RNA encoding an antibody

Abstract

The present invention relates to a RNA encoding an antibody or a fragment or variant thereof and a composition, in particular a passive vaccine, comprising such an RNA. The present invention further relates to the use of such an RNA or of such a composition for treatment of tumours and cancer diseases, cardiovascular diseases, infectious diseases, autoimmune diseases, virus diseases and monogenetic diseases, e.g. also in gene therapy. The present invention also relates to a combination of at least two modified RNA's, in particular wherein one RNA encodes a heavy chain variable region of an antibody and another RNA encodes the corresponding light chain variable region of said antibody.

Claims

1. A composition comprising: (I) an RNA comprising (a) at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584, wherein the first coding sequence and the second coding sequence are present in the same RNA molecule; or (II) (a) at least a first RNA molecule comprising at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second RNA molecule comprising at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584.

2. The composition according to claim 1, comprising: (I) an RNA comprising (a) at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584, wherein the first coding sequence and the second coding sequence are present in the same RNA molecule.

3. The composition according to claim 1, comprising: (II) (a) at least a first RNA molecule comprising at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second RNA molecule comprising at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 90% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584.

4. The composition according to claim 3, wherein the first and/or the second RNA is monocistronic.

5. The composition according to claim 3, wherein the first and the second RNA is mRNA.

6. The composition according to claim 5, wherein the G/C content of the first and second coding sequences of the RNAs is increased compared to the G/C content of the corresponding coding sequence of the corresponding wild-type RNA, and/or wherein the C content of the first and second coding sequences of the RNAs is increased compared to the C content of the corresponding coding sequence of the corresponding wild-type RNA, and/or wherein the codons in the first and second coding sequences of the RNA are adapted to human codon usage.

7. The composition according to claim 5, wherein the first and the second RNA comprise a 5′-CAP structure and at least one 3′-untranslated region element (3′-UTR element).

8. The composition according to claim 5, wherein the first and/or the second RNA comprises at least one histone stem-loop.

9. A method of treating cancer, wherein the method comprises administering to a subject in need thereof an effective amount of the composition according to claim 1.

10. The method according to claim 9, further defined as a method of treating a metastatic cancer.

11. The composition according to claim 3, comprising: (II) (a) at least a first RNA molecule comprising at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 95% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second RNA molecule comprising at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 95% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584.

12. The composition according to claim 7, wherein the first and the second mRNAs comprise a modified nucleoside.

13. The composition according to claim 12, wherein the modified nucleoside is N1-methyl-pseudouridine.

14. The composition according to claim 2, wherein the RNA is a mRNA.

15. The composition according to claim 14, comprising: (I) an RNA comprising (a) at least a first coding sequence, wherein the first coding sequence comprises a nucleic acid sequence at least 95% identical to the RNA sequence of SEQ ID NO: 61574 and encoding a polypeptide according to SEQ ID NO: 61573; and (b) at least a second coding sequence, wherein the second coding sequence comprises a nucleic acid sequence at least 95% identical to the RNA sequence of SEQ ID NO: 61585 and encoding a polypeptide according to SEQ ID NO: 61584.

16. The composition according to claim 14, wherein said first and said second coding sequences are separated by an internal ribosome entry site (IRES).

17. The composition according to claim 14, wherein the mRNA comprises a 5′-CAP structure and at least one 3′-untranslated region element (3′-UTR element).

18. The composition according to claim 17, wherein the mRNA comprises a modified nucleoside.

19. The composition according to claim 18, wherein the modified nucleoside is N1-methyl-pseudouridine.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 illustrates the structure of an IgG antibody. IgG antibodies are built up from in each case two identical light and two heavy protein chains which are bonded to one another via disulfide bridges. The light chain comprises the N-terminal variable domain V.sub.L and the C-terminal constant domain C.sub.L. The heavy chain of an IgG antibody can be divided into an N-terminal variable domain V.sub.H and three constant domains C.sub.H1, C.sub.H2 and C.sub.H3.

(2) FIG. 2 shows the gene cluster for the light and the heavy chains of an antibody: (A): Gene cluster for the light chain κ. (B): Gene cluster for the light chain λ. (C): and (D): Gene cluster for the heavy chain. In this context, the variable region of a heavy chain is composed of three different gene segments. In addition to the V and J segments, additional D segments are also found here. The V.sub.H, D.sub.H and J.sub.H segments can likewise be combined with one another virtually as desired to form the variable region of the heavy chain.

(3) FIG. 3 illustrates in the form of a diagram the differences in the light and heavy chains of murine (i.e. obtained in the mouse host organism), chimeric, humanized and human antibodies.

(4) FIG. 4 shows an overview of the structure of various antibody fragments. The constituents of the antibody fragments are shown on a dark grey background.

(5) FIG. 5 shows various variants of antibodies and antibody fragments in FIGS. 5A, 5B and 5C: (A) shows a diagram of an IgG antibody of two light and two heavy chains. (B) shows an Fab fragments from the variable and a constant domain in each case of a light and a heavy chain. The two chains are bonded to one another via a disulfide bridge. (C) shows an scFv fragment from the variable domain of the light and the heavy chain, which are bonded to one another via an artificial polypeptide linker.

(6) FIG. 6 shows a presentation of an exemplified antibody-coding (modified) RNA according to the invention as an expression construct. In this: V.sub.H=variable domain of the heavy chain; C.sub.H=constant domain of the heavy chain; V.sub.L=variable domain of the light chain; C.sub.L=constant domain of the light chain; SIRES=internal ribosomal entry site (IRES, superIRES) muag=mutated form of the 3′ UTR of the alpha-globin gene; and A70C30=polyA-polyC tail.

(7) FIG. 7 shows a diagram of the detection of an antibody coded by an RNA according to the invention by means of ELISA on the example of the antigen Her2.

(8) FIG. 8 shows the wild-type DNA sequence of the heavy chain of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC content: 56.5%, length: 1,344) (SEQ ID NO: 61161).

(9) FIG. 9 shows a GC-optimized DNA sequence of the heavy chain of the antibody rituximab (=Rituxan, MabThera) (GC content: 65.9%, length: 1,344) (SEQ ID NO: 61162).

(10) FIG. 10 shows the wild-type DNA sequence of the light chain of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC content: 58.5%, length: 633) (SEQ ID NO: 61163).

(11) FIG. 11 shows a GC-optimized DNA sequence of the light chain of the antibody rituximab (=Rituxan, MabThera) (GC content: 67.2%, length: 633) (SEQ ID NO: 61164).

(12) FIG. 12 shows the total construct of a GC-optimized DNA sequence of the antibody rituximab (=Rituxan, MabThera) with the light and heavy chains (SEQ ID NO: 61165). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 25, SEQ ID NO: 61209):

(13) TABLE-US-00012 AAGCTT HindIII CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGG CGCCCTCGCCCTGACGCAGACCTGGGCCGGG.

(14) The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with CAG represents the actual antibody coding sequence (see FIG. 9) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA (). The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with CAG running to the stop codon TGA () (see FIG. 11). Both coding regions for the light and the heavy chain are separated by an IRES element () The inventive RNA coded by the construct given in FIG. 12 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 12), preferably in combination with at least one ribosomal entry site.

(15) FIG. 13 shows the wild-type DNA sequence of the heavy chain of the antibody cetuximab (=Erbitux) (wild-type: GC content: 56.8%, length: 1,359) (SEQ ID NO: 61166).

(16) FIG. 14 shows a GC-optimized DNA sequence of the heavy chain of the antibody cetuximab (=Erbitux) (GC content: 65.9%, length: 1,359) (SEQ ID NO: 61167).

(17) FIG. 15 shows the wild-type DNA sequence of the light chain of the antibody cetuximab (=Erbitux) (wild-type: GC content: 58.2%, length: 642) (SEQ ID NO: 61168).

(18) FIG. 16 shows a GC-optimized DNA sequence of the light chain of the antibody cetuximab (=Erbitux) (GC content: 65.7%, length: 642) (SEQ ID NO: 61169).

(19) FIG. 17 shows the total construct of a GC-optimized DNA sequence of the antibody cetuximab (=Erbitux) with the light and heavy chains (SEQ ID NO: 61170). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 26, SEQ ID No 61210):

(20) TABLE-US-00013 AAGCTT HindIII 0 CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGG CGCCCTCGCCCTGACGCAGACCTGGGCCGGG.

(21) The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with CAG represents the actual antibody coding sequence (see FIG. 14) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA (). The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with GAC running to the stop codon TGA () (see FIG. 16). Both coding regions for the light and the heavy chain are separated by an IRES element (). The inventive RNA coded by the construct given in FIG. 17 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 17), preferably in combination with at least one ribosomal entry site.

(22) FIG. 18 shows the wild-type DNA sequence of the heavy chain of the antibody trastuzumab (=Herceptin) (wild-type: GC content: 57.8%, length: 1,356) (SEQ ID NO: 61171).

(23) FIG. 19 shows a GC-optimized DNA sequence of the heavy chain of the antibody trastuzumab (=Herceptin) (GC content: 67.0%, length: 1,356) (SEQ ID NO: 61172).

(24) FIG. 20 shows the wild-type DNA sequence of the light chain of the antibody trastuzumab (=Herceptin) (wild-type: GC content: 56.9%, length: 645) (SEQ ID NO: 61173).

(25) FIG. 21 shows a GC-optimized DNA sequence of the light chain of the antibody trastuzumab (=Herceptin) (GC content: 66.4%, length: 645) (SEQ ID NO: 61174).

(26) FIG. 22 shows a total construct of the GC-optimized DNA sequence of the antibody trastuzumab (=Herceptin) with the light and heavy chains (SEQ ID NO: 61175). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 27, SEQ ID NO: 61211):

(27) TABLE-US-00014 AAGCTT HindIII CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGG CGCCCTCGCCCTGACGCAGACCTGGGCCGGG.

(28) The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with GAG represents the actual antibody coding sequence (see FIG. 19) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA (). The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with GAC running to the stop codon TGA () (see FIG. 21). Both coding regions for the light and the heavy chain are separated by an IRES element (). The inventive RNA coded by the construct given in FIG. 22 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 22), preferably in combination with at least one ribosomal entry site.

(29) FIG. 23 shows for Example 1 RNA-mediated antibody expression in cell culture. CHO or BHK cells were transfected with 20 μg of antibody-encoding mRNA according to the invention which was produced (RNA, G/C enriched, see above) or mock-transfected. 24 hours after transfection protein synthesis was analysed by Western blotting of cell lysates. Cells harboured about 0.5 μg of protein as assessed by Western Blot analysis. Each lane represents 10% of total lysate. Humanised antibodies served as control and for a rough estimate of protein levels. The detection antibody recognises both heavy and light chains; moreover, it shows some unspecific staining with cell lysates (three distinct bands migrating much slower than those of the antibodies). A comparison with control antibodies clearly demonstrates that heavy and light chains were produced in equal amounts.

(30) FIG. 24 shows for Example 1 that RNA-mediated antibody expression gives rise to a functional protein (antibody). Functional antibody formation was addressed by FACS staining of antigen-expressing target cells. In order to examine the production of functional antibodies, cell culture supernatants of RNA-transfected (20 μg of Ab-RNA as defined above in Example 1) cells were collected after 48 to 96 hours. About 8% of total supernatant was used to stain target cells expressing the respective antigen. Humanised antibodies served as control and for a rough estimate of protein levels. Primary antibody used for cell staining: a) humanised antibody; b) none; c,d) supernatant from RNA-transfected cells expressing the respective antibody; e) supernatant from mock-transfected CHO cells. Calculations on the basis of the analysis shown in FIG. 24 reveal that cells secreted more than 12-15 μg of functional antibody within 48-96 hours. Accordingly, the present invention proves that RNA encoding antibodies may enter into cell, may be expressed within the cell and considerable amounts of RNA encoded antibodies are then secreted by the cell into the surrounding medium/extracellular space. Cell transfection in vivo or in vitro by the inventive RNA may therefore be used to provide antibodies acting e.g. therapeutically in the extracellular space.

(31) FIG. 25 shows an alternative sequence of the construct of FIG. 12 (antibody rituximab), wherein the restriction sites have been modified as compared to SEQ ID NO: 61165 of FIG. 12 (SEQ ID NO: 61209). For closer information with regard to the description of various sequence elements it is referred to FIG. 12.

(32) FIG. 26 shows an alternative sequence of the construct of FIG. 17 (antibody cetuximab), wherein the restriction sites have been modified as compared to SEQ ID NO: 61170 of FIG. 17 (SEQ ID NO: 61210). For closer information with regard to the description of various sequence elements it is referred to FIG. 17.

(33) FIG. 27 shows an alternative sequence of the construct of FIG. 22 (antibody trastuzumab), wherein the restriction sites have been modified as compared to SEQ ID NO: 61175 of FIG. 22 (SEQ ID NO: 61211). For closer information with regard to the description of various sequence elements it is referred to FIG. 22.

(34) FIG. 28 shows for Example 2 the median survival time of mice injected with mRNA encoding the antibody trastuzumab (Herceptin) as compared to the median survival time of naïve control mice in an in vivo tumor model. Briefly, BALB/c nu/nu mice (n=14 per group) were subcutaneously implanted with slow-release estrogen pellets (0.72 mg 17β-estradiol). Mice were inoculated subcutaneously with 10×10.sup.6 BT-474 tumour cells (100 μl of a cell/matrigel suspension) per mouse on day 0. Treatment was started on day 11 when tumors became injectable. Mice were treated twice weekly for up to 3.5 weeks with a single dose of 50 μg of mRNA (R1965) in a 50 μl injection volume (Ringer Lactate buffer).

(35) FIG. 29 shows for Example 3 the concentration of cetuximab in the supernatant of R3578-transfected cells (in vitro antibody expression study). Briefly, HEK293T cells were transfected with 1 μg or 4 μg of mRNA (R3578) using the Lipofectamine2000 reagent. 24 hours after the transfection, the supernatant was collected and used for staining of A431 cells (EGFR-expressing cell line) and analysed by flow cytometry (FACS). The concentration of Cetuximab in the supernatant of the transfected cells was calculated using a standard curve generated with the commercially available Cetuximab protein.

(36) FIG. 30 shows for Example 3 the median survival time of mice injected with mRNA encoding the antibody cetuximab (Erbitux) as compared to the median survival time of naïve control mice in an in vivo tumor model. Briefly, BALB/c nu/nu mice were inoculated subcutaneously in the right flank (near the dorsal region) with a cell suspension of about 5×10.sup.6 SW48 cells (human colon cancer cell line; 100 μl of a cell/matrigel suspension). When the tumor reached a volume of 400-500 mm.sup.3, the tumor tissue blocks were harvested for transplantation. SW48 tumor blocks (about 1.5 mm×1.5 mm×1.5 mm in size) were subcutaneously transplanted in the right flank (near the dorsal region) of 125 animals; eventually 40 tumor-bearing mice were enrolled in the study and were assigned to one of the following four groups (n=10 per group): untreated, Ringer Lactate (“RiLa”), 50 μg mRNA encoding cetuximab (“R3578 (50 μg)”) and 100 μg mRNA encoding cetuximab (“R3578 (100 μg)”). Except for the untreated group, all mice received the respective “treatment” (RiLa or 50 or 100 μg mRNA) every 3 days for a total of seven injections (21 days).

(37) FIG. 31 shows for Example 3 the concentration of cetuximab antibody in the sera of treated mice. Briefly, the sera from mice injected with 100 μg and 50 μg of R3578 were collected 24 hours after the third application and tested by flow cytometry (FACS) for the presence of functional antibodies as described above. The sera from untreated animals and mice injected with RiLa served as controls.

(38) FIG. 32 shows for Example 4 the reduction of the mean tumor volume after treatment with mRNA encoding Blinatumomab (R3981) versus untreated (RiLa control buffer experiment). Mean tumor volume after treatment with R3981 or buffer is depicted. NOG mice were subcutaneously challenged with a mixture of NALM-6 cells and human PBMCs followed by treatment with R3981 or buffer as a control (5x on consecutive days). Tumor growth was measured using caliper and tumor growth curves are depicted. Contrary to the control group, only one of six mice in the cohort treated with the mRNA encoding Blinatumomab developed a measurable tumor. As a result, a statistically significant inhibition of tumor growth was observed compared to the control group.

(39) FIG. 33 shows for Example 4 the tumor volume of R3981- and buffer-treated mice on day 34. Day 34 was chosen for this analysis as the last day when all animals in all groups were still alive and therefore the mean tumor volumes could be compared. The treatment with the mRNA encoding Blinatumomab (R3981) significantly inhibited tumor growth compared to the buffer control. The dots represent the tumor volume of individual mice and the horizontal line represents the median.

(40) FIG. 34 shows for Example 4 the median survival time of mice injected with mRNA encoding the antibody blinatumomab (“R3981”) as compared to the median survival time of buffer control mice in an in vivo tumor model. Briefly, survival proportions after tumor challenge with NALM-6 cells were investigated. Survival in groups treated with R3981 or buffer are shown. MS: median survival time.

(41) FIG. 35 shows for Example 5 expression of anti-BoNTx antibodies by mRNA transfected cells evaluated by Western blot analysis. Aliquots of cell lysates and supernatants were separated by SDS-PAGE, blotted onto a membrane, and stained with an anti-human detection antibody recognizing heavy as well as light chain. Samples from cells transfected with mRNA encoding an unrelated antibody were used as positive control. Mock-transfected cells served as negative control.

(42) FIG. 36 shows for Example 6 the expression of anti-HA antibodies by mRNA transfected cells evaluated by Western blot analysis. Aliquots of cell lysates and supernatants were separated by SDS-PAGE, blotted onto a membrane, and stained with an anti-human detection antibody recognizing heavy as well as light chain. 100 ng of a recombinant antibody were used as positive control and for rough quantification of mRNA-mediated antibody expression. Mock-transfected cells served as negative control.

(43) FIG. 37 shows for Example 6 the production of functional anti-HA antibodies by mRNA transfected cells evaluated by flow cytometry. 24 h after transfection of BHK cells with mRNA-encoded anti-HAn antibody supernatant was collected and used for staining of HA-expressing HeLa cells. The supernatant of mock-transfected cells served as negative control.

(44) FIG. 38 shows for Example 7 the production of functional anti-RAV G antibodies by mRNA transfected cells evaluated by flow cytometry. 24 h after transfection of BHK cells with mRNA-encoded anti-RAV G antibody supernatant was collected and used for staining of RAV G-expressing HeLa cells. The supernatant of mock-transfected cells served as negative control.

(45) FIG. 39 shows the complete mRNA sequence “R1965” coding for the antibody Trastuzumab (Herceptin) (cf. Example 1).

(46) FIG. 40 shows the complete mRNA sequence “R3578” coding for the antibody Cetuximab (Erbitux) (cf. Example 1).

(47) FIG. 41 shows the complete mRNA sequence “R3981” coding for the antibody Blinatumomab (cf. Example 1).

(48) FIG. 42 shows for Example 8 data resulting from an ELISA assay (titers of anti-HIV antibodies expressed by mRNA). Individual supernatants (triplicates; pooled) were analyzed by IgG-specific ELISA. For mock co-transfection, an mRNA encoding eGFP was used.

(49) FIG. 43 shows for Example 8 the HIV entry in MAGI-R5 cells in a Magi R5-Tropic Antiviral Assay (VC=virus control; CC=cell control) of a control without RNA (A); the HIV entry in MAGI-R5 cells in a Magi R5-Tropic Antiviral Assay (VC=virus control; CC=cell control) of mRNA-encoded VRC01 (B); and the HIV entry in MAGI-R5 cells in a Magi R5-Tropic Antiviral Assay (VC=virus control; CC=cell control) of commercially available recombinant VRC01 control (C).

(50) FIG. 44 shows for Example 9 the concentration of human antibodies in the supernatant of R3917-transfected HEK293T cells evaluated by ELISA. The plates were coated with anti-human antibodies, followed by incubation with the supernatant of R3917-transfected cells and anti-human detection antibodies. The concentration of human antibodies was calculated from the standard curve generated using commercially available Rituximab. The supernatant from the sham-transfected cells (WFI, water for injection) served as a control.

(51) FIG. 45 shows for Example 9 the concentration of the functional Rituximab antibodies in the supernatant of R3917-transfected cells evaluated by flow cytometry. 24 h after the transfection of HEK293T cells with mRNA-encoded Rituximab (R3917) supernatant was collected and used for staining of CD20-expressing Raji cells. The concentration of Rituximab was calculated from the standard curve generated using commercially available Rituximab. The supernatant from the sham-transfected cells (WFI) served as a control.

(52) FIG. 46 shows for Example 10 the expression of anti-RSV F antibodies by mRNA transfected cells evaluated by Western blot analysis. Aliquots of cell lysates and supernatants were separated by SDS-PAGE, blotted onto a membrane, and stained with an anti-human detection antibody recognizing heavy as well as light chain. 100 ng of a recombinant antibody were used as positive control and for rough quantification of mRNA-mediated antibody expression. Mock-transfected cells served as negative control.

EXAMPLES

(53) The Examples shown in the following are merely illustrative and shall describe the present invention in a further way. These Examples shall not be construed to limit the present invention thereto.

Example 1: Preparation of an mRNA Encoding Heavy and Light Chain Variable Regions and Antibody Expression

(54) 1.1 Preparation of Expression Vectors for Modified RNA Sequences:

(55) For the production of modified RNA sequences according to the invention, the GC-enriched and translation-optimized DNA sequences which code for a heavy chain and a light chain of the antibodies shown below in Table 12 (e.g. cetuximab (Erbitux), trastuzumab (Herceptin) and rituximab (Rituxan), cf. SEQ ID NO: 61161-61175, where SEQ ID NO: 61161, 61163, 61166, 61168, 61171 and 61173 represent the particular coding sequences which are not GC-optimized of the heavy and the light chains of these antibodies and SEQ ID NO: 61162, 61164, 61165, 61167, 61169, 61170, 61172, 61174, and 61175 represent the coding GC-enriched sequences (see above)) were cloned into the pCV19 vector (CureVac GmbH) by standard molecular biology methods. To ensure equimolar expression of the two chains, an IRES (internal ribosomal entry site) was introduced. The mutated 3′ UTR (untranslated region) of the alpha-globin gene and a polyA-polyC tail at the 3′ end serve for additional stabilizing of the mRNA. The signal peptide of the HLA-A*0201 gene is coded for secretion of the antibody expressed. A His tag was additionally introduced for detection of the antibody. FIG. 6 shows the expression constructs used for cetuximab (Erbitux), trastuzumab (Herceptin) and rituximab (Rituxan).

(56) TABLE-US-00015 TABLE 12 SEQ ID NOs of exemplified and preferred antibodies encoded by the mRNA according to the present invention and of exemplified and preferred mRNAs according to the invention Protein heavy Protein light Optimized CDS Optimized CDS chain (SEQ ID chain (SEQ ID heavy chain light chain mRNA sequence Antibody NO) NO) (SEQ ID NO) (SEQ ID NO) (SEQ ID NO) Cetuximab 61237 61238 61240 61241 61243 (“R3578”) (Erbitux) Trastuzumab 61270 61271 61273 61274 61276 (“R1965”) Rituximab 61303 61305 61306 61308 61310 (Rituxan) (“R3001”) Blinatumomab 61640 — 61642 (single — 61643 (“R3981”) (single chain) chain) Anti-BoNTx_v1 61603 61606 61604 61607 61605 (heavy chain; R4120”) 61608 (light chain; “R4122”) Anti-BoNTx_v2 61609 61612 61610 61613 61611 (heavy chain; R5045”) 61614 (light chain; “R5046”) Anti-HA 61456 61457 61458 61459 61465 CR8033_v1 (“R3996”) Anti-HA 61469 61470 61471 61472 61474 CR8033_v2 (“R3998”) Anti-HA 61475 61476 61477 61478 61480 CR8033_v3 (“R4000”) Anti-HA 61481 61482 61483 61484 61486 CR8033_v4 (“R4002”) Anti-HA 61487 61488 61489 61490 61492 CR8033_v5 (“R4004”) Anti-HA 61493 61494 61495 61496 61498 CR8033_v6 (“R4012”) Anti-Rabies 61408 61412 61409 61413 61410 (heavy chain; “R4116”) 61414 (light chain; “R4118”) Anti-Rabies 61384 61385 61402 61403 61405 (“R3059”) Anti-HIV 61370 61381 61371 61382 61372 (heavy chain; “R5319”) 61383 (light chain; “R5320”) Rituximab 61320 61332 61321 61333 61337 (Rituxan) (“R3917”) Anti-RSV F 61675 61697 61676 61698 61677 (heavy chain; “R4179”) 61699 (light chain; “R4181”) Anti-RSV F 61686 61708 61687 61709 61688 (heavy chain; “R4180”) 61710 (light chain; “R4182”) Anti-RSV F 61660 61661 61662 61663 61666 (“R3060”)

(57) Table 13 below shows further RNA constructs, which were produced, including their SEQ ID NOs and the antibodies, which they encode.

(58) TABLE-US-00016 TABLE 13 SEQ ID NOs of exemplified and preferred mRNAs according to the invention encoding the indicated antibodies. RNA construct name SEQ ID NO Encoded antibody R3578 61243 Cetuximab (Erbitux) R3000 61244 Cetuximab (Erbitux) R1965 61276 Trastuzumab (Herceptin) R2999 61277 Trastuzumab (Herceptin) R3012 61278 Trastuzumab (Herceptin) R3001 61310 Rituximab R3484 61311 Rituximab R4128 61322 Rituximab R5910 61323 Rituximab R4129 61334 Rituximab R5911 61335 Rituximab R3917 61337 Rituximab R4126 61348 Lexatumumab R4127 61359 Lexatumumab R3985 61361 Lexatumumab R5319 61372 VRC01 R5320 61383 VRC01 R3059 61404 SO57 R3059 61405 SO57 R3061 61406 SO57 R4634 61407 SO57 R4116 61410 SO57 R4635 61411 SO57 R4118 61414 SO57 R4636 61415 SO57 R4640 61416 SO57 R4640 61417 SO57 R5230 61428 anti-rabies_Mouse_ab R5231 61439 anti-rabies_Mouse_ab R4112 61460 CR8033 R4530 61461 CR8033 R4114 61462 CR8033 R4531 61463 CR8033 R3996 61465 CR8033 R4633 61466 CR8033 R4639 61467 CR8033 R4639 61468 CR8033 R3998 61473 CR8033 R3998 61474 CR8033 R4000 61479 CR8033 R4000 61480 CR8033 R4002 61485 CR8033 R4002 61486 CR8033 R4004 61491 CR8033 R4004 61492 CR8033 R4012 61497 CR8033 R4012 61498 CR8033 R4007 61520 5J8 R4008 61542 FLA5.10 R4010 61564 PN-SIA49 R5417 61575 Ipilimumab R5418 61586 Ipilimumab R4120 61603 anti-BoNT-A R4120 61604 anti-BoNT-A R4120 61605 anti-BoNT-A R4122 61606 anti-BoNT-A R4122 61607 anti-BoNT-A R4122 61608 anti-BoNT-A R5045 61609 anti-BoNT-A R5045 61610 anti-BoNT-A R5045 61611 anti-BoNT-A R5046 61612 anti-BoNT-A R5046 61613 anti-BoNT-A R5046 61614 anti-BoNT-A R3118, R3729 61615 anti-BoNT-A R3118 61616 anti-BoNT-A R3729 61617 anti-BoNT-A R3979 61638 Blinatumomab R3981 61643 Blinatumomab R3058 61665 anti-RSV R3060 61666 anti-RSV R4179 61677 anti-RSV R4180 61688 anti-RSV R4181 61699 anti-RSV R4182 61710 anti-RSV R4124 61721 anti-VEGFR2 R4125 61732 anti-VEGFR2 R3983 61733 anti-VEGFR2 R3983 61734 anti-VEGFR2

(59) 1.2 Preparation of the G/C-Enriched and Translation-Optimized Antibody-Coding mRNA

(60) An in vitro transcription was carried out by means of T7 polymerase (T7-Opti mRNA Kit, CureVac, Tubingen, Germany), followed by purification with Pure Messenger™ (CureVac, Tubingen, Germany). For this, a DNase digestion was first carried out, followed by an LiCl precipitation and thereafter an HPLC using a porous reverse phase as the stationary phase (PURE Messenger).

(61) 1.3 Cell Lines

(62) RNA-based expression of humanised antibodies was done in either CHO-K1 or BHK-21 (Syrian hamster kidney, HER2-negative) cells. The tumour cell lines BT-474, A-431 and Raji strongly expressing HER2, EGFR and CD20, respectively, were used to record antibody levels by FACS analysis. All cell lines except CHO were maintained in RPMI medium supplemented with FCS and glutamine according to the supplier's information. CHO cells were grown in Ham's F12 supplemented with 10% FCS. All cell lines were obtained from the German collection of cell cultures (DSMZ, Braunschweig, Germany).

(63) 1.4 Antibody Expression

(64) Various amounts of mRNA (G/C enriched as defined by FIGS. 12, 17, 22, 25, 26, 27) encoding the humanised antibodies Herceptin, Erbitux, and Rituxan, respectively, were transfected into either CHO or BHK cells by electroporation (300 V, 450 μF for CHO and 300 V, 150 μF for BHK). After transfection, cells were seeded onto 24-well cell culture plates at a density of 200.000 to 400.000 cells per well. For collection of secreted protein, medium was replaced by 250 μl of fresh medium after cell attachment to the plastic surface. Secreted protein was collected for 24-96 hours and stored at 4° C. In addition, cells were harvested into 50 μl of phosphate buffered saline (1×PBS buffer) containing 0.5% BSA and broken up by three freeze-thaw cycles. Cell lysates were cleared by centrifugation and stored at −80° C.

(65) 1.5 Western Blot Analysis

(66) In order to detect translation of transfected RNA, proteins from either cell culture supernatants or cell lysates were separated by a 12% SDS-PAGE and blotted onto a nitrocellulose membrane. Humanised antibodies Herceptin (Roche), Erbitux (Merck KGAA), and Mabthera=Rituxan (Roche) were used as controls. After blotting was completed, membranes were consecutively incubated with a biotinylated goat anti-human IgG antibody (Dianova), streptavidin coupled to horseradish peroxidase (BD), and a chemiluminescent substrate (SuperSignal West Pico, Pierce). Staining was detected with a Fuji LAS-1000 chemiluminescence camera. Results are shown in FIG. 23.

(67) 1.6 FACS Analysis

(68) Functional antibody formation can be demonstrated by FACS staining of antigen-expressing target cells. In order to examine the production of functional antibodies, cell culture supernatants of RNA-transfected cells were collected after 48 to 96 hours. Approximately 200.000 target cells expressing the respective antigen were incubated with either control antibodies (Herceptin, Erbitux, Mabthera) or cell culture supernatants. For detection of bound antibodies, cells were stained with biotinylated goat anti-human IgG antibody (Dianova) and PE-labelled streptavidin (Invitrogen). Cells were analysed on a FACSCalibur (BD).

Example 2: Effects of an mRNA Encoding Trastuzumab (Herceptin) in an In Vivo Tumor Model

(69) 2.1 Preparation of mRNA

(70) For the present example a DNA sequence encoding the Trastuzumab protein was prepared and used for subsequent in vitro transcription reactions as described in Example 1.

(71) Briefly, a vector for in vitro transcription was constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and light chain of the Trastuzumab antibody, separated by the internal ribosomal entry site (IRES) from Encephalomyocarditis virus (EMCV). An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. This DNA construct is shown in FIGS. 22 and 39 (SEQ ID NO: 61175). This vector was transcribed in vitro in the presence of a cap analog resulting in 5′-capped (m7G) mRNA (“R1965”).

(72) 2.2 Animal Study

(73) Before the start of the experiment, 7 weeks old female BALB/c nu/nu mice (n=14 per group) were subcutaneously implanted with slow-release estrogen pellets (0.72 mg 17β-estradiol) because the BT-474 cell line is estrogen receptor positive and estrogen enhances tumorigenicity. Mice were inoculated subcutaneously with 10×10.sup.6 BT-474 tumour cells (100 μl of a cell/matrigel suspension) per mouse on day 0. Treatment was started on day 11 when tumors became injectable. Mice were treated twice weekly for up to 3.5 weeks with a single dose of 50 μg of mRNA (R1965) in a 50 μl injection volume (Ringer Lactate buffer).

(74) 2.3 Statistical Analysis

(75) The statistical difference in survival was evaluated using Mantel-Cox (p=0.0499) and Gehan-Breslow (p=0.0425) tests, which assume the proportional hazards or give more weight to deaths at early time points, respectively.

(76) 2.4 Results

(77) Results are shown in FIG. 28. This experiment demonstrates the effectiveness of the mRNA-encoded antibody Trastuzumab with respect to enhancing survival of nude BALB/c mice harboring a human tumor cell xenograft (BT-474 breast cancer cell line). The Her-2 positive tumor cell line BT-474 was used to establish tumors which were then treated by intratumoral injections of mRNA encoding the anti-Her-2 antibody Trastuzumab. The effectiveness of treatment was demonstrated by prolonged survival of treated animals compared to untreated animals (FIG. 28). The median survival time compared to untreated mice was increased by 5.5 days.

Example 3: In Vitro and In Vivo Effects of an mRNA Encoding Cetuximab (Erbitux)

(78) 3.1 Preparation of mRNA

(79) For the present example a DNA sequence encoding the Cetuximab protein was prepared and used for subsequent in vitro transcription reactions as described in Example 1.

(80) Briefly, a vector for in vitro transcription was constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and light chain of the Cetuximab antibody, separated by the internal ribosomal entry site (I RES) from Encephalomyocarditis virus (EMCV). An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. This DNA construct is shown in FIGS. 17 and 40 (SEQ ID NO: 61170). This vector was transcribed in vitro. After in vitro transcription, the mRNA was enzymatically capped and polyadenylated. The resulting mRNA was termed “R3578”.

(81) 3.2 In Vitro Expression of the Antibody Cetuximab

(82) The expression of functional antibodies by mRNA-encoded Cetuximab was evaluated in vitro. To this end, HEK293T cells were transfected with 1 μg or 4 μg of mRNA (R3578) using the Lipofectamine2000 reagent. 24 hours after the transfection, the supernatant was collected and used for staining of A431 cells (EGFR-expressing cell line) and analysed by flow cytometry (FACS). The concentration of Cetuximab in the supernatant of the transfected cells was calculated using a standard curve generated with the commercially available Cetuximab protein. As shown in FIG. 29, transfection with 4 μg of mRNA (R3578) resulted in the production of functional antibodies at the concentration of approximately 40 ng/ml.

(83) 3.3 Animal Study

(84) 6-7 weeks old female BALB/c nu/nu mice (n=10) were inoculated subcutaneously in the right flank (near the dorsal region) with a cell suspension of about 5×10.sup.6 SW48 cells (human colon cancer cell line; 100 μl of a cell/matrigel suspension). When the tumor reached a volume of 400-500 mm.sup.3, the tumor tissue blocks were harvested for transplantation. SW48 tumor blocks (about 1.5 mm×1.5 mm×1.5 mm in size) were subcutaneously transplanted in the right flank (near the dorsal region) of 125 animals; eventually 40 tumor-bearing mice were enrolled in the study. The animals were weighed and randomized into treatment groups when the tumor size reached a volume of 100-150 mm.sup.3. The date to start treatment was designated as day 0. All groups consisted of 10 animals each. The mRNA or Ringer lactate buffer was administered in a 50 μl volume intratumorally as shown in Table 14.

(85) TABLE-US-00017 TABLE 14 Group designation and dosing schedule No. Frequency of an- and days of dosing Group imals Treatment Dose (after randomization) 1 10 Untreated — — 2 10 Ringer Lactate — Every 3 days for a total number of 7 injections 3 10 R3578 (Cetuximab 100 μg Every 3 days for a total (Erbitux) SEQ ID number of 7 injections NO: 61243) 4 10 R3578 (Cetuximab  50 μg Every 3 days for a total (Erbitux) SEQ ID number of 7 injections NO: 61243)

(86) Animals in a deteriorating condition with a body weight loss greater than 30% or bearing a tumor exceeding 2,000 mm.sup.3 in size were euthanized.

(87) Tumor volume, expressed in mm.sup.3, was calculated using the following formula, in which “a” and “b” are the long and the short diameters of a tumor, respectively.
V(mm.sup.3)=(a×b.sup.2)/2

(88) Statistical Analysis

(89) The statistical difference in survival was evaluated using Mantel-Cox and Gehan-Breslow tests, which assume the proportional hazards or give more weight to deaths at early time points, respectively. The hazard ratio (logrank) as part of the survival analysis of two data sets was included in the results. Hazard is defined as the slope of the survival curve and the hazard ratio compares the rate of death between two groups. The statistical difference between groups was evaluated using Mann-Whitney test.

(90) Results

(91) This experiment demonstrates the efficacy of the mRNA-encoded antibody Cetuximab with respect to enhancing survival of nude BALB/c mice harboring a human tumor cell xenograft (SW48 human colon cancer cell line).

(92) As shown in FIG. 30, compared to the buffer-treated mice, the treatment with R3578 increased the time to the first death incident by 20% (7 days; first incident at day 42 compared to day 35 in RiLa-treated mice) in the group injected with 100 μg of mRNA-encoded Cetuximab (FIG. 30A) and approximately 15% (5 days) in the group treated with 50 μg of R3578 (FIG. 30B). Moreover, at day 51 all mice in the RiLa group were dead, whereas in total four mice treated with R3578 were still alive (one mouse in group treated with 100 μg R3578 and three mice treated with 50 μg R3578) were still alive. Consequently, the median survival time compared to RiLa-injected mice was increased in animals treated with 100 μg or 50 μg of mRNA-encoded Cetuximab.

(93) To confirm the expression and functionality of mRNA-encoded Cetuximab in vivo, the sera from mice injected with 100 μg and 50 μg of R3578 were collected 24 hours after the third application and tested by flow cytometry (FACS) for the presence of functional antibodies as described above. The sera from untreated animals and mice injected with RiLa served as controls. As shown in FIG. 31, Cetuximab antibodies were clearly detectable in both groups injected with R3578 confirming the in vivo expression and functionality (capability to bind to EGFR) of mRNA-encoded antibodies.

Example 4: Effects of an mRNA Encoding a Single Chain, Bispecific Antibody (Blinatumomab) in an In Vivo Tumor Model

(94) As a further example, mRNA coding for Blinatumomab was tested in vivo (a bispecific anti-CD3/anti-CD19 antibody).

(95) 4.1 Preparation of mRNA

(96) For the present example a DNA sequence encoding the Blinatumomab antibody was prepared and used for subsequent in vitro transcription reactions in a similar manner as described in Example 1, except that the antibody encoded by the mRNA was Blinatumomab.

(97) Briefly, a vector for in vitro transcription was constructed containing a T7 promoter and a GC-enriched sequence coding for Blinatumomab (a fusion protein consisting of the variable regions of two single-chain monoclonal antibodies (scFvs)—CD19 and CD3—covalently linked by a non-immunogenic five-amino acid chain). An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction enzyme site used for linearization of the vector before in vitro transcription. The respective CDS sequence as well as the sequence of the mRNA can be retrieved from Table 12 (Example 1). This vector was transcribed in vitro in the presence of a cap analog resulting in 5′-capped (m7G) mRNA (“R3981”).

(98) 4.2 Animal Study

(99) NOG female mice (n=6 per group) were inoculated subcutaneously in the right flank with a cell suspension consisting of 1×10.sup.6 NALM-6 cells (human pre-B cell leukemia) and 1×10.sup.8 freshly isolated human PBMCs (peripheral blood mononuclear cells). The NALM-6 cells were co-injected together with human peripheral mononuclear cells (PBMCs) as source of human T-cells because Blinatumomab as a bispecific antibody recognizes the CD19 protein on the human NALM-6 cells and the CD3 protein on the human T cells. One hour after cell inoculation mice were treated by peritumoral injections of the mRNA encoding Blinatumomab (“R3981”; 100 μg) or buffer (Ringer Lactate) as a control and this treatment was repeated on five consecutive days. The detailed group description is depicted in Table 15.

(100) TABLE-US-00018 TABLE 15 Animal groups and dosing schedule. No. Treatment Group of animals PBMCs Treatment Dose schedule 1 6 — Ringer Lactate — At five consecutive days beginning at day 0 2 6 + Ringer Lactate — At five consecutive days beginning at day 0 3 6 + R3981 100 μg At five (Blinatumomab consecutive SEQ ID NO: days beginning 61643) at day 0

(101) The animal health status was checked daily. Animals in a deteriorating condition with a body weight loss greater than 20% or bearing a tumor exceeding 2 cm.sup.3 in size were euthanized.

(102) Tumor volume, expressed in cm.sup.3, was calculated using the following formula, in which “a” and “b” are the long and the short diameters of a tumor, respectively.
V(cm.sup.3)=(a×b.sup.2)/2

(103) Statistical Analysis

(104) The statistical analysis of tumor growth curves was performed using 2-way ANOVA test with Bonferroni post test. The statistical analysis of differences in tumor volume at day 34 was performed using t-test with Welch's correction (the data were normally distributed as determined by Kolmogorov-Smirnov normality test). The statistical difference in survival was evaluated using Mantel-Cox test.

(105) Results

(106) This experiment shows the efficacy of the mRNA-encoded Blinatumomab antibody in terms of reduction of tumor growth and enhancing survival of NOG mice harboring a human cell xenograft (NALM-6 human pre-B leukemia cells).

(107) Subcutaneously injected NALM-6 cells developed palpable tumors in control treated mice at day 25. Thereafter, the tumor rapidly increased in size in all buffer-treated animals (FIG. 32). Contrary to the control group, only one of six mice in the cohort treated with the mRNA-encoded Blinatumomab developed a measurable tumor. As a result, a statistically significant inhibition of tumor growth in the group injected with R3981 in comparison to buffer-treated mice was observed.

(108) To further demonstrate the impact of the mRNA-encoded Blinatumomab treatment on the growth of the subcutaneously injected NALM-6 cells the tumor volume of each mouse at day 34 was depicted (FIG. 33). Day 34 was chosen for this analysis as the last day when all animals in all groups were still alive and therefore the mean tumor volumes can be compared. As shown in FIG. 33, treatment with R3981 significantly inhibited tumor growth compared to the buffer control.

(109) In addition to the effect on tumor growth, the difference in survival between the experiments groups was evaluated. As shown in FIG. 34, treatment with the mRNA-encoded Blinatumomab significantly enhanced mice survival compared to the buffer-treated animals. At day 49, all animals in the R3981-treated group were alive (5/6 mice were completely tumor-free and only one mouse had a measurable tumor) compared to the control group where five of six animals were already dead. Consequently, the R3981-treated group had an undefined median survival time (MS), whereas the buffer-treated group reached MS at 38.25 days. Thus treatment with the mRNA encoding Blinatumomab significantly enhanced the survival compared to the buffer-treated animals.

Example 5: In Vitro Expression of mRNA-Encoded Anti-BoNTx Antibody

(110) In this experiment the in vitro expression of mRNA-encoded anti-BoNTx antibody was evaluated.

(111) 5.1 Preparation of mRNA

(112) For the present example DNA sequences encoding an antibody directed against the Botulinum neurotoxin (BoNTx) (Amersdorfer et al., 1997. Infect. Immun. 65(9):3743-52) were prepared and used for subsequent in vitro transcription reactions. Heavy (HC) and light (LC) chain of the antibody were encoded as separate entities and constructs differed regarding signal peptides used for protein secretion (Table 16).

(113) Vectors for in vitro transcription were constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and light chain of the antibody, respectively. An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. The respective CDS sequences as well as the sequences of the mRNA can be retrieved from Table 12 (Example 1). For capping of the mRNA, in vitro transcription was conducted in the presence of cap analog.

(114) TABLE-US-00019 TABLE 16 mRNA constructs encoded signal mRNA antibody peptide RNA design R5045 (any of SEQ ID NOs anti- HLA-2 HC and LC 61609-61611)/R5046 (any BoNTx encoded on of SEQ ID NOs 61612-61614) separate mRNA molecules R4120 (any of SEQ ID NOs anti- immuno- HC and LC 61603-61605)/R4122 (any BoNTx globulin encoded on of SEQ ID NOs 61606-61608) separate mRNA molecules

(115) 5.2 In Vitro Expression of the Anti-BoNTx Antibody Evaluated by Western Blot Analysis

(116) The expression of mRNA-encoded anti-BoNTx antibody was evaluated in vitro. To this end, BHK cells were transfected with 10 μg of mRNA using the Lipofectamine2000 reagent. 24 hours after the transfection, cells and supernatants were collected for Western blot analysis to determine the expression of human antibodies.

(117) 5.3 Results

(118) As shown in FIG. 35, human antibodies were clearly detectable in lysates and supernatants of mRNA-transfected cells. The mRNA-transfected cells produced both, heavy and light chain, and gave rise to high and equivalent levels of both chains in the supernatant, thus strongly suggesting the production of correctly folded and assembled antibodies. Expression was specific as no antibodies were detected in the supernatants of mock-transfected cells.

Example 6: In Vitro Expression of mRNA-Encoded Anti-Influenza (Anti-HA) Antibody

(119) In these experiments the in vitro expression and binding to the native antigen of mRNA-encoded CR8033 (anti-HA: anti-hemagglutinin) antibody was evaluated.

(120) 6.1 Preparation of mRNA

(121) For the present example DNA sequences encoding the CR8033 anti-hemagglutinin antibody (Dreyfus et al., 2012. Science 337(6100):1343-8) were prepared and used for subsequent in vitro transcription reactions. The antibody was represented by bi-cistronic sequences in which heavy chain (HC) and light chain (LC) were separated by the internal ribosomal entry site (IRES) from either Encephalomyocarditis (EMCV) or Foot-and-mouth disease (FMDV) virus. Moreover, sequences varied with respect to the order of heavy and light chain or utilized different signal peptides for the secretion of both chains (Table 17).

(122) Vectors for in vitro transcription were constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and light chain of the antibody. An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. The respective CDS sequences as well as the sequences of the mRNA can be retrieved from Table 12 (Example 1). For capping of the mRNA, in vitro transcription was conducted in the presence of cap analog.

(123) TABLE-US-00020 TABLE 17 mRNA constructs encoded mRNA antibody signal peptide RNA design R3996 (SEQ ID CR8033 immunoglobulin HC:EMCV-IRES:LC NO: 61465) (anti-HA) R4000 (SEQ ID CR8033 Albumin (ALB) HC:EMCV-IRES:LC NO: 61479, (anti-HA) 61480)

(124) 6.2 In Vitro Expression of the CR8033 Antibody Evaluated by Western Blot Analysis

(125) The expression of antibodies by mRNA-encoded CR8033 was evaluated in vitro. To this end, BHK cells were transfected with 10 μg of mRNA using the Lipofectamine2000 reagent. 24 hours after the transfection, cells and supernatants were collected for Western blot analysis to determine the expression of human antibodies.

(126) 6.3 In Vitro Expression of Functional CR8033 Antibody Evaluated by Flow Cytometry

(127) To confirm the functionality of the in vitro-produced mRNA-encoded antibody, the supernatant obtained after transfection of BHK cells (as described above) was used for staining of hemagglutinin (HA) expressing HeLa cells. To this end, HeLa cells were transfected with 1 μg of HA-expressing mRNA using the Lipofectamine2000 reagent and, after staining, analyzed by flow cytometry (FACS). The expression is presented as median fluorescence intensity.

(128) 6.4 Results

(129) As shown in FIG. 36, mRNA-transfected cells produced both, heavy and light chain, and gave rise to high and equivalent levels of both chains in the supernatant, thus strongly suggesting the production of correctly folded and assembled antibodies. Expression was specific as no antibodies were detected in the supernatants of mock-transfected cells.

(130) As shown in FIG. 37, all antibody-encoding mRNAs resulted in the production of functional antibodies.

Example 7: In Vitro and In Vivo Expression of mRNA-Encoded Anti-Rabies (anti-RAV G) Antibody

(131) In this experiment the in vitro expression and binding to the native antigen of mRNA-encoded anti-RAV G antibody was evaluated.

(132) 7.1 Preparation of mRNA

(133) For the present example DNA sequences encoding an antibody directed against the Rabies virus glycoprotein (RAV G) (SO57 antibody; Prosniak et al., 2003. J. Infect. Dis. 188(1):53-6) were prepared and used for subsequent in vitro transcription reactions. Heavy (HC) and light (LC) chain of the antibody were either linked by the internal ribosomal entry site (IRES) from Encephalomyocarditis virus (EMCV) or encoded as separate entities (Table 18).

(134) Vectors for in vitro transcription were constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and/or light chain of the antibody. An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. The respective CDS sequences as well as the sequences of the mRNA can be retrieved from Table 12 (Example 1). For capping of the mRNA, in vitro transcription was conducted in the presence of cap analog.

(135) TABLE-US-00021 TABLE 18 mRNA constructs encoded signal mRNA antibody peptide RNA design R4116 (SEQ ID NO: anti-RAV G immuno- HC and LC encoded 61410)/R4118 (SEQ globulin on separate ID NO: 61414) mRNA molecules R3059 (SEQ ID NO: anti-RAV G immuno- HC:EMCV-IRES:LC 614104/61405) globulin

(136) 7.2 In Vitro Expression of the Functional Anti-RAV G Antibody Evaluated by Flow Cytometry

(137) To demonstrate functionality of in vitro-produced mRNA-encoded antibody, the supernatant obtained after transfection of BHK cells was used for staining of RAV G expressing HeLa cells. To this end, BHK cells were transfected with 10 μg of antibody-encoding mRNA and HeLa cells were transfected with 1 μg of RAV G-expressing mRNA, respectively, using the Lipofectamine2000 reagent. After staining, HeLa cells were analyzed by flow cytometry (FACS). The expression level of the anti-RAV G antibody is presented as median fluorescence intensity.

(138) 7.3 Results

(139) As shown in FIG. 38, all antibody-encoding mRNAs resulted in the production of functional antibodies. However, the antibody produced from mRNA molecules separately encoding heavy chain and light chain produced higher antibody levels as compared to the antibody produced from an mRNA molecule encoding both, heavy chain and light chain. All antibodies were functional as they recognized and bound RAV G antigen expressed on the surface of HeLa cells. Encoding heavy and light chain by separate mRNA molecules instead of a bi-cistronic construct strongly increased the amount of functional antibodies secreted by mRNA-transfected cells.

Example 8: In Vitro Expression of mRNA-Encoded Anti-HIV Antibody

(140) In this experiment the in vitro expression and neutralization activity to the HIV-1Ba-L HIV strain was tested for RNA-encoded antibodies.

(141) 8.1 Preparation of mRNA

(142) For the present example DNA sequences encoding an antibody directed against the HIV (VRC01; Wu et al., Science 329(5993):856-861, 2010) were prepared and used for subsequent in vitro transcription reactions. Heavy (HC) and light (LC) chain of the antibody were encoded as separate entities (Table 19). For the heavy chains of VRC01, the sequence of the IgG constant region of S057 and the sequence of an immunoglobulin kappa light chain constant region (GenBank: AGH70219.1) was used.

(143) Vectors for in vitro transcription were constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and/or light chain of the antibody. An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. The respective CDS sequences as well as the sequences of the mRNA can be retrieved from Table 12. For capping of the mRNA, in vitro transcription was conducted in the presence of cap analog. Cells were transfected with lipofectamin 2000 complexed mRNA.

(144) TABLE-US-00022 TABLE 19 mRNA constructs mRNA construct encoded antibody RNA design R5319 (SEQ ID NO: VRC01 HC and LC encoded on 61372)/R5320 (SEQ separate mRNA molecules ID NO: 61383)

(145) 8.2 In Vitro Expression of the Functional Anti-HIV Antibody Evaluated by IgG ELISA

(146) To demonstrate expression of in vitro-produced mRNA-encoded antibody, the supernatant obtained after transfection of BHK cells was subjected to an IgG-specific ELISA where plates were coated with an anti-human IgG antibody. Antibody detection was obtained in a plate reader.

(147) 8.3 In Vitro Functionality of an Anti-HIV Antibody Evaluated in MAGI-R5 Cells—Inhibitory Effect on HIV Infection

(148) The inhibitory activity of the mRNA-encoded antibody of the invention on HIV infection is measured on the human MAGI R5 recombinant cell line coexpressing the human CCR5 receptor and CD4 at their extracellular membrane. The cells used in the assay contain the HIV-1 LTR promoter that drives expression of β-gal upon infection (this driven by the interaction of tat and the LTR).

(149) Consequently, to demonstrate the functionality of anti-HIV antibody, the supernatant obtained after transfection of BHK cells was subjected to the virus entry test using MAGI-R5 cells which report the entry of HIV by chemo luminescence (Magi R5-Tropic Antiviral Assay performed at Southern Research, Maryland, USA). Inhibition of virus entry correlates with reduced RLU (relative light units). Upon virus entry, the receptor (CCR5) fused to beta-gal is expressed which is detected by chemo-luminescence, thus, the lower the RLU values the more inhibition of virus entry is observed.

(150) 8.4 Results

(151) As shown in FIG. 42, mRNA encoding anti-HIV antibody expressed antibodies.

(152) As shown in FIG. 43, increasing concentrations of expressed anti-HIV antibody reduced virus entry in MAGI cells (CC=cell control containing cells only; VC=virus control containing also virus). Included as a control was commercially available recombinant VRC01 (FIG. 43C). mRNA-encoded VRC01 (FIG. 43B) inhibited the entry of HIV similar to recombinant VRC01 (FIG. 43C). Thus, the mRNA-encoded antibody of the invention is able to protect a human recombinant cell line (MAGI R5 cell) from the infection by a HIV virus.

Example 9: In Vitro Expression of mRNA-Encoded Rituximab

(153) In these experiments the in vitro expression of mRNA-encoded Rituximab and binding to its native antigen was evaluated.

(154) 9.1. Preparation of mRNA

(155) For the present example a DNA sequence encoding the Rituximab protein was prepared and used for subsequent in vitro transcription reactions.

(156) A vector for in vitro transcription was constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and light chain of the Rituximab antibody, separated by the internal ribosomal entry site (IRES) from Encephalomyocarditis virus (EMCV). An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. This vector was transcribed in vitro in the presence of a cap analog resulting in 5′-capped (m7G) mRNA (R3917; SEQ ID NO: 61337).

(157) 9.2 In Vitro Expression of the Rituximab Antibody Evaluated by ELISA

(158) The expression of functional antibodies by mRNA-encoded Rituximab was evaluated in vitro. To this end, HEK293T cells were transfected with 1 μg or 4 μg of mRNA (R3917) using the Lipofectamine2000 reagent. 24 hours after the transfection, the supernatant was collected and used in ELISA to determine the expression of human antibodies.

(159) 9.3 In Vitro Expression of the Functional Rituximab Antibody Evaluated by Flow Cytometry

(160) To confirm the functionality of the in vitro-produced mRNA-encoded Rituximab, the supernatant obtained after transfection of HEK293T cells (as described above) was used for staining of Raji cells (the cell line expressing human CD20) and the cells were analysed by flow cytometry (FACS). The concentration of Rituximab in the supernatant of the transfected cells was calculated using a standard curve generated with the commercially available Rituximab protein.

(161) 9.4 Results

(162) In these experiments the in vitro expression of mRNA-encoded Rituximab and binding to its native antigen was evaluated.

(163) As shown in FIG. 44, the concentration of over 10 ng/ml of human antibodies was detected in the supernatant of cells transfected with 4 μg of R3917, the expression was dose-dependent and specific as no antibodies were detected in the supernatants of the sham-transfected cells. These antibodies were functional as they recognized and bound CD20 antigen expressed on the surface of Raji cells (FIG. 45). The estimated concentration of the antibodies using ELISA (here, a method that measures human antibodies) and flow cytometry (here, a method that measures only functional Rituximab) was similar suggesting that all antibodies detected in the supernatant are fully functional.

Example 10: In Vitro Expression of mRNA-Encoded Anti-RSV F Antibody

(164) In this experiment the in vitro expression of an mRNA-encoded antibody against human respiratory syncytial virus F protein (anti-RSV F antibody; Palivizumab) was investigated.

(165) 10.1 Preparation of mRNA

(166) For the present example DNA sequences encoding an antibody directed against the human respiratory syncytial virus F protein (RSV F) (Synagis antibody) were prepared and used for subsequent in vitro transcription reactions. Heavy (HC) and light (LC) chain of the antibody were either linked by the internal ribosomal entry site (IRES) from Encephalomyocarditis virus (EMCV) or encoded as separate entities (Table 20). Vectors for in vitro transcription were constructed containing a T7 promoter and a GC-enriched sequence coding for the heavy and/or light chain of the antibody. An α-globin 3′-UTR, followed by an A64 poly(A) sequence and a C30 sequence, was inserted 3′ of the open reading frame (ORF). The C30 sequence was followed by a restriction site used for linearization of the vector before in vitro transcription. For capping of the mRNA, in vitro transcription was conducted in the presence of cap analog.

(167) TABLE-US-00023 TABLE 20 mRNA constructs encoded mRNA construct antibody RNA design R4179 (SEQ ID NO: anti-RSV F immuno- HC and LC encoded 61677)/R4181 (SEQ globulin on separate ID NO: 61699) mRNA molecules R4180 (SEQ ID NO: anti-RSV F immuno- HC and LC encoded 61688)/R4182 (SEQ globulin on separate ID NO: 61710) mRNA molecules R3060 (SEQ ID NO: anti-RSV F HLA-2 HC:EMCV-IRES:LC 61666)

(168) 10.2 In vitro expression of the anti-RSV-F antibodies evaluated by Western blot analysis The expression of mRNA-encoded anti-RSV F antibody was evaluated in vitro. To this end, BHK cells were transfected with 10 μg of mRNA using the Lipofectamine2000 reagent. 24 hours after the transfection, cells and supernatants were collected for Western blot analysis to determine the expression of human antibodies.

(169) 10.3 Results

(170) As shown in FIG. 46, human antibodies were clearly detectable in lysates and supernatants of mRNA-transfected cells. However, the antibody level was strongly dependent on the format of antibody representation. The mRNA-transfected cells produced both, heavy and light chain, while encoding heavy and light chain by separate mRNA molecules instead of a bi-cistronic construct strongly improved the ratio of heavy and light chain, thus giving rise to almost equivalent levels of both chains. Expression was specific as no antibodies were detected in the supernatants of mock-transfected cells.