Transcriptome-wide design of selective, bioactive small molecules targeting RNA
11636918 · 2023-04-25
Assignee
Inventors
Cpc classification
G01N2500/04
PHYSICS
C07D235/20
CHEMISTRY; METALLURGY
C07H15/04
CHEMISTRY; METALLURGY
G16B15/00
PHYSICS
C07H15/234
CHEMISTRY; METALLURGY
G01N33/5308
PHYSICS
C07D235/18
CHEMISTRY; METALLURGY
G16B15/30
PHYSICS
International classification
G16B15/30
PHYSICS
C07D235/18
CHEMISTRY; METALLURGY
C07D235/20
CHEMISTRY; METALLURGY
C07H15/04
CHEMISTRY; METALLURGY
C07H15/234
CHEMISTRY; METALLURGY
G01N33/53
PHYSICS
G16B15/00
PHYSICS
G16B30/00
PHYSICS
Abstract
Methods and computer systems are described herein for identifying small molecules that bind to selected RNA structural features (e.g., to RNA secondary structures). Also described are compounds and compositions that modulate RNA function and/or activity.
Claims
1. A method for identifying a compound that binds to an RNA, comprising: (a) generating a query dataset of RNA secondary structures from one or more sequences of the RNA alone; (b) comparing the query dataset of RNA secondary structures with a dataset of identified bound RNA motif-small molecule pairs, to generate an output listing of pairs of identified RNA secondary structures and the identified small molecule that binds thereto; (c) obtaining an RNA with an identified RNA secondary structure and the identified small molecule that binds thereto; (d) determining a binding affinity of the identified RNA secondary structure with the identified small molecule that binds thereto by mixing an RNA having the RNA secondary structure with the identified small molecule and measuring the binding affinity, and/or determining whether the identified small molecule reduces or increases amounts of an RNA having the RNA secondary structure in a mammalian cell; to thereby identify a compound that binds to the RNA.
2. The method of claim 1, wherein the output listing of pairs of identified RNA secondary structures and the identified small molecule that binds thereto comprises one or more RNA sequences for each RNA secondary structure, a description of each RNA secondary structure, a description or name of each RNA having each RNA secondary structure, and a description of each small molecule by chemical formula, chemical name, chemical structure, three-dimensional structure, or a combination thereof.
3. The method of claim 1, further comprising obtaining RNA that binds to each small molecule to generate a series of RNA samples, amplifying each RNA sample in the series, sequencing each RNA sample in the series, or any combination thereof.
4. The method of claim 1, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a structural description of each RNA motif, a listing of which RNA motif binds to each small molecule or compound, one or more RNA sequences for each RNA motif, a description of each RNA motif's 2-dimensional and/or three-dimensional structure, a description of each RNA motif as single-stranded or double-stranded, a description of each RNA motif as an internal loop, hairpin loop, a bulge, a bubble, or a branch, or any combination thereof.
5. The method of claim 1, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multi-branch loop, or pseudoknot.
6. The method of claim 1, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a structural description of each small molecule, a description of each small molecule by chemical formula, chemical name, a description of each small molecule structure, a description of each small molecule three-dimensional structure, a description of each small molecule three-dimensional atomic structure, or a combination thereof.
7. The method of claim 1, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of bonds formed between RNA motifs and small molecules, a description of alignments for each structural feature of each RNA motif with each small molecule to which the RNA motif binds, a description of alignments for each structural feature of small molecule with each structural feature of the RNA motif to which the small molecule binds, of any combination thereof.
8. The method of claim 1, wherein comparing the query dataset of RNA secondary structures generated from one or more sequences of the RNA alone, with the dataset of identified bound RNA motif-small molecule pairs, comprises: (a) aligning one or more structural features of each RNA secondary structure with one or more structural features of one or more of the RNA motifs; (b) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs; (c) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs until a best-fit RNA motif is identified that optimally corresponds with each RNA secondary structure; (d) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs until a best-fit compound-RNA motif pair is identified, where the RNA motif of the pair has a structure that optimally corresponds with each RNA secondary structure; or (e) any combination thereof.
9. The method of claim 1, wherein the method identifies a compound that binds to the RNA by providing an output listing at least one RNA secondary structure generated from one or more sequences of the RNA alone, and a small molecule that binds to the at least one RNA secondary structure.
10. The method of claim 1, wherein the RNA is a microRNA, a tRNA, a rRNA, or a small interfering RNA.
11. The method of claim 1, wherein the dataset of identified bound RNA motif-small molecule pairs is generated by two-dimensional combinatorial screening.
12. A computer system for identifying a molecule that binds to an RNA comprising: one or more computer processors; and storage having computer-useable instructions embodied thereon; wherein the computer-useable instructions are configured to generate a structured query dataset describing RNA secondary structures from one or more sequences of the RNA alone; and compare the structured query dataset describing RNA secondary structures with a structured dataset of identified RNA motif-small molecule pairs, to thereby identify the molecule that binds to the RNA.
13. The computer system of claim 12, wherein the query dataset of RNA secondary structures comprises one or more RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multi-branch loop, pseudoknot, bulge, bubble, branch, or a combination therefore.
14. The computer system of claim 12, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a structural description of each RNA motif, a structural description of each small molecule, and a listing of which RNA motif binds to each small molecule or compound.
15. The computer system of claim 12, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multibranch loop, or pseudoknot, bulge, bubble, branch, or a combination therefore.
16. The computer system of claim 12, wherein comparison of the structured query dataset describing RNA secondary structures generated from one or more sequences of the RNA alone, with the structured dataset of identified RNA motif-small molecule pairs comprises: (a) aligning one or more structural features of each RNA secondary structure with one or more structural features of one or more of the RNA motifs; (b) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs; (c) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs until a best-fit RNA motif is identified that optimally corresponds with each RNA secondary structure; (d) a series of alignments for each structural feature of each RNA secondary structure with one or more structural features of one or more of the RNA motifs until a best-fit compound-RNA motif pair is identified, where the RNA motif of the pair has a structure that optimally corresponds with each RNA secondary structure; or (e) any combination thereof.
17. The computer system of claim 12, wherein the computer-useable instructions are further configured to provide an output listing at least one RNA secondary structure from the RNA, and a small molecule that binds to the at least one RNA secondary structure.
18. The computer system of claim 12, wherein the computer-useable instructions are further configured to evaluate an RNA secondary structure identified to bind a small molecule by compiling sequence features in the RNA secondary structure, and comparing the number of sequence features in the RNA secondary structure to the number of the same sequence features in a larger population of RNA motifs.
19. The computer system of claim 12, wherein the computer-useable instructions are further configured to assign one or more Z.sub.obs-scores to an RNA secondary structure identified to bind a small molecule using Equations (I) and (II):
20. The computer system of claim 19, wherein the computer-useable instructions are further configured to sum the one or more Z.sub.obs-scores to generate at least one ΣZ score for the RNA secondary structure when a Z.sub.obs-score indicates that a structural feature in the RNA secondary structure is distinct from the larger library of structural features (population 2) at a 95% confidence level.
21. The computer system of claim 20, wherein the computer-useable instructions are further configured to plot the at least one ΣZ score against measured binding affinities of the small molecule for the RNA to generate a ΣZ score—binding affinity plot, where the plot is fitted to an inverse first-order equation.
22. The computer system of claim 12, wherein the computer-useable instructions are further configured to generate output that predicts an affinity and selectivity of the small molecule for the RNA.
23. One or more computer-readable hardware storage having computer-useable instructions embodied thereon and configured for performing a method of generating a structured query dataset describing RNA secondary structures from one or more sequences of the RNA alone; and comparing the structured query dataset describing RNA secondary structures with a structured dataset of identified RNA motif-small molecule pairs to identify a molecule that binds to the RNA.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION
(21) A method is described herein called inforna that provides a streamlined approach for designing bioactive small molecules that target RNA sequence secondary structures (e.g., structural motifs). A myriad of genomic and functional studies are rapidly providing information about disease-associated genes, including non-coding RNAs (Kramer & Cohen, Nat. Rev. Drug Discov. 3, 965-972 (2004). The inforna methods provide an expedited route to identify small molecules that target the RNA product of those genes. The inforna methods not only speed up drug discovery, but also more accurately identify drug candidates that have a higher likelihood of having useful activity. For example, as described in more detail below, use of the inforna methods identified multiple bioactive compounds from only a small dataset of RNA motif-small molecule interactions.
(22) The inforna methods provided herein utilize and compare datasets of information, providing an output of which RNA structural secondary structures will likely bind to which small molecule. Those datasets include (a) a dataset of RNA secondary structures to be queried; and (b) a dataset of identified RNA motif-small molecule interactions (e.g., as identified by two-dimensional combinatorial screening (2DCS)). In general, the term “motif” refers to an RNA structure that has already been identified. The term “secondary structure” is a more general term referring to the structures that can form when an RNA molecule folds back on itself.
(23) The output of RNA sequences and secondary structures that will likely bind to a small molecule can be further analyzed by other prediction processes and by chemical and biological assays (e.g., binding assays). For example, a StARTS statistical method can be used to further refine predictions. The StARTS method predicts the affinities and selectivities of RNA motif-small molecule interactions by comparing the rate of occurrence of small structural features (a guanine adjacent to an adenine, for example) in selected RNA motifs to its rate of occurrence in the entire RNA library. The StARTS method therefore facilitates identification of which RNA secondary structures and motifs are most unique or distinctive in populations of RNA molecules.
(24) For example,
(25) A dataset of RNA secondary structures to be queried can be generated from one or more RNA sequences alone. For example, RNA secondary structures can be identified as the lowest free energy secondary structures formed by an RNA as it folds back upon itself to form double-stranded regions as well as single-stranded loops and mismatched ‘bubbles’ in the double-stranded regions. Such low free energy secondary structures can be predicted by programs such as RNAstructure (Mathews et al., Proc. Natl. Acad. Sci. U.S.A. 101, 7287-7292 (2004); Mathews et al., J. Mol. Biol. 288, 911-940 (1999), which are specifically incorporated by reference herein in their entireties).
(26) The regions of secondary structure that are more likely to bind small molecules are openings in double-stranded regions (‘internal loops’), single-stranded ends of RNA molecules, and other single-stranded regions. For example,
(27) A listing of one or many selected RNA sequences can be evaluated so that a dataset of RNA secondary structures is provided. For example, the query dataset of RNA secondary structures can include one or more RNA secondary structures from just one RNA of particular interest, which could be a target for drug design. The dataset can therefore include each RNA secondary structure within the selected RNA. In other situations, the query dataset of RNA secondary structures can be generated from a family of RNA species having related functions, or from a series of RNA species (e.g., those thought to be involved in the onset, maintenance or progression of disease). For example, the query dataset of RNA secondary structures can be from just one RNA molecule, or from 1-5 RNA molecules, or from 1-10 RNA molecules, or from 1-50 RNA molecules, or from 1-100 RNA molecules, or from 1-500 RNA molecules, or from 1-1000 RNA molecules, or from 1-5000 RNA molecules, or from 1-10,000 RNA molecules. The query dataset of RNA secondary structures can also, for example, include structures from just one RNA molecule, or from 2-5 RNA molecules, or from 2-10 RNA molecules, or from 5-50 RNA molecules, or from 10-100 RNA molecules, or from 20-500 RNA molecules, or from 100-1000 RNA molecules, or from 5000-5000 RNA molecules, or from 100-10,000 RNA molecules.
(28) In some instances, the methods described herein can employ an RNA motif library, or can employ an RNA motif library as a query dataset. For example, the RNA motif library can be an RNA internal loop library whose members differ from one another (i) in the identity of the bases in the RNA internal loop and/or (ii) in the identity of the base pairs adjacent to the RNA internal loop (the so-called loop closing base pairs). The RNA motif library can be, for example, a symmetric internal loop library, an asymmetric internal loop library, a 1×1 internal loop library, a 1×2 internal loop library, a 1×3 internal loop library, a 2×2 internal loop library, a 2×3 internal loop library, a 2×4 internal loop library, a 3×3 internal loop library, a 3×4 internal loop library, a 4×4 internal loop library, a 4×5 internal loop library, a 5×5 internal loop library, a 1 base bulge library, a 2 base bulge library, a 3 base bulge library, a 4 base bulge library, a 5 base bulge library, a 4 base hairpin loop library, a 5 base hairpin loop library, a 6 base hairpin loop library, a 7 base hairpin loop library, an 8 base hairpin loop library, a 9 base hairpin loop library, a 10 base hairpin loop library, a multibranch loop library, a pseudoknot library, etc. Combinations of these and other RNA motif libraries can be used or evaluated. For example, the RNA motif library can have two or more internal or terminal loops, bulges, stems, hairpins, or other structural elements.
(29) For completeness, it may be desirable to employ or evaluate an RNA motif library that includes all possible combinations of bases (e.g., an 3×3 internal loop library containing 1600 different 3×3 internal loops). The members of the RNA motif library can further include (i.e., in addition to the variable RNA motif region) RNA regions that do not vary from member to member (e.g., invariant stem regions, invariant hairpin loop regions, etc.). Suitable RNA motif libraries can be prepared by conventional transcription techniques (e.g., those employing T7 RNA polymerase, as described, for example, in Milligan et al., “Synthesis of Small RNAs Using T7 RNA Polymerase,” Methods Enzymol., 180:51-62 (1989), which is hereby incorporated by reference) from DNA templates, such as DNA templates that are commercially available from Integrated DNA Technologies (Coralville, Iowa)).
(30) The Examples illustrate analyses of numerous human microRNAs (miRNAs). MicroRNAs have important functional roles in the regulation of transcription and translation. By using the methods described herein small molecules can be identified that can modulate the function of such microRNAs. However, the methods are also useful for modulating the function of other types of RNA, such as pri-miRNA, mRNA, tRNA and rRNA. The RNA molecules that are evaluated can be small or large.
(31) The complete sequence of each query RNA molecule can be provided in the dataset of RNA secondary structures, or the complete sequence of each query RNA molecule can be linked to its query RNA secondary structures so that the source of the secondary structures within the query dataset can be identified.
(32) The dataset of identified RNA motif-small molecule interactions is distinct from the dataset of RNA secondary structures to be queried. The dataset of RNA motif-small molecule interactions is a dataset of the RNA motifs and the molecules that are known to bind to those RNA motifs. Such a dataset can be generated by the two-dimensional combinatorial screening (2DCS) procedures that have previously been developed by the inventors (see, e.g., U.S. Patent Application Publication 20080188377 by Disney & Childs-Disney; Childs-Disney et al., ACS Chem. Biol. 2, 745-754 (2007); Disney et al., J. Am. Chem. Soc. 130, 11185-11194 (2008), each of which is specifically incorporated by reference herein in its entirety).
(33) The 2DCS method involves probing a library of compounds with a library of RNA motifs, and then identifying which RNA motifs bind to which compounds. Thus wet experimentation and physical manipulation is performed on the small molecules and the library of RNS motifs. The library of RNA motifs employed for 2DCS can include a synthetic RNA framework with at least one defined structural region (e.g., one or more double-stranded ‘stem’ regions of known sequence), and one variable region (e.g., a single stranded loop, or a single stranded ‘bubble’ of variable sequence that can be a nonhybridized section RNA flanked by doubled stranded RNA segments). For example, the library of RNA motifs can be a 3×3 nucleotide RNA internal loop library, where the defined regions of the 3×3 ILL RNA molecule are shown in
(34) For the 2DCS method, the library of compounds can be immobilized onto a microarray so that the address of each compound is known. The array of compounds can be embedded within a gel (e.g., agarose or polyacrylamide) to facilitate localization and processing of small molecule—RNA motif binding pairs. A mix of RNA molecules, including an entire library of RNA motifs, optionally with any desired control RNAs, and/or competitor oligonucleotides is incubated with each compound in the array. After incubation under conditions that allow binding, RNA molecules bound by the compounds are separately harvested, amplified, and sequenced.
(35) For example, in 2DCS experiments described herein, a small molecule library was conjugated onto an agarose microarray surface. The small molecule microarray was then probed with a library of small RNA motifs likely to be found as components of RNAs of interest. For example, the 3×3 ILL RNA with a variable internal loop that is shown in
(36) RNAs bound by the immobilized compounds are separately harvested, amplified, and sequenced. The RNA motifs in the bound RNAs are identified and the dataset of identified RNA motif-small molecule interactions is prepared by listing the small molecules and the RNA motif(s) that are bound by the small molecule(s). The dataset can include primary and secondary structural information for each RNA motif as well as structural information for each small molecule (e.g., name, chemical formula, chemical structure, three-dimensional structure, and the like).
(37) StARTS is a statistical approach that can be paired with inforna to further evaluate the binding affinity of RNA secondary structures for the small molecule partner(s) identified by inforna. StARTS identifies features in RNA motifs that positively and negatively contribute to binding (see, Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011); Paul et al., Nucleic Acids Res. 37 (17): 5894-5907 (2009), each of which is incorporated by reference herein in its entirety).
(38) In the StARTS approach, sequences of one or more RNA secondary structures identified as binding a small molecule are compiled, and the occurrence rate of each sequence feature in the RNA secondary structures is compared to the occurrence rate of that feature in a larger population of RNA motifs. A sequence feature is any short RNA sequence (for example, a 5′GC step) that may or may not be different from the sequence features that are present in a larger population of RNA sequences. However, the sequence features are those sequences that are present in the population of RNA secondary structures that bind to a small molecule. By comparing these two populations, the relative enrichment for a specific feature in RNA secondary structure for binding to a small molecule can be computed. Thus, the StARTS method identifies which sequence features are more prevalent in a selected population of RNA sequences than in a larger population of RNA sequences.
(39) The more distinctive sequence features are assigned a statistical significance, or a Z-score and a corresponding two-tailed p-value. The Z scores can be determined by statistical analysis using a RNA Privileged Space Predictor (RNA-PSP) program that determines which features occur in the selected RNA secondary structures with greater than 95% confidence (see, Paul et al., Nucleic Acids Res. 37 (17): 5894-5907 (2009), which is incorporated herein by reference in its entirety). The confidence intervals are associated with a Z-score, where a larger value corresponds to a higher confidence level. Each RNA secondary structure can have multiple features that contribute to it being different from a larger population of RNA motifs and a sum of the Z-scores for all features in an RNA secondary structure can be computed (ΣZ) as an indicator of the total structural distinctiveness of an RNA motif.
(40) To complete the StARTS analysis, the Z-scores can then plotted against the measured binding affinities of the RNA secondary structure for a compound, and this relationship can be fitted to an inverse first-order equation, which allows prediction of the affinity of a compound for a RNA library member.
(41) The computer program RNA-PSP has previously been developed by the inventors to address the need for fast and accurate statistical analysis of selected RNAs. RNA-PSP was developed on a Microsoft Visual Basic 2008 platform, and allows direct input of sequence files from any selection. The inputted sequence file is then analyzed to extract the sequences of the variable region for each selected library member. For the automated extraction of selected sequences, users specify the constant and the variable regions of the library, allowing RNA-PSP to sort through a sequencing file and identify embedded RNAs from the selection. See, Paul et al., Nuc. Acids Res. 37 (17): 5894-5907 (2009). Once the selected structures are extracted by the program, it generates all possible combinations of sequences from the original library and stores the results. For example, in the 3×3 nucleotide hairpin library shown in
(42) RNA-PSP ranks the most statistically significant feature for the various RNA motif sequences by performing a Z-test that generates Z-scores using Equations (I) and (II):
(43)
where
(44) n.sub.1 is the size of Population 1 (e.g., the selected RNA secondary structure(s)),
(45) n.sub.2 is the size of Population 2 (e.g., a library of RNA motifs),
(46) p1 is the observed proportion of Population 1 displaying the feature, and
(47) p2 is the observed proportion for Population 2 displaying the feature.
(48) The output of RNA-PSP is a Z.sub.obs score, and a corresponding two-tailed p-value is assigned to reflect a confidence level that a structural feature is distinct from those in the population as a whole. Z scores are the Z.sub.obs scores with greater than 95% confidence limits. The table in
(49) Population 1 can be any selected subset of RNA sequences, such as the output from an inforna analysis, or a subset of the inforna output, such as one or more RNA secondary structures that are predicted to bind a small molecule, or appear to contribute to binding of a small molecule by wet testing. A family or genus of related RNA sequences or motifs that share some structural features is typically evaluated to assess whether the common structural features contribute to binding with a small molecule. For example, Population 1 could include all the sequences defined by the generic loop structure in the first box in the table shown in
(50) The genus of secondary structures or motifs (e.g., loops) can have a multitude of different sequence features, and a multitude of different Z scores. When a given genus contains the sequence with the highest Z score, that high scoring sequence and that genus could be good target for binding a small molecule. However, each sequence within the genus of sequences (those described by the first box in
(51) The affinity of a small molecule for the various RNA library members can be illuminated when Z scores are plotted against the measured binding affinities and this plot is fitted to an inverse first-order equation. Such a graph can be used to predict the affinity of the small molecule for any RNA library member (see, e.g., Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011)). The combination of statistical and experimental evaluation makes StARTS a valuable tool for clarifying which of the secondary structures identified by inforna are the best drug targets.
(52) StARTS therefore predicts the affinities and selectivities of RNA-small molecule interactions by comparing the rate of occurrence of a feature in selected RNA motifs (a guanine adjacent to an adenine, for example) to its rate of occurrence in the entire RNA library. The confidence that a selected feature did not occur randomly is assigned a Z-score and a corresponding two-tailed p-value. Only features that are statistically significant (p≤0.05 or ≥95% confidence) are considered. The analysis identifies features that contribute positively (positive Z-score) and negatively (negative Z-score) to binding, facilitating prediction of which RNAs bind and which RNAs do not.
(53)
(54) The system can include a number of entries. For example, each entry can be assigned the following parameters, which can be present in various tables that are linked for facile searching: (i) a unique ligand (small molecule) identifier; (ii) a unique RNA secondary structure or motif identifier; (iii) the RNA secondary structure or motif type; (iv) the RNA secondary structure or motif size; (v) the RNA secondary structure or motif sequence; (vi) the closing base pair(s) of the RNA; (vii) the Fitness Score for the RNA secondary structure or motif (which indicates the overall fitness of the RNA motif-small molecule interactions and is highly correlated to the binding affinity); (viii) the dissociation constant, K.sub.d, of the RNA motif-small molecule pair if measured; and, (ix) other notes including, for example, the PubMed identification reference number of the RNA molecules that are the source of the secondary structures(s) and motif(s).
(55)
(56) The Motif table shown at the left in
(57) In
(58) The Small Molecule table to the right in
(59) The Motif Size INT component in the Motif Size table of
(60) The Small Molecule ID INT in the table to right in
(61) The Fitness Score Float in the Motif table to left in
(62) The Motif Size table on the right side of
(63) The Small Molecule Table shown at the right in
(64) The Motif Has Ligand Table shown at the right in
(65)
(66) Each record in the database is assigned a unique Motif ID, Motif Identifier, Motif Type, Motif Size, Closing Base Pair, Sum Z-score for the motif, which indicates statistical significance and is highly correlated to affinity, Fitness Score, Dissociation Constant (K.sub.d) if measured and the PMID publication reference ID. There are two defined functions in the system that are used in parsing the CT files. Depending on the search criteria the system will either return no matches or a set of records that match the search criteria. This record set can then be passed to the user interface where it is processed further to apply any format changes. Once this is complete this record set populates the user interface grid. The values are displayed in the following order: CT Filename, Compound Structure which is an image visualizing the SMILES field, Query Motif, Motif in Target RNA, Loop Nucleotides, Fitness Score, Loop Identifier, Dissociation Constant (K.sub.d) if measured and the PMID publication reference link. Since the search results can be rather large, a 200 row limit is applied to reduce the load of the server and the lag between search submissions. If the user wishes to view all the records, an export to excel option is available. This option is not limited by the number of records.
(67) Thus, the inforna process generates an output after dataset comparison(s)/queries, where the output can include the structure of the RNA molecule(s) queried (e.g., as a .ct file), the structure of the small molecule(s) that bind to an identified motif in the queried RNA including a link to the corresponding SMILES file, the motif(s) within the RNA motif—small molecule dataset that is similar to or exactly matches motif(s) in the queried RNA that binds the small molecule, the motif(s) in the queried RNA that is predicted to bind a small molecule ligand, the (loop) nucleotides in the motif(s) from the queried RNA, the Fitness Score of each newly discovered small molecule—RNA motif pair, a Binding constant (K.sub.d or IC.sub.50), a Loop Identifier for the motif in the database that is similar to or exactly matches motif(s) in the queried RNA (as referred to in publications), and the PubMed identification where the motif in the database is reported.
(68) The functions or algorithms described herein may be implemented in software or a combination of software and human implemented procedures, for example. The software may consist of computer executable instructions stored on computer readable media such as memory or other type of storage devices. Further, such functions correspond to modules, which are software, hardware, firmware or any combination thereof. Multiple functions may be performed in one or more modules as desired, and the embodiments described are merely examples. The software may be executed on a digital signal processor, ASIC, microprocessor, or other type of processor operating on a computer system, such as a personal computer, server or other computer system. In one embodiment, multiple such computer systems are utilized in a distributed network to implement multiple analyses, draw upon information from distributed sources, or facilitate transaction based usage. An object-oriented, service-oriented, or other architecture may be used to implement such functions and communicate between the multiple systems and components.
(69) For example, the computer may operate in a networked environment using a communication connection to connect to one or more remote computers, such as database servers. The remote computer may include a personal computer (PC), server, router, network PC, a peer device or other common network node, or the like. The communication connection may include a Local Area Network (LAN), a Wide Area Network (WAN) or other networks.
(70) Datasets of information can be in different forms and from different sources. For example, datasets can be stored and updated in the form of computer-accessible storage. Computer-accessible storage includes random access memory (RAM), read only memory (ROM), erasable programmable read-only memory (EPROM) & electrically erasable programmable read-only memory (EEPROM), flash memory or other memory technologies, compact disc read-only memory (CD ROM), Digital Versatile Disks (DVD) or other optical disk storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium capable of storing computer-readable instructions.
(71) Computer-readable instructions (e.g., for inforna) can be stored on a computer-readable medium and can be executable by a processing unit of the computer. A hard drive, CD-ROM, and RAM are some examples of articles including a non-transitory computer-readable medium. For example, a computer program linked to, or including, the inforna programs can be capable of providing a generic technique to perform an access control check for data access and/or for doing an operation on one of the servers in a component object model (COM) based system, or can be included on a CD-ROM and loaded from the CD-ROM to a hard drive. The computer-readable instructions allow computer to provide generic access controls in a COM based computer network system having multiple users and servers.
(72) A system bus can be any of several types of bus structures including a memory bus or memory controller, a peripheral bus, and a local bus using any of a variety of bus architectures. The system memory can also be referred to as simply the memory, and, in some embodiments, includes read-only memory (ROM) and random-access memory (RAM). A basic input/output system (BIOS) program, containing the basic routines that help to transfer information between elements within the computer, such as during start-up, may be stored in ROM. A computer that includes the inforna process can further include a hard disk drive for reading from and writing to a hard disk, a magnetic disk drive for reading from or writing to a removable magnetic disk, and an optical disk drive for reading from or writing to a removable optical disk such as a CD ROM or other optical media.
(73) Such a hard disk drive, magnetic disk drive, and optical disk drive can couple with a hard disk drive interface, a magnetic disk drive interface, and an optical disk drive interface, respectively. The drives and their associated computer-readable media provide non-volatile storage of computer-readable instructions, data structures, program modules and other data for the computer. It should be appreciated by those skilled in the art that any type of computer-readable media which can store data that is accessible by a computer, such as magnetic cassettes, flash memory cards, digital video disks, Bernoulli cartridges, random access memories (RAMs), read only memories (ROMs), redundant arrays of independent disks (e.g., RAID storage devices) and the like, can be used in the exemplary operating environment.
(74) A plurality of program modules can be stored on the hard disk, magnetic disk, optical disk, ROM, or RAM, including an operating system, one or more application programs, other program modules, and program data. Programming for implementing one or more processes or method described herein may be resident on any one or number of these computer-readable media.
(75) A user may enter commands and information into computer through input devices such as a keyboard and pointing device. Other input devices (not shown) can include a microphone, touch screen, joystick, game pad, satellite dish, scanner, or the like. These other input devices are often connected to the processing unit through a serial port interface that is coupled to the system bus, but can be connected by other interfaces, such as a parallel port, game port, or a universal serial bus (USB). A monitor or other type of display device can also be connected to the system bus via an interface, such as a video adapter. The monitor can display a graphical user interface for the user, and may include a touchscreen, allowing user interactions to select functions and enter data. In addition to a monitor, computers typically include other peripheral output devices, such as speakers and printers.
(76) The computer may operate in a networked environment using logical connections to one or more remote computers or servers, such as remote computer. These logical connections are achieved by a communication device coupled to or a part of the computer; the invention is not limited to a particular type of communications device. Such a remote computer can be another computer, a server, a router, a network PC, a client, a peer device or other common network node, and typically includes many or all of the elements described above relative to the computer. The logical connections include a local area network (LAN) and/or a wide area network (WAN). Such networking environments are commonplace in office networks, enterprise-wide computer networks, intranets and the internet, which are all types of networks.
(77) When used in a LAN-networking environment, the computer can be connected to the LAN through a network interface or adapter, which is one type of communications device. In some embodiments, when used in a WAN-networking environment, the computer typically includes a modem (another type of communications device) or any other type of communications device, e.g., a wireless transceiver, for establishing communications over the wide-area network, such as the internet. Such a modem, which may be internal or external, is connected to the system bus via the serial port interface. In a networked environment, program modules depicted relative to the computer can be stored in the remote memory storage device of remote computer, or server. It is appreciated that the network connections described are exemplary and other means of, and communications devices for, establishing a communications link between the computers may be used including hybrid fiber-coax connections, T1-T3 lines, DSL's, OC-3 and/or OC-12, TCP/IP, microwave, wireless application protocol, and any other electronic media through any suitable switches, routers, outlets and power lines, as the same are known and understood by one of ordinary skill in the art.
(78) Electronic Apparatus and System
(79) Example embodiments may therefore be implemented in digital electronic circuitry, or in computer hardware, firmware, software, or in combinations of them. Example embodiments may be implemented using a computer program product, for example, a computer program tangibly embodied in an information carrier, for example, in a machine-readable medium for execution by, or to control the operation of, data processing apparatus, for example, a programmable processor, a computer, or multiple computers.
(80) A computer program can be written in any form of programming language, including compiled or interpreted languages, and it can be deployed in any form, including as a stand-alone program or as a module, subroutine, or other unit suitable for use in a computing environment. A computer program can be deployed to be executed on one computer or on multiple computers at one site or distributed across multiple sites and interconnected by a communication network.
(81) In example embodiments, operations may be performed by one or more programmable processors executing a computer program to perform functions by operating on input data and generating output. Method operations can also be performed by, and apparatus of example embodiments may be implemented as, special purpose logic circuitry (e.g., a FPGA or an ASIC).
(82) The computing system can include clients and servers. A client and server are generally remote from each other and typically interact through a communication network. The relationship of client and server arises by virtue of computer programs running on the respective computers and having a client-server relationship to each other. In embodiments deploying a programmable computing system, it will be appreciated that both hardware and software architectures merit consideration. Specifically, it will be appreciated that the choice of whether to implement certain functionality in permanently configured hardware (e.g., an ASIC), in temporarily configured hardware (e.g., a combination of software and a programmable processor), or a combination of permanently and temporarily configured hardware may be a design choice. Below are set out hardware (e.g., machine) and software architectures that may be deployed, in various example embodiments.
(83) Example Machine Architecture and Machine-Readable Medium
(84)
(85) The example computer system 1100 includes a processor 1102 (e.g., a central processing unit (CPU), a graphics processing unit (GPU) or both), a main memory 1104 and a static memory 1106, which communicate with each other via a bus 1108. The computer system 1100 may further include a video display unit 110 (e.g., a liquid crystal display (LCD) or a cathode ray tube (CRT)). The computer system 1100 also includes an alphanumeric input device 1112 (e.g., a keyboard), a cursor control device 1114 (e.g., user interface (UI) navigation device or computer mouse), a disk drive unit 1116, a signal generation device 1118 (e.g., a speaker) and a network interface device 1120.
(86) Machine Readable Medium
(87) The disk drive unit 1116 includes a machine-readable medium 1122 on which is stored one or more sets of data structures and instructions 1124 (e.g., software) embodying or used by any one or more of the methodologies or functions described herein. The instructions 1124 may also reside, completely or at least partially, within the main memory 1104, static memory 1106, and/or within the processor 1102 during execution thereof by the computer system 1100, the main memory 1104 and the processor 1102 also constituting machine-readable media.
(88) While the machine-readable medium 1122 is shown in an example embodiment to be a single medium, the term “machine-readable medium” may include a single medium or multiple media (e.g., a centralized or distributed database, and/or associated caches and servers) that store the one or more instructions 1124 or data structures. The term “machine-readable medium” shall also be taken to include any tangible medium that is capable of storing, encoding or carrying instructions for execution by the machine and that cause the machine to perform any one or more of the methodologies of the embodiments of the present invention, or that is capable of storing, encoding or carrying data structures used by or associated with such instructions. The term “machine-readable medium” shall accordingly be taken to include, but not be limited to, solid-state memories, and optical and magnetic media. Specific examples of machine-readable media include non-volatile memory, including by way of example, semiconductor memory devices (e.g., Erasable Programmable Read-Only Memory (EPROM), Electrically Erasable Programmable Read-Only Memory (EEPROM)) and flash memory devices; magnetic disks such as internal hard disks and removable disks; magneto-optical disks; and CD-ROM and DVD-ROM disks. A “machine-readable storage medium” shall also include devices that may be interpreted as transitory, such as register memory, processor cache, and RAM, among others. The definitions provided herein of machine-readable medium and machine-readable storage medium are applicable even if the machine-readable medium is further characterized as being “non-transitory.” For example, any addition of “non-transitory,” such as non-transitory machine-readable storage medium, is intended to continue to encompass register memory, processor cache and RAM, among other memory devices.
(89) Transmission Medium
(90) The instructions 1124 may further be transmitted or received over a communications network 1126 using a transmission medium. The instructions 1124 may be transmitted using the network interface device 1120 and any one of a number of well-known transfer protocols (e.g., HTTP). Examples of communication networks include a LAN, a WAN, the Internet, mobile telephone networks, Plain Old Telephone (POTS) networks, and wireless data networks (e.g., Wi-Fi and WiMax networks). The term “transmission medium” shall be taken to include any intangible medium that is capable of storing, encoding or carrying instructions for execution by the machine, and includes digital or analog communications signals or other intangible media to facilitate communication of such software.
(91) Methods of Treatment
(92) As illustrated herein, the methods of the invention can identify compounds that modulate the function of RNA. For example, several compounds were identified that modulate microRNA function, including compounds 1, 2, and 3 (see,
(93) One aspect of the invention is a method of treatment in a subject in need thereof that includes administering to the mammal a compound identified by the methods described herein to thereby treat the subject. Any of the compounds described herein can be used in such methods. For example, the methods can include administering any of the following compounds to a mammal.
(94) ##STR00004## ##STR00005## ##STR00006##
and any combination thereof, wherein n is any integer of 1 to 10.
(95) As illustrated herein, compounds described herein can increase apoptosis. For example, compounds 1, BSH-2-H and BSH-4-H induce apoptosis by modulation of the miR-96-FOXO1 regulation pathway in breast cancer cells (MCF7 or MDA MB 231 breast cancer cells). As shown in
(96) In some embodiments, compounds identified by the methods described herein can increase apoptosis by at least 10%, or 20%, or 40%, or 50%, or 70%, or 75%, or 100%, or 150%, or 200%, or 300%, or 400%, or 500%, or 700%, or 1000%. Some compounds can increase apoptosis by at least 2-fold, or 3-fold, of 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or by at least 10-fold.
(97) The methods and compositions described herein can be used to treat a variety of cancers and tumors, for example, leukemia, sarcoma, osteosarcoma, lymphomas, melanoma, glioma, pheochromocytoma, hepatoma, ovarian cancer, skin cancer, testicular cancer, gastric cancer, pancreatic cancer, renal cancer, breast cancer, prostate cancer, colorectal cancer, cancer of head and neck, brain cancer, esophageal cancer, bladder cancer, adrenal cortical cancer, lung cancer, bronchus cancer, endometrial cancer, nasopharyngeal cancer, cervical or liver cancer, and cancer at an unknown primary site.
(98) Compositions
(99) The invention also relates to compositions containing one or more small molecules, including any small molecule identified by the methods described herein. The compositions of the invention can be pharmaceutical compositions. In some embodiments, the compositions can include a pharmaceutically acceptable carrier. By “pharmaceutically acceptable” it is meant a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and is not deleterious to the recipient thereof.
(100) The small molecule(s) included in the compositions can be any of the compounds disclosed herein, as well as any compound identified by the methods described herein. Examples include any of the following compounds:
(101) ##STR00007## ##STR00008## ##STR00009##
and any combination thereof, where n is an integer of 1 to 10.
(102) In some embodiments, the small molecules are administered in a “therapeutically effective amount.” Such a therapeutically effective amount is an amount sufficient to obtain the desired physiological effect, e.g., treatment of a condition, disorder, disease and the like or reduction in symptoms of the condition, disorder, disease and the like. For example, the therapeutic agents can be administered to treat a condition, disorder, or disease such as cancer, viral infection, bacterial infection and/or microbial infection.
(103) To achieve the desired effect(s), a small molecule or a combination thereof, may be administered as single or divided dosages. For example, one or more of the small molecules can be administered in dosages of at least about 0.001 mg/kg to about 500 to 750 mg/kg, of at least about 0.01 mg/kg to about 300 to 500 mg/kg, at least about 0.1 mg/kg to about 100 to 300 mg/kg or at least about 1 mg/kg to about 50 to 100 mg/kg of body weight, although other dosages may provide beneficial results. The amount administered will vary depending on various factors including, but not limited to, the molecule, polypeptide, antibody or nucleic acid chosen for administration, the disease, the weight, the physical condition, the health, and the age of the mammal. Such factors can be readily determined by the clinician employing animal models or other test systems that are available in the art.
(104) Administration of the small molecules as therapeutic agents in accordance with the present invention may be in a single dose, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The administration of the small molecules and compositions of the invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
(105) To prepare the composition, the small molecules (and other agents if desired) are synthesized or otherwise obtained, purified as necessary or desired. These small molecules (and other agents if desired) can be suspended in a pharmaceutically acceptable carrier and/or lyophilized or otherwise stabilized. These small molecules (and selected agents if any) can be adjusted to an appropriate concentration, and optionally combined with other agents. The absolute weight of a given small molecule (and other optional agents) included in a unit dose can vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one small molecule can be administered. Alternatively, the unit dosage can vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.
(106) Daily doses of the small molecules of the invention can vary as well. Such daily doses can range, for example, from about 0.1 g/day to about 50 g/day, from about 0.1 g/day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.
(107) It will be appreciated that the amount of small molecules for use in treatment will vary not only with the particular carrier selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient. Ultimately the attendant health care provider may determine proper dosage. In addition, a pharmaceutical composition may be formulated as a single unit dosage form.
(108) Thus, one or more suitable unit dosage forms comprising the small molecules can be administered by a variety of routes including parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), oral, rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes. The small molecules can also be formulated for sustained release (for example, using microencapsulation, see WO 94/07529, and U.S. Pat. No. 4,962,091). The formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to the pharmaceutical arts. Such methods may include the step of mixing the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
(109) The compositions of the invention may be prepared in many forms that include aqueous solutions, suspensions, tablets, hard or soft gelatin capsules, and liposomes and other slow-release formulations, such as shaped polymeric gels. However, administration of small molecules can also involve parenteral or local administration in an aqueous solution or sustained release vehicle.
(110) Liquid pharmaceutical compositions may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, dry powders for constitution with water or other suitable vehicle before use. Such liquid pharmaceutical compositions may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
(111) A compound or small molecule can be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dosage form in ampoules, prefilled syringes, small volume infusion containers or multi-dose containers with an added preservative. The pharmaceutical compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Suitable carriers include saline solution and other materials commonly used in the art.
(112) The compositions can also contain other ingredients such as chemotherapeutic agents, anti-viral agents, antibacterial agents, antimicrobial agents and/or preservatives. Examples of additional therapeutic agents that may be used include, but are not limited to: alkylating agents, such as nitrogen mustards, alkyl sulfonates, nitrosoureas, ethylenimines, and triazenes; antimetabolites, such as folate antagonists, purine analogues, and pyrimidine analogues; antibiotics, such as anthracyclines, bleomycins, mitomycin, dactinomycin, and plicamycin; enzymes, such as L-asparaginase; farnesyl-protein transferase inhibitors; hormonal agents, such as glucocorticoids, estrogens/antiestrogens, androgens/antiandrogens, progestins, and luteinizing hormone-releasing hormone anatgonists, octreotide acetate; microtubule-disruptor agents, such as ecteinascidins or their analogs and derivatives; microtubule-stabilizing agents such as paclitaxel (Taxol®), docetaxel (Taxotere®), and epothilones A-F or their analogs or derivatives; plant-derived products, such as vinca alkaloids, epipodophyllotoxins, taxanes; and topoisomerase inhibitors; prenyl-protein transferase inhibitors; and miscellaneous agents such as, hydroxyurea, procarbazine, mitotane, hexamethylmelamine, platinum coordination complexes such as cisplatin and carboplatin; and other agents used as anti-cancer and cytotoxic agents such as biological response modifiers, growth factors; immune modulators, and monoclonal antibodies. The compounds of the invention may also be used in conjunction with radiation therapy.
(113) Definitions
(114) The terms “small molecule” and “compound” have the same meaning and are used interchangeably.
(115) “Nucleic acid”, as used herein, is meant to refer to RNA and DNA. “RNA”, as used herein, is meant to refer to ribonucleic acid molecules and oligomers. “DNA”, as used herein, is meant to refer to deoxyribonucleic acid molecules and oligomers.
(116) “RNA motif”, as used herein, is meant to refer to a targetable internal loop, hairpin loop, bulge, or other targetable nucleic acid structural motifs, for example, as described in Batey et al., “Tertiary Motifs in RNA Structure and Folding,” Angew. Chem. Int. Ed., 38:2326-2343 (1999), which is hereby incorporated by reference. Examples of RNA motifs include symmetric internal loops, asymmetric internal loops, 1×1 internal loops, 1×2 internal loops, 1×3 internal loops, 2×2 internal loops, 2×3 internal loops, 2×4 internal loops, 3×3 internal loops, 3×4 internal loops, 4×4 internal loops, 4×5 internal loops, 5×5 internal loops, 1 base bulges, 2 base bulges, 3 base bulges, 4 base bulges, 5 base bulges, 4 base hairpin loops, 5 base hairpin loops, 6 base hairpin loops, 7 base hairpin loops, 8 base hairpin loops, 9 base hairpin loops, 10 base hairpin loops, multibranch loops, pseudoknots, etc. RNA motifs have known structures.
(117) “Interacts”, as used herein, is mean to refer to binding or other stabilized association between a small molecule and an RNA motif. The association can be thermodynamically stabilized or kinetically stabilized or both, and the interaction can be the result of covalent bonding, hydrogen bonding, van der Waals interactions, electrostatic interactions, or combinations of these and/or other types of interactions.
(118) The following non-limiting Examples describe some of the experiments performed in developing and validating aspects of the invention.
Example 1: Materials and Methods
(119) This Example describes some of the materials and methods used in developing the invention.
(120) StARTS Analysis
(121) The inventors have previously developed a selection-based strategy referred to as Two-Dimensional Combinatorial Screening (2DCS; Childs-Disney et al., ACS Chem. Biol. 2, 745-754 (2007); Disney et al., J. Am. Chem. Soc. 130, 11185-11194 (2008)) as well as a method to statistically analyze selection data called Structure-Activity Relationships Through Sequencing (StARTS) to identify and annotate (score) RNA motif-small molecule interactions (Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011), the contents of which are specifically incorporated herein by reference in their entireties).
(122) For 2DCS, a small molecule library is conjugated onto an agarose microarray surface. The microarray is then probed for binding to a library of small RNA motifs likely to be found as components of larger cellular RNAs, for example, the 3×3 ILL RNA motif shown in
(123) StARTS is a statistical approach that identifies features in RNA motifs that positively and negatively contribute to binding (Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011). StARTS predicts the affinities and selectivities of RNA-small molecule interactions by comparing the rate of occurrence of a feature in selected RNA motifs (a guanine adjacent to an adenine, for example) to its rate of occurrence in the entire RNA library. The confidence that a selected feature did not occur randomly is assigned a Z-score and a corresponding two-tailed p-value (Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011). Only features that are statistically significant (p≤0.05 or ≥95% confidence) are considered. This analysis identifies features that contribute positively (positive Z-score) and negatively (negative Z-score) to binding, allowing prediction of which RNAs bind and which RNAs do not. Each RNA motif has many statistically significant features. Therefore, the Z-scores for each feature are summed to afford a ΣZ-score (
(124) By combining statistical parameters from StARTS with experimentally determined binding affinities, the affinity and selectivity of every RNA motif displayed in a library can be predicted. The selectivity of a selected RNA for different small molecules can be predicted by comparing its ΣZ-score for one small molecule to its ΣZ-score for another. For example, an RNA that has a large ΣZ-score for small molecule A and a small ΣZ-score for small molecule B is selective for small molecule A. Fitness Scores are normalized to the RNA motif with the highest ΣZ-score.
(125) A database of RNA motif-small molecule interactions and their corresponding StARTS analyses were used to identify lead small molecules that may modulate the function of microRNAs. The current version of the database of RNA motif-small molecule interactions consists of 794 RNA motifs and 11 small molecules.
(126) All human precursor miRNAs (1,048) were downloaded from miRBase (v. 16) (Griffiths-Jones et al., Nucleic Acids Res. 34, D140-144 (2006); Griffiths-Jones et al., Nucleic Acids Res. 36, D154-158 (2008)), and their secondary structures were predicted using the free energy minimization program RNAstructure (Mathews et al., Proc. Natl. Acad. Sci. U.S.A. 101, 7287-7292 (2004)). Note that secondary structure prediction is considered structure determination for microRNAs (Ambros et al., RNA 9, 277-279 (2003)). Inforna parsed the secondary structural motifs and compared them to the database of RNA motif-small molecule interactions. A total of 1,668 RNA motif-small molecule hits were obtained. Of those hits, 26 motifs are internal loops located in either Drosha or Dicer processing sites of miRNAs that are implicated in disease and that have been validated for modulation of the disease by oligonucleotides. Only RNA motifs that are in processing sites (by Drosha or Dicer) of miRNAs associated with diseases are listed. Inforna provided an output of the targetable motifs in each RNA, and the corresponding small molecules that bind those RNAs. A subset of the results is provided in Table 1, where column 1 represents the serial number of the microRNA hits (1-22), column 4 (labeled “Small) identifies the small molecule by number (1-9), column 6 is the Pubmed reference for the microRNA disease association, column 7 (labeled “Up or Down”) shows whether the microRNA is up-regulated or down-regulated in the disease indicated in column 5. The numbers “4” and “6” in the last two rows of Table 1 indicate that are two small molecules “4” and “6” that target pre-miR-885.
(127) TABLE-US-00001 TABLE 1 Hits obtained from searching the RNA motifs in miRBase (v. 16) for overlap with the database of RNA motif-small molecule interactions using inforna. microRNA Loop Small Disease PubMed ID Up or Down 1 pre-miR-34c 5′GCU/ 6 pancreatic 19714243 Down 3′CCA cancer Parkinson′s 21558425 Down disease Alzheimer′s 21946562 Down disease melanoma 22102694 Down breast cancer 22074923 Down 2 pre-miR-92a-2 5′CCU/ 6 lymphoma 21383985 Down 3′GUG hepatocellular 16331254 Up carcinoma glioblastoma 22895567 Up colorectal 21826996 Up neoplasm 3 pre-miR-96 5′UUU/ 1 breast neoplasm 19574223 Up 3′AUA breast neoplasm 21203424 Up urinary bladder 21166959 Up neoplasm heptaocellular 22160187 Up neoplasm prostatic 22045813 Up neoplasm colorectal 22844381 Up neoplasm 4 pre-miR-130b 5′UAC/ 6 stomach 20176475 Up 3′ACG neoplasms chronic myeloid 21638198 Up leukemia 5 pre-miR-181c 5′GAG/ 9 acute myeloid 22251480 Up 3′C_C leukemia (bulge) 6 pre-miR-182 5′UUUU/ 3 melanoma 19188590 Up 3′AUCA prostatic 19267923 Up neoplasms glioma 20406893 Up breast neoplasm 19574223 Up acute leukemia 20227111 Up endometrial 20028871 Up neoplasm lung cancer 21904633 Up prostatic 22045813 Up neoplasm ovarian 22322863 Up neoplasm 7 pre-miR-210 5′ACU/ 2 ischemic heart 20837903 Up 3′UCA disease 7 renal carcinoma 21465485 Up 8 pre-miR-301a 5′UAC/ 6 pancreatic 22628193 Up 3′ACG cancer colorectal 23393589 Up cancer 9 pre-miR-301b 5′UCU/ 1 breast cancer 21393507 Up 3′AAA 10 pre-miR-320c 5′UCU/ 1 breast cancer 21393507 Up 3′AAA 11 pre-miR-320d-1 5′UCU/ 1 breast cancer 21393507 Up 3′AAA Kaposi′s sarcoma 23418466 Down 12 pre-miR-378 5′GGC/ 8 stomach neoplasms 19175831 Down 3′CGG leukemia 19022373 Down melanoma 20529253 Down neoplasms 21242960 Up/Down (Myc regulator) non-small cell 22052152 Up lung cancer colorectal 22469014 Down neoplasm 13 pre-miR-433 5′UUA/ 1 Parkinson′s 18252210 Up 3′ACU disease 14 pre-miR-449c 5′GUA/ 1 stomach neoplasm 21418558 Down 3′UCU 15 pre-miR-515-1 5′UUC/ 7 squamous cell 21244772 Up 3′GCG neoplasm 16 pre-miR-515-2 5′UCA/ 4 squamous cell 21244772 Up 3′AUU neoplasm 7 stomach neoplasm 22112324 Up 17 pre-miR-517c 5′CCC/ 6 hepatocellular 22027761 Up 3′GUG carcinoma 9 18 pre-miR-518e 5′CCC/ 9 melanoma 20529253 Down 3′GUG 19 pre-miR-519d 5′CCC/ 9 breast neoplasm 20331864 Up 3′GUG hepatocellular 21524841 Down neoplasm hepatocellular 22262409 Up neoplasm 20 pre-miR-525 5′CUC/ 9 hepatocellular 22362728 Up 3′GCG carcinoma 21 pre-miR-661 5′AGG/ 6 breast neoplasm 20543867 Up 3′UGC stomach neoplasm 22112324 Down 22 pre-miR-885 5′UCU/ 4 squamous cell 22071691 Down 3′AUA neoplasm 6
(128) StARTS analyses were used to determine the fitness of a small molecule for binding the RNA target of interest identified as output by inforna (Table 1;
(129) Compound 1 was predicted by inforna to bind other pre-microRNAs, including pre-microRNA-301b, 320c, 320d-1, 433 and 449c, which may indicate that the compound is non-selective. However, StARTS analysis predicts that 1 binds the targetable loop in pre-microRNA-449c with low affinity (
(130) A number of compounds were evaluated as described herein including, for example, compounds 1, 2, 3, 4 and 5 shown below:
(131) ##STR00010##
While compounds 1, 2, 4 and 5 share some structural features, the structure of compound 3 is quite different from the others shown above.
(132) 2DCS selection was completed for three compounds that are chemically similar to compound 1: compounds 2, 4, and 5 (Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011). Visual inspection suggests that 2 and 4 might bind RNA with higher affinity than 1 because of their larger surface areas that could stack on RNA bases and because of the presence of additional hydrogen bond donors and acceptors. However, StARTS analysis predicts that 2 and 4 bind weakly to the targetable loop in the miR-96 precursor, which is in excellent agreement with the in vivo data (
(133) DNA Templates and PCR Amplification
(134) The RNA motifs (internal loops) used in these studies were embedded into a hairpin cassette, C1 (
(135) The miR-96 precursor used in nuclease protection assays was modified to contain a 5′-GGG overhang to facilitate transcription using T7 RNA polymerase, or GGG-pre-microRNA-96. There was no change in the lowest free energy secondary structure predicted by RNAstructure (Mathews et al., Proc. Natl. Acad. Sci. U.S.A. 101, 7287-7292 (2004)), and nuclease protection assays confirm that the predicted structure is adopted in solution (
(136) TABLE-US-00002 C1: (SEQ ID NO: 1) 5′-GGGAGAGGGTTTAATTACGAAAGTAATTGGATCCGCAAGG; 5′UUU/3′AUA: (SEQ ID NO: 8) 5′-GGGAGAGGGTTTAATTTTACGAAAGTAATATTGGATCCGCAAGG; 5′CGAUUU/3′GGUAUA: (SEQ ID NO: 9) 5′-GGGAGAGGGTTTAATCCGATTTTACGAAAGTAATATGGGATTGGATC CGCAAGG; and GGG-pre-microRNA-96: (SEQ ID NO: 22) 5′GGGTGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCTCCGCT CTGAGCAATCATGTGCAGTGCCAATATGGGAAA.
RNA Transcription
(137) RNA oligonucleotides were in vitro transcribed by T7 RNA polymerase in 1X Transcription Buffer (40 mM Tris HCl, pH 8.1, 1 mM spermidine, 0.001% (v/v) Triton X-100 and 10 mM DTT) (McKenna et al., Nat. Protoc. 2, 3270-3277 (2007)) containing 2.25 mM of each rNTP and 5 mM MgCl.sub.2 at 37° C. overnight. The transcribed RNAs were purified on a denaturing 15% polyacrylamide gel and isolated as previously described by Childs-Disney et al., ACS Chem. Biol. 2, 745-754 (2007). Concentrations were determined by absorbance at 260 nm and the corresponding extinction coefficient. Extinction coefficients were calculated using the HyTher server (Peyret et al., Biochemistry 38, 3468-3477 (1999); SantaLucia et al., Proc. Natl. Acad. Sci. U.S.A. 95, 1460-1465 (1998)), which uses parameters based on the extinction coefficients of RNA nearest neighbors (Puglisi & Tinoco, Methods Enzymol. 180, 304-325 (1989)).
(138) Binding Affinity Measurements
(139) Dissociation constants were determined using an in solution, fluorescence-based assay (Disney et al., J. Am. Chem. Soc. 130, 11185-11194 (2008)). The RNA of interest was folded in 1X Assay Buffer (8 mM Na.sub.2HPO.sub.4, pH 7.0, 190 mM NaCl, 1 mM EDTA and 40 μg/mL BSA) by heating at 60° C. for 5 min and slowly cooling to room temperature. A selected fluorescently labeled compound was added to a final concentration of 50 nM for compounds 1-Fl, 4-Fl, and 5-Fl or 500 nM for compound 2. Serial dilutions (1:2) were then completed in 1× Assay Buffer supplemented with 50 nM of compounds 1-Fl, 4-Fl, or 5-Fl or 500 nM of 2. The solutions were incubated for 30 min at room temperature and then transferred to a 96-well plate and fluorescence intensity measured. The change in fluorescence intensity as a function of RNA concentration was fit to the following equation (Wang & Rando, Chem. Biol. 2, 281-290. (1995).):
I=I.sub.0+0.5Δε(([FL].sub.0+[RNA].sub.0+K.sub.t)−(([FL].sub.0+[RNA].sub.0+K.sub.t).sup.2−4[FL].sub.0[RNA].sub.0).sup.0.5)
where I and I.sub.0 are the observed fluorescence intensity in the presence and absence of RNA respectively, Δε is the difference between the fluorescence intensity in the absence of RNA and in the presence of infinite RNA concentration, [FL].sub.0 and [RNA].sub.0 are the concentrations of small molecule and RNA, respectively, and K.sub.t is the dissociation constant.
(140) The targetable loops (motifs) were embedded into C1 (
(141) Nuclease Protection Assays
(142) GGG-pre-microRNA-96 was 5′ end labeled with .sup.32P as previously described by Disney et al. (Biochemistry 39, 14269-14278 (2000)).
(143) For double stranded-RNA specific endoribonuclease cleavage the RNA was folded in 1× Reaction Buffer (Ambion) by heating at 60° C. for 5 min and slowly cooling to room temperature. Double stranded-RNA specific endoribonuclease (Escherichia coli RNase III; Ambion) was then added to a final concentration of 0.15 units/μL followed by addition of serially diluted concentrations of compound 1. The solution was incubated at 37° C. for 2 h, and the cleavage products were separated on a denaturing 15% polyacrylamide gel.
(144) For RNase T1 Cleavage, the RNA was folded in either 1× RNA Sequencing Buffer (Ambion; denaturing conditions) or in 1× RNA Structure Buffer (Ambion; native conditions) by incubating it at 55° C. for 10 min followed by slowly cooling to room temperature. RNase T1 was added to a final concentration of 0.1 units/μL followed by addition of serially diluted concentrations of 1. The solution was incubated at room temperature for 15 min, and the cleaved products were separated on a denaturing 15% polyacrylamide gel.
(145) Preparation of Cell Extracts Containing Drosha
(146) Drosha is a Class 2 RNase III enzyme that initiates the processing of microRNA (miRNA), or short RNA molecules naturally expressed by cells.
(147) HEK 293T cells were maintained in DMEM supplemented with 10% FBS in a T-75 flask. After cells reached 70% confluence, they were transfected with Drosha-cmyc51, obtained from Addgene (Addgene plasmid 10828) using Lipofectamine 2000 (Invitrogen) per the manufacturer's protocol. Approximately 48 h post-transfection, the cells were collected by scrapping them in 1 mL ice-cold 1× DPBS followed by centrifugation at 6000 rpm for 5 min at 4° C. The cells were resuspended in 500 μL of 1× Lysis Buffer (20 mM Tris HCl, pH 8.0, 100 mM KCl and 0.2 mM EDTA) and sonicated for 30 seconds. Cellular debris was pelleted by centrifugation (12000 rpm for 15 min at 4° C.), and the supernatant containing Drosha was transferred to a new tube.
(148) Inhibition of Drosha Cleavage In Vitro
(149) The cDNA template for pri-miRNA-96 was PCR amplified from MCF7 genomic DNA using the following primers:
(150) forward primer: 5′GGCCGAATTCTAATACGACTCACTATAGGC ACCAGTGCCATCTGCTT (SEQ ID NO:23); and reverse primer: 5′-CGCAGCTGCGGGTCCT (SEQ ID NO: 232). The forward primer contains a T7 promoter that was employed to produce pri-miR-96 via run-off transcription as described herein. Internally labeled pri-miR-96 was transcribed using α-.sup.32P ATP and purified using a denaturing 10% polyacrylamide gel. In order to determine if compound 1 inhibits Drosha cleavage in vitro, 2 μL of .sup.32P-labeled pri-miR-96 (approx. 10,000 counts) and 40 μM of compound 1 were incubated in 6.4 mM MgCl.sub.2 (30 μL total volume) at room temperature for 10 min. (Untreated controls included 0.04% DMSO, the same concentration as in treated samples). Then, 1 μL of the Drosha-cmyc lysate was added, and the samples were incubated at 37° C. for 3 h. The reactions were quenched by phenol-chloroform extraction followed by ethanol precipitation. The resulting pellet was dissolved in 10 μL of 2× Gel Loading Buffer (8 M urea, 50 mM EDTA, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanol), and the reaction products were separated on a denaturing 10% acrylamide gel.
Cell Culture
(151) Cells (e.g., from the MCF7 breast cancer cell line) were cultured in Dulbecco's modified eagle medium/F12 (DMEM/F12) supplemented with 10% FBS (complete growth medium) at 37° C. and 5% CO.sub.2.
(152) Plasmids
(153) Luciferase constructs are those describe by Guttilla & White (J. Biol. Chem. 284, 23204-23216 (2009)).
(154) RNA Isolation and Quantitative Real Time Polymerase Chain Reaction (qRT-PCR) of miRNAs
(155) MCF7 cells were cultured in either 6-well or 12-well plates, and total RNA was extracted using TRIzol LS reagent (Ambion) per the manufacturer's protocol. Approximately 200 ng of total RNA was used in reverse transcription (RT) reactions, which were completed using a Tagman MicroRNA RT Kit (Applied Biosystems) or a miScript II RT kit (Qiagen) per the manufacturer's protocol. qRT-PCR was performed on a 7900HT Fast Real Time PCR System (Applied Biosystem) using Taqman Universal PCR Master Mix or power SYBR green master mix (Applied Biosystems). All primer sets for mature miRNAs were purchased from Applied Biosystems. The expression level of mature miRNAs was normalized to U6 small nuclear RNA.
(156) Pri-, pre-, and mature miR-96 RT-PCR products were analyzed on a denaturing 10% polyacrylamide gel stained with ethidium bromide. Expression levels were normalized to GAPDH. The primers used for pre- and pri-miR-96 and GAPDH were purchased from IDT and have the sequences shown in Table 2.
(157) TABLE-US-00003 TABLE 2 Sequences of forward primers used for an SYBR qRT-PCR system to profile the effect of compound 1 on other miRNAs and the sequences of the universal reverse primer. Also listed are forward and reverse primers for pri-miR-96, pre-miR-96, and GAPDH. SEQ ID MicroRNA Primer Sequence NO: hsa-miR-212 TAACAGTCTCCAGTCACGGCC 24 hsa-miR-346 TGTCTGCCCGCATGCCTGCCTCT 25 hsa-miR-194 TGTAACAGCAACTCCATGTGGA 26 hsa-miR-196b TAGGTAGTTTCCTGTTGTTGGG 27 hsa-miR-196a TAGGTAGTTTCATGTTGTTGGG 28 hsa-miR-106b TAAAGTGCTGACAGTGCAGAT 29 hsa-miR-210 CTGTGCGTGTGACAGCGGCTGA 30 hsa-miR-214 ACAGCAGGCACAGACAGGCAGT 31 hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG 32 hsa-miR-514 ATTGACACTTCTGTGAGTAGA 33 hsa-miR-29c TAGCACCATTTGAAATCGGTTA 34 hsa-miR-410 AATATAACACAGATGGCCTGT 35 hsa-miR-198 GGTCCAGAGGGGAGATAGGTTC 36 hsa-let-7i TGAGGTAGTAGTTTGTGCTGTT 37 hsa-miR-188-5p CATCCCTTGCATGGTGGAGGG 38 hsa-miR-92a TATTGCACTTGTCCCGGCCTGT 39 hsa-miR-126 TCGTACCGTGAGTAATAATGCG 40 hsa-miR-181c AACATTCAACCTGTCGGTGAGT 41 hsa-miR-30b TGTAAACATCCTACACTCAGCT 42 hsa-miR-183 TATGGCACTGGTAGAATTCACT 43 hsa-miR-30c TGTAAACATCCTACACTCTCAGC 44 hsa-miR-421 ATCAACAGACATTAATTGGGCGC 45 hsa-miR-193b AACTGGCCCTCAAAGTCCCGCT 46 hsa-miR-651 TTTAGGATAAGCTTGACTTTTG 47 hsa-miR-15a TAGCAGCACATAATGGTTTGTG 48 hsa-miR-301b CAGTGCAATGATATTGTCAAAGC 49 hsa-miR-18b TAAGGTGCATCTAGTGCAGTTAG 50 hsa-miR-15b TAGCAGCACATCATGGTTTACA 51 hsa-miR-10a TACCCTGTAGATCCGAATTTGTG 52 hsa-miR-26b TTCAAGTAATTCAGGATAGGT 53 hsa-let-7a TGAGGTAGTAGGTTGTATAGTT 54 hsa-miR-506 TAAGGCACCCTTCTGAGTAGA 55 hsa-let-7g TGAGGTAGTAGTTTGTACAGTT 56 hsa-miR-25 CATTGCACTTGTCTCGGTCTGA 57 hsa-miR-433 ATCATGATGGGCTCCTCGGTGT 58 hsa-miR-144 TACAGTATAGATGATGTACT 59 hsa-miR-32 TATTGCACATTACTAAGTTGCA 60 hsa-miR-200c TAATACTGCCGGGTAATGATGGA 61 hsa-miR-29a TAGCACCATCTGAAATCGGTTA 62 hsa-miR-497 CAGCAGCACACTGTGGTTTGT 63 hsa-miR-548b-3p CAAGAACCTCAGTTGCTTTTGT 64 hsa-miR-24 TGGCTCAGTTCAGCAGGAACAG 65 hsa-miR-187 TCGTGTCTTGTGTTGCAGCCGG 66 hsa-miR-18a TAAGGTGCATCTAGTGCAGATAG 67 hsa-miR-222 AGCTACATCTGGCTACTGGGT 68 hsa-miR-9 TCTTTGGTTATCTAGCTGTATGA 69 hsa-miR-125b TCCCTGAGACCCTAACTTGTGA 70 hsa-miR-365 TAATGCCCCTAAAAATCCTTAT 71 hsa-miR-10b TACCCTGTAGAACCGAATTTGTG 72 hsa-let-7c TGAGGTAGTAGGTTGTATGGTT 73 hsa-miR-185 TGGAGAGAAAGGCAGTTCCTGA 74 hsa-miR-648 AAGTGTGCAGGGCACTGGT 75 hsa-miR-206 TGGAATGTAAGGAAGTGTGTGG 76 hsa-miR-124 TAAGGCACGCGGTGAATGCC 77 hsa-miR-132 TAACAGTCTACAGCCATGGTCG 78 hsa-miR-519b-5p CTCTAGAGGGAAGCGCTTTCTG 79 hsa-miR-148b TCAGTGCATCACAGAACTTTGT 80 hsa-miR-125a-5p TCCCTGAGACCCTTTAACCTGTGA 81 hsa-miR-20b CAAAGTGCTCATAGTGCAGGTAG 82 hsa-miR-512-3p AAGTGCTGTCATAGCTGAGGTC 83 hsa-miR-186 CAAAGAATTCTCCTTTTGGGCT 84 hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC 85 hsa-miR-622 ACAGTCTGCTGAGGTTGGAGC 86 hsa-miR-429 TAATACTGTCTGGTAAAACCGT 87 hsa-miR-23a ATCACATTGCCAGGGATTTCC 88 hsa-miR-485-3p GTCATACACGGCTCTCCTCTCT 89 hsa-miR-19b TGTGCAAATCCATGCAAAACTGA 90 hsa-miR-141 TAACACTGTCTGGTAAAGATGG 91 hsa-miR-103 AGCAGCATTGTACAGGGCTATGA 92 hsa-miR-96 TTTGGCACTAGCACATTTTTGCT 93 hsa-miR-23b ATCACATTGCCAGGGATTACC 94 hsa-miR-152 TCAGTGCATGACAGAACTTGG 95 hsa-miR-610 TGAGCTAAATGTGTGCTGGGA 96 hsa-miR-203 GTGAAATGTTTAGGACCACTAG 97 hsa-miR-127-3p TCGGATCCGTCTGAGCTTGGCT 98 hsa-miR-134 TGTGACTGGTTGACCAGAGGGG 99 hsa-let-7f TGAGGTAGTAGATTGTATAGTT 100 hsa-miR-122 TGGAGTGTGACAATGGTGTTTG 101 hsa-miR-142-3p TGTAGTGTTTCCTACTTTATGGA 102 hsa-miR-34a TGGCAGTGTCTTAGCTGGTTGT 103 hsa-miR-24 TGGCTCAGTTCAGCAGGAACAG 104 hsa-miR-187 TCGTGTCTTGTGTTGCAGCCGG 105 hsa-miR-18a TAAGGTGCATCTAGTGCAGATAG 106 hsa-miR-222 AGCTACATCTGGCTACTGGGT 107 hsa-miR-9 TCTTTGGTTATCTAGCTGTATGA 108 hsa-miR-125b TCCCTGAGACCCTAACTTGTGA 109 hsa-miR-365 TAATGCCCCTAAAAATCCTTAT 110 hsa-miR-10b TACCCTGTAGAACCGAATTTGTG 111 hsa-let-7c TGAGGTAGTAGGTTGTATGGTT 112 hsa-miR-185 TGGAGAGAAAGGCAGTTCCTGA 113 hsa-miR-648 AAGTGTGCAGGGCACTGGT 114 hsa-miR-206 TGGAATGTAAGGAAGTGTGTGG 115 hsa-miR-124 TAAGGCACGCGGTGAATGCC 116 hsa-miR-132 TAACAGTCTACAGCCATGGTCG 117 hsa-miR-519b-5p CTCTAGAGGGAAGCGCTTTCTG 118 hsa-miR-148b TCAGTGCATCACAGAACTTTGT 119 hsa-miR-125a-5p TCCCTGAGACCCTTTAACCTGTGA 120 hsa-miR-20b CAAAGTGCTCATAGTGCAGGTAG 121 hsa-miR-512-3p AAGTGCTGTCATAGCTGAGGTC 122 hsa-miR-186 CAAAGAATTCTCCTTTTGGGCT 123 hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC 124 hsa-miR-622 ACAGTCTGCTGAGGTTGGAGC 125 hsa-miR-429 TAATACTGTCTGGTAAAACCGT 126 hsa-miR-23a ATCACATTGCCAGGGATTTCC 127 hsa-miR-485-3p GTCATACACGGCTCTCCTCTCT 128 hsa-miR-19b TGTGCAAATCCATGCAAAACTGA 129 hsa-miR-141 TAACACTGTCTGGTAAAGATGG 130 hsa-miR-103 AGCAGCATTGTACAGGGCTATGA 131 hsa-miR-96 TTTGGCACTAGCACATTTTTGCT 132 hsa-miR-23b ATCACATTGCCAGGGATTACC 133 hsa-miR-152 TCAGTGCATGACAGAACTTGG 134 hsa-miR-610 TGAGCTAAATGTGTGCTGGGA 135 hsa-miR-203 GTGAAATGTTTAGGACCACTAG 136 hsa-miR-127-3p TCGGATCCGTCTGAGCTTGGCT 137 hsa-miR-134 TGTGACTGGTTGACCAGAGGGG 138 hsa-let-7f TGAGGTAGTAGATTGTATAGTT 139 hsa-miR-122 TGGAGTGTGACAATGGTGTTTG 140 hsa-miR-142-3p TGTAGTGTTTCCTACTTTATGGA 141 hsa-miR-34a TGGCAGTGTCTTAGCTGGTTGT 142 hsa-miR-19a TGTGCAAATCTATGCAAAACTGA 143 hsa-miR-130b CAGTGCAATGATGAAAGGGCAT 144 hsa-miR-128a TCACAGTGAACCGGTCTCTTT 145 hsa-miR-182 TTTGGCAATGGTAGAACTCACACT 146 hsa-miR-135b TATGGCTTTTCATTCCTATGTGA 147 hsa-miR-34c-5p AGGCAGTGTAGTTAGCTGATTGC 148 hsa-miR-1 TGGAATGTAAAGAAGTATGTAT 149 hsa-miR-143 TGAGATGAAGCACTGTAGCTC 150 hsa-miR-338-3p TCCAGCATCAGTGATTTTGTTG 151 hsa-miR-138 AGCTGGTGTTGTGAATCAGGCCG 152 hsa-miR-27a TTCACAGTGGCTAAGTTCCGC 153 hsa-miR-27b TTCACAGTGGCTAAGTTCTGC 154 hsa-miR-320 AAAAGCTGGGTTGAGAGGGCGA 155 hsa-miR-16 TAGCAGCACGTAAATATTGGCG 156 hsa-miR-100 AACCCGTAGATCCGAACTTGTG 157 hsa-miR-140-3p TACCACAGGGTAGAACCACGG 158 hsa-miR-590-5p GAGCTTATTCATAAAAGTGCAG 159 hsa-miR-135a TATGGCTTTTTATTCCTATGTGA 160 hsa-miR-378 ACTGGACTTGGAGTCAGAAGG 161 hsa-miR-139-5p TCTACAGTGCACGTGTCTCCAG 162 hsa-miR-331-5p CTAGGTATGGTCCCAGGGATCC 163 hsa-miR-342-3p TCTCACACAGAAATCGCACCCGT 164 hsa-miR-99a AACCCGTAGATCCGATCTTGTG 165 hsa-miR-517a ATCGTGCATCCCTTTAGAGTGT 166 hsa-miR-489 GTGACATCACATATACGGCAGC 167 hsa-miR-20a TAAAGTGCTTATAGTGCAGGTAG 168 hsa-miR-218 TTGTGCTTGATCTAACCATGT 169 hsa-miR-101 TACAGTACTGTGATAACTGAA 170 hsa-miR-205 TCCTTCATTCCACCGGAGTCTG 171 hsa-miR-98 TGAGGTAGTAAGTTGTATTGTT 172 hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT 173 hsa-miR-181b AACATTCATTGCTGTCGGTGGGT 174 hsa-miR-30a TGTAAACATCCTCGACTGGAAG 175 hsa-miR-21 TAGCTTATCAGACTGATGTTGA 176 hsa-miR-140-5p CAGTGGTTTTACCCTATGGTAG 177 hsa-miR-302a TAAGTGCTTCCATGTTTTGGTGA 178 hsa-miR-29b TAGCACCATTTGAAATCAGTGTT 179 hsa-miR-590-3p TAATTTTATGTATAAGCTAGT 180 hsa-let-7d AGAGGTAGTAGGTTGCATAGTT 181 hsa-miR-519c-3p AAAGTGCATCTTTTTAGAGGAT 182 hsa-miR-181a AACATTCAACGCTGTCGGTGAGT 183 hsa-miR-181d AACATTCATTGTTGTCGGTGGGT 184 hsa-miR-301a CAGTGCAATAGTATTGTCAAAGC 185 hsa-miR-150 TCTCCCAACCCTTGTACCAGTG 186 hsa-miR-298 AGCAGAAGCAGGGAGGTTCTCCCA 187 hsa-miR-137 TTATTGCTTAAGAATACGCGTAG 188 hsa-miR-127-5p CTGAAGCTCAGAGGGCTCTGAT 189 hsa-miR-133a TTTGGTCCCCTTCAACCAGCTGAA 190 hsa-miR-153 TTGCATAGTCACAAAAGTGATC 191 hsa-miR-193a-3p AACTGGCCTACAAAGTCCCAGTAA 192 hsa-miR-216a TAATCTCAGCTGGCAACTGTGAAA 193 hsa-miR-217 TACTGCATCAGGAACTGATTGGAAA 194 hsa-miR-224 CAAGTCACTAGTGGTTCCGTT 195 hsa-miR-199a-5p CCCAGTGTTCAGGCTACCTGTTC 196 hsa-miR-200a TAACACTGTCTGGTAACGATGTAA 197 hsa-miR-302a* TAAACGTGGATGTACTTGCT 198 hsa-miR-326 TGGGCCCTTCCTCCAGAA 199 hsa-miR-33b GTGCATTGCTGTTGCATTGC 200 hsa-miR-139-3p GGAGACGCGGCCCTGTTGGAGT 201 hsa-miR-451 CCGTTACCATTACTGAGTTAA 202 hsa-miR-324-3p ACTGCCCCAGGTGCTGCTGG 203 hsa-miR-509-3-5p GGGTACTGCAGACGTGGCAATCATG 204 hsa-miR-483-3p TCACTCCTCTCCTCCCGTCTT 205 hsa-miR-146b-3p CTGTGGACTCAGTTCTGGAA 206 hsa-miR-34b AATCACTAACTCCACTGCCATC 207 hsa-miR-371-5p CAAACTGTGGGGGCACTAA 208 hsa-miR-488* CCCAGATAATGGCACT 209 hsa-miR-513a-3p TTTCACCTTTCTGAGAAGGAA 210 hsa-miR-513b TTCACAAGGAGGTGTCATTTAT 211 hsa-miR-449b GCCAGCAGGCAGTGTATTGTTAGCTGGC 212 hsa-miR-486-5p TCCTGTACTGAGCTGCCCCGAG 213 hsa-miR-1246 AATGGATTTTTGGAGCAGG 214 hsa-miR-1245 AAGTGATCTAAAGGCCTACAT 215 SNORD48 CCCCAGGTAACTCTTGAGTGT 216 SNORD47 TAATGATATCACTGTAAAACC 217 SNORD44 ATGCTGACTGAACATGAAGGTC 218 RNU6 ACACGCAAATTCGTGAAGCGTTC 219 Universal GAATCGAGCACCAGTTACGC 220 Reverse Pre-miRNA-96-F ATTTTGGCACTAGCACATTTTTGCT 221 Pre-miRNA-96-R CCATATTGGCACTGCACATGATT 222 Pri-miRNA-96-F AGAGAGCCCGCACCAGT 223 Pri-miRNA-96-R CTTGAGGAGGAGCAGGCT 224 GAPDH-F AAGGTGAAGGTCGGAGTCAA 225 GAPDH-R AATGAAGGGGTCATTGATGG 226
Transcriptome-Wide Profiling of Mature MicroRNAs by qRT-PCR
(158) MCF7 cells were cultured and total RNA was extracted as described above. Approximately 1 μg of total RNA was used in RT reactions, which were completed using miScript II RT kit (Qiagen) per the manufacturer's protocol. qRT-PCR was performed using power SYBR green master mix (Applied Biosystems) on a 7900HT Fast Real Time PCR System. All forward primers were purchased from Life Technologies while the universal reverse primer was purchased from IDT (Table 2). Expression levels were normalized using RNU6, SNORD44, SNORD47 and SNORD48.
(159) Dual Luciferase Assay
(160) MCF7 cells were grown in 96-well plates to ˜80% confluency in complete growth medium. The cells were transiently transfected with 100 ng of plasmid encoding either the miR-96 3′ UTR target or a mutated 3′ UTR target using Lipofectamine 2000 per the manufacturer's protocol. Approximately 5 h post transfection, the small molecule of interest was added in complete growth medium, and the cells were incubated for another 20 h. Luciferase activity was then measured using a Dual Glo Luciferase Assay System (Promega) per the manufacturer's protocol. The values reported are the average of at least three measurements, and errors are the corresponding standard deviations.
(161) Western Blotting
(162) MCF7 cells were grown in 6-well plates to ˜80% confluency in complete growth medium. The cells were then incubated with 40 μM of 1 for 20 h. Total protein was extracted using M-PER Mammalian Protein Extraction Reagent (Pierce Biotechnology) using the manufacturer's protocol. Extracted total protein was quantified using a Micro BCA Protein Assay Kit (Pierce Biotechnology). Approximately 40 μg of total protein was resolved on an 8% SDS-polyacrylamide gel, and then transferred to a PVDF membrane. The membrane was briefly washed with 1× Tris-buffered saline (TBS), and then blocked in 5% milk in 1× TBST (1× TBS containing 0.1% Tween-20) for 1 h at room temperature. The membrane was then incubated in 1:1000 FOXO1 primary antibodies (Cell Signaling Technology) in 1× TBST containing 3% BSA overnight at 4° C. The membrane was washed with 1× TBST and incubated with 1:2000 anti-rabbit IgG horseradish-peroxidase secondary antibody conjugate (Cell Signaling Technology) in 1× TBS for 1 h at room temperature. After washing with 1× TBST, protein expression was quantified using SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology) per the manufacturer's protocol. The membrane was then stripped using 1× Stripping Buffer (200 mM glycine, pH 2.2 and 0.1% SDS) followed by washing in 1× TBS. The membrane was blocked and probed for GAPDH following the same procedure described above using 1:2000 GAPDH primary antibodies (Abeam). Image J software from the National Institutes of Health was used to quantify band intensities.
(163) siRNA Treatment
(164) ON-TARGETplus SMARTpool FOXO1 siRNA and ONTARGETplus GAPD Control Pool were purchased from Dharmacon (Thermo Scientific) and were used at a final concentration of 100 nM. MCF7 cells were reverse transfected in a 6-well plate using Lipofectamine RNAiMAX reagent (Invitrogen) per the manufacturer's protocol.
(165) APO BrdU TUNEL Assay
(166) MCF7 cells were grown in 6-well plates to 70-80% confluency. For experiments in which RNAi was used to knock down FOXO1 or GAPDH expression, the cells were first transfected as described above. Cells were treated with small molecules for 20 h followed by completion of an APO BrdU TUNEL assay (Molecular Probes) per the manufacturer's protocol. Flow cytometry was performed using a BD LSRII instrument (BD Biosciences). At least 10,000 events were used for analysis.
(167) Annexin V/PI Assays
(168) Annexin V staining was used as an indicator of apoptosis. In normal cells phosphatidylserine is located on the cytoplasmic surface of cell membrane. In apoptotic cells, phosphatidylserine is translocated to the outer leaflet of plasma membrane. Such translocation exposes phosphadidylserine, so that it can be stained by Annexin V, which has high affinity for phosphatidylserine.
(169) MCF7 cells were grown in 6-well plates to 70-80% confluency. The cells were incubated with 40 μM of compound 1 for 20 h and then detached from the surface using accutase. They were washed twice each with ice cold 1× DPBS and 1× Annexin Binding Buffer (50 mM Hepes (pH 7.4), 700 mM NaCl and 12.5 mM CaCl.sub.2). The cells were resuspended in 100 μL 1× Annexin Binding Buffer, and then 5 μL Annexin V-APC (eBioscience) were added. The solution was incubated for 10 min at room temperature followed by washing with 1× Annexin Binding Buffer. The cells were then stained with 1 μg/mL propidium iodide in 300 μL of 1× Annexin Binding Buffer for 15 min at room temperature. Flow cytometry was performed using a BD LSRII instrument (BD Biosciences). At least 10,000 events were used for analysis.
(170) Cellular Permeability
(171) MCF7 cells were grown in 6-well plates to ˜80% confluency in complete growth medium. Then, 10 μM of the indicated small molecule was added, and the cells were incubated for 20 h. The cells were trypsinized from the plate, washed twice with 1× DPBS, and stained with 1 μg/mL PI for 30 min on ice. Cellular permeability was quantified by flow cytometry using a BD LSRII flow cytometer (BD Biosciences) and Hoechst filters. At least 10,000 events were used for analyses (
(172) Assessment of Cellular Morphology
(173) MCF7 cells were grown in 6-well plates to ˜80% confluency in complete growth medium. Then, 40 μM of the indicated small molecule was added to the well, and the cells were incubated for 20 h. The cells were imaged using an Olympus IX71 microscope (
(174) Synthesis of 1, 2, 4, 5 and their Fluorescein Conjugates
(175) Compounds 1, 2, 4 and 5 and the fluorescein conjugates of 1 and 4 (1-Fl and 4-Fl, respectively (
(176) Synthesis of 5-Fl
(177) The synthetic scheme for making compound 5-Fl is shown in
Example 2: Compounds Identified for 22 Disease-Related miRNA Precursors
(178) This Example describes development of an approach to identify lead small molecules that inhibit microRNA biogenesis, where the compounds are identified solely from the RNA sequences.
(179) In order to develop a computational approach to design small molecules that bind RNA from sequence, an algorithm was developed to parse RNA secondary structures into motifs. These motifs are then compared to our database of RNA motif-small molecule interactions to identify overlap (
(180) The computational approach was validated using microRNAs (miRNAs), a class of RNAs that regulate many biological processes. MicroRNAs are transcribed as precursors that are processed into 21-25 nucleotide RNAs that negatively regulate gene expression through translational repression or cleavage of a target mRNA (
(181) The goal of these studies was to use inforna to identify a small molecule that binds a precursor miRNA and inhibits its maturation (see
(182) Next, the inventors refined the lead interactions based on the following criteria:
(183) (i) the targetable motif must be in a Drosha or Dicer processing site, which are cleaved to produce pre-miRNAs and mature miRNAs, respectively. Processing is required for the mature, active miRNA to be produced (Bartel, Cell 116, 281-297 (2004)); and
(184) (ii) the miRNA must be causative of disease.
(185) In order to be validated as a miRNA upregulated in disease, phenotype reversal with oligonucleotides (i.e., antagomirs) was previously established (Krutzfeldt et al., Nature 438, 685-689 (2005); Ebert & Sharp, RNA 16, 2043-2050 (2010); Obad et al., Nat. Genet. 43, 371-378 (2011). For miRNAs under-expressed in a disease, validation was previously established by adding the miRNA to cells and observing improvement of disease-associated defects. In summary, lead small molecules were identified for twenty-two (22) different miRNA precursors that are causative of diseases including prostate, breast, ovarian, and pancreatic cancers, Parkinson's disease, and Alzheimer's disease (
Example 3: StARTS Analysis of Lead Compounds
(186) This Example describes Structure-Activity Relationships Through Sequencing (StARTS) to computationally probe the fitness of miRNA precursor-small molecule interactions.
(187) StARTS analysis of hit compounds was used to assess the fitness of each small molecule lead for binding the corresponding RNA motif in the precursor miRNA target (Velagapudi et al., Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010); Velagapudi et al., J. Am. Chem. Soc. 133, 10111-10118 (2011); see also Example 1).
(188) Briefly, StARTS determines the fitness of a small molecule binder by assigning statistical significance for each feature in a motif (such as a GC step) that contributes positively or negatively to binding. Statistical significance is expressed as a Z-score; the Z-scores are summed to afford a ΣZ-score for each motif (
(189) StARTS analysis determined that the fittest interactions were: compound 1 with the miR-96 precursor (Fitness Score=100), compound 2 with the miR-210 precursor (Fitness Score=95), and compound 3 with miR-182 precursor (fitness score=75) (
Example 4: Bioactivity and Selectivity of Compounds Predicted to Target microRNA Precursors by Inforna
(190) This Example illustrates the bioactivity and selectivity of the small molecules predicted to target microRNA precursors by inforna. Initially, compounds 1, 2, and 3 were tested for inhibiting production of the mature miRNA from their target precursors in primary cell lines by quantitative real time RT-PCR (
(191) Treatment of primary cells with higher concentrations of compound 2 leads to reduced potency, perhaps due to a lack of selectivity at these elevated concentrations. These differences in bioactivity could be due to differences in affinity, selectivity, permeability, and cellular localization. Importantly, these studies demonstrate that small molecules targeting either Dicer (compound 2) or Drosha (compounds 1 and 3) sites in precursor miRNAs can inhibit biogenesis in cell culture. Importantly, these data show that bioactive small molecules targeting RNA can be designed from only sequence in a transcriptome-wide manner without target bias.
(192) Interestingly, miR-96, -182, and -183 precursors (
(193) To confirm that the binding site of compound 1 in the miR-96 precursor was accurately predicted by inforna, the inventors completed nuclease protection assays. These studies confirm that compound 1 binds to the Drosha processing site (
Example 5: The Downstream Effects of Compound 1
(194) This Example illustrates the effect of compound 1 on the downstream targets of miR-96. MicroRNA-96 is upregulated in cancer and is linked to oncogenic transformation by silencing of FOXO1 (Forkhead box protein O1) through translational repression (Guttilla & White, J. Biol. Chem. 284, 23204-23216 (2009); Xie, et al., Blood 119, 3503-3511 (2012)). FOXO transcription factors function as regulators of cell cycle progression, including apoptosis (Dansen & Burgering, Trends Cell Biol. 18, 421-429 (2008).
(195) Compound 1 was tested for its ability to increase expression of FOXO1 protein using a luciferase model system. A target sequence fully complementary to miR-96 was inserted downstream of the Renilla luciferase gene (Guttila et al. J. Biol. Chem. 284, 23204-23216 (2009)). A small molecule that inhibits maturation of miR-96 will increase luciferase expression. MCF7 cells were transfected with a plasmid that express the luciferase model system, followed by treatment with 1. In agreement with decreased miR-96 production observed in qRT-PCR experiments (
(196) Next, the inventors tested compound 1 for its ability to increase endogenous levels of FOXO1 protein by Western blotting (
Example 6: Compound 1 can Stimulate Apoptosis
(197) This Example illustrates that compound 1 induces apoptosis by modulation of the miR-96-FOXO1 regulation pathway.
(198) As shown in
Example 7: Compound 1 Selectivity for MicroRNA-96
(199) Compound 1 was predicted to bind Dicer and Drosha processing sites in miRNA precursors other than the miR-96 precursor. However, these predicted Dicer and Drosha interactions appear to be less fit than that between compound 1 and the miR-96 precursor (
(200) Therefore, the selectivity of compound 1 for modulating expression of 149 disease-associated and highly abundant miRNAs (Tables 1 and 2) was assessed via qRT-PCR (
(201) These studies confirm the selectivity of compound 1 for the designed target on a transcriptome-wide level. Thus, it appears that compound 1 provides an unparalleled level of selectivity for a small molecule that modulates RNA function and has selectivity that can go beyond that observed with some miRNA-targeting oligonucleotides, as evidenced by the studies in
Example 8: Comparison of Inforna to Traditional Medicinal Chemistry Approaches
(202) The luciferase model system described above provides a robust assay to test other small molecules for modulating the miR-96-FOXO1 pathway. This system was therefore used to compare the design of small molecules via inforna to the more traditional medicinal chemistry approaches—screening and lead optimization via the synthesis of compound derivatives. First, a previously constructed library of small molecules was tested that are biased for binding RNA (28 total compounds;
(203) A commonly employed method for drug optimization is the synthesis of compound derivatives, i.e., chemically similar small molecules. We therefore tested three compounds that are chemically similar to 1, compounds 2, 4, and 5 (
(204) The activities of compounds 2, 4, and 5 were studied in the MCF7 cell line. The compounds are inactive at 40 μM concentration in all assays: (i) they do not affect miR-96 expression levels (
Example 9: Inforna Process
(205) This Example describes computational aspects of the inforna process.
(206) Many RNA motif-small molecule interactions have been identified by using a small molecule library-versus-RNA library screening platform developed by the inventors and their co-workers—presently about 1,500. Computational tools are generally needed to effectively assemble and process this information so that RNA molecules (especially larger, cellular RNAs) can become effective drug targets. To enable the facile programmatic searching of these interactions against a target RNA, the inventors constructed a dataset of RNA motif-small molecule interactions and inforna, which can be a web-based front end for searching the database.
(207) Description of the Database
(208) A schema of the database is shown in
(209) Motif Table:
(210) id INT creates a column “id” that will automatically increment each time a new entry is added to the table. VARCHAR (#) indicates variable-length strings of text where “#” indicates the maximum number of characters with the string. DOUBLE is an approximate numeric data type that may consist of an integer, fraction, or both and indicates that the contents of the column are numeric in nature.
(i) Motif Identifier: each RNA motif is assigned a numerical identifier. The current database has ˜1500 RNA motif-small molecule partners.
(ii) Motif ID: each motif is assigned a number.
(iii) Sequence with Closing Pairs: entire sequence of the RNA motif 5′ Sequence: the 5′ sequence of the RNA motif with the closing base pair 3′ Sequence: the 3′ sequence of the RNA motif with the closing base pair Sequence with Base Pair: the entire sequence of the RNA motif and the closing base pairs Loop Nucleotides: sequence of RNA motif excluding closing base pairs Closing Pairs (5′,3′): sequence of the 5′ and 3′ closing base pairs
(iv) Small Molecule ID: name of small molecule (also referred to as a ligand) that the RNA motif binds
(v) Size INT: links to the Motif Type & Size table to autopopulate the table and assign a unique identifier to each row; creates a column “id” that will automatically increment each time a new entry is added to the table.
(vi) Motif Type: each motif type (hairpin, 3×3 nucleotide internal loop, etc.) is assigned a unique numerical identifier.
(vii) Fitness Score: represents the fitness of the RNA motif for binding the small molecule (small molecule).
(viii) Len: indicates the length (integer values only) of the randomized region, or loop nucleotides.
(viii) Kd nM error nm: binding affinity (dissociation constant; K.sub.d) or IC.sub.50 if determined is shown in the output
(x) PMID: PubMed ID
Motif Size Table. The Motif Size table is linked to the Motif Table as shown in
Small Molecule Table. The Small Molecule table is linked to the Motif Table as shown in
(i) Small Molecule ID: a numerical identifier assigned to each small molecule starting from 1. The current database has 24 small molecules.
(ii) Small Molecule Name: name assigned to each small molecule to identify it.
(iii) SMILES: SMILES, or simplified molecular-input line-entry system, is text that describes the small molecule's structure. SMILES text can be input into various programs to reconstitute the small molecule's structure. There is separate folder of the structures with JPEG files that are output for each search.
Motif Has Ligand Table. The Motif Has Ligand table is linked to the Motif Table as shown in
(i) Small Molecule ID: a numerical identifier assigned to each small molecule starting from 1. The current database has 24 small molecules.
(ii) Motif ID: each motif type is represented with a numerical identifier, which is annotated in the Motif table.
Description of the Algorithm/Search Engine
(211) A schematic of the search engine's flow of data is shown in
(212) Each record in the database is assigned a unique Motif ID, Motif Identifier, Motif Type, Motif Size, Closing Base Pair, Sum Z-score for the motif, which indicates statistical significance and is highly correlated to affinity, Fitness Score, Dissociation Constant (K.sub.d) if measured and the PMID publication reference ID. There are two defined functions in the database that are used in parsing the CT files. Depending on the search criteria the database will either return no matches or a set of records that match the search criteria. This record set is now passed to the user interface where it is processed further to apply any format changes. Once this is complete this record set populates the user interface grid. The values are displayed in the following order: CT Filename, Compound Structure which is an image visualizing the SMILES field, Query Motif, Motif in Target RNA, Loop Nucleotides, Fitness Score, Loop Identifier, Dissociation Constant (K.sub.d) if measured and the PMID publication reference link (
(213) Output of a Database Query. The output of a database query includes (
(214) the structure of the RNA that was queried (as a .ct file) structure of the small molecule that binds a motif in the queried RNA. The associated SMILES text is available by clicking on the structure of the small molecule. motif within the database that is similar to or exactly matches motif(s) in the queried RNA that binds the small molecule motif in the queried RNA that is predicted to bind the small molecule small molecule loop nucleotides in motif from the queried RNA Fitness Score Loop Identifier Dissociation Constant (K.sub.d or IC.sub.50) PMID that is linked to the database at ncbi.nlm.nih.gov/pubmed/.
Example 10: Designer Small Molecules that Target the Precursor to microRNA-96 and Trigger Apoptosis Selectively in Breast Cancer Cell Lines
(215) This Example describes the identification of small molecules that can target dimer loops in the secondary structures of RNA molecules, and the ability of such small molecules to reduce microRNA-96 levels and trigger apoptosis in cancer cells
(216) Materials and Methods
(217) Chemicals: Fmoc protected rink amide resin, diisopropylcarbodiimide (DIC) and 1-Hydroxy-7-azabenztriazole (HOAT), were purchased from Advanced ChemTech. 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), Propylamine and Bromoacetic acid were purchased from Acros Organics. Propargylamine was purchased from Combi-Blocks. N,N Dimethylformamide (DMF), Dichloromethane and Methanol (ACS grade and HPLC grade) were purchased from Fisher Scientific. Dry N,N Dimethylformamide (dDMF) was purchased from EMD. N,N-Diisopropropylethylamine (DIEA) and trifluoroacetic acid (TFA) were purchased from Alfa Aesar. Piperidine was purchased from Sigma-Aldrich.
(218) Mass spectra: Mass spectra was recorded on a 4800 plus MALDI TOF/TOF analyzer.
(219) Preparative HPLC: Peptoids were purified using either a reverse phase Atlantis Prep T3 C18 5 μM column or a Sunfire Prep C18 5 μM 19×150 mm column. HPLC separations were completed using a Waters 1525 Binary HPLC Pump equipped with a Waters 2487 Dual Absorbance Detector system. A linear gradient from 20% to 100% B in A over 60 min and a flow rate of 5 mL/min were employed. (A: water+0.1% (v/v) TFA; B: methanol+0.1% (v/v) TFA.)
(220) Analytical HPLC: The purity was evaluated on a reverse phase Waters Symmetry C18 5 μm 4.6×150 mm column at room temperature. A flow rate of 1 mL/min and a linear gradient of 0% to 100% B in A over 60 min were applied. Absorbance was monitored at 220 and 345 nm.
(221) General protocol for peptoid synthesis: Peptoids were synthesized via standard resin-supported oligomerization protocol.sup.1. Fmoc-protected rink amide resin (200 mg, 138 μmol) with a substitution level of 0.69 mmol/g was allowed to swell for 5 min each in DCM and DMF with shaking. The resin was deprotected with 20% piperidine in DMF (3 mL, 2×20 min) at room temperature.
(222) Coupling step: The resin was then washed with DMF (3×5 min). Bromoacetic acid was coupled to the resin bound amine in the presence of 5 equivalents of bromoacetic acid and 5 equivalents of DIC in 3 mL dDMF. The reaction mixture was heated in a Panasonic microwave at 10% power (70 watts) (2×30 s). The resin was then washed with dDMF (3×5 min).
(223) Displacement step: (a) Introduction of click counterpart: The resin was then treated with 10 equivalents of propargylamine (1.38 mmol, 88 μL) in 3 mL of DMF in a Panasonic microwave at 10% power (70 watts) (1×30 s) and shaken at room temperature for 2 h. (b) Chain extension with spacer (propylamine): Coupling with Bromoacetic acid was repeated after the introduction of propargylamine. The resin was then treated with 10 equivalents of propylamine (1.38 mmol, 113 μL) in 3 mL of DMF in a Panasonic microwave at 10% power (70 watts) (1×30 s) and shaken at room temperature for 20 min. The resin was then washed with dDMF and reaction with propylamine was repeated one more time. Step (b) was repeated until the required length (n=1 to 4) of the peptoid was obtained.
(224) Conjugation of ligand modules to the peptoid scaffold: The following process was employed:
(225) (a) an Ht carboxylate with the following structure was coupled to the end of the peptoid backbone.
(226) ##STR00011##
The peptoid (50 mg, 34.5 μmol) from the previous step was directly treated with a solution of Ht carboxylate (27 mg, 52 μmol), EDC (8 mg, 52 μmol), HOAT (7 mg, 52 μmol) and DIEA (66 μL, 345 μmol) in 2 mL dDMF in a microwave vial in a Biotage Initiator+ at 75° C. for 2 h. The resin was then washed with DMF (3×5 min).
(227) (b) BSH azide was added onto the peptoid from the previous step via Huisgen dipolar cycloaddition reaction (HDCR). The peptoid (50 mg, 34.5 μmol) from previous step was directly treated with a solution of BSH azide (7 mg, 8.6 μmol), Cu(I) catalyst (1.5 mg, 2.6 μmol) and DIEA (66 μL, 345 μmol) in 2 mL dDMF in a microwave vial at 120° C. for 2 h in a Biotage Initiator+. The resin was then washed with DMF (3×5 min) followed by DCM (3×5 min) before cleaving the peptoid off the resin in (1:1) TFA:DCM for 15 min at room temperature. The solvent was removed under vacuum and the crude product was purified via HPLC as described in general methods.
(228) General Methods for cell culture: MDA MB 231 cells were cultured in Roswell Park Memorial Institute 1640 medium (RPMI 1640) (Cellgro) supplemented with 10% FBS (Cellgro) and penicillin-streptomycin (MP Biomedicals). MCF-10A cells were cultured in Dulbecco's modified eagle medium/F12 (DMEM/F12) (Cellgro) supplemented with 10% FBS, 20 ng/mL EGF, 0.5 μg/mL hydrocortisone (Pfaltz and Bauer Inc.), 100 ng/mL cholera toxin (Sigma), 10 μg/mL insulin (Gemini Bio-Products) and penicillin-streptomycin.
(229) Annexin V/PI assays: MDA MB 231 or MCF-10A cells were grown in 6-well plates to 40-50% confluency. The cells were incubated with 50 nM of small molecule for 72 h and then detached from the surface using accutase. They were washed twice each with ice cold 1× DPBS and 1× Annexin Binding Buffer (50 mM Hepes (pH 7.4), 700 mM NaCl and 12.5 mM CaCl.sub.2). The cells were resuspended in 100 μL 1× Annexin Binding Buffer, and then 5 μL Annexin V-APC (eBioscience) were added. The solution was incubated for 10 min at room temperature followed by washing with 1× Annexin Binding Buffer. The cells were then stained with 1 μg/mL propidium iodide in 300 μL of 1× Annexin Binding Buffer for 15 min at room temperature. Flow cytometry was performed using a BD LSRII instrument (BD Biosciences). At least 10,000 events were used for analysis.
(230) Results
(231) The lead small molecule 1 was optimized by using modular assembly approach enabled by Inforna. Briefly, the secondary structure of the microRNA-96 hairpin precursor was mined using the methods described herein to identify compounds that could bind to target sites in the RNA structure (
(232) The dimeric compounds were synthesized by using a modular assembly approach shown in the synthetic scheme below. A peptoid scaffold was employed where an azide derivative of compound 1 was the first module, and the second module was an acylated derivative of compound H, where the acylation was on an amino site on a peptoid backbone. A peptoid backbone was linked to the H compound, which was then linked to the azide derivative of compound 1 via a Huisgen dipolar cycloaddition reaction between the azide on compound 1 and an alkyne on the H peptoid. The spacing between the two modules was varied by inserting propylamine spacers between the RNA binding modules.
(233) ##STR00012## ##STR00013##
(234) The compounds are called BSH-n-H in which the BSH refers to compound 1 and H refers to module 2, both conjugated onto the backbone. The number between these BSH and H is the number of propylamine spacers between the compound 1 and H RNA binding modules. Thus, BSH-1-H refers to a compound with one propylamine spacer between the two RNA binding modules. The structure of the BSH-n-H genus is shown below.
(235) ##STR00014##
(236) A library of these dimer compounds with varied spacing was synthesized according to the routes shown above. These dimer compounds were characterized using the methods described above. The results are shown in Table 3.
(237) TABLE-US-00004 TABLE 3 Characterization of designer dimeric, BSH-n-H,compounds Expected/Observed t.sub.R (HPLC Compound Name Structure Mass (M + H.sup.+) retention time) BSH-1-H
(238) This library of dimers was then screened for processing inhibition of microRNA-96 hairpin precursors by using qRT-PCR to quantify the abundance of the mature, pre-, and pri-microRNAs. The data are shown in
(239) ##STR00019##
(240) The binding affinity of the optimal BSH-2-H dimer was then tested against a variety of constructs that displace the 1×1 nucleotide GG internal loop binding site, the 1×1 nucleotide UU internal loop binding site, or both. Binding was also evaluated against a DNA hairpin. These studies demonstrated that BSH-2-H has significantly selectivity for the RNA that contains both sites and is >30-fold higher affinity binder than monomeric compounds to the designed RNA substrates, 5′CGAUU/3′GGUAUA (
(241) TABLE-US-00005 TABLE 4 Dissociation constants of BSH-FL (fluorescein derivative of BSH, compound 1), H and BSH-2-H towards the different nucleic acids with the binding constants are reported in nanomolar. Small Molecule 5′UUU/3′AUA 5′CGA/3′GGU 5′CGAUU/3′GGUAUA C1 H Hairpin BSH-FL 1270 ± 140 nM 9400 ± 1400 nM 3400 ± 100 nM >30,000 nM >30,000 nM H >20,000 nM 1450 ± 150 nM 2680 ± nM >2000 nM 200 nM BSH-2-H 1167 ± 279 nM 900 ± 200 nM 85 ± 11 nM >4000 nM >50,000 nM
(242) The compound BSH-2-H was then tested to evaluate whether it affected the production of FOXO1 protein in cultured cancer cells. FOXO1 mRNA is targeted by miR-96, and is translationally repressed by it. These studies showed that application of 50 nM of BSH-2-H caused an increase in the amount of FOXO1 protein expressed in cells by 2.5-fold (
(243) If FOXO1 levels are boosted in cells apoptosis should be triggered. Therefore, the BSH-2-H compound was tested for induction of apoptosis in a variety of breast cancer cell lines (MCF7 and MDA MB 231 triple negative cells) as well as in healthy breast tissue (MCF-10A). As shown in
(244) References
(245) 1. Guan, L. & Disney, M. D. Recent advances in developing small molecules targeting RNA. ACS Chem. Biol. 7, 73-86 (2012). 2. Thomas, J. R. & Hergenrother, P. J. Targeting RNA with small molecules. Chem. Rev. 108, 1171-1224 (2008). 3. Yoshizawa, S., Fourmy, D. & Puglisi, J. D. Recognition of the codon-anticodon helix by ribosomal RNA. Science 285, 1722-1725 (1999). 4. Carter, A. P. et al. Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature 407, 340-348. (2000). 5. Mathews, D. H. et al. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. U.S.A. 101, 7287-7292 (2004). 6. Batey, R. T., Rambo, R. P. & Doudna, J. A. Tertiary Motifs in RNA Structure and Folding. Angew. Chem. Int. Ed. Engl. 38, 2326-2343 (1999). 7. Spahn, C. M. et al. Hepatitis C virus IRES RNA-induced changes in the conformation of the 40s ribosomal subunit. Science 291, 1959-1962 (2001). 8. Childs-Disney, J. L., Wu, M., Pushechnikov, A., Aminova, O. & Disney, M. D. A small molecule microarray platform to select RNA internal loop-ligand interactions. ACS Chem. Biol. 2, 745-754 (2007). 9. Disney, M. D. et al. Two-dimensional combinatorial screening identifies specific aminoglycoside-RNA internal loop partners. J. Am. Chem. Soc. 130, 11185-11194 (2008). 10. Velagapudi, S. P., Seedhouse, S. J. & Disney, M. D. Structure-activity relationships through sequencing (StARTS) defines optimal and suboptimal RNA motif targets for small molecules. Angew. Chem. Int. Ed. Engl. 49, 3816-3818 (2010). 11. Velagapudi, S. P., Seedhouse, S. J., French, J. & Disney, M. D. Defining the RNA internal loops preferred by benzimidazole derivatives via 2D combinatorial screening and computational analysis. J. Am. Chem. Soc. 133, 10111-10118 (2011). 12. Jiang, Q. et al. miR2Disease: a manually curated database for microRNA deregulation in human disease. Nucleic Acids Res. 37, D98-104 (2009). 13. Griffiths-Jones, S., Saini, H. K., van Dongen, S. & Enright, A. J. miRBase: tools for microRNA genomics. Nucleic Acids Res. 36, D154-158 (2008). 14. Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233 (2009). 15. Ambros, V. et al. A uniform system for microRNA annotation. RNA 9, 277-279 (2003). 16. Wu, M. & Turner, D. H. Solution structure of (rGCGGACGC)2 by two-dimensional NMR and the iterative relaxation matrix approach. Biochemistry 35, 9677-9689 (1996). 17. SantaLucia, J., Jr. & Turner, D. H. Structure of (rGGCGAGCC)2 in solution from NMR and restrained molecular dynamics. Biochemistry 32, 12612-12623 (1993). 18. Bartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297 (2004). 19. Krutzfeldt, J. et al. Silencing of microRNAs in vivo with ‘antagomirs’. Nature 438, 685-689 (2005). 20. Ebert, M. S. & Sharp, P. A. MicroRNA sponges: progress and possibilities. RNA 16, 2043-2050 (2010). 21. Obad, S. et al. Silencing of microRNA families by seed-targeting tiny LNAs. Nat. Genet. 43, 371-378 (2011). 22. Guttilla, I. K. & White, B. A. Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J. Biol. Chem. 284, 23204-23216 (2009). 23. Redova, M. et al. MiR-210 expression in tumor tissue and in vitro effects of its silencing in renal cell carcinoma. Tumour Biol. 34, 481-491 (2013). 24. Childs-Disney, J. L., Hoskins, J., Rzuczek, S. G., Thornton, C. A. & Disney, M. D. Rationally designed small molecules targeting the RNA that causes myotonic dystrophy type 1 are potently bioactive. ACS Chem. Biol. 7, 856-862 (2012). 25. Pilch, D. S. et al. Binding of a hairpin polyamide in the minor groove of DNA: sequence-specific enthalpic discrimination. Proc. Natl. Acad. Sci. U.S.A. 93, 8306-8311 (1996). 26. Pushechnikov, A. et al. Rational design of ligands targeting triplet repeating transcripts that cause RNA dominant disease: application to myotonic muscular dystrophy type 1 and spinocerebellar ataxia type 3. J. Am. Chem. Soc. 131, 9767-9779 (2009). 27. Lee, M. M., Pushechnikov, A. & Disney, M. D. Rational and modular design of potent ligands targeting the RNA that causes myotonic dystrophy 2. ACS Chem. Biol. 4, 345-355 (2009). 28. Parkesh, R. et al. Design of a bioactive small molecule that targets the myotonic dystrophy type 1 RNA via an RNA motif-ligand database & chemical similarity searching. J. Am. Chem. Soc. 134, 4731-4742 (2012). 29. Kumar, A. et al. Chemical correction of pre-mRNA splicing defects associated with sequestration of muscleblind-like 1 protein by expanded r(CAG)-containing transcripts. ACS Chem. Biol. 7, 496-505 (2012). 30. Pinto, I. G., Guilbert, C., Ulyanov, N. B., Stearns, J. & James, T. L. Discovery of ligands for a novel target, the human telomerase RNA, based on flexible-target virtual screening and NMR. J. Med. Chem. 51, 7205-7215 (2008). 31. Disney, M. D. et al. A small molecule that targets r(CGG)exp and improves defects in fragile X-associated tremor ataxia syndrome ACS Chem. Biol. 7, 1711-1718 (2012). 32. Luzhkov, V. B. et al. Virtual screening and bioassay study of novel inhibitors for dengue virus mRNA cap (nucleoside-2′O)-methyltransferase. Bioorg. Med. Chem. 15, 7795-7802 (2007). 33. Xu, S., Witmer, P. D., Lumayag, S., Kovacs, B. & Valle, D. MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster. J. Biol. Chem. 282, 25053-25066 (2007). 34. Stenvang, J., Petri, A., Lindow, M., Obad, S. & Kauppinen, S. Inhibition of microRNA function by antimiR oligonucleotides. Silence 3, 1 (2012). 35. Xie, L. et al. FOXO1 is a tumor suppressor in classical Hodgkin lymphoma. Blood 119, 3503-3511 (2012). 36. Dansen, T. B. & Burgering, B. M. Unravelling the tumor-suppressive functions of FOXO proteins. Trends Cell Biol. 18, 421-429 (2008). 37. Huang, H. & Tindall, D. J. FOXO factors: a matter of life and death. Future Oncol. 2, 83-89. (2006). 38. Lewis, B. P., Burge, C. B. & Bartel, D. P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 15-20 (2005). 39. Wolkenberg, S. E. & Boger, D. L. Mechanisms of in situ activation for DNA-targeting antitumor agents. Chem. Rev. 102, 2477-2495 (2002). 40. Tran, T. & Disney, M. D. Identifying the preferred RNA motifs and chemotypes that interact by probing millions of combinations. Nat. Commun. 3, 1125 (2012). 41. Hawkins, P. C., Skillman, A. G. & Nicholls, A. Comparison of shape-matching and docking as virtual screening tools. J. Med. Chem. 50, 74-82 (2007). 42. Stelzer, A. C. et al. Discovery of selective bioactive small molecules by targeting an RNA dynamic ensemble. Nat. Chem. Biol. 7, 553-559 (2011). 43. Kramer, R. & Cohen, D. Functional genomics to new drug targets. Nat. Rev. Drug Discov. 3, 965-972 (2004). 44. Bevilacqua, J. M. & Bevilacqua, P. C. Thermodynamic analysis of an RNA combinatorial library contained in a short hairpin. Biochemistry 37, 15877-15884 (1998). 45. McKenna, S. A. et al. Purification and characterization of transcribed RNAs using gel filtration chromatography. Nat. Protoc. 2, 3270-3277 (2007). 46. Peyret, N., Seneviratne, P. A., Allawi, H. T. & SantaLucia, J., Jr. Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A. A, C. C, G. G, and T. T mismatches. Biochemistry 38, 3468-3477 (1999). 47. SantaLucia, J., Jr. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc. Natl. Acad. Sci. U.S.A. 95, 1460-1465 (1998). 48. Puglisi, J. D. & Tinoco, I., Jr. Absorbance melting curves of RNA. Methods Enzymol. 180, 304-325 (1989). 49. Wang, Y. & Rando, R. R. Specific binding of aminoglycoside antibiotics to RNA. Chem. Biol. 2, 281-290 (1995). 50. Disney, M. D., Gryaznov, S. M. & Turner, D. H. Contributions of individual nucleotides to tertiary binding of substrate by a Pneumocystis carinii group I intron. Biochemistry 39, 14269-14278 (2000). 51. Landthaler, M., Yalcin, A. & Tuschl, T. The human DiGeorge syndrome critical region gene 8 and its D. melanogaster homolog are required for miRNA biogenesis. Curr. Biol. 14, 2162-2167 (2004). 52. Jang, H.; Fafarman, A.; Holub, J. M.; Kirshenbaum, K. Org Lett, 7: 1951 (2005). 53. Disney, M. D.; Labuda, L. P.; Paul, D. J.; Poplawski, S. G.; Pushechnikov, A.; Tran, T.; Velagapudi, S. P.; Wu, M.; Childs-Disney, J. L. J Am Chem Soc 130: 11185 (2008).
(246) All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.
(247) The specific methods and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims.
(248) As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to “a compound,” “a small molecule,” “a nucleic acid” or “an RNA” includes a plurality of such compounds, small molecules, nucleic acids or RNA molecules (for example, a solution of compounds, small molecules, nucleic acids or RNA molecules, or a series of compound, small molecule, nucleic acid or RNA molecule preparations), and so forth. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.
(249) The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention.
(250) The following statements are intended to describe and summarize various features of the invention according to the foregoing description in the specification.
(251) Statements:
(252) 1. A method for identifying a compound that binds to an RNA, comprising comparing a query dataset of RNA secondary structures from the RNA, with a dataset of identified bound RNA motif-small molecule pairs, to thereby identify a compound that binds to the RNA.
(253) 2. The method of statement 1, wherein the query dataset of RNA secondary structures comprises one or more RNA sequence for one or more selected secondary structure from the RNA.
(254) 3. The method of statement 1 or 2, wherein the query dataset of RNA secondary structures comprises one or more RNA sequence for one or more selected secondary structure, and a description of the secondary structure.
(255) 4. The method of any of statements 1-3, wherein the query dataset of RNA secondary structures from the RNA comprises one or more single-stranded segments, one or more double-stranded segments, or a combination thereof that are present in the RNA after folding of the RNA.
(256) 5. The method of any of statements 1-4, wherein query dataset of RNA secondary structures comprises one or more single-stranded segments formed by the RNA after folding into a low free energy structure.
(257) 6. The method of any of statements 1-5, wherein query dataset of RNA secondary structures comprises one or more single-stranded segments formed by the RNA after folding into a folded structure that is stable under physiological conditions.
(258) 7. The method of any of statements 1-6, wherein the query dataset of RNA secondary structures comprises one or more internal loops, hairpin loops, bulges, bubbles, branches, or combinations thereof.
(259) 8. The method of any of statements 1-7, wherein the query dataset of RNA secondary structures comprises one or more RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multibranch loop, pseudoknot, or a combination therefore.
(260) 9. The method of any of statements 1-8, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a structural description of each RNA motif, a structural description of each small molecule, and a listing of which RNA motif binds to each small molecule or compound.
(261) 10. The method of any of statements 1-9, wherein the dataset of identified bound RNA motif-small molecule pairs comprises one or more RNA sequence for each RNA motif.
(262) 11. The method of any of statements 1-10, wherein the dataset of identified bound RNA motif-small molecule pairs comprises one or more RNA sequence for each RNA motif, and a description of each RNA motif's 2-dimensional and/or three-dimensional structure.
(263) 12. The method of any of statements 1-10, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as single-stranded or double-stranded.
(264) 13. The method of any of statements 1-12, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an internal loop, hairpin loop, a bulge, a bubble, or a branch.
(265) 14. The method of any of statements 1-13, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multi-branch loop, or pseudoknot.
(266) 15. The method of any of statements 1-14, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each small molecule by chemical formula, chemical name, chemical structure, three-dimensional structure, three-dimensional atomic structure, or a combination thereof.
(267) 16. The method of any of statements 1-15, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of bonds formed between RNA motifs and small molecules.
(268) 17. The method of any of statements 1-16, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of alignments for each structural feature of each RNA motif with each small molecule to which the RNA motif binds.
(269) 18. The method of any of statements 1-17, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of alignments for each structural feature of small molecule with each structural feature of the RNA motif to which the small molecule binds.
(270) 19. The method of any of statements 1-18, wherein comparing the query dataset of RNA secondary structures from the RNA, with the dataset of identified bound RNA motif-small molecule pairs comprises aligning one or more structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs.
(271) 20. The method of any of statements 1-19, wherein comparing the query dataset of RNA secondary structures from the RNA, with the dataset of identified bound RNA motif-small molecule pairs comprises a series of alignments for each structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs.
(272) 21. The method of any of statements 1-20, wherein comparing the query dataset of RNA secondary structures from the RNA, with the dataset of identified bound RNA motif-small molecule pairs comprises a series of alignments for each structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs until a best-fit RNA motif is identified that optimally corresponds with RNA secondary structure.
(273) 22. The method of any of statements 1-21, wherein comparing the query dataset of RNA secondary structures from the RNA, with the dataset of identified bound RNA motif-small molecule pairs comprises a series of alignments for each structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs until a best-fit compound-RNA motif pair is identified, where the RNA motif of the pair has a structure that optimally corresponds with RNA secondary structure.
(274) 23. The method of statements 22, wherein the one or more structural feature of each RNA secondary structure is a ribonucleotide, a ribonucleotide sequence, a ribonucleotide position, a ribonucleotide conformation, a ribonucleotide atomic coordinate dataset, a ribonucleotide sequence atomic coordinate dataset, or a combination thereof for each RNA secondary structure.
(275) 24. The method of any of statements 1-23, wherein the one or more structural feature of each RNA secondary structure is a ribonucleotide, a ribonucleotide sequence, a ribonucleotide position, a ribonucleotide conformation, a ribonucleotide atomic coordinate dataset, a ribonucleotide sequence atomic coordinate dataset, or a combination thereof for each RNA secondary structure as the RNA secondary structure is optimally positioned to bind a small molecule.
(276) 25. The method of any of statements 1-24, wherein the one or more structural feature of one or more of the RNA motifs is a ribonucleotide, a ribonucleotide sequence, a ribonucleotide position, a ribonucleotide conformation, a ribonucleotide atomic coordinate dataset, a ribonucleotide sequence atomic coordinate dataset, or a combination thereof for each RNA motif as the RNA motif is optimally positioned to bind a small molecule.
(277) 26. The method of any of statements 1-25, further comprising generating the query dataset of RNA secondary structures from the RNA sequence.
(278) 27. The method of any of statements 1-23, further comprising generating the query dataset of RNA secondary structures from the RNA sequence by folding the RNA into a low free energy folded structure.
(279) 28. The method of any of statements 1-24, further comprising generating the query dataset of RNA secondary structures from the RNA sequence by folding the RNA into folded structure that is stable under physiological conditions.
(280) 29. The method of any of statements 1-25, wherein the method identifies a compound that binds to the RNA by providing an output listing at least one RNA secondary structure from the RNA, and a small molecule that binds to the at least one RNA secondary structure.
(281) 30. The method of statement 26, wherein the output listing further comprises each RNA secondary structure and the compound that binds to the at least one RNA secondary structure, by name, sequence, chemical formula, chemical structure, or a combination thereof.
(282) 31. The method of any of statements 1-27, wherein the RNA and compound are assayed to determine a binding affinity.
(283) 32. The method of any of statements 1-28, wherein a RNA secondary structure identified to bind a compound is further evaluated by StARTS.
(284) 33. The method of any of statements 1-29, wherein a RNA secondary structure identified to bind a compound is further evaluated compiling sequence features in the RNA secondary structure and observing an occurrence rate of each sequence feature in the RNA secondary structure compared to an occurrence rate of the same sequence feature in a larger population of RNA motifs.
(285) 34. The method of any of statements 1-30, wherein a RNA secondary structure identified to bind a compound is assigned one or more Z.sub.obs-scores using Equations (I) and (II):
(286)
where n.sub.1 is the size of a population of structural features in RNA secondary structure identified to bind a compound (population 1); n.sub.2 is the size of a population of structural features from a larger library of RNA motifs (population 2); p1 is the observed proportion of Population 1 displaying the feature, and p2 is the observed proportion for Population 2 displaying the feature.
(287) 35. The method of statement 31, wherein Z.sub.obs-scores are summed to generate at least one ΣZ score for an RNA secondary structure when a Z.sub.obs-score indicates that a structural feature in the RNA secondary structure is distinct from the larger library of structural features (population 2) at a 95% confidence level.
(288) 36. The method of statement 32, wherein ΣZ scores are plotted against measured binding affinities the RNA to generate a ΣZ score—binding affinity plot.
(289) 37. The method of statement 33, where and the plot is fitted to an inverse first-order equation.
(290) 38. The method of any of statements 1-34, wherein the method predicts the affinity and selectivity of a compound for an RNA.
(291) 39. The method of any of statements 1-35, wherein the dataset of identified bound RNA motif-small molecule pairs is or has been generated by two-dimensional combinatorial screening.
(292) 40. The method of any of statements 1-36, wherein the dataset of identified bound RNA motif-small molecule pairs is or has been generated by two-dimensional combinatorial screening, which comprises probing a small molecule library with a library of RNA motifs, and identifying which RNA motif(s) bind to which small molecule(s).
(293) 41. The method of statement 37, wherein small molecules in the small molecule library are immobilized on a solid support.
(294) 42. The method of statement 37 or 38, wherein each small molecule in the small molecule library is immobilized at an identified address on a solid support.
(295) 43. The method of any of statements 37-39, wherein identifying which RNA motif(s) bind to which small molecule(s) comprising isolating RNA bound to each small molecule to generate a series of RNA samples, amplifying each RNA sample in the series, sequencing each RNA sample in the series, or combinations thereof.
(296) 44. The method of any of statements 1-40, wherein the compound is one of the small molecules listed or identified in the dataset of identified bound RNA motif-small molecule pairs.
(297) 45. The method of any of statements 1-41, further comprising simultaneously identifying series of compounds, each binding to a different RNA.
(298) 46. The method of any of statements 1-42, wherein the method is a computer-based method.
(299) 47. A computer system for performing the method of any of statements 1-43.
(300) 48. A computer program product comprising a computer program for performing the method of any of statements 1-43.
(301) 49. A compound selected from the group consisting of:
(302) ##STR00020## ##STR00021## ##STR00022## ##STR00023## ##STR00024##
(303) 50. An immobilized compound of statement 46.
(304) 51. The compound of statement 46 or 47, immobilized to a solid support.
(305) 52. A compound selected from the group consisting of:
(306) ##STR00025## ##STR00026## ##STR00027## and any combination thereof.
(307) 53. A composition comprising a carrier and one or more the compounds of statement 46 or 49.
(308) 54. The composition of statement 50, wherein the carrier is a pharmaceutically acceptable carrier.
(309) 55. A method of modulating microRNA function or activity comprising contacting the microRNA with one or more of the compounds of statement 46 or 47, or with the composition of statement 50 or 51, to thereby modulate microRNA function or activity.
(310) 56. The method of statement 52, wherein the microRNA function or activity is reduced.
(311) 57. The method of statement 52, wherein the microRNA function or activity is increased.
(312) 58. A method of treatment comprising administering a compound of statement 46 or 49 to a subject in need thereof, to thereby treat the subject.
(313) 59. A method of treatment comprising administering a small molecule identified by the method of any statements 1-42, to a subject in need thereof, to thereby treat the subject.
(314) 60. The method of statement 54 or 55, wherein the subject has, or is suspected of having, cancer.
(315) 61. The method of any of statements 51-56, wherein the compound binds to a microRNA.
(316) 62. The method of any of statements 51-56, wherein the compound binds to a microRNA selected from the group consisting of an miR-96, miR-182, miR-210, and precursors thereof.
(317) 63. The method of any of statements 51-56, wherein the compound binds to a microRNA sequence selected from the groups consisting of SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO: 15; SEQ ID NO:16; and SEQ ID NO:17.
(318) 64. The method of any of statements 55-60, wherein the subject has pancreatic cancer, Parkinson's disease, Alzheimer's disease, melanoma, breast cancer, lymphoma, hepatocellular carcinoma, glioblastomas, colorectal neoplasm, breast neoplasm, breast neoplasm, urinary bladder neoplasm, hepatocellular neoplasm, prostatic neoplasm, colorectal neoplasm, stomach neoplasms, chronic myeloid leukemia, acute myeloid leukemia, melanoma, prostatic neoplasms, glioma, breast neoplasm, acute leukemia, endometrial neoplasm, lung cancer, prostatic neoplasm, ovarian neoplasm, ischemic heart disease, renal carcinoma, pancreatic cancer, colorectal cancer, breast cancer, breast cancer, breast cancer, Kaposi's sarcoma, stomach neoplasms, leukemia, melanoma, neoplasms (Myc regulator), non-small cell lung cancer, colorectal neoplasm, Parkinson's disease, stomach neoplasm, squamous cell neoplasm, squamous cell neoplasm, stomach neoplasm, hepatocellular carcinoma, melanoma, breast neoplasm, hepatocellular neoplasm, hepatocellular neoplasm, hepatocellular carcinoma, breast neoplasm, stomach neoplasm, squamous cell neoplasm, or a combination thereof.
(319) 65. A computer system for identifying a molecule that binds to an RNA comprising: one or more computer processors and storage configured to compare a structured query dataset describing RNA secondary structures of the RNA, and a structured dataset of identified RNA motif-small molecule pairs, to thereby identify a molecule that binds to the RNA.
(320) 66. The computer system of statement 65, wherein the query dataset describing RNA secondary structures comprises one or more RNA sequence for one or more selected secondary structure.
(321) 67. The computer system of statement 65 or 66, wherein the query dataset of RNA secondary structures comprises one or more internal loops, hairpin loops, bulges, bubbles, branches, or combinations thereof.
(322) 68. The computer system of any of statements 65-67, wherein the query dataset of RNA secondary structures comprises one or more RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multibranch loop, pseudoknot, or a combination therefore.
(323) 69. The computer system of any of statements 65-68, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a structural description of each RNA motif, a structural description of each small molecule, and a listing of which RNA motif binds to each small molecule or compound.
(324) 70. The computer system of any of statements 65-69, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an internal loop, hairpin loop, a bulges, a bubble, or a branch.
(325) 71. The computer system of any of statements 65-70, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each RNA motif as an RNA symmetric internal loop, asymmetric internal loop, 1×1 internal loop, 1×2 internal loop, 1×3 internal loop, 2×2 internal loop, 2×3 internal loop, 2×4 internal loop, 3×3 internal loop, 3×4 internal loop, 4×4 internal loop, 4×5 internal loop, 5×5 internal loop, 1 base bulge, 2 base bulge, 3 base bulge, 4 base bulge, 5 base bulge, 4 base hairpin loop, 5 base hairpin loop, 6 base hairpin loop, 7 base hairpin loop, 8 base hairpin loop, 9 base hairpin loop, 10 base hairpin loop, multibranch loop, or pseudoknot.
(326) 72. The computer system of any of statements 65-71, wherein the dataset of identified bound RNA motif-small molecule pairs comprises a description of each small molecule by chemical formula, chemical name, chemical structure, three-dimensional structure, or a combination thereof.
(327) 73. The computer system of any of statements 65-72, wherein comparison of the structured query dataset describing RNA secondary structures of the RNA, with the structured dataset of identified RNA motif-small molecule pairs comprises a series of alignments for each structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs in the identified RNA motif-small molecule pairs.
(328) 74. The computer system of any of statements 65-73, wherein comparison of the structured query dataset describing RNA secondary structures of the RNA, with the structured dataset of identified RNA motif-small molecule pairs comprises a series of alignments for each structural feature of each RNA secondary structure with one or more structural feature of one or more of the RNA motifs in the identified RNA motif-small molecule pairs until a best-fit RNA motif is identified that optimally corresponds with RNA secondary structure.
(329) 75. The computer system of statement 74, wherein the one or more structural feature of each RNA secondary structure is a ribonucleotide, a ribonucleotide sequence, a ribonucleotide position, a ribonucleotide conformation, a ribonucleotide atomic coordinate dataset, a ribonucleotide sequence atomic coordinate dataset, or a combination thereof for each RNA secondary structure.
(330) 76. The computer system of statement 74 or 75, wherein the one or more structural feature of one or more of the RNA motifs is a ribonucleotide, a ribonucleotide sequence, a ribonucleotide position, a ribonucleotide conformation, a ribonucleotide atomic coordinate dataset, a ribonucleotide sequence atomic coordinate dataset, or a combination thereof for each RNA motif as the RNA motif is optimally positioned to bind a small molecule.
(331) 77. The computer system of any of statements 65-76, wherein the computer system is further configured to generate the query dataset of RNA secondary structures from the RNA sequence.
(332) 78. The computer system of any of statements 65-77, wherein the computer system is further configured to generate the query dataset of RNA secondary structures by a computer system that comprises folding the RNA into a low free energy folded structure.
(333) 79. The computer system of any of statements 65-78, wherein the computer system is further configured to provide an output listing at least one RNA secondary structure from the RNA, and a small molecule that binds to the at least one RNA secondary structure.
(334) 80. The computer system of any of statements 65-79, wherein the computer system is further configured to evaluate a RNA secondary structure identified to bind a small molecule by compiling sequence features in the RNA secondary structure, and comparing the number of sequence features in the RNA secondary structure to the number of the same sequence features in a larger population of RNA motifs.
(335) 81. The computer system of any of statements 65-80, wherein the computer system is further configured to assign one or more Z.sub.obs-scores to a RNA secondary structure identified to bind a small molecule using Equations (I) and (II):
(336)
where n.sub.1 is the size of a population of structural features in RNA secondary structure identified to bind a compound (population 1); n.sub.2 is the size of a population of structural features from a larger library of RNA motifs (population 2); p1 is the observed proportion of Population 1 displaying the feature, and p2 is the observed proportion for Population 2 displaying the feature.
(337) 82. The computer system of statement 81, wherein the computer system is further configured to sum the Z.sub.obs-scores to generate at least one ΣZ score for an RNA secondary structure when a Z.sub.obs-score indicates that a structural feature in the RNA secondary structure is distinct from the larger library of structural features (population 2) at a 95% confidence level.
(338) 83. The computer system of statement 81 or 82, wherein the computer system is further configured to plot the ΣZ scores against measured binding affinities of the small molecule for the RNA to generate a ΣZ score-binding affinity plot.
(339) 84. The computer system of statement 82, where and the plot is fitted to an inverse first-order equation.
(340) 85. The computer system of any of statements 65-84, wherein the computer system is further configured to generate output that predicts the affinity and selectivity of a small molecule for an RNA.
(341) 86. The computer system of any of statements 65-85, wherein the computer system is configured to simultaneously compare a series of RNA secondary structures with a series of RNA motif-small molecule pairs to thereby identify a series of RNA—molecule binding pairs.
(342) 87. One or more computer-readable hardware storage having computer-useable instructions embodied thereon for performing a method of comparing a structured query dataset describing RNA secondary structures of the RNA, with a structured dataset of identified RNA motif-small molecule pairs to identify a molecule that binds to the RNA.
(343) 88. Use of the compound of claim 52 or the composition of claim 53 or 54 for treatment of cancer.
(344) 89. Use of the compound of claim 52 or the composition of claim 53 or 54 as a medicament.