real-time PCR)(SEQ ID NO: 3); hif-2a, forward, 5-cgacaatgacagctgacaaggag-3 (SEQ ID NO: 4); reverse, 5-ttggtgaccgtgcacttcatcctc-3 (SEQ ID NO: 5); hif-3a, forward, 5-atggactgggaccaagacaggtc-3 (SEQ ID NO: 6); reverse, 5-agcttcttctttgacaggttcggc-3 (SEQ ID NO: 7); vhl, forward, 5-tctcaggtcatcttctgcaac-3 (SEQ ID NO: 8); reverse, 5-aggctccgcacaacctgaag-3 (SEQ ID NO: 9); Glut1, forward 5-tgtgctgtgctcatgaccatc-3 (SEQ ID NO: 10) and reverse 5-acgaggagcaccgtgaagat-3 (SEQ ID NO: 11); mHes1F: gccagtgtc aacacgacaccgg (SEQ ID NO: 12), mHes1R: tcacctcgttcatgcactcg (SEQ ID NO: 13); HIF1F, 5-ccatgtgaccatgaggaaatgagag-3 (SEQ ID NO: 14); HIF1R, 5-tcatatccaggctgtgtcgactgag-3 (SEQ ID NO. 15); GLUT1F, 5-tcaatgctgatgatgaacctgct-3 (SEQ ID NO: 16); GLUT1R, 5-ggtgacacttcacccacataca-3 (SEQ ID NO: 17).
(108) ShRNA-Mediated Knockdown of HIF1 and Ectopic Expression of VHL and dRdA1, 2dOP
(109) Lentiviral vectors carrying siRNAs are known in the art. The core sequence of HIF1-ShRNA-1 is 5-ctagagatgcagcaagatc-3 (SEQ ID NO: 18), while that of HIF1-ShRNA-2 is 5-gagagaaatgcttacacac-3 (SEQ ID NO: 19). The same vector was used to express full length VHL cDNA, and dominant negative Notch mutant dRdA1-42dOP (AA1995-2370). The tumor cell cultures were infected with either control lentivirus or lentivirus encoding HIF1 shRNA, dRdA1-42dOP or VHL cDNA by spinoculation. The cultures were selected with 5 g/ml of blasticidin for 5 days to remove uninfected cells.
(110) In vitro colony formation assay for tumor cells and bone marrow cells is known in the art.
(111) In Vivo Tumorigenicity Assay
(112) Given numbers of total tumor cells or sorted subsets were injected into either immune competent B10.BR mice or RAG-2.sup./BALB/c mice. Moribund mice were considered to have reached experimental endpoint and were euthanized. The therapeutic effects were analyzed by Kaplan Meier survival analysis.