Synthetic polynucleotides encoding a human FKRP protein

11596698 · 2023-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention concerns synthetic polynucleotides encoding a human fukutin-related protein (FKRP) wherein the synthetic polynucleotides contain at least a mutation avoiding supplementary transcript(s) generated from frameshift start codon(s). The synthetic polynucleotides are useful, especially for treating a pathology linked to a FKRP deficiency or induced by a defect in α-dystroglycan (α-DG) glycosylation, such as LGMD2I.

Claims

1. A synthetic polynucleotide encoding a human fukutin-related protein (FKRP) consisting of or comprising the sequence SEQ ID NO: 1, wherein the polynucleotide has at least one antisense start codon mutated, said antisense start codon being located at position 819 of sequence SEQ ID NO: 2, wherein the polynucleotide comprises the sequence SEQ ID NO: 4.

2. A vector comprising the polynucleotide according to claim 1.

3. The vector according to claim 2, wherein the vector is an adeno-associated viral (AAV) vector.

4. The vector according to claim 3, wherein the AAV vector is of serotype 9.

5. The vector according to claim 2, wherein the vector comprises the sequence SEQ ID NO: 11 or a sequence having at least 90% identity thereto.

6. An isolated cell comprising the polynucleotide of claim 1.

7. A pharmaceutical composition comprising the polynucleotide of claim 1 and a pharmaceutically acceptable carrier.

8. The vector according to claim 3, wherein the AAV vector is serotype 2, 8, or 9.

9. The vector according to claim 3, wherein the AAV vector is serotype 2/9.

10. A method of treating a dystroglycanopathy, the method comprising administering the pharmaceutical composition of claim 7 to a subject in need thereof.

11. The method according to claim 10, wherein the dystroglycanopathy is selected from the group consisting of: Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) and Muscle-Eye-Brain disease (MEB).

12. The method of claim 10, wherein the dystroglycanopathy is LGMD2I.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Scheme of the plasmids used in this study: Panel A/pAAV-hDesmin-hFKRPwt; Panel B/pAAV-hDesmin-hFKRP-OPTmin; Panel C/pAAV-hDesmin-hFKRP-OPTcomp.

(2) FIGS. 2A-2C: Injection of C57BI6 mice without (PBS) or with AAV9 comprising different forms of the human FKRP (hFKRP) transgene: hFKRP-wt (coding sequence SEQ ID NO: 2), hFKRP-OPTmin (coding sequence SEQ ID NO: 3) and hFKRP-OPTcomp (coding sequence SEQ ID NO: 4) at 2 different doses (3E9 vg/TA and 1.5E10 vg/TA). FIG. 2A shows evaluation of the FKRP expression by western-blotting. FIG. 2B shows quantification of the FKRP protein after normalization with GADPH. FIG. 2C shows quantification of the FKRP protein after normalization with GADPH: administration of FKRP wt (SEQ ID NO: 2), FKRP-OPTcomp (SEQ ID NO: 4), FKRP-06 (SEQ ID NO: 20), FKRP-OPT-07 (SEQ ID NO: 5), FKRP-OPT-08 (SEQ ID NO: 6), FKRP-OPT-10 (SEQ ID NO: 7), and FKRP-OPT-11 (SEQ ID NO: 8), at the dose of 3E9 vg/TA.

(3) FIGS. 3A-3C: In vivo evaluation of FKRP-OPTcomp (SEQ ID NO: 4) after administration to HSA-FKRPdel mice (a FKRP-deficient mouse model) at 2 different doses (3E9 vg/TA and 1.5E10 vg/TA). FIG. 3A shows centronucleation index in the TA muscle. FIG. 3B shows force of TA in situ. FIG. 3C shows results of an Escape Test.

DETAILED DESCRIPTION OF THE INVENTION

(4) The present invention is based on the finding that the suppression of supplementary frameshift start codon(s) contained in the coding region of the Fukutin-related protein (FKRP) increases FKRP expression.

(5) Accordingly, in one aspect, the invention provides a synthetic polynucleotide encoding a human FKRP, wherein said polynucleotide contains at least a mutation avoiding supplementary transcript(s) generated from frameshift start codon(s).

(6) According to the invention, the synthetic polynucleotide comprises or consists of a nucleic acid sequence encoding a functional human FKRP.

(7) In one embodiment, the polynucleotide encoding the human FKRP, also named ORF for “open reading frame”, is a cDNA. However, e.g. single- or double-stranded DNA or RNA can be used.

(8) In the frame of the invention, a human FKRP protein is a protein consisting of or comprising the sequence shown in SEQ ID NO: 1 (corresponding to a protein of 495 aa).

(9) According to specific embodiments, a functional human FKRP is a protein having the same functions as the native human FKRP encoded by SEQ ID NO: 1, especially the ability to glycosylate α-dystroglycan (αDG) and/or to alleviate, at least partially, one or more of the symptoms associated with a defect in FKRP, especially the LGMD2I phenotype as disclosed above. It can be a fragment and/or a derivative thereof. According to one embodiment, said FKRP sequence has identity greater than or equal to 60%, 70%, 80%, 90%, 95% or even 99% with sequence SEQ ID NO: 1.

(10) As known in the art, the native human sequence encoding the human FKRP protein of sequence SEQ ID NO: 1 has the sequence SEQ ID NO: 2.

(11) The present invention excludes the native sequence SEQ ID NO: 2 and is focused on sequences encoding SEQ ID NO: 1 but different from SEQ ID NO: 2. More precisely, the native polynucleotide (SEQ ID NO: 2) has been modified or optimized: Based on the degeneracy of the genetic code, one or more base(s) of the native sequence (SEQ ID NO: 2) have been substituted by other bases(s) while not changing the resulting amino acid sequence (SEQ ID NO: 1). In other words, the present invention provides a synthetic polynucleotide, i.e. a polynucleotide which is not naturally occurring, advantageously optimized.

(12) According to another specific embodiment, a synthetic polynucleotide according to the invention does not consist of or comprise the sequence SEQ ID NO: 20, or any sequence having at least 90% identity thereto.

(13) Preferably, the synthetic polynucleotide encoding a human FKRP is about 60% homologous/identical, more preferably about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 88%, 89% or about 90%, 91%, 92%, 93%, 94% homologous/identical, even more preferably, about 95% homologous/identical, and even more preferably about 96%, 97%, 98% or even 99% homologous/identical to a nucleotide sequence of an isolated nucleic acid encoding a functional human FKRP (preferably of sequence SEQ ID NO: 1), especially of sequence SEQ ID NO: 2. As previously mentioned, said polynucleotide does not comprise or does not consist of the sequence SEQ ID NO: 2.

(14) As known in the art, a coding sequence can contain frameshift start codon(s) in a sense or antisense direction, which can generate alternative or supplementary transcription products. As an example, the coding sequence may contain further ATG in case of sense start codons, or CAT in case of an antisense start codon. According to a specific embodiment, these start codons are frameshift, i.e. they generate alternative Open Reading Frames (ORF) which are not in phase/frame with the coding sequence of the human FKRP, but shifted by one nucleotide (“phase/frame+1”) or 2 nucleotides (“phase/frame+2”). In other words, the so-called “frameshift” start codon(s) are in one of the alternative frames of the FKRP coding sequence.

(15) In the specific case of SEQ ID NO: 2: The main ORF starts at position 1 with a ATG (nucleotides 1 to 3 of SEQ ID NO: 2) encoding a Methionine (M or Met); the corresponding ORF is composed of 1488 bases or nucleotides, encodes a 495 aa protein and ends by a stop codon TGA. Further ORFs in phase, i.e. in frame, start at positions 430 (nucleotides 430 to 432 of SEQ ID NO: 2) and 1279 (nucleotides 1279 to 1281 of SEQ ID NO: 2) with a ATG encoding a Methionine (M or Met). It is however not possible to change them since no other codon than ATG codes for a Methionine classically.

(16) In phase +1, there are 4 start codons able to generate supplementary transcripts: CAT at position 429 (nucleotides 429 to 431 of SEQ ID NO: 2), 819 (nucleotides 819 to 821 of SEQ ID NO: 2) and 1431 (nucleotides 1431 to 1433 of SEQ ID NO: 2) corresponding to ATG in the antisense direction; ATG at position 545 (nucleotides 545 to 547 of SEQ ID NO: 2), in the sense direction.

(17) There is no potential start codon (sense or antisense) in phase/frame+2.

(18) According to the invention, at least one base change is introduced in order to mutate the start codon but without changing the encoded amino acids.

(19) According to an embodiment, the polynucleotide has one start codon mutated, said start codon being located at position 429 (“429-431”), or 545 (“545-547”), or 819 (“819-821”), or 1431 (“1431-1433”) of sequence SEQ ID NO: 2.

(20) In a preferred embodiment, the polynucleotide has at least one start codon mutated, said start codon being located at position 819 (“819-821”) of sequence SEQ ID NO: 2.

(21) According to another embodiment, the polynucleotide has at least two (2) start codons mutated, said start codons being located at position 429 and 545, or 429 and 819, or 429 and 1431, or 545 and 819 or 545 and 1431, or 819 and 1431 of sequence SEQ ID NO: 2. Advantageously, the mutated start codons is located at positions 429 and 819, 545 and 819, or 819 and 1431 of sequence SEQ ID NO: 2.

(22) According to still another embodiment, the polynucleotide has at least three (3) start codons mutated, said start codons being located at position 429 and 545 and 819, or 429 and 545 and 1431, or 429 and 819 and 1431, or 545 and 819 and 1431 of sequence SEQ ID NO: 2, advantageously at position 429, 819 and 1431 of sequence SEQ ID NO: 2.

(23) More advantageously, the polynucleotide consists of or comprises the sequence SEQ ID NO: 4, or SEQ ID NO: 7, or SEQ ID NO: 8.

(24) According to still another embodiment, the polynucleotide has at least four (4) start codons mutated, said start codons being located at position 429 and 545 and 819 and 1431 of sequence SEQ ID NO: 2. Advantageously, the polynucleotide consists of or comprises the sequence SEQ ID NO: 3, or SEQ ID NO: 5, or SEQ ID NO: 6.

(25) The modification of the start codon can result from 1, 2 or 3 mutations in said codon. As already mentioned, said mutations should not change the encoded sequence.

(26) The suppression of the antisense start codon located at position 429 (“429-431”) can e.g. result from the change of the C base located at position 429 into G or A. As a consequence, the “CAT” (ATG in the antisense direction) is converted into “GAT” (ATC in the antisense direction) or “AAT” (ATT in the antisense direction), which does not correspond to a start codon in the antisense direction anymore but does not change the corresponding amino acid sequence.

(27) The suppression of the sense start codon located at position 545 (“545-547”) can e.g. result from the change of the T base located at position 546 into C. As a consequence, the “ATG” is converted into “ACG”, which does not correspond to a start codon in the sense direction anymore but does not change the corresponding amino acid sequence.

(28) The suppression of the antisense start codon located at position 819 (“819-821”) can e.g. result from the change of the C base located at position 819 into G or A. As a consequence, the “CAT” (ATG in the antisense direction) is converted into “GAT” (ATC in the antisense direction) or “AAT” (ATT in the antisense direction), which does not correspond to a start codon in the antisense direction anymore but does not change the corresponding amino acid sequence.

(29) The suppression of the antisense start codon located at position 1431 (“1431-1433”) can e.g. result from the change of the C base located at position 1431 into G. As a consequence, the “CAT” (ATG in the antisense direction) is converted into “GAT” (ATC in the antisense direction), which does not correspond to a start codon in the antisense direction anymore but does not change the corresponding amino acid sequence.

(30) The polynucleotide of the invention can be further optimized as follows:

(31) According to one embodiment, the GC content is modified, advantageously decreased. Preferably the GC content of the polynucleotide of the invention is reduced by less than 5% relative to the GC content of SEQ ID NO: 2 or by more than 10% relative to the GC content of SEQ ID NO: 2. While replacing the G and C bases by A or T, the amino acid sequence should be conserved and preferably no additional start codon is introduced.

(32) According to another embodiment, the CG motifs are replaced to avoid CpG islets formation preferably with the same precautions as disclosed above (the amino acid sequence is conserved and no additional start codon is introduced).

(33) According to another embodiment, the sequence is optimized based on transfer RNA frequencies in human, e.g. following the codon frequency table disclosed in Sharp et al. (1988), preferably with the same precautions as disclosed above.

(34) According to another embodiment, the polynucleotide of the invention may further have at least a mutation in the region 553-559 of SEQ ID NO: 2 (GCCCCCG), which corresponds to a stem-loop. Advantageously, the stem-loop structure is modified or even destroyed because of the mutation(s). As an example, the nucleotide C at position 558 of SEQ ID NO: 2 is converted into T.

(35) According to a specific embodiment, the polynucleotide of the invention consists of or comprises a sequence selected among SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, or a sequence being about 60% homologous/identical, more preferably about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 88%, 89% or about 90%, 91%, 92%, 93%, 94% homologous/identical, even more preferably, about 95% homologous/identical, and even more preferably about 96%, 97%, 98% or even 99% homologous/identical thereto.

(36) According to a preferred embodiment, said homologous sequence has the same start codons mutated.

(37) Accordingly and as an example, the present invention also relates to a sequence having 60% identity, more preferably about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 88%, 89% or about 90%, 91%, 92%, 93%, 94% identity, even more preferably, about 95% identity, and even more preferably about 96%, 97%, 98% or even 99% identity to SEQ ID NO: 4 and having 3 start codons mutated at position 429, 819 and 1431 of sequence SEQ ID NO: 2. According to a specific embodiment, said sequence is SEQ ID NO: 7 or SEQ ID NO: 8.

(38) According to another example, the present invention also relates to a sequence having 60% identity, more preferably about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 88%, 89% or about 90%, 91%, 92%, 93%, 94% identity, even more preferably, about 95% identity, and even more preferably about 96%, 97%, 98% or even 99% identity to SEQ ID NO: 6 and having 4 start codons mutated at position 429, 545, 819 and 1431 of sequence SEQ ID NO: 2. According to a specific embodiment, said sequence is SEQ ID NO: 5 or SEQ ID NO: 3.

(39) According to a specific embodiment, the isolated polynucleotide is inserted into a vector. In brief summary, the expression of natural or synthetic nucleic acids is typically achieved by operably linking a nucleic acid or portions thereof to a promoter, and incorporating the construct into an expression vector. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.

(40) In one embodiment, the vector is an expression vector, advantageously a viral vector.

(41) In one embodiment, the viral vector is selected from the group consisting of a baculoviral vector, herpes viral vector, lentiviral vector, retroviral vector, adenoviral vector, and adeno-associated viral (AAV) vector.

(42) According to a specific embodiment of the invention, the viral vector containing the polynucleotide is an adeno-associated viral (AAV) vector.

(43) Adeno-associated viral (AAV) vectors have become powerful gene delivery tools for the treatment of various disorders. AAV vectors possess a number of features that render them ideally suited for gene therapy, including a lack of pathogenicity, moderate immunogenicity, and the ability to transduce post-mitotic cells and tissues in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method.

(44) In one embodiment, the encoding sequence is contained within an AAV vector. More than 100 naturally occurring serotypes of AAV are known. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for dystrophic pathologies. AAV viruses may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus.

(45) As mentioned above, the use of AAV vectors is a common mode of exogenous delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the serotypes of AAVs isolated from human or non-human primates (NHP) and well characterized, human serotype 2 is the first AAV that was developed as a gene transfer vector. Other currently used AAV serotypes include AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, AAV11 and AAV12. In addition, non-natural engineered variants and chimeric AAV can also be useful.

(46) Desirable AAV fragments for assembly into vectors include the cap proteins, including the vp1, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells.

(47) Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Thus exemplary AAVs, or artificial AAVs, include AAV2/8 (U.S. Pat. No. 7,282,199), AAV2/5 (available from the National Institutes of Health), AAV2/9 (WO2005/033321), AAV2/6 (U.S. Pat. No. 6,156,303), and AAVrh10 (WO2003/042397), among others. In one embodiment, the vectors useful in the compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV serotype capsid, e.g., an AAV8 capsid, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV8 rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAV8 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV serotype, which differs from that which is providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 (U.S. Pat. No. 7,282,199).

(48) According to one embodiment, the composition comprises an AAV of serotype 2, 5, 8 or 9. Advantageously, the claimed vector is an AAV8 or AAV9 vector, especially an AAV2/8 or AAV2/9 vector. More advantageously, the claimed vector is an AAV9 vector or an AAV2/9 vector.

(49) In the AAV vectors used in the present invention, the AAV genome may be either a single stranded (ss) nucleic acid or a double stranded (ds)/self complementary (sc) nucleic acid molecule.

(50) Advantageously, the polynucleotide encoding the human FKRP is inserted between the ITR («Inverted Terminal Repeat») sequences of the AAV vector. Typical ITR sequences correspond to SEQ ID NO: 12 (5′ITR sequences) and SEQ ID NO: 16 (3′ITR sequences).

(51) Recombinant viral particles can be obtained by any method known to the one skilled in the art, e.g. by co-transfection of 293 HEK cells, by the herpes simplex virus system and by the baculovirus system. The vector titers are usually expressed as viral genomes per mL (vg/mL).

(52) In one embodiment, the vector comprises regulatory sequences, especially a promoter sequence. Such promoters can be natural or synthetic (artificial) promoters, inducible or constitutive.

(53) In one embodiment, the promoter is a ubiquitous promoter or having a low tissue-specificity. As an example, the expression vector can harbor the phosphoglycerate kinase 1 (PGK), EF1, β-actin, CMV promoter.

(54) In a preferred embodiment, the promoter sequence is chosen in order to adequately govern the expression of the nucleic acid sequence placed under its control, in terms of expression level, but also of tissue specificity. In one embodiment, the expression vector comprises a muscle specific promoter. Such a promoter allows a robust expression in the skeletal muscles, and possibly in the cardiac muscle (heart). Examples of suitable promoters known by the skilled person are e.g. the desmin promoter, the muscle creatine kinase (MCK) promoter, the CK6 promoter, the Syn promoter, the ACTA1 promoter or the synthetic promoter C5-12 (spC5-12). Of particular interest is the human desmin promoter as shown in sequence SEQ ID NO: 13.

(55) The FKRP promoter can also be used.

(56) A non-exhaustive list of other possible regulatory sequences is: sequences for transcript stabilization, e.g. intron 1 of hemoglobin (HBB2). As shown in sequence SEQ ID NO: 14, said HBB2 intron is advantageously followed by consensus Kozak sequence included before AUG start codon within mRNA, to improve initiation of translation;

(57) a polyadenylation signal, e.g. the polyA of the gene of interest, the polyA of SV40 or of beta hemoglobin (HBB2), advantageously in 3′ of the sequence encoding the human FKRP. As a preferred example, the poly A of HBB2 is disclosed in sequence SEQ ID NO: 15;

(58) enhancer sequences;

(59) miRNA target sequences, which can inhibit the expression of the sequence encoding the human FKRP in non target tissues, in which said expression is not desired, for example where it can be toxic. Preferably, the corresponding miRNA is not present in the skeletal muscles, and possibly not in the heart.

(60) Typically, a vector according to the invention comprises:

(61) 5′ITR sequences (SEQ ID NO: 12) corresponding to nucleotides 494 to 638 of SEQ ID NO: 10 or 11; followed by

(62) the human desmin promoter (SEQ ID NO: 13) corresponding to nucleotides 639 to 1699 of SEQ ID NO: 10 or 11; followed by

(63) the HBB2 intron followed by consensus Kozak sequence (SEQ ID NO: 14) corresponding to nucleotides 1700 to 2151 of SEQ ID NO: 10 or 11; followed by

(64) the polynucleotide encoding the human FKRP, e.g. SEQ ID NO: 3 or 4 or 5 or 6 or 7 or 8, corresponding to nucleotides 2152 to 3639 of SEQ ID NO: 10 or 11 in case of SEQ ID NO: 3 and 4; followed by

(65) the HBB2 polyA sequence (SEQ ID NO: 15) corresponding to nucleotides 3640 to 4405 of SEQ ID NO: 10 or 11; followed by

(66) 3′ITR sequences (SEQ ID NO: 16) corresponding to nucleotides 4406 to 4550 of SEQ ID NO: 10 or 11.

(67) In relation to a polynucleotide having the sequence SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 6, a vector of the invention comprises the sequences shown in SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 21 respectively.

(68) According to one embodiment, the invention relates to a vector, advantageously an expression vector, more advantageously an AAV vector harboring the sequence SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 21. As mentioned above, the invention also encompasses homologous sequences, that is, displaying about 60% homology, more preferably about 70% homology, even more preferably about 80% homology, more preferably about 90% homology, even more preferably about 95% homology, and even more preferably about 97%, 98% or even 99% homology to the sequence SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 21.

(69) Further aspects of the invention concern:

(70) A cell comprising the polynucleotide of the invention or a vector comprising said polynucleotide, as disclosed above.

(71) The cell can be any type of cells, i.e. prokaryotic or eukaryotic. The cell can be used for propagation of the vector or can be further introduced (e.g. grafted) in a host or a subject. The polynucleotide or vector can be introduced in the cell by any means known in the art, e.g. by transformation, electroporation or transfection. Vesicles derived from cells can also be used.

(72) A transgenic animal, advantageously non-human, comprising the polynucleotide of the invention, a vector comprising said polynucleotide, or a cells comprising said polynucleotide or said vector, as disclosed above.

(73) Another aspect of the invention relates to a composition comprising a polynucleotide, a vector or a cell, as disclosed above, for use as a medicament.

(74) According to an embodiment, the composition comprises at least said gene therapy product (the polynucleotide, the vector or the cell), and possibly other active molecules (other gene therapy products, chemical molecules, peptides, proteins . . . ), dedicated to the treatment of the same disease or another disease.

(75) The present invention then provides pharmaceutical compositions comprising a polynucleotide, a vector or a cell of the invention. Such compositions comprise a therapeutically effective amount of the therapeutic (the polynucleotide or vector or cell of the invention), and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.

(76) The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, sustained-release formulations and the like. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.

(77) In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to release pain at the site of the injection.

(78) In one embodiment, the composition according to the invention is suitable for administration in humans. The composition is preferably in a liquid form, advantageously a saline composition, more advantageously a phosphate buffered saline (PBS) composition or a Ringer-Lactate solution.

(79) The amount of the therapeutic (i.e. a nucleic acid or a vector or a cell) of the invention which will be effective in the treatment of the target diseases can be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, the weight and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances.

(80) Suitable administration should allow the delivery of a therapeutically effective amount of the gene therapy product to the target tissues, especially skeletal muscles and possibly heart. In the context of the invention, when the gene therapy product is a viral vector comprising a polynucleotide encoding a human FKRP, the therapeutic dose is defined as the quantity of viral particles (vg for viral genomes) containing the FKRP sequence, administered per kilogram (kg) of the subject.

(81) Available routes of administration are topical (local), enteral (system-wide effect, but delivered through the gastrointestinal (GI) tract), or parenteral (systemic action, but delivered by routes other than the GI tract). The preferred route of administration of the compositions disclosed herein is parenteral which includes intramuscular administration (i.e. into the muscle) and systemic administration (i.e. into the circulating system). In this context, the term “injection” (or “perfusion” or “infusion”) encompasses intravascular, in particular intravenous (IV), intramuscular (IM), intraocular or intracerebral administration. Injections are usually performed using syringes or catheters.

(82) In one embodiment, systemic delivery of the composition comprises administering the composition near a local treatment site, i.e. in a vein or artery nearby a weakened muscle. In certain embodiments, the invention comprises the local delivery of the composition, which produces systemic effects. This route of administration, usually called “regional (loco-regional) infusion”, “administration by isolated limb perfusion” or “high-pressure transvenous limb perfusion” has been successfully used as a gene delivery method in muscular dystrophy (Fan et al., 2012).

(83) According to one aspect, the composition is administered to an isolated limb (loco-regional) by infusion or perfusion. In other words, the invention comprises the regional delivery of the composition in a leg and/or arm by an intravascular route of administration, i.e. a vein (transveneous) or an artery, under pressure. This is usually achieved by using a tourniquet to temporarily arrest blood circulation while allowing a regional diffusion of the infused product, as e.g. disclosed by Toromanoff et al. (2008).

(84) In one embodiment, the composition is injected in a limb of the subject. When the subject is a human, the limb can be the arm or the leg. According to one embodiment, the composition is administered in the lower part of the body of the subject, e.g. below the knee, or in the upper part of the body of the subject, e.g., below the elbow.

(85) In one embodiment, the composition is administered to a peripheral vein, e.g. the cephalic vein. The volume of the composition to be infused can be in a range that varies between about 5 and 40% of the limb volume. The typical dose can vary between 5 and 30 ml/kg of body weight. In one embodiment, the pressure to be applied (tourniquet pressure or maximum line pressure) is below 100 000 Pa, advantageously below 50 000 Pa. In a preferred embodiment, the pressure applied is around 300 torr (40 000 Pa).

(86) In one embodiment, the blood circulation of the limb is stopped using a tourniquet that is tightened for several minutes to more than one hour, typically between about 1 and 80 minutes, for example about 30 minutes. In a preferred embodiment, the tourniquet was applied before, during and after the administration, for example about 10 minutes prior to, about 20 minutes during and about 15 min after the infusion. More generally, the pressure is applied for several minutes, typically between about 1 and 80 minutes, for example about 30 minutes. In a preferred embodiment, the pressure is applied before, during and after the administration, for example about 10 minutes prior to, about 20 minutes during and about 15 minutes after the infusion.

(87) In one embodiment, the average flow rate is comprised between 5 and 150 ml/min, advantageously between 5 and 80 ml/min, for example 10 ml/min. Of course, the flow rate also determines the time period during which the blood circulation is stopped and the pressure applied.

(88) In the context of a loco-regional administration, the dose injected may vary between 10.sup.12 and 10.sup.14 vg/kg of the patient body, preferably between 10.sup.12 and 10.sup.13 vg/kg.

(89) A preferred method of administration according to the invention is systemic administration. Systemic injection opens the way to an injection of the whole body, in order to reach the entire muscles of the body of the subject including the heart and the diaphragm and then a real treatment of these systemic and still incurable diseases. In certain embodiments, systemic delivery comprises delivery of the composition to the subject such that composition is accessible throughout the body of the subject.

(90) According to a preferred embodiment, systemic administration occurs via injection of the composition in a blood vessel, i.e. intravascular (intravenous or intra-arterial) administration. According to one embodiment, the composition is administered by intravenous injection, through a peripheral vein.

(91) The systemic administration is typically performed in the following conditions: a flow rate of between 1 to 10 mL/min, advantageously between 1 to 5 mL/min, e.g. 3 mL/min; the total injected volume can vary between 1 and 20 mL, preferably 5 mL of vector preparation per kg of the subject. The injected volume should not represent more than 10% of total blood volume, preferably around 6%.

(92) When systemically delivered, the composition is preferably administered with a dose less than or equal to 10.sup.15 vg/kg or even 10.sup.14 vg/kg, advantageously between 10.sup.12 vg/kg and 10.sup.14 vg/kg, more advantageously between 5.Math.10.sup.12 vg/kg and 10.sup.14 vg/kg, e.g. 1, 2, 3, 4, 5, 6, 7, 8 or 9.Math.10.sup.13 vg/kg. A lower dose of e.g. 1, 2, 3, 4, 5, 6, 7, 8 or 9.Math.10.sup.12 vg/kg can also be contemplated in order to avoid potential toxicity and/or immune reactions. As known by the skilled person, a dose as low as possible giving a satisfying result in term of efficiency is preferred.

(93) In a specific embodiment, the treatment comprises a single administration of the composition.

(94) “Dystroglycanopathy” means a disease or pathology linked to an aberrant glycosylation of α-dystroglycan (αDG). This defect can be due to a FKRP defect. According to a specific embodiment, the pathology is selected in the group consisting of: Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) and Muscle-Eye-Brain disease (MEB), advantageously LGMD2I.

(95) Subjects that could benefit from the compositions of the invention include all patients diagnosed with such a disease or at risk of developing such a disease. A subject to be treated can then be selected based on the identification of mutations or deletions in the FKRP gene by any method known to the one skilled in the art, including for example sequencing of the FKRP gene, and/or through the evaluation of the FKRP level of expression or activity by any method known to the one skilled in the art. Therefore, said subjects include both subjects already exhibiting symptoms of such a disease and subjects at risk of developing said disease. In one embodiment, said subjects include subjects already exhibiting symptoms of such a disease. In another embodiment, said subjects are ambulatory patients and early non-ambulant patients.

(96) Such compositions are notably intended for gene therapy, particularly for the treatment of Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) and Muscle-Eye-Brain disease (MEB), advantageously LGMD2I.

(97) According to one embodiment, the present invention concerns a method of treatment of a dystroglycanopathy comprising administering to a subject the gene therapy product (polynucleotide, vector or cell), as disclosed above.

(98) Advantageously, the dystroglycanopathy is a pathology linked to an aberrant glycosylation of α-dystroglycan (αDG) and/or a FKRP deficiency. More advantageously, the pathology is Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) or Muscle-Eye-Brain disease (MEB).

(99) In an additional aspect, the invention provides a method of increasing glycosylation of α-dystroglycan (αDG) in a cell comprising delivering to said cell the polynucleotide or the vector of the invention, wherein the synthetic polynucleotide is expressed in said cell, thereby producing FKRP and increasing glycosylation of αDG.

(100) The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, fourth edition (Sambrook, 2012); “Oligonucleotide Synthesis” (Gait, 1984); “Culture of Animal Cells” (Freshney, 2010); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1997); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Short Protocols in Molecular Biology” (Ausubel, 2002); “Polymerase Chain Reaction: Principles, Applications and Troubleshooting”, (Babar, 2011); “Current Protocols in Immunology” (Coligan, 2002).

(101) These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention.

(102) Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

(103) The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.

(104) Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods.

EXAMPLES

(105) The invention is further described in detail by reference to the following experimental examples and the attached figures. These examples are provided for purposes of illustration only, and are not intended to be limiting.

(106) Materials and Methods

(107) Design of the novel human FKRP sequences:

(108) The human FKRP coding sequence SEQ ID NO: 2 has been modified according to the following rules:

(109) introduction of mutations suppressing the sense and antisense frameshift ATG present in the coding region, at positions 429 (antisense; phase+1), 546 (sense; phase+1), 819 (antisense; phase+1) and/or 1431 (antisense; phase+1);

(110) possibly following the codon frequency table as e.g. disclosed in Sharp et al. (1988);

(111) without generation of new Open-Reading-Frame (ORF);

(112) possibly replacing CG motives to avoid CpG islets formation;

(113) possibly decreasing GC %;

(114) possibly modifying the stem-loop present at position 553-559 of SEQ ID NO: 2.

(115) All the resulting designed sequences (SEQ ID NO: 3 to 8 shown in Table 1 below) encode a FKRP protein having sequence SEQ ID NO: 1, corresponding to the human native FKRP sequence.

(116) Plasmids and AAV vectors:

(117) The coding sequence of the human Fkrp gene (SEQ ID NO: 2) was synthesized using classical gene synthesis service methodology, and inserted into a plasmid (pUC57) containing AAV2 ITRs, the human desmin promoter, the HBB2 intron followed by Kozak sequence, and the HBB2 polyA (Hemoglobin subunit (32 polyadenylation signal).

(118) The resulting plasmid, shown in FIG. 1, panel A, is called pAAV-hDesmin-hFKRPwt. The sequence of the insert including the ITR sequences is shown in SEQ ID NO: 9.

(119) Plasmids pAAV-hDesmin-hFKRP-OPTmin (FIG. 1, panel B) and pAAV-hDesmin-hFKRP-OPTcomp (FIG. 1, panel C), whose insert sequence is shown in SEQ ID NO: 10 and 11 respectively, have been obtained by replacing the coding sequence of the native human FKRP protein (SEQ ID NO: 2) by the modified sequences SEQ ID NO: 3 and 4, respectively. The other plasmids FKRP-06, FKRP-OPT-07, FKRP-OPT-08, FKRP-OPT-10 and FKRP-OPT-11 have been obtained in a similar way by replacing SEQ ID NO: 2 by sequence SEQ ID NO: 20, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

(120) Adenovirus free rAAV2/9 viral preparations were generated by packaging AAV2-ITR recombinant genomes in AAV9 capsids, using a three plasmids transfection protocol as previously described (Bartoli et al., 2006). Briefly, HEK293 cells were cotransfected with pAAV-hDesmin-hFKRPwt (or pAAV-hDesmin-hFKRP-OPTmin or pAAV-hDesmin-hFKRP-OPTcomp), a RepCap plasmid (pAAV2.9, Dr J. Wilson, UPenn) and an adenoviral helper plasmid (pXX6; Apparailly et al., 2005) at a ratio of 1:1:2. Crude viral lysate was harvested at 60 hr post-transfection and lysed by freeze-and-thaw cycles. The viral lysate was purified through two rounds of CsCl ultracentrifugation followed by dialysis. Viral genomes were quantified by a TaqMan real-time PCR assay using primers and probes corresponding to the HBB2 polyA of the AAV vector genome. The primer pairs and TaqMan probes used for amplification were:

(121) Forward: CCAGGCGAGGAGAAACCA (SEQ ID NO: 17)

(122) Reverse: CTTGACTCCACTCAGTTCTCTTGCT (SEQ ID NO: 18); and

(123) Probe: CTCGCCGTAAAACATGGAAGGAACACTTC (SEQ ID NO: 19).

(124) Western-Blotting

(125) Cell pellets and muscle tissues were mechanically homogenized in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, Mass., USA), complemented with Complete protease inhibitor cocktail EDTA-free (Roche, Bale, Switzerland). Nucleic acids contained in the samples were degradated by incubation 15 minutes at 37° C. with benzonase (Sigma, St. Louis, Mo., USA).

(126) Proteins were separated using precast polyacrylamide gel (4-15%, BioRad, Hercules, Calif., USA) and then transferred to nitrocellulose membrane.

(127) Rabbit polyclonal antibody against FKRP has been previously described (Gicquel et al., 2017). Nitrocellulose membranes were probed with antibodies against FKRP (1:100) and GAPDH (Santa Cruz Biotechnologies, Dallas, Tex., USA, 1:200) for normalization, for 2 hours at room temperature.

(128) Finally, membranes were incubated with IRDye® for detection by the Odyssey infrared-scanner (LI-COR Biosciences, Lincoln, Nebr., USA).

(129) Animals and Injections

(130) One month-old mice were used. All animals of this study were handled according to the European guidelines for the human care and use of experimental animals, and all procedures on animals were approved by Genopole's ethics committee.

(131) For the evaluation of gene transfer efficiency, male C57BI6 mice were injected intramuscularly into the TA (Tibialis Anterior) muscle with a volume of 25 μL, at two different doses: 3 E9 vg/TA and 1.5 E10 vg/TA. As a negative control, mice were injected with the buffer used for the AAV formulation, i.e. PBS. Mice were euthanized after 1 month and the injected muscles were dissected out and frozen in isopentane cooled in liquid nitrogen.

(132) For in vivo functional tests, AAV9-FKRP containing FKRP-OPTcomp sequence (SEQ ID NO: 4) was administrated by intravenous injection to HSA-FKRPdel mice, a FKRP-deficient mouse model, at 2 doses: 2.5 E12 vg/kg and 1 E13 vg/kg. After 3 months, the animals were submitted to different functional tests.

(133) In Vivo Evaluation

(134) Escape Test:

(135) The global strength of mice is evaluated by the escape test (Carlson and Makiejus, 1990). Briefly, mice are placed on a platform facing the entrance of a 30 cm-long tube. A cuff wrapped around the tail is connected to a fixed force transducer and the mice are induced to escape within the tube in the direction opposite from the force transducer by a gentle pinching of the tail. A short peak of force is induced by this flight forward and the average of the five highest force peaks normalized by body weight are analyzed. Material used: Force transducer ADInstrument MLT1030 serial 810. Software ADinstrument Labchart7.
Force of TA In Situ:

(136) Skeletal muscle function is evaluated by the measure of muscle contraction in situ, as previously described (Vignaud et al., 2005). Animals are anesthetized by intra-peritoneal injection of Ketamine (100 mg/kg) and Xylazine (10 mg/kg) and supplemental doses are administered as required to maintain deep anaesthesia. The knee and foot are fixed with clamps and stainless steel pins. The TA muscle is exposed and the distal tendon is cut and attached to a force transducer (Aurora Scientific, Dublin, Ireland). The sciatic nerves are proximally crushed and distally stimulated by a bipolar silver electrode using supra-maximal square wave pulses of 0.1 ms duration. Absolute maximal forces are determined at optimal length (length at which maximal tetanic tension is observed). The specific maximal force is calculated by normalizing the total muscle force with the muscle mass.

(137) Material used: Apparatus Aurora Scientific. Sensor 305C 5N Cambridge Technology Model 6650 no X11271243Y. Software ASI 610A Dynamic muscle Control.
Centronucleation Index:

(138) Injected mice were sacrificed soon after the functional tests. Skeletal muscles were sampled and frozen in cooled isopentane. Transverse cryosections were stained with Hematoxylin-Phloxine-Saffron (HPS) and were used for centronucleated fibers numeration. The number of centronucleated fibers was reported to the slice area to obtain the centronucleation index.

(139) Results:

(140) I/ Design of Novel Human FKRP Sequences:

(141) In order to evaluate the impact of modifications in the FKRP coding sequence, a series of sequences encoding the human FKRP protein of sequence SEQ ID NO: 1, derived from the sequence SEQ ID NO: 2, have been designed and synthetized. The main features of said sequences are summarized in Table 1:

(142) TABLE-US-00001 TABLE 1 Characteristics of the modified sequences encoding the human FKRP protein Base at Stem-loop at Name Sequence position position 553-559 FKRP wt SEQ ID NO: 2 429: C Preserved 546: T 819: C 1431: C FKRP-OPTmin SEQ ID NO: 3 429: G Preserved 546: C 819: A 1431: G FKRP-OPTcomp SEQ ID NO: 4 429: G Modified 546: T 819: G 1431: G FKRP-OPT-07 SEQ ID NO: 5 429: G Preserved 546: C 819: A 1431: G FKRP-OPT-08 SEQ ID NO: 6 429: G Preserved 546: C 819: A 1431: G FKRP-OPT-10 SEQ ID NO: 7 429: G Modified 546: T 819: G 1431: G FKRP-OPT-11 SEQ ID NO: 8 429: A Modified 546: T 819: G 1431: G FKRP-06 SEQ ID NO: 20 429: A Modified (WO2016/138387) 546: C 819: C 1431: G
II/ Evaluation of the Constructs In Vivo:

(143) FIG. 2A shows the results obtained by western-blot on FKRP expression after gene transfer. The FKRP protein expressed from the different constructs (wt and optimized) has the expected size (58 kDa). Moreover, the modified FKRP transgenes allow a higher expression of the FKRP protein in comparison with the wild type sequence. The intensity of the obtained bands was quantified and normalized by the GAPDH normalizer. The quantification indicates a 5 fold increase for hFKRP-OPTcomp compared to FKRP wt (FIG. 2B).

(144) The same experiments were repeated with the different FKRP sequences shown in table 1, including the sequence disclosed in WO2016/138387 (SEQ ID NO: 1 in said document; SEQ ID NO: 20 in the present application). As illustrated in FIG. 2C, the sequence disclosed in WO2016/138387 (noted FKRP-06) does not allow reaching the level of transgene expression observed with the constructs according to the invention. Among the newly tested sequences, FKRP-08 is the best candidate but they generally lead to a level of transgene expression higher than the native sequence.

(145) III/ Functional Evaluation of the Constructs:

(146) The best candidate, i.e. FKRP-OPTcomp (SEQ ID NO: 4), has been tested for its in vivo efficiency in a FKRP-deficient mouse model.

(147) The data of FIG. 3A reveal a reduction of centronucleation in treated animals. Moreover, the in situ measurement of the force of the tibialis anterior (TA) muscle (FIG. 3B) and of the global strength evaluated by the escape test (FIG. 3C) reveal an improvement of the muscle function in treated animals.

(148) Conclusions:

(149) C/ Results of an Escape Test.

(150) The present study shows that sequence optimization of the human FKRP transgene allows an improved level of FKRP expression after intramuscular injection of AAV vectors harboring said transgenes in mice. This increase is of therapeutic and clinical interest since it ameliorates the efficacy of the treatment and/or allows decreasing the injected doses of the therapeutic product.

REFERENCES

(151) Apparailly, F., Khoury, M., Vervoordeldonk, M. J., Adriaansen, J., Gicquel, E., Perez, N., Riviere, C., Louis-Plence, P., Noel, D., Danos, O. et al. (2005) Adeno-associated virus pseudotype 5 vector improves gene transfer in arthritic joints. Hum. Gene Ther., 16, 426-434. Bartoli, M., Poupiot, J., Goyenvalle, A., Perez, N., Garcia, L., Danos, 0. and Richard, I. (2006) Noninvasive monitoring of therapeutic gene transfer in animal models of muscular dystrophies. Gene Ther., 13, 20-28. Beedle, A. M., Turner, A. J., Saito, Y., Lueck, J. D., Foltz, S. J., Fortunato, M. J., Nienaber, P. M. and Campbell, K. P. (2012) Mouse fukutin deletion impairs dystroglycan processing and recapitulates muscular dystrophy. J. Clin. Invest., 122, 3330-3342. Beltran-Valero de Bernabe, D., Voit, T., Longman, C., Steinbrecher, A., Straub, V., Yuva, Y., Herrmann, R., Sperner, J., Korenke, C., Diesen, C. et al. (2004) Mutations in the FKRP gene can cause muscle-eye-brain disease and Walker-Warburg syndrome. J. Med. Genet., 41, e61. Breton, C. and Imberty, A. (1999) Structure/function studies of glycosyltransferases. Curr. Opin. Struct. Biol., 9, 563-571. Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E. et al. (2001) Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan. Am. J. Hum. Genet., 69, 1198-1209. Gicquel et al. (2017) Hum Mol Genet, doi: 10.1093/hmg/ddx066. Kanagawa, M., Kobayashi, K., Tajiri, M., Manya, H., Kuga, A., Yamaguchi, Y., Akasaka-Manya, K., Furukawa, J. I., Mizuno, M., Kawakami, H. et al. (2016) Identification of a Post-translational Modification with Ribitol-Phosphate and Its Defect in Muscular Dystrophy. Cell reports, in press. Mercuri, E., Brockington, M., Straub, V., Quijano-Roy, S., Yuva, Y., Herrmann, R., Brown, S. C., Torelli, S., Dubowitz, V., Blake, D. J. et al. (2003) Phenotypic spectrum associated with mutations in the fukutin-related protein gene. Ann. Neurol., 53, 537-542. Muller, T., Krasnianski, M., Witthaut, R., Deschauer, M. and Zierz, S. (2005) Dilated cardiomyopathy may be an early sign of the C826A Fukutin-related protein mutation. Neuromuscul. Disord., 15, 372-376. Rohr, U. P., Wulf, M. A., Stahn, S., Steidl, U., Haas, R. and Kronenwett, R. (2002) Fast and reliable titration of recombinant adeno-associated virus type-2 using quantitative real-time PCR. J. Virol. Methods, 106, 81-88. Sharp, P. M., Cowe E., Higgins D. G., Shields D. C, Wolfe K. H, Wright F (1988) Codon usage patterns in Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens; a review of the considerable within-species diversity. Nucleic Acids Res., 16(17):8207-11. Sveen, M. L., Schwartz, M. and Vissing, J. (2006) High prevalence and phenotype-genotype correlations of limb girdle muscular dystrophy type 2I in Denmark. Ann. Neurol., 59, 808-815. Toromanoff et al. (2008), Molecular Therapy 16(7):1291-99. Wahbi, K., Meune, C., Hamouda el, H., Stojkovic, T., Laforet, P., Becane, H. M., Eymard, B. and Duboc, D. (2008) Cardiac assessment of limb-girdle muscular dystrophy 21 patients: an echography, Holter ECG and magnetic resonance imaging study. Neuromuscul. Disord., 18, 650-655. Zheng Fan et al. (2012), Molecular Therapy 20(2), 456-461.