Read through of truncated proteins in premature termination codon diseases using an optimized genetic codon expansion system

11597931 · 2023-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a method for high-efficiently reading through a nonsense mutation site in a pathogenic gene in a monogenic hereditary disease and restoring the normal structure and function of a mutant protein, by using a genetic code expanded non-natural amino acid system. By modifying a tRNA of Methanosarcina barkeri (tRNAPyl), an all-new UAA and UGA encoded non-natural amino acid system that has high read-through efficiency is obtained, and the range of using the orthogonal pair of tRNAPyl and pyrrolysyl-tRNA synthetase (PylRS) is expanded. A plasmid mimicking the endogenous premature termination codon is constructed, so as to evaluate the efficiency of reading through the endogenous premature termination codon. Also provided is a system mainly comprising pathogenic genes of monogenic hereditary diseases and tumor inhibitory genes in tumor cells.

Claims

1. A method of expressing a full length dystrophin protein in a cell of a muscular dystrophy patient, the cell of the patient comprising a Duchenne muscular dystrophy (DMD) gene that is mutated by the presence of a premature UAA or UGA stop codon, the method comprising introducing into the cell a non-natural amino acid system consisting of a tRNA consisting of SEQ ID NO: 1 or 2, a pyrrolysyl-tRNA synthetase (PylRS) and a non-natural amino acid, wherein the non-natural amino acid is ##STR00024##

2. The method of claim 1, wherein the non-natural amino acid is incorporated into the dystrophin protein at position N, and is linked to the protein in the following manner: ##STR00025## wherein the direction from R.sub.1 to R.sub.2 is the direction of the amino acid sequence from N-terminus to C-terminus, and position N may be an amino acid at any position of the protein, and correspondingly, R.sub.1 is an amino acid residue from position 1 to position N−1, R.sub.2 is an amino acid residue from position N+1 to the C-terminus, and R3 is ##STR00026##

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. tRNAPylCUA/PylRS, tRNA.sup.Pyl.sub.UUA/PylRS and tRNA.sup.Pyl.sub.UCA/PylRS read through GFP green fluorescent protein TAG, TAA and TGA stop codons respectively.

(2) FIG. 2A. Establishment of the screening method for the stable cell line HEK293-PYL of orthogonal tRNA/aminoacyl tRNAsynthetase.

(3) FIG. 2B. Construction of the double virus overexpression system.

(4) FIG. 2C. Construction of the pXH-12t-zeo vector.

(5) FIG. 3. Western blot confirms that in the stable cell line HEK293-PYL, the expression of the protein is restored by reading through the premature termination codons on the disease protein dystrophin.

(6) FIG. 4. Read-through of the endogenous premature termination codons in the stable cell line HEK293-PYL.

(7) FIG. 5. Genetic codon expansion technology reads through the premature termination codons in A549 and DU145 tumor cell lines to restore the expression of STK11 and EPHB2 proteins.

(8) What have been described above are only some embodiments of the invention. It will be apparent to those skilled in the art that various variations and modifications can be made without departing from the spirit and scope of the invention, which all fall into the protection scope of the present invention.

(9) In order to better understand the present invention, the inventors have described and illustrated the specific experiments by the Examples, which are intended to illustrate and not to limit the scope of the present invention. Any variations or embodiments equivalent to the invention are included in the invention.

Example 1: Construction of PCMV-UUA (tRNA.SUP.PYL..SUB.UUA./PylRS) AND PCMV-UCA (tRNA.SUP.PYL..SUB.UCA./PylRS) Plasmids

(10) (1) Preparation of Methanosarcina barkeri PCMV-CUA Plasmid (tRNAPylCUA/PylRS)

(11) Plasmid pACYC-tRNA/PylRS (hereinafter referred to as PCMV-CUA) was obtained from Escherichia coli pACYC-tRNA/PylRS comprising pACYC-tRNA/PylRS, which was deposited on Jun. 14, 2011 under accession number CGMCC No: 4951 with the classification name Escherichia coli, which was obtained from the depository, China General Microbiological Culture Collection Center, Institute of Microbiology Chinese Academy of Sciences NO. 1 West Beichen Road, Chaoyang District, Beijing. The plasmid can express the tRNA synthetase (PylRS) which specifically recognizes the non-natural amino acids Lys-diazirine and Lys-azido and the tRNA which specifically recognizes the amber stop codon UAG (tRNAPylCUA).

(12) (2) Construction of PCMV-UUA (tRNA.sup.Pyl.sub.UUA/PylRS) and PCMV-UCA (tRNA.sup.Pyl.sub.UCA/PylRS) plasmids by point mutation tRNAPylCUA

(13) The inventors designed mutant primers for the anticodon loop of the mutant tRNAPylCUA. The specific primers are shown below.

(14) TABLE-US-00002 TABLE 1 POINT MUTATION PRIMERS FOR THE ANTICODON LOOP OF TRNAPYLCUA PCMV-UAG-UAA-for TGTAGATCGAATGGACTTTAAATCCGTTCAGC SEQ ID NO: CGG 17 PCMV-UAG-UAA-rev CCGGCTGAACGGATTTAAAGTCCATTCGATCT SEQ ID NO: ACA 18 PCMV-UAG-UGA-for CATGTAGATCGAATGGACTTCAAATCCGTTCA SEQ ID NO: GCCGGGTT 19 PCMV-UAG-UGA- AACCCGGCTGAACGGATTTGAAGTCCATTCGA SEQ ID NO: rev TCTACATG 20

(15) Plasmids PCMV-UUA (tRNA.sup.Pyl.sub.UUA/PylRS) and PCMV-UCA (tRNA.sup.Pyl.sub.UCA/PylRS) were obtained by using PCMV-CUA as the template plasmid, point mutating the base CUA on the anticodon loop of tRNAPylCUA to UUA and UCA with the above primers using the site-directed mutagenesis kit (QuikChange® Lightning Site-Directed Mutagenesis Kits, Catalog #210518) according to the instructions. The mutation was verified to be successful by sequencing. The sequence of tRNA.sup.Pyl.sub.UUA is represented by SEQ ID NO: 1; the sequence of tRNA.sup.Pyl.sub.UCA is represented by SEQ ID NO: 2.

Example 2: Detection of Read-Through Efficiency of Three TRNAPYLCUA/UUA/UCA/PylRS Orthogonal Systems Using GFP Green Fluorescent Protein Comprising Premature Termination Codons

(16) (1) Synthesis and Identification of the Non-Natural Amino Acid Lys-Diazirine

(17) The chemical synthesis reaction scheme of the non-natural amino acid Lys-diazirine was as follows:

(18) ##STR00019##

(19) As shown in the above scheme, 15 mL of the starting material 1 (5-hydroxy-2-pentanone) and 40 mL of liquid ammonia were stirred and reacted at −40° C. for 5 h. Then the temperature was lowered to −60° C. The solution of NH2OSO3H in methanol was slowly added dropwise. The mixture was allowed to warm to room temperature and allowed to react overnight. The precipitate was filtered off, and triethylamine was added to the supernatant. 12 was slowly added under ice bath until the color of the reaction solution became dark, and no bubbles were generated. After the reaction was completed, the solvent was evaporated, and the mixture was extracted with diethyl ether and dried. Ether was distilled off, and the remaining liquid was evaporated under reduced pressure to give 25.4 g of colorless viscous liquid product 2.

(20) The above product 2 was dissolved in pyridine. 11 g of TsCl was added with stirring at 0° C. to react overnight. After the reaction was completed, the reaction mixture was poured into a mixture of concentrated hydrochloric acid and ice water, and extracted with ethyl ether. The ether layer was washed with 1N hydrochloric acid and 1N NaOH. The organic phase was dried to give 11.8 g of a colorless viscous liquid product 3.

(21) The above product 3 was dissolved in DMF, and NaN3 was added to react at room temperature overnight until the reaction was completed. A lot of water was added, and the mixture was extracted with ethyl ether. Ethyl ether was distilled off, and the remaining product was mixed with THF:water (9:1). Triphenylphosphine was added and reacted at room temperature. After the completion of the reaction, 1N HCl was added and the mixture was stirred, and THF was spin dried. The unreacted starting materials, PPh3 and O═PPh3 were washed away with methylene chloride, and the mixture was adjusted to pH 12 with 1N NaOH. 4.0 g of product 4 was obtained after extracted with dichloromethane.

(22) 5.2 g of the starting material 5 (Boc-Lys-OMe) was reacted with carbonyldiimidazole to prepare 5.9 g of compound 6. Compound 6 was then coupled with the above product 4 (4.0 g) to give compound 7, which was finally deprotected in two steps to remove Boc and methyl ester to give desired 4.5 g product 8, Lys-diazirine. The result verified by spectrometry was:

(23) 1H NMR (400 MHz, D2O): δ 3.10 (1H, t, J=6.3 Hz), 2.96 (4H, m), 1.25 (10H, m), 0.90 (3H, s); 13C NMR (100 MHz, D2O): 183.63, 160.66, 56.00, 39.80, 39.30, 34.49, 30.84, 29.20, 26.75, 23.92, 22.43, 18.80; HREIMS m/z 308.16937 [M+1]+(calcd for C12H22N5NaO3, 308.16931). It proved that the obtained Lys-diazirine structure was correct.

(24) (2) Construction of a GFP Reporter Gene Containing Premature Termination Codons

(25) Green fluorescent protein GFP is the most commonly used reporter gene and a powerful tool for indicating the insertion of non-natural amino acids. It consists of 238 amino acids and its gene sequence is represented by SEQ ID NO: 7.

(26) The GFP sequence was inserted into the pcDNA3.1 commercial plasmid, and the amino acid codon at position 39 of the GFP fluorescent gene was mutated to three premature termination codons UAG, UAA and UGA respectively. Primers capable of mutating the codon encoding the amino acid into three stop codons respectively were designed, and the specific primers are shown in the following table.

(27) TABLE-US-00003 TABLE 2 LIST OF GFP MUTATION PRIMERS GFP-39-UAG-for GGCGAGGGCGATGCCACCTAGGGCAAGC SEQ ID NO: 21 TGACCCTGAAGTTC GFP-39-UAG-for GAACTTCAGGGTCAGCTTGCCCTAGGTGG SEQ ID NO: 22 CATCGCCCTCGCC GFP-39-UAA-for GGCGAGGGCGATGCCACCTAAGGCAAGC SEQ ID NO: 23 TGACCCTGAAGTTC GFP-39-UAA-for GAACTTCAGGGTCAGCTTGCCTTAGGTGG SEQ ID NO: 24 CATCGCCCTCGCC GFP-39-UAG-for GGCGAGGGCGATGCCACCTGAGGCAAGC SEQ ID NO: 25 TGACCCTGAAGTTC GFP-39-UAG-for GAACTTCAGGGTCAGCTTGCCTCAGGTGG SEQ ID NO: 26 CATCGCCCTCGCC

(28) The expression plasmids (pcDNA3.1-GFP-39TAG, pcDNA3.1-GFP-39TAA and pcDNA3.1-GFP-39TGA) were constructed by using the wild-type GFP expression vector pcDNA3.1-GFP-WT as a template, mutating the amino acid codon at position 39 to three stop codons respectively with the site-directed mutagenesis kit (QuikChange® Lightning Site-Directed Mutagenesis Kits, Catalog #210518) according to the instructions. The mutation was verified to be successful by sequencing.

(29) (3) Verification of the Read-Through Efficiency of the Orthogonal System after Mutation by Transient Transfection of PCMV and pcDNA3.1-GFP Plasmids in 293T Cells

(30) The pcDNA3.1-GFP obtained in step 2 of Example 2, and the PCMV plasmid of step 2 of Example 1 were mixed in a ratio of 1:2 according to the grouping of Table 3, and then mixed with the transfection reagent megatrans1.0 in a ratio of 1:3. They were added together to 293T cells. After 6 hours, the solution was changed, and

(31) ##STR00020##
was added at the concentration of 1 mM. The cells were further cultured in an incubator at 37° C., 5% CO2 for 48 hours. Then green fluorescence was observed by fluorescent microscopy. The result was shown in FIG. 1. It was finally confirmed that tRNAPyl/PylRS has an efficient read-through effect on the stop codon perfectly paired thereto, in which the read-through efficiency for UAG is the highest, that for UGA is the second, and that for UAA is the lowest.

(32) TABLE-US-00004 TABLE 3 PCMV PLASMID AND GFP PLASMID GROUPING MIX group plasmid 1 PCMV-TAG and pcDNA3.1-GFP-39TAG 2 PCMV-TAA and pcDNA3.1-GFP-39TAG 3 PCMV-TGA and pcDNA3.1-GFP-39TAG 4 PCMV-TAG and pcDNA3.1-GFP-39TAA 5 PCMV-TAA and pcDNA3.1-GFP-39TAA 6 PCMV-TGA and pcDNA3.1-GFP-39TAA 7 PCMV-TAG and pcDNA3.1-GFP-39TGA 8 PCMV-TAA and pcDNA3.1-GFP-39TGA 9 PCMV-TGA and pcDNA3.1-GFP-39TGA

Example 3: Reading Trough the Disease Protein Dystrophin in Three HEK293-Pyl Stable Cell Lines

(33) (1) Construction of the Stable Cell Line HEK293-PYL

(34) Two lentiviral overexpression vectors carrying puromycin and hygromycin resistances were constructed, which respectively carry an aminoacyl tRNA synthetase and a reporter gene GFP with TAG mutation at position 39. The stable cell strain pylRS/GFP39TAG was obtained after two rounds of transfection of HEK-293T cells with viruses and screening with puromycin/hygromycin. Subsequently, three pXH-zeo-12tRNA vectors carrying 12 copies of tRNA (CUA\UUA\UCA) and zeomycin resistance were constructed. The cell strain pylRS/GFP39TAG was transfected with linearized plasmids, and then screened in the presence of UAA. Finally, GFP-positive cells were isolated (the cells were green in the presence of UAA, and were colorless in the absence of UAA) to obtain three HEK293-PYL stable cell lines expressing tRNAPylCUA/PylRS, tRNA.sup.Pyl.sub.UUA/PylRS and tRNA.sup.Pyl.sub.UCA/PylRS respectively (FIG. 2A).

(35) A. Construction of the Vector

(36) We firstly constructed two lentiviral overexpression vectors respectively carrying puromycin and hygromycin resistances, which respectively carry an aminoacyl tRNA synthetase and a reporter gene GFP with TAG mutation at position 39. See FIG. 2B. Starting from the psd31 vector, we firstly replaced sv40-puroR gene with IRES-puroR and IRES-hygroR genes respectively by BamHI/xbaI restriction enzyme cutting site, thus obtained two viral vectors psd31-IRES-puroR and psd31-IRES-hygroR with different resistances, wherein IRES was an internal ribosome entry site and was often used for polycistronic gene expression. For example, an IRES sequence was inserted after the gene of interest, followed by a selectable marker gene, such that the transcribed mRNA could simultaneously express two proteins. There were two advantages to overexpress the gene of interest using the IRES system: 1. The gene of interest shared a promoter with the marker gene, avoiding the occurrence of false positive; 2. The translation efficiency of IRES was lower than that of the traditional translation initiation site, so that the expression level of the gene of interest was higher than that of the marker gene. Therefore, we introduced the CMV-pylRS sequence and the CMV-GFP39TAG sequence respectively before the IRES site by the BamHI restriction enzyme cutting site, so that obtained the double-virus system psd31-CMV-pylRS-IRES-puroR/psd31-CMV-GFP39TAG-IRES-hygroR which could simultaneously overexpress two proteins of interest. The main primers used are shown in Table 4.

(37) TABLE-US-00005 TABLE 4 PRIMERS FOR DOUBLE VIRUS CONSTRUCTION SOE IRES-hygro-for(BamHI) CGGGATCCAATTCCGCCCCTCTC SEQ ID NO: 27 PCR IRES-hygro-middle-for: CCCACAAGGAGACGACCTTCCATGA SEQ ID NO: 28 primers AAAAGCCTGAACTCACC IRES-hygro-middle- GGTGAGTTCAGGCTTTTTCATGGAA SEQ ID NO: 29 rev: GGTCGTCTCCTTGTGGG IRES-hyg ro-rev(xbaI): GCTCTAGA SEQ ID NO: 30 TCATTCCTTTGCCCTCGGAC SOE 3.1-CMV-for(BamHI) CGGGATCCGTTGACATTGATTATTG SEQ ID NO: 31 PCR AC primers CMV-GFP-middle-for: CCCAAGCTGGCTAGTTAAGCTTGCC SEQ ID NO: 32 ACCATGGATTACAAGGATGACGACG CMV-GFP-middle-rev: CGTCGTCATCCTTGTAATCCATGGT SEQ ID NO: 33 GGCAAGCTTAACTAGCCAGCTTGGG GFP-his-rev(BamHI): CGGGATCCTCAATGGTGATGGTGAT SEQ ID NO: 34 GATG PCR Pro-P1-for(BamHI): TGGATCCCCAATATTGGCCATTAGC SEQ ID NO: 35 primers C MbpyIRS-rev(bamHI): TGGATCCAAAAATTATAGATTGGTTG SEQ ID NO: 36 Sequencing PSD31-Bam HI- CAGGGACAGCAGAGATCCAG SEQ ID NO: 37 primers sequencing-for: 31-IRES-BamHI-rev: GGCTTCGGCCAGTAACGTTAG SEQ ID NO: 38

(38) The inventors overexpressed the tRNA by means of plasmid stable transfection. In order to ensure the expression level of the tRNA, the inventors constructed the vector pXH-12t-zeo, the sequence of which is shown in SEQ ID NO: 8. (FIG. 2C)

(39) B. Packaging and Transduction of the Lentivirus

(40) The psd31-CMV-pylRS-IRES-puroR virus was first packaged and transfected into HEK293T cells. The screening concentration of puromycin was 0.6 ug/ml. After the stable cell line No. 1 was obtained, the psd31-CMV-pylRS-IRES-puroR virus was added. The screening concentration of hygromycin was 200 ug/ml. The stable cell line No. 2 was obtained.

(41) C. Stable Transfection of the Plasmid

(42) The inventors performed a third round of screening by stable plasmid transfection, and finally obtained a special cell line stably expressing orthogonal tRNA/aminoacyl tRNA synthetase. The steps were as follows:

(43) A. After pXH-12t-zeo vector was linearized by restriction enzyme cutting, the stable cell line No. 2 expressing pylRS and GFP39TAG proteins was transfected (10 cm culture dish, 10 ug plasmid per dish, no antibiotics when being transfected).

(44) B. After 6 hours of transfection, the solution was changed and non-natural amino acids were added.

(45) C. After 48 hours of transfection, green fluorescence was observed, and the solution was changed, and 400 ug/ml of zeomycin was added.

(46) D. The solution was changed every 3 days until all the cells of the blank group died, and the transfection group formed clones.

(47) E. The GFP-positive clones were isolated and purified, and the culture was further expanded with half-dosage of zeomycin to obtain a 12t-zeo stable cell line HEK293-PYL.

(48) The main points of screening for monoclones by plasmid stable transfection are as follows:

(49) A. The cell density of the cells stably transfected by the plasmid is important. The cell density is sparse at the time of screening, and it is easy to die and difficult form a clone.

(50) B. From the time of monoclonalization, it is necessary to increase the nutrients, serum and growth factors.

(51) C. When the number of cells inoculated into the well as a monoclone is small, the signal between the cells becomes weak and the positive cells may be in poor condition or even die. A special culture solution can be used: at the cell confluence of 80%, the old culture solution is sterilized by a filter, and is mixed with the fresh culture solution at a ratio of 1:1 for use. Alternatively, increase the concentration of the serum suitably.

(52) D. After the digestion of the monoclone, do not add zeomycin and UAA, and should add them after cell adhesion to avoid cell death.

(53) (2) Construction of the Dp71b Mutant Plasmid Containing the Premature Termination Codon UAG

(54) The Dp71b sequence of the isoform of the Dystrophin protein is shown in SEQ ID NO: 9. The inventors performed point mutations on the wild-type Dp71b sequence according to the sites of nonsense mutations in Duchenne muscular dystrophy patients, and introduced the premature termination codon at different positions to construct Dp71b plasmids Dp71b3116TAG (c.9346C>T), Dp71b3317TAG (c.9952C>T) and Dp71b3601TAG (c.10801C>T) comprising the premature termination codon UAG, which are shown in SEQ ID NOs: 10 to 12. The mutation was verified to be successful by sequencing.

(55) TABLE-US-00006 TABLE 5 PRIMERS FOR DP71B POINT MUTATIONS Dp71b-9346-for TGAAACTCCGAAGACTGTAGAAGGCCCTTTGCTTG SEQ ID NO: 39 Dp71b-9346-for CAAGCAAAGGGCCTTCTACAGTCTTCGGAGTTTCA SEQ ID NO: 40 Dp71b-9952-for CATCAGGCCAAATGTAACATCTGCAAATAGTGTCCA SEQ ID NO: 41 ATCATT Dp71b-9952-for AATGATTGGACACTATTTGCAGATGTTACATTTGGC SEQ ID NO: 42 CTGATG Dp71b-10801-for GCTGGAGCAACCCTAGGCAGAGGCCAA SEQ ID NO: 43 Dp71b-10801-for TTGGCCTCTGCCTAGGGTTGCTCCAGC SEQ ID NO: 44

(56) (2) Reading Through the Disease Protein Dystrophin in the Stable Cell Line HEK293-PYL

(57) The Dp71b3116TAG, Dp71b3317TAG and Dp71b3601TAG plasmids obtained in step 2 of Example 3 were mixed with the transfection reagent megatrans1.0 in a ratio of 1:3, and were added together to the stable cell line HEK293-PYL. After 6 hours, the solution was changed and

(58) ##STR00021##
at 1 mM was added. After the cells were cultured in an incubator at 37° C., 5% CO2 for 48 hours, the protein was extracted. The production of the full-length dystrophin protein was detected by Western blot (the primary antibody was anti-dystrophin, which was a C-terminal antibody of an anti-dystrophin protein, catalog No. 12715-1-AP), as shown in FIG. 3. It was proved that tRNAPyl/PylRS could read through the premature termination codons at different positions and restore the expression of disease proteins.

Example 4: Investigation of the Effect of Reading Through the Endogenous Premature Termination Codon in the Stable Cell Line HEK293-Pyl

(59) (1) Construction of the Endogenous Premature Termination Codon Plasmids pcDNA3.1-Smad-39TAG; pcDNA3.1-Smad-39TAA; pcDNA3.1-Smad-39TGA

(60) Smad gene sequence consisting of introns and exons (as shown in SEQ ID: 3) was inserted into the pcDNA3.1 commercial plasmid, and then the amino acid codons at positions 39, 122 and 133 of Smad were mutated to the premature termination codon UAG to obtain plasmids pcDNA3-Smad-39TAG, pcDNA3-Smad-122TAG and pcDNA3-Smad-133TAG (as shown in SEQ ID NOs: 4 to 6).

(61) (2) Verification of the Read-Through of the Endogenous Premature Termination Codon in the Stable Cell Line

(62) The pcDNA3-Smad-39TAG, pcDNA3-Smad-122TAG or pcDNA3-Smad-133TAG plasmid obtained in step 1 of Example 4 was mixed with the transfection reagent megatrans1.0 in a ratio of 1:3, and was added to the stable cell line HEK293-PYL. After 6 hours, the solution was changed and

(63) ##STR00022##
at 1 mM was added. After the cells were cultured in an incubator at 37° C., 5% CO2 for 48 hours, the protein was extracted. The production of the full-length Smad protein was detected by Western blot (the primary antibody was anti-myc, which was a tag antibody), as shown in FIG. 4. It was verified that the genetic codon expansion technology could inhibit the nonsense-mediated mRNA degradation process, and read through the premature termination codon to restore the expression of the protein.

Example 5: Genetic Codon Expansion Reads Through Premature Termination Codon in the Genome of a Tumor Cell Line

(64) According to the literature, STK11 on human lung cancer cell A 549 genome has a nonsense mutation, c.109C>T, p. Q37X, which is an amber stop codon UAG; EPHB2 gene on human prostate cancer cell DU 145 genome has a nonsense mutation, c.2167C>T, p. Q723X, which is an amber stop codon UAG.

(65) The PCMV-CUA (tRNAPylCUA/PylRS) plasmid was mixed with the transfection reagent megatrans1.0 in a ratio of 1:3, and was transfected into A 549 and DU145 cells respectively. After 6 hours, the solution was changed and

(66) ##STR00023##
at 1 mM was added. After the cells were cultured in an incubator at 37° C., 5% CO2 for 48 hours, the protein was extracted. The production of the full-length STK11 and EPHB2 proteins was detected by Western blot (the primary antibodies were anti-STK11 and anti-EPHB2 respectively), as shown in FIG. 5. It was verified that the genetic codon expansion technology could read through the premature termination codon on the endogenous genome to restore the expression of the tumor suppressor gene proteins.