Mantle phenotype detection in palm
11632922 · 2023-04-25
Assignee
Inventors
- Meilina Ong Abdullah (Seremban, MY)
- Ooi Siew Eng (Kuala Lumpur, MY)
- Leslie Low Eng Ti (Kuala Lumpur, MY)
- Rajinder Singh (Kuala Lumpur, MY)
- Rajanaidu Nookiah (Kuala Lumpur, MY)
- Ravigadevi Sambanthamurthi (Selangor, MY)
- Nan Jiang (St. Louis, MO, US)
- Steven W. Smith (Fitchburg, WI, US)
- Nathan D. Lakey (Chesterfield, MO)
- Rob Martienssen (Cold Spring Harbor, NY, US)
- Jared Ordway (St. Louis, MO)
- Michael Hogan (Ballwin, MO, US)
Cpc classification
G16B20/20
PHYSICS
A01H1/04
HUMAN NECESSITIES
C12Q2537/164
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
G16B20/00
PHYSICS
International classification
A01H1/04
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
G16B20/20
PHYSICS
Abstract
Methods, compositions, kits, and computer program code are provided for predicting somaclonal abnormality (e.g., a Mantled phenotype) in a plant and or sorting plants based on the predicted presence or absence of somaclonal abnormality.
Claims
1. A method for physically separating the oil palm plant or seed predicted to have the Mantled phenotype from one or more oil palm plants or seeds predicted to lack the Mantled phenotype based on the methylation status, the method comprising: obtaining genotype information for a sample from the oil palm seeds or plants, wherein the genotype information comprises methylation status of at least one cytosine within a differential methylation region (DMR), wherein the DMR is within a sequence of DNA at least 95% identical to SEQ ID NO:66 and predicting, based on the obtained genotype information, presence or absence of the Mantled phenotype of the palm plants or seeds, or obtaining predicted presence or absence of the Mantled phenotype of palm plants or seeds based on methylation status of at least one cytosine within the DMR; and, physically separating the oil palm plant or seed predicted to have the Mantled phenotype from one or more oil palm plants or seeds predicted to lack the Mantled phenotype based on the methylation status, wherein a reduced methylation status of at least one cytosine within the DMR relative to a control locus indicates presence of the Mantled phenotype.
2. The method of claim 1, wherein the DMR is within a DNA region in the sample from the oil palm seed or plant, where the DNA region is at least 95% identical to SEQ ID NO:43.
3. The method of claim 1, wherein the control locus is an control locus endogenous to the plant.
4. The method of claim 1, wherein the control locus is an control locus exogenous to the plant.
5. The method of claim 1, wherein the method comprises predicting the Mantled phenotype when the methylation status of the at least one cytosine is hypomethylated relative to a sample from oil palm seed or plant having or predicted to have the Mantled phenotype.
6. The method of claim 1, wherein the DMR is within a DNA region in the sample from the oil palm seed or plant, where the DNA region is at least 95% identical to SEQ ID NO:3.
7. The method of claim 1, wherein the at least one cytosine is a first cytosine in a CHG sequence, wherein H is C, A, or T.
8. The method of claim 1, wherein the DMR is within a DNA region in the sample from the oil palm plant or seed, where the DNA region is at least 95% identical to SEQ ID NO:15, 16 or 17.
9. The method of claim 1, wherein the DMR is within a DNA region in the sample from the oil palm plant or seed, where the DNA region is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO:43, 44, 45, and 46.
10. The method of claim 1, wherein the at least one cytosine is in an AlwNI, BbvI, ScrFI, or RsaI restriction endonuclease recognition site.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION OF THE INVENTION
(18) I. Introduction
(19) The development of oil palm planting material that consistently exhibits high oil yields has been hindered by the emergence of somaclonal abnormalities in plants that have been in vitro cultured. Oil palm plants exhibiting somaclonal abnormality as a result of in vitro culture include, for example, those exhibiting a Mantled phenotype. The present inventors have identified a molecular mechanism underlying somaclonal abnormality in oil palm plants: differential methylation within the oil palm locus corresponding to SEQ ID NO:1. The inventors have also identified DNA regions, meta-regions, and biomarkers within SEQ ID NO:1, where the methylation status is predictive of the presence or absence of a somaclonal abnormality. Methods, compositions, kits, and computer program products, including those described herein, can therefore be utilized to determine the methylation status of one or more DMRs, DNA regions, meta-regions, biomarkers, or cytosine nucleotides (e.g., cytosines in a CHG motif) therein to predict the presence or absence of a somaclonal abnormality in a plant and/or separate plants based on the predicted presence or absence of somaclonal abnormality each plant. For example, a culture of plant cells can be assayed to predict the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype).
(20) II. DNA Regions
(21) Differential methylation can be detected in a DNA region. A DNA region comprises a nucleic acid having one or more methylation sites of interest (e.g., a cytosine, a “microarray feature,” or an amplicon amplified from a select primer or primer pair) and flanking nucleic acid sequences (i.e., “wingspan”) of up to 4 kilobases (kb) in either or both of the 3′ or 5′ direction from the amplicon. This range roughly corresponds to the lengths of DNA fragments obtained by randomly fragmenting the DNA before screening for differential methylation between DNA in two or more samples (e.g., carrying out methods used to initially identify differentially methylated sequences as described in Example 1, below). In some embodiments, the wingspan of the one or more DNA regions is about 0.5 kb, 0.75 kb, 1.0 kb, 1.5 kb, 2.0 kb, 2.5 kb, 3.0 kb, 3.5 kb or 4.0 kb in both 3′ and 5′ directions relative to the sequence represented by the microarray feature. In some embodiments, the wingspan of the one or more DNA regions is about 2 kb, or 2 kb, in both the 3′ and 5′ directions relative to centermost nucleotide in the sequence represented by a microarray feature.
(22) The methylation sites in a DNA region can reside in non-coding transcriptional control sequences (e.g., promoters, enhancers, etc.) or in coding sequences, including introns, exons, and retrotransposon elements of the oil palm genome locus corresponding to SEQ ID NO:1. In some embodiments, the methods comprise detecting the methylation status within, at, or near one or more transposable elements (e.g., comprising a nucleic acid sequence that is in, or within about 1.0 kb, 1.5 kb, 2.0 kb, 2.5 kb, 3.0 kb, 3.5 kb or 4.0 kb 3′ or 5′ of, a transposable element in SEQ ID NO:1).
(23) The DNA regions of the invention also include naturally occurring variants, including for example, variants occurring in different subject populations and variants arising from single nucleotide polymorphisms (SNPs). SNPs encompass insertions and deletions of varying size and simple sequence repeats, such as dinucleotides and trinucleotide repeats. Variants include nucleic acid sequences sharing at least 90%, 95%, 98%, 99% sequence identity, i.e., having one or more deletions, additions, substitutions, inverted sequences, etc., relative to a DNA region described herein. Where the nucleic acid is an siRNA having a length of 21 or 24 nucleotides, variants include nucleic acid sequences sharing at least 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 identical nucleotides, e.g., having 1, 2, 3, 4, 5, 6, 7, 8, 9 or more deletions, additions, substitutions, inverted sequences, etc., relative to a DNA region described herein.
(24) III. METHODS
(25) In some embodiments, the presence or absence of somaclonal abnormalities (e.g., the Mantled phenotype) can be predicted by determining the methylation status of one or more cytosines within a genomic region of an oil palm plant corresponding to SEQ ID NO:1. SEQ ID NO:1 contains three different retrotransposons (SEQ ID NO:2, Element 1 (Rider); SEQ ID NO:3, Element 2 (Karma); SEQ ID NO:4, Element 3 (Koala)) and the EgDEF1 gene, which is transcribed in at least four different forms (cDEF1, encoded by SEQ ID NO:5; tDEF1, encoded by SEQ ID NO:75; kDEF1, encoded by SEQ ID NO:78; and gDEF1, encoded by SEQ ID NO:80).
(26) The methylation status of one or more cytosines (e.g., cytosines in a CHG motif) of SEQ ID NO:1 can, e.g., be determined and compared to a control, or a threshold value, and the presence or absence of somaclonal abnormalities can thereby be predicted. In some cases, a somaclonal abnormality is predicted when the methylation is increased at one or more specific cytosines (e.g., relative to a control or threshold value). In some cases, a somaclonal abnormality is predicted when the methylation is reduced at one or more specific cytosines (e.g., relative to a control or threshold value). In some cases, a somaclonal abnormality is predicted when the methylation is either increased or reduced at one or more specific cytosines (e.g., relative to a control or threshold value).
(27) In some embodiments, the presence or absence of somaclonal abnormalities (e.g., the Mantled phenotype) can be predicted by determining the expression level of one or more transcripts that are differentially expressed in normal versus mantled plants, plant cells, or tissues. In some cases, a somaclonal abnormality is predicted when expression of one or more transcripts is reduced (e.g., relative to a control or threshold value). In some cases, the transcript is encoded by a sequence within SEQ ID NO:1. In some cases, the transcript is encoded by SEQ ID NO:77. In some cases, the transcript is encoded by a sequence within one or more of SEQ ID NOs: 130-134, 136-139, 142-143, or 144-161. In some cases, the transcript is encoded by a sequence within one or more of SEQ ID NO:144-161. In some cases, the transcript is an siRNA transcript (e.g., a 24mer siRNA). In some cases, a somaclonal abnormality is predicted when expression of one or more transcripts is increased (e.g., relative to a control or threshold value). In some cases, the transcript is encoded by a sequence within one or more of SEQ ID NO: 135, 140, or 141. In some cases, the transcript is an siRNA transcript (e.g., a 24mer siRNA).
(28) A. Methods for Determining Methylation
(29) Any method for detecting DNA methylation can be used in the methods of the present invention.
(30) In some embodiments, methods for detecting methylation include randomly shearing or randomly fragmenting the genomic DNA, cutting the DNA with a methylation-dependent or methylation-sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA. Selective identification can include, for example, separating cut and uncut DNA (e.g., by size) and quantifying a sequence of interest that was cut or, alternatively, that was not cut. See, e.g., U.S. Pat. No. 7,186,512. Alternatively, the method can encompass amplifying intact DNA after restriction enzyme digestion, thereby only amplifying DNA that was not cleaved by the restriction enzyme in the area amplified. See, e.g., U.S. Pat. Nos. 7,910,296; 8,361,719; 7,901,880; and 8,163,485. In some embodiments, amplification can be performed using a primer, or pair of primers, that is gene specific. Alternatively, adaptors can be added to the ends of the randomly fragmented DNA, the DNA can be digested with a methylation-dependent or methylation-sensitive restriction enzyme, intact DNA can be amplified using a primer or primers that hybridize to the adaptor sequences. In this case, a second step can be performed to determine the presence, absence or quantity of a particular gene in an amplified pool of DNA. In some embodiments, the DNA is amplified using real-time, quantitative DNA amplification (e.g., PCR).
(31) In some embodiments, the methods comprise quantifying the average methylation density in a target sequence within a population of genomic DNA. In some embodiments, the method comprises contacting genomic DNA with a methylation-dependent restriction enzyme or methylation-sensitive restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved; quantifying intact copies of the locus; and comparing the quantity of amplified product to a control value representing the quantity of methylation of control DNA, thereby quantifying the average methylation density in the locus compared to the methylation density of the control DNA.
(32) The quantity of methylation of a locus of DNA can be determined by providing a sample of genomic DNA comprising the locus, cleaving the DNA with a restriction enzyme that is either methylation-sensitive or methylation-dependent, and then quantifying the amount of intact (e.g., uncut by the methylation-sensitive or methylation-dependent restriction enzyme) DNA or quantifying the amount of cut DNA at the DNA locus of interest. The amount of intact or cut DNA will depend on the initial amount of genomic DNA containing the locus, the amount of methylation in the locus, and the number (i.e., the fraction) of nucleotides in the locus that are methylated in the genomic DNA. The amount of methylation in a DNA locus can be determined by comparing the quantity of intact DNA or cut DNA to a control value representing the quantity of intact DNA or cut DNA in a similarly-treated DNA sample. The control value can represent a known or predicted number of methylated nucleotides. Alternatively, the control value can represent the quantity of intact or cut DNA from the same locus in another (e.g., normal, wild-type) cell or a second locus.
(33) By using at least one methylation-sensitive or methylation-dependent restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved and subsequently quantifying the remaining intact copies and comparing the quantity to a control, average methylation density of a locus can be determined. If the methylation-sensitive restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved due to the presence of methylation at the cleavage site, then the remaining intact DNA will be directly proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Similarly, if a methylation-dependent restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved due to the lack of methylation at the cleavage site, then the remaining intact DNA will be inversely proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Such assays are disclosed in, e.g., U.S. Pat. No. 7,910,296.
(34) Kits for the above methods can include, e.g., one or more of methylation-dependent restriction enzymes, methylation-sensitive restriction enzymes, amplification (e.g., PCR) reagents, and one or more probes and/or primers. In some cases, the one or more probes and/or primers are specific for, e.g., specifically hybridize to, SEQ ID NO:1, or a portion thereof. In some cases, the one or more probes and/or primers are specific for, e.g., specifically hybridize to, bisulfite converted SEQ ID NO:1, or a portion thereof.
(35) Quantitative amplification methods (e.g., quantitative PCR or quantitative linear amplification) can be used to quantify the amount of intact DNA within a locus selected by one or more amplification primers following restriction digestion. Methods of quantitative amplification are disclosed in, e.g., U.S. Pat. Nos. 6,180,349; 6,033,854; and 5,972,602, as well as in, e.g., Gibson et al., Genome Research 6:995-1001 (1996); DeGraves, et al., Biotechniques 34(1):106-10, 112-5 (2003); Deiman B, et al., Mol Biotechnol. 20(2):163-79 (2002). Amplifications can be monitored in “real time.”
(36) Additional methods for detecting DNA methylation can involve genomic sequencing before and after treatment of the DNA with bisulfite. See, e.g., Frommer et al., Proc. Natl. Acad. Sci. USA 89:1827-1831 (1992). When sodium bisulfite is contacted to DNA, unmethylated cytosine is converted to uracil, while methylated cytosine is not modified.
(37) In some embodiments, restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA is used to detect DNA methylation. See, e.g., Sadri & Hornsby, Nucl. Acids Res. 24:5058-5059 (1996); Xiong & Laird, Nucleic Acids Res. 25:2532-2534 (1997).
(38) In some embodiments, a MethyLight assay is used alone or in combination with other methods to detect DNA methylation (see, Eads et al., Cancer Res. 59:2302-2306 (1999)). Briefly, in the MethyLight process genomic DNA is converted in a sodium bisulfite reaction (the bisulfite process converts unmethylated cytosine residues to uracil). Amplification of a DNA sequence of interest is then performed using, e.g., PCR primers that hybridize to CpG dinucleotides. By using one or more primers that hybridize only to sequences resulting from bisulfite conversion of unmethylated DNA, (or alternatively to methylated sequences that are not converted) amplification can indicate methylation status of sequences where the one or more primers hybridize. Similarly, the amplification product can be detected with a probe that specifically binds to a sequence resulting from bisulfite treatment of unmethylated (or methylated) DNA. If desired, both primer(s) and probe(s) can be used to detect methylation status. Thus, kits for use with MethyLight can include sodium bisulfite as well as primer(s) or detectably-labeled probe(s) (including but not limited to Taqman or molecular beacon probes) that distinguish between methylated and unmethylated DNA that have been treated with bisulfite. Other kit components can include, e.g., reagents necessary for amplification of DNA including but not limited to, PCR buffers, deoxynucleotides; and a thermostable polymerase.
(39) In some embodiments, a Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension) reaction is used alone or in combination with other methods to detect DNA methylation (see, Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531 (1997)). The Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, supra). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest.
(40) Typical reagents (e.g., as might be found in a typical Ms-SNuPE-based kit) for Ms-SNuPE analysis can include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for a specific gene; reaction buffer (for the Ms-SNuPE reaction); and detectably-labeled nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
(41) In some embodiments, a methylation-specific PCR (“MSP”) reaction is used alone or in combination with other methods to detect DNA methylation. An MSP assay entails initial modification of DNA by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA. See, Herman et al., Proc. Natl. Acad. Sci. USA 93:9821-9826, (1996); U.S. Pat. No. 5,786,146.
(42) Additional methylation detection methods include, but are not limited to, methylated CpG island amplification (see, Toyota et al., Cancer Res. 59:2307-12 (1999)) and those described in, e.g., U.S. Patent Publication 2005/0069879; Rein, et al. Nucleic Acids Res. 26 (10): 2255-64 (1998); Olek, et al. Nat Genet. 17(3): 275-6 (1997); and PCT Publication No. WO 00/70090.
(43) In some embodiments, the methods include: obtaining a biological sample from a plant; determining the methylation status of at least one cytosine (e.g., cytosine in a CHG motif) within a differential methylation region (DMR) in the sample from the plant, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1; and correlating the methylation status of the at least one cytosine to the presence or absence of a somaclonal abnormality in the plant, wherein the correlation comprises predicting the presence or absence of somaclonal abnormality in the plant.
(44) A biological sample can be obtained by any method known in the art. In general, the biological sample is obtained in a manner that preserves the nucleic acid of the sample. In some cases, the biological sample is obtained and treated to preserve the methylation status of genomic DNA therein. In some cases, the biological sample is obtained and treated to preserve RNA integrity.
(45) Alternatively, in some cases, the methods include providing a prediction of a presence or absence of a somaclonal abnormality in a plurality of plants, wherein the presence or absence of a somaclonal abnormality is determined by a methylation status of at least one cytosine within a differential methylation region (DMR) in a sample from each plant, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1; and physically separating a plant predicted to have a somaclonal abnormality from a plant predicted to lack a somaclonal abnormality.
(46) In some cases, the method further includes physically separating a plant predicted to have a somaclonal abnormality from one or more plants predicted to lack a somaclonal abnormality. In some cases, the plants can be physically separated, e.g., by selecting plants predicted to have a somaclonal abnormality and destroying or discarding them. In some cases, the plants are physically separated by selecting plants predicted to lack a somaclonal abnormality for cultivation. In some cases, plants selected for cultivation are germinated, transplanted, or planted. In some cases, plants not selected for cultivation are discarded or destroyed. In some cases, physically separated plants are treated to reduce, mitigate, eliminate, or prevent the somaclonal abnormality. For example, the physically separated plants can be contacted with an expression cassette containing a promoter operably linked to a polynucleotide encoding a transcript that is reduced in expression in a plant predicted to have a somaclonal abnormality.
(47) In some cases, the DMR is within a DNA meta-region in the sample from the plant. The meta-region contains two or more overlapping DNA regions that exhibit differential methylation. Exemplary DNA meta-regions include overlapping 4 kb wingspan regions (2 kb 5′ and 3′) centered on biomarkers corresponding (e.g., at least 90%, 95%, or 99% identical, or identical) to SEQ ID NOS: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72. In some cases, the DNA meta-regions are in SEQ ID NO:1, or are in the locus corresponding to (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to) SEQ ID NO:1 in the oil palm genome. Exemplary DNA meta-regions include those at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the DMR is within a DNA region in the sample from the plant. The DNA region can, e.g., be a 4 kb, wherein the DNA region is at least about 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the cytosine is in a biomarker, wherein the biomarker is at least 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72.
(48) In some embodiments, the presence of a somaclonal abnormality is predicted when the methylation status of at least one cytosine is reduced relative to a control locus. In some embodiments, the presence of a somaclonal abnormality is predicted when the methylation status of at least one cytosine is increased relative to a control locus. In some cases, either an increase or a decrease in methylation of at least one cytosine predicts the presence of a somaclonal abnormality. In some cases, the at least one cytosine is in a locus, retrotransposon, DNA meta-region, DNA region, or biomarker corresponding (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical) to a sequence selected from SEQ ID NOS: 1-5, and 7-75, 78, or 80.
(49) The methylation status of the at least one cytosine can be compared to a control locus to determine a relative change in methylation. For example, if the methylation status of the cytosine at the test locus indicates a higher degree of methylation as compared to the methylation status of at the control locus, then the methylation status of the test locus is increased. As another example, if the methylation status of the cytosine at the test locus indicates a lower degree of methylation as compared to the methylation status of at the control locus, then the methylation status of the test locus is decreased. Typically, the control locus will have a known, relatively constant, methylation status. For example, the control locus can be previously determined to have no, some, or a high amount of methylation, thereby providing a relative constant value to control for error in detection methods, etc., unrelated to the presence or absence of a somaclonal abnormality. In some embodiments, the control locus is endogenous, i.e., is part of the genome of the individual sampled. Alternatively, the control locus can be an exogenous locus, e.g., a DNA sequence spiked into the sample in a known quantity and having a known methylation status.
(50) In some embodiments, the methylation status of at least one cytosine in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 different differential methylation regions (DMRs) are determined to predict the presence or absence of a somaclonal abnormality. In some cases, the DMRs are in a locus, retrotransposon, DNA meta-region, DNA region, or biomarker corresponding (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical) to a sequence independently selected from SEQ ID NOS: 1-5, and 7-75.
(51) In some embodiments, the predicted somaclonal abnormality is an abnormality that reduces fruit yield, oil yield, growth, or reproduction of an oil palm plant. In some cases, the reduction is relative to a control plant, such as a parent plant, or a wild-type plant of the same fruit color (nigrescens or virescens) or shell thickness (dura, tenera, or pisifera) phenotype. In some cases, the somaclonal abnormality exhibits a Mantled phenotype.
(52) B. Predicting Abnormality by Gene Expression Analysis
(53) Methylation of genomic DNA can affect expression (transcription and/or translation) of nearby gene sequences. Therefore, in some embodiments, the methods include the step of correlating the methylation status of at least one cytosine in a DNA region with the expression of nearby coding sequences, such as one or more transcripts of cDEF1 (SEQ ID NO:5), tDEF1 (SEQ ID NO:75), kDEF1 (SEQ ID NO:78), or gDEF1 (SEQ ID NO:80), and/or one or more transcripts of a retrotransposon near the EgDEF1 locus (SEQ ID NO:2, 3, or 4). For example, expression of gene sequences within about 1.0 kb, 1.5 kb, 2.0 kb, 2.5 kb, 3.0 kb, 3.5 kb or 4.0 kb, or more, in either the 3′ or 5′ direction from the cytosine of interest in the DNA region can be detected. In some embodiments, the methods include the step of detecting or quantifying the expression of nearby coding sequences, such as one or more transcripts of cDEF1 (SEQ ID NO:5), tDEF1 (SEQ ID NO:75), kDEF1 (SEQ ID NO:78), or gDEF1 (SEQ ID NO:80), and/or one or more transcripts of a retrotransposon near the EgDEF1 locus (SEQ ID NO:2, 3, or 4), and correlating the expression with a presence or absence or prediction of a somaclonal abnormality.
(54) In some cases, expression of cDEF1 is correlated with a normal phenotype. For example, in some cases, cDEF1 expression is higher in plants with a normal phenotype, and thus a Mantled phenotype is predicted when a low level (e.g., relative to a threshold or control) of cDEF1 expression is detected. In some cases, expression of tDEF1 is correlated with a Mantled phenotype. For example, in some cases, tDEF1 expression is higher in plants with a Mantled phenotype, and thus a Mantled phenotype is predicted when a high level (e.g., relative to a threshold or control) of tDEF1 expression is detected. In some cases, expression of kDEF1 is correlated with a Mantled phenotype. For example, in some cases, kDEF1 expression is higher in plants with a Mantled phenotype, and thus a Mantled phenotype is predicted when a high level (e.g., relative to a threshold or control) of kDEF1 expression is detected. In some cases, expression of gDEF1 is correlated with a Mantled phenotype. For example, in some cases, gDEF1 expression is higher in plants with a Mantled phenotype, and thus a Mantled phenotype is predicted when a high level (e.g., relative to a threshold or control) of gDEF1 expression is detected. In some cases, the threshold or control is a sample from a normal plant or an expression value for a normal plant. In some cases, the threshold or control is a sample from an abnormal (e.g., Mantled) plant or an expression value for an abnormal (e.g., Mantled) plant.
(55) In some cases, expression of an siRNA encoded within SEQ ID NO:1 is correlated with a normal phenotype, and thus a Mantled phenotype is predicted when a low level (e.g., relative to a threshold or control) of siRNA expression is detected. For example, in some cases, a Mantled phenotype is predicted when a low level (e.g., relative to a threshold or control) of expression of one or more siRNAs encoded by one or more of SEQ ID NOs:144-161 is detected. In some cases, a Mantled phenotype is predicted when expression of one or more siRNAs encoded by one or more of SEQ ID NOs:144-161 is reduced by at least 50% relative to a control or threshold value. As another example, in some cases, a Mantled phenotype is predicted when a low level (e.g., relative to a threshold or control) of expression of an siRNA encoded by SEQ ID NO:91 is detected. In some cases, a Mantled phenotype is predicted when expression of an siRNA encoded by SEQ ID NO:91 is reduced by at least 50%, 60%, 70%, 80%, or 90% relative to a control or threshold value.
(56) Methods for measuring transcription and/or translation of a particular gene sequence are well known in the art. See, for example, Ausubel, Current Protocols in Molecular Biology, 1987-2006, John Wiley & Sons; and Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Edition, 2000, Cold Spring Harbor Laboratory Press. In some embodiments, the gene or protein expression of a gene encoded in SEQ ID NO:1, 2, 3, 4, 5, 75, 78, or 80 is compared to a control, for example the expression of a nearby gene sequence from a sample from plant known to be negative for somaclonal abnormality or known to be positive for somaclonal abnormality, or to an expression level that distinguishes between somaclonally abnormal and wild-type states. Such methods involving detection of expression, like the methods of detecting methylation described herein, are useful in predicting the presence or absence of somaclonal abnormality (e.g., useful in predicting the presence or absence of the Mantled phenotype) in a plant.
(57) In some cases, the expression of a regulatory RNA is detected. For example, a regulatory RNA that modulates the expression of cDEF1 (SEQ ID NO:5), tDEF1 (SEQ ID NO:75) can be detected. Exemplary regulatory RNAs include, but are not limited to, microRNAs. In some cases, the expression of one or more regulatory RNAs that are at least partially encoded within a retrotransposon located in the genomic locus corresponding to SEQ ID NO:1 is detected. Differential DNA methylation can result in changes in regulatory RNA expression (e.g., microRNAs, small interfering RNAs and antisense RNAs) which can then result in changes of gene expression in cis or in trans. Likewise, regulatory RNAs themselves can direct the establishment and/or maintenance of DNA methylation state in plants via the RNA-directed DNA methylation (RdDM) system. See Vu, et al. 2013 Development 140: 2953-60, Regulski, et al. 2013 Genome Res 23: 1651. Therefore, in some cases, mechanisms involving regulatory RNAs may be involved in either the establishment of differential DNA methylation associated with the Mantled phenotype, or in the mechanism by which differential DNA methylation regulates the function of genes involved in the Mantled phenotype.
(58) In some embodiments, the methods further comprise the step of correlating the methylation status of one or more cytosines in SEQ ID NO:1, or DNA region, DNA meta-region, or biomarker therein, to expression of one or more of the gene regions identified in SEQ ID NO:1, 2, 3, 4, 5, 75, 78, or 80. In some embodiments, the methods further comprise the step of correlating the methylation status and/or expression level to the Mantled phenotype.
(59) In some embodiments, the expression of a small RNA is detected. Small RNAs are a small non-coding expressed RNA molecules. Small RNAs can be involved in gene regulation and other biological processes. Exemplary small RNAs detected or quantified by the methods of the present invention include one or more small RNAs encoded by a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161. Exemplary small RNAs detected or quantified by the methods of the present invention include one or more small RNAs at least partially encoded by a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161.
(60) In some cases, small RNAs are differentially expressed in normal versus abnormal (e.g., Mantled) plants. Such differential expression can be detected in a plant sample and correlated with a predicted normal or abnormal (e.g., Mantled) phenotype for the plant corresponding to the sample. Such differentially expressed small RNAs include, but are not limited to those encoded by, or at least partially encoded by, a polynucleotide at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161.
(61) In some cases, an abnormal (e.g., Mantled) phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, or 143 is increased (e.g., relative to a threshold or control). In some cases, an abnormal (e.g., Mantled) phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 116, 117, 135 140, or 141 is increased (e.g., relative to a threshold or control). In some cases, the threshold or control is a sample from a normal plant or an expression value for a normal plant. In some cases, the threshold or control is a sample from an abnormal (e.g., Mantled) plant or an expression value for an abnormal (e.g., Mantled) plant.
(62) In some cases, an abnormal (e.g., Mantled) phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:135, 140, or 141 is detected, or when an increased expression level (e.g., relative to a threshold or control) is detected. In some cases, a normal phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO: 130, 131, 132, 133, 134, 136, 137, 138, 139, 142, or 143 is detected, or when an increased expression level (e.g., relative to a threshold or control) is detected. In some cases, the threshold or control is a sample from a normal plant or an expression value for a normal plant. In some cases, the threshold or control is a sample from an abnormal (e.g., Mantled) plant or an expression value for an abnormal (e.g., Mantled) plant.
(63) In some cases, an abnormal (e.g., Mantled) phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161 is decreased (e.g., relative to a threshold or control). In some cases, an abnormal (e.g., Mantled) phenotype is predicted when expression of a small RNA encoded by, or at least partially encoded by, a polynucleotide sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:97, 115, 118, 119, 120, 121, 122, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161 is decreased (e.g., relative to a threshold or control).
(64) In some embodiments, the methods include: obtaining a biological sample from a plant; detecting or quantifying expression of one or more of SEQ ID NO:2, 3, 4, 5, 75, 78, 80, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161; and correlating the expression or expression level to the presence or absence of a somaclonal abnormality in the plant, wherein the correlation comprises predicting the presence or absence of somaclonal abnormality in the plant.
(65) A biological sample can be obtained by any methods known in the art. In general, the biological sample is obtained in a manner that preserves the nucleic acid of the sample. In some cases, the biological sample is obtained and treated to preserve the RNA therein. In some cases, the biological sample is obtained and treated to preserve RNA integrity.
(66) Alternatively, in some cases, the methods include providing a prediction of a presence or absence of a somaclonal abnormality in a plurality of plants, wherein the presence or absence of a somaclonal abnormality is determined by gene expression analysis; and physically separating a plant predicted to have a somaclonal abnormality from a plant predicted to lack a somaclonal abnormality.
(67) In some cases, the method further includes physically separating a plant predicted to have a somaclonal abnormality from one or more plants predicted to lack a somaclonal abnormality. In some cases, the plants can be physically separated, e.g., by selecting plants predicted to have a somaclonal abnormality and destroying or discarding them. In some cases, the plants are physically separated by selecting plants predicted to lack a somaclonal abnormality for cultivation. In some cases, plants selected for cultivation are germinated, transplanted, or planted. In some cases, plants not selected for cultivation are discarded or destroyed. In some cases, physically separated plants are treated to reduce, mitigate, eliminate, or prevent the somaclonal abnormality.
(68) In some embodiments, the predicted somaclonal abnormality is an abnormality that reduces fruit yield, oil yield, growth, or reproduction of an oil palm plant. In some cases, the reduction is relative to a control plant, such as a parent plant, or a wild-type plant of the same fruit color (nigrescens or virescens) or shell thickness (dura, tenera, or pisifera) phenotype. In some cases, the somaclonal abnormality exhibits a Mantled phenotype.
(69) C. Sampling and/or Sorting Oil palm nucleic acid can be obtained from any suitable cell or tissue of an oil palm plant. For example, oil palm nucleic acid can be obtained from a leaf, a stem, a root, a seed, or a plant cell or group of plant cells in, or obtained from, in vitro culture. In some cases, the oil palm nucleic acid is obtained from endosperm tissue of a seed. In some embodiments, nucleic acid is extracted from a plant cell (e.g., a plant cell in, or obtained from, in vitro culture), a seedling, an immature (e.g., non fruit bearing) plant, or a mature plant. In some cases, the oil palm nucleic acid is obtained in such a manner that the oil palm plant is not reduced in viability or is not substantially reduced in viability. For example, in some cases, sample extraction can reduce the number of viable plants or seeds in a population by less than about 20%, 15%, 10%, 5%, 2.5%, 1%, or less. In some cases, nucleic acid is obtained from a population of plant cells, wherein the population of plant cells is of a uniform or substantially uniform genotype and/or epigenotype at one or all genomic loci. For example, a sample of nucleic acid from a portion of plant cells in an in vitro culture can be extracted, assayed, and the results used to sort the in vitro culture. Exemplary tissue types for obtaining a suitable sample include leaf from in vitro plantlets and nursery ramets. Alternatively, tissues such as roots, inflorescence and zygotic embryos can also be used. Tissues from potential ortets can also be screened prior to tissue culture. Seeds from semiclones and biclones can be tested as well.
(70) Sampling can be automated. For example, a machine can be used to pick plant cell colonies or clumps, or portions thereof, in an in vitro culture for analysis. Similarly, a machine can take samples from a plant or seed, or to take samples from a plurality of plant cell colonies, clumps, plants, or seeds. Sampling can also be performed manually. Further sampling methodologies are described herein.
(71) In some embodiments, the sampling is controlled to deter contamination of the sample. For example, washing steps can be employed between sample processing steps. Alternatively, disposable or removable sample handling elements can be utilized, e.g., disposable pipetting tips, disposable receptacles or containers, or disposable blades or grinders.
(72) In some cases, samples are purified prior to detection of the methylation status of one or more cytosines within a DMR of an oil palm plant. For example, samples can be centrifuged, extracted, precipitated (e.g., alcohol precipitated), or purified using a solid support (e.g., using nucleic acid binding beads or membranes). Additional methods for purification of plant nucleic acids are known by those of skill in the art.
(73) In some embodiments, the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype) is predicted, and the plant is sorted based on the predicted phenotype. The somaclonal abnormality (e.g., the Mantled phenotype) can be predicted, e.g., based on the methylation status of one or more cytosines in SEQ ID NO:1, or one or more DNA regions, DNA meta-regions, or biomarkers therein, and the plant is sorted based on the predicted phenotype. In some cases, the somaclonal abnormality (e.g., the Mantled phenotype) can be predicted, e.g., based on methylation status or gene expression, and the plant is sorted based on the predicted phenotype.
(74) For example, a plurality of plants can be sorted (e.g., physically separated) into Mantled or non-Mantled (e.g., wild-type) plants based on their predicted phenotype (e.g., based on their methylation or expression as described herein). Wild-type plants can be sorted and stored or utilized and planted or otherwise separated from plant propagation material used for the clonal generation of plants lacking one or more somaclonal abnormalities. In some cases plants having one or more somaclonal abnormalities, e.g., Mantled plants, can be discarded or destroyed (e.g., autoclaved) or not cultivated in commercial oil palm production.
(75) In some cases, the plant is a plant cell, a clump of plant cells, or a colony of plant cells from in vitro culture and the in vitro culture is discarded or destroyed when one or more plants from the culture are predicted to have a somaclonal abnormality (e.g., one or more plants are predicted to exhibit a Mantled phenotype). In some cases, the plant is a young ramet and nucleic acid from the plant is assayed to predict the presence or absence of a somaclonal abnormality. In some cases, the young ramet is then sorted before it is planted in the field. For example, young ramet predicted to have a somaclonal abnormality (e.g., the Mantled phenotype) can be discarded. Ramets predicted to lack a somaclonal abnormality can be further cultivated and/or planted in the field. As yet another alternative, oil palm plants that have been planted in the field for optimal palm oil yield, but are not mature enough to verify the absence of a somaclonal abnormality (e.g., a Mantled phenotype) can be assayed and plants predicted to have a somaclonal abnormality can be removed from the field.
(76) In some embodiments, the presence or absence of a somaclonal abnormality and plant fruit color and/or shell thickness phenotype is predicted. Methods for predicting fruit color and/or shell thickness phenotype, and/or sorting based on such predicted phenotypes, are disclosed in, e.g., U.S. patent application Ser. No. 14/226,508, filed on Mar. 26, 2014; and Ser. No. 13/800,652, filed on Mar. 13, 2013. In some cases, fruit color can be predicted and/or sorted based on the genotype of the VIR gene. In some cases, shell thickness can be predicted and/or sorted based on the genotype of the SHELL gene.
(77) In some cases, the fruit color and/or shell thickness prediction is combined with a methylation status or gene expression information to predict the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype). In some cases, the plant is sorted based on one, two, or all three predicted phenotypes. For example, the plant can be sorted into nigrescens or virescens seeds or plants and dura, tenera, or pisifera seeds or plants based on their predicted phenotypes. The plants can then be verified as predicted to lack a somaclonal abnormality (e.g., the Mantled phenotype). In some cases, the plants can be predicted to lack a somaclonal abnormality (e.g., the Mantled phenotype), and then such plants can be sorted and/or stored based on their predicted, or expected, nigrescens, virescens, dura, tenera, and/or pisifera phenotypes.
(78) In some cases, the prediction of one or more phenotypes is performed in young plants before cultivation in the field. Therefore, in some cases, the samples are young ramets during hardening in the pre-nursery or acclimatization in the nursery. In some embodiments, the samples are obtained from a semiclonal or biclonal plant that has been germinated and then cultivated less than 1, 2, 4, 6, months or less than 1, 2, 3, 4, or 5 years. In some embodiments, the samples are obtained before the plant has been germinated (e.g., from a seed) or shortly thereafter (e.g., less than about 1, 2, 3, 4, or 5 weeks after germination).
(79) In some embodiments, the methylation status of at least one cytosine is determined an combined with DNA fingerprinting methods to aid in cataloging, selecting, maintaining, organizing, identifying, or tracking of clonal material, stocks, strains, or cultures. For example, in vitro cultures can be confirmed to derive from a specified source or lineage suing DNA fingerprinting and methylation status or gene expression used to predict the presence or absence of a somaclonal abnormality. Similarly, the presence or absence of a strain, stock, or varietal protected under a Plant Variety Protection Act (e.g., the Plant Variety Protection Act of Malaysia or Indonesia) can be ascertained and the presence or absence of a somaclonal abnormality predicted. In some embodiments, palms can be identified and/or confirmed using DNA fingerprinting as having, or likely having, one or more desirable phenotypes (e.g., fruit color, shell thickness, pest resistance, etc.) and the presence or absence of a somaclonal abnormality predicted. Methods for DNA fingerprinting are known in the art and include, e.g., those described in Lim & Rao, J Oil Palm Research, 17:136-144 (December 2005); Billotte, et al., Genome, 44(3): 413-425 (2001); Jack & Mayes, Oleagineux, 48(1): 1-8 (1993); Jack, et al., Theor Appl Genet, 90:543-649 (1995); Cheah, et al., Advances in Oil Palm Research p. 332-70 (2000); and Corley, J. Oil Palm Research, 17:64-69 (2005).
(80) Machines can be utilized to carry out one or more methods described herein, prepare plant samples for one or more methods described herein, or facilitate high throughput sorting of oil palm plants.
(81) In some cases, a machine can sort and orient seeds such that the seed are all oriented in a similar manner. The seeds for example, can be oriented such that embryo region of the seed is down and the embryo free region is oriented up. In some cases, the seeds can be placed into an ordered array or into a single line.
(82) In some embodiments, the seed is held in pre-determined orientation to facilitate efficient and accurate sampling. For example, the machine can orient the seeds by seed shape or visual appearance. In some cases, the seed is oriented to facilitate sampling from the ‘Crown’ of each respective seed, containing the cotyledon and/or endosperm tissue of the seed, so that the germination viability of each seed is preserved.
(83) In some cases, a machine can separately store plants and corresponding extracted samples. For example, a sample may be obtained from an in vitro culture, and the culture stored. In some cases, the extracted samples and stored plants are organized, labeled, or catalogued in such a way that the sample and the plant (e.g., culture) from which it is derived can be determined. In some cases, the extracted samples and stored plants are tracked so that each can be accessed after data is collected. For example, a sample can be extracted from a culture and the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype) predicted for the sample, and thus the seed. The plant can then be accessed, germinated, planted, stored, or destroyed based on the prediction.
(84) In some cases, the extraction and storing are performed automatically by the machine, but the methylation analysis and/or treatment of analyzed plants performed manually or performed by another machine. As such, in some embodiments, a system is provided consisting of two or more machines for extraction of samples, sorting and storing, and prediction of the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype).
(85) In some cases, the plants are stored in an array by the machine, such as individually in an array of tubes or wells. The plants can be sampled and/or interrogated in or from each well. The results of the sampling or interrogating can be correlated with the position of the plant in the array.
(86) Sampling can include extraction and/or analysis of nucleic acid (e.g., DNA or RNA). Sampling can further include magnetic resonance imaging, optical dispersion, optical absorption, ELISA, enzymatic assay, or the like.
(87) Systems, machines, methods and compositions for plant culturing, sampling, and/or sorting are further described in, e.g., U.S. Pat. Nos. 4,910,146; 6,307,123; 6,646,264; 6,673,595; 7,367,155; 8,312,672; 7,685,768; 7,673,572; 8,443,545; 7,998,669; 8,114,669; 8,362,317; 8,076,076; 7,402,731; 7,600,642; 8,237,016; 8,401,271; 8,281,935; 8,241,914; 6,880,771; 7,909,276; 8,221,968; and 7,454,989. Systems, machines, methods and compositions for plant culturing, sampling, and/or sorting are also further described in, e.g., U.S. Patent Application Publication NOs: 2012/180386; 2009/070891; 2013/104454, 2012/117865, 2008/289061; 2008/000815; 2011/132721; 2011/195866; 2011/0079544; 2010/0143906; and 2013/079917. Additional systems, machines, methods, and compositions for plant culturing, sampling, and/or sorting are further described in international patent application publications WO2011/119390; and WO2011/119394.
(88) Also provided herein are methods for using the systems, machines, methods, and compositions described herein for plant (e.g., a seed, a seedling, a plant, a plant cell, a plant cell colony, or a clump of plant cells) sampling or sorting. For example, a plant or set of plants can be loaded into a sampler, and a sample obtained. In some cases, the plant can be stored, e.g., in an array. In some cases, the storage is performed by the machine that samples the plant. In other cases, the plant is stored by another machine, or stored manually. In some cases, DNA can be extracted from the sample. In some cases, sample can be obtained and DNA extracted by the same machine. In other cases, the DNA is extracted by another machine, or manually. The extracted DNA can be analyzed and the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype) predicted. In some cases, the extracted DNA is analyzed by the same machine, by another machine, or manually. In some cases, the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype) is predicted by the machine, a different machine, or manually. In some cases, stored plants can be disposed of (e.g., cultivated, treated, or destroyed) based on the prediction of the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype). In some cases, stored plants can be disposed of based on the VIR genotype or predicted fruit color phenotype, based on their predicted shell thickness phenotype, and/or based on the prediction of the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype). For examples, plants predicted to have a somaclonal abnormality can be discarded or destroyed, or treated. As another example, plants predicted to be pisifera and/or Mantled, or dura and/or Mantled, can be removed from (e.g., separated from) the population of plants that are selected for planting and cultivation in the field for oil production. Similarly, e.g., plants predicted to be tenera and having an absence of somaclonal abnormality (e.g., lacking the Mantled phenotype), can be separated from other plants and/or selected for field cultivation. In some cases, the plant is disposed of by the machine, a different machine, or manually.
(89) In some cases, the plant (e.g., a seed, a seedling, a plant, a plant cell, a plant cell colony, or a clump of plant cells) or plants are shipped from a customer to a service provider, analyzed, and returned. In some cases, only plants with a predicted phenotype or phenotypes are returned. For example, only plants predicted to lack a somaclonal abnormality, or a combination thereof are returned. In other cases, plants are sampled, and the samples are shipped from a customer to a service provider for analysis. The customer can then utilize information provided by the analysis to dispose of the plants.
(90) In some cases, reagents, such as the compositions described herein are provided for sampling of plants manually or automatically. For example, endonucleases, oligonucleotide primers or probes, or a combination thereof as described herein can be provided. As another example, reaction mixtures or kits containing reagents necessary for analysis of nucleic acid from an oil palm plant can be provided, as described herein.
(91) C. Screening Culture Conditions
(92) In vitro culture can produce somaclonal abnormalities in oil palm lines. For example, in vitro culture can give rise to oil palm plants having the Mantled phenotype. In some cases, culture conditions or protocols can screened to identify conditions or protocols that reduce or eliminate the generation of somaclonal variants. Such conditions or protocols can then be used to develop clonally propagated oil palm plant lines having reduced, or no, somaclonal abnormalities. For example, an in vitro culture can be subjected to standard culture conditions as a control. A similar, or identical culture can then be subjected to a test condition. The presence or absence, proportion, or likelihood of a somaclonal abnormality can be determined in the control and test cultures. Test conditions that reduce or eliminate somaclonal abnormalities can then be identified and utilized. In some cases, the experiment can be repeated iteratively to further improve culture conditions. Exemplary culture conditions include, but are not limited to, physiological state of palm during sampling, type of explant, number of subcultures, number of ramets per embryogenic line, auxin hormone level and type, cytokinin hormone level and type, salt concentration, osmolarity, pH, temperature, photoperiod, presence and/or type of feeder cells, media composition, etc.
(93) In some cases, in vitro plant cultures can be screened to identify cultures that have developed somaclonal abnormalities. For example, an in vitro oil palm plant culture, or a set of in vitro oil palm plant cultures can be assayed, the presence or absence of somaclonal abnormalities can be predicted, and then cultures predicted to have a somaclonal abnormality, or a high percentage or likelihood of somaclonal abnormalities, can be separated, discarded or destroyed. In some cases, cultures predicted to have a somaclonal abnormality can be treated to reduce the likelihood of, prevent, or revert the somaclonal abnormality.
(94) IV. Reducing Somaclonal Abnormalities
(95) In some embodiments, plants (e.g., plant cell in vitro tissue cultures) are treated to reduce, prevent, mitigate, eliminate, or revert a somaclonal abnormality or a predicted somaclonal abnormality. In some cases, somaclonal abnormalities are reduced, prevented, mitigated, eliminated, or reverted by exogenously applying to the plant an mRNA encoded by SEQ ID NO:5 or a sequence at least 90%, 95%, or 99% identical to SEQ ID NO:5; or exogenously applying to the plant a small RNA encoded by a sequence comprising a polynucleotide at least 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 116, 117, 123, 124, 130, 131, 132, 133, 134, 136, 137, 138, 139, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161.
(96) In some cases, the exogenously applying the mRNA or small RNA comprises contacting a cytoplasm or nucleus of the plant with the mRNA or small RNA. In some cases, the mRNA or small RNA is produced in an in vitro transcription reaction. In some cases, the exogenously applying the mRNA or small RNA comprises contacting the plant with an expression cassette comprising a heterologous promoter operably linked to a polynucleotide at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:5. In some cases, the exogenously applying the mRNA or small RNA comprises contacting the plant with an expression cassette comprising a heterologous promoter operably linked to a polynucleotide encoding a small RNA, wherein the polynucleotide comprises a sequence at least 75%, 80%, 85%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 116, 117, 123, 124, 130, 131, 132, 133, 134, 136, 137, 138, 139, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 or 161.
(97) In some cases, the exogenously applying the mRNA or small RNA comprises generating a transgenic plant with a heterologous promoter operably linked to one or more of the foregoing polynucleotides and generating an in vitro tissue culture from the transgenic plant. In some cases, such a tissue culture system can reduce or eliminate the generation of somaclonal abnormalities. Thus, oil palm plants having one or more desirable properties such as high oil yield, or a desired dura, tenera, pisifera, virescens, or nigrescens, phenotype, can be generated indefinitely via in vitro tissue culture propagation techniques without, or with less, risk of generating plants with a somaclonal abnormality.
(98) V. Kits
(99) This invention also provides kits for the detection and/or quantification of methylation within the DMRs, DNA regions, DNA meta-regions, or biomarkers of the invention using the methods described herein.
(100) The kits of the invention can comprise at least one polynucleotide that hybridizes to at least one of the diagnostic biomarker sequences of the invention and at least one reagent for detection of methylation. Reagents for detection of methylation can include, e.g., sodium bisulfite, polynucleotides designed to specifically hybridize to sequence that is a produce (e.g., an amplification product) of a biomarker sequence of the invention if the biomarker sequence is not methylated (e.g., containing at least one C.fwdarw.U conversion) or to specifically hybridize if the biomarker sequence is methylated, and/or a methylation-sensitive or methylation-dependent restriction enzyme. The kits can provide solid supports in the form of an assay apparatus that is adapted to use in the assay. The kits may further comprise detectable labels, optionally linked to a polynucleotide, e.g., a probe, in the kit. Other materials useful in the performance of the assays can also be included in the kits, including test tubes, transfer pipettes, and the like. The kits can also include written instructions for the use of one or more of these reagents in any of the assays described herein.
(101) In some embodiments, a kit for determining the methylation status of at least one DMR in a biological sample from an oil palm plant is provided, the kit including: (1) a polynucleotide, or a pair of polynucleotides, capable of specifically amplifying at least a portion of a DMR, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1; and a methylation-dependent, a methylation sensitive restriction enzyme, and/or sodium bisulfite; or (2) sodium bisulfite, primers, and adapters for whole genome amplification, and at least one polynucleotide to quantify the presence of the converted methylated and/or the converted unmethylated sequence of at least one cytosine from a DMR, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1; or (3) methylation sensing restriction enzymes, primers and adapters for whole genome amplification, and at least one polynucleotide to quantify the number of copies of at least a portion of a DMR, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1; or (4) a methylation sensing binding moiety and at least one polynucleotide to quantify the number of copies of at least a portion of a DMR, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1.
(102) In some cases, the DMR is within a DNA meta-region in the sample from the plant. The meta-region contains two or more overlapping DNA regions that exhibit differential methylation. Exemplary DNA meta-regions include overlapping 4 kb wingspan regions (2 kb 5′ and 3′) centered on biomarkers corresponding (e.g., at least 90%, 95%, or 99% identical, or identical) to SEQ ID NOS: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72. In some cases, the DNA meta-regions are in SEQ ID NO:1, or are in the locus corresponding to (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to) SEQ ID NO:1 in the oil palm genome. Exemplary DNA meta-regions include those at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the DMR is within a DNA region in the sample from the plant. The DNA region can, e.g., be a 4 kb, wherein the DNA region is at least about 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the cytosine is in a biomarker, wherein the biomarker is at least 90%, 95%, or 95% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72.
(103) In some embodiments, the kit determines the methylation status of at least one cytosine in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 different differential methylation regions (DMRs) are determined to predict the presence or absence of a somaclonal abnormality. In some cases, the DMRs are in a locus, retrotransposon, DNA meta-region, DNA region, or biomarker corresponding (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical) to a sequence independently selected from SEQ ID NOS: 1-5, and 7-75.
(104) In some embodiments, the kit contains a detectably labeled polynucleotide probe that specifically detects an amplified DMR, or a portion thereof.
(105) VI. Computer Program Product
(106) The calculations for the methods described herein can involve computer-based calculations and tools to predict the presence or absence of somaclonal abnormalities (e.g., predict the Mantled phenotype) in a plant or plant cells. For example, a methylation value for a DNA region, DNA meta-region, biomarker, a portion thereof, or one or more cytosines therein, can be compared by a computer to a threshold or control value, as described herein. The tools are advantageously provided in the form of computer programs that are executable by a general purpose computer system (referred to herein as a “host computer”) of conventional design. The host computer may be configured with many different hardware components and can be made in many dimensions and styles (e.g., desktop PC, laptop, tablet PC, handheld computer, server, workstation, mainframe). Standard components, such as monitors, keyboards, disk drives, CD and/or DVD drives, and the like, may be included. Where the host computer is attached to a network, the connections may be provided via any suitable transport media (e.g., wired, optical, and/or wireless media) and any suitable communication protocol (e.g., TCP/IP); the host computer may include suitable networking hardware (e.g., modem, Ethernet card, WiFi card). The host computer may implement any of a variety of operating systems, including UNIX, Linux, Microsoft Windows, MacOS, or any other operating system.
(107) Computer code for implementing aspects of the present invention may be written in a variety of languages, including PERL, C, C++, Java, JavaScript, VBScript, AWK, or any other scripting or programming language that can be executed on the host computer or that can be compiled to execute on the host computer. Code may also be written or distributed in low level languages such as assembler languages or machine languages.
(108) The host computer system advantageously provides an interface via which the user controls operation of the tools. In the examples described herein, software tools are implemented as scripts (e.g., using PERL), execution of which can be initiated by a user from a standard command line interface of an operating system such as Linux or UNIX. Those skilled in the art will appreciate that commands can be adapted to the operating system as appropriate. In other embodiments, a graphical user interface may be provided, allowing the user to control operations using a pointing device. Thus, the present invention is not limited to any particular user interface.
(109) Scripts or programs incorporating various features of the present invention may be encoded on various computer readable media for storage and/or transmission. Examples of suitable media include magnetic disk or tape, optical storage media such as compact disk (CD) or DVD (digital versatile disk), flash memory, and carrier signals adapted for transmission via wired, optical, and/or wireless networks conforming to a variety of protocols, including the Internet.
(110) In some embodiments, the computer program product contains a computer readable medium encoded with program code, the program code including:
(111) program code for receiving a methylation value representing the methylation status of at least one cytosine within a differential methylation region (DMR) in the sample from the oil palm plant, wherein the DMR is within a sequence of DNA at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to SEQ ID NO:1;
(112) program code for comparing the methylation value to a control value, wherein the control value distinguishes between plants with and without a somaclonal abnormality, wherein the comparison of the methylation value to the control value is predictive of the presence or absence of a somaclonal abnormality in the plant.
(113) In some cases, the DMR is within a DNA meta-region in the sample from the plant. The meta-region contains two or more overlapping DNA regions that exhibit differential methylation. Exemplary DNA meta-regions include overlapping 4 kb wingspan regions (2 kb 5′ and 3′) centered on biomarkers corresponding (e.g., at least 90%, 95%, or 99% identical, or identical) to SEQ ID NOS: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72. In some cases, the DNA meta-regions are in SEQ ID NO:1, or are in the locus corresponding to (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to) SEQ ID NO:1 in the oil palm genome. Exemplary DNA meta-regions include those at least 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the DMR is within a DNA region in the sample from the plant. The DNA region can, e.g., be a 4 kb, wherein the DNA region is at least about 70%, 80%, 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 73, and 74. In some cases, the cytosine is in a biomarker, wherein the biomarker is at least 90%, 95%, or 99% identical, or identical, to a sequence selected from the group consisting of SEQ ID NO:7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 71, and 72.
(114) The methylation status of the at least one cytosine can be compared to a control value, wherein the control value is a methylation value for a control locus to determine a relative change in methylation. For example, if the methylation status of the cytosine at the test locus indicates a higher degree of methylation as compared to the methylation status of at the control locus, then the methylation status of the test locus is increased. As another example, if the methylation status of the cytosine at the test locus indicates a lower degree of methylation as compared to the methylation status of at the control locus, then the methylation status of the test locus is decreased. Typically, the control locus will have a known, relatively constant, methylation status. For example, the control locus can be previously determined to have no, some, or a high amount of methylation, thereby providing a relative constant value to control for error in detection methods, etc., unrelated to the presence or absence of a somaclonal abnormality. In some embodiments, the control locus is endogenous, i.e., is part of the genome of the individual sampled. Alternatively, the control locus can be an exogenous locus, e.g., a DNA sequence spiked into the sample in a known quantity and having a known methylation status.
(115) In some embodiments, the methylation status of at least one cytosine in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 different differential methylation regions (DMRs) are determined to predict the presence or absence of a somaclonal abnormality. In some cases, the DMRs are in a locus, retrotransposon, DNA meta-region, DNA region, or biomarker corresponding (e.g., at least 70%, 80%, 90%, 95%, or 99% identical, or identical) to a sequence independently selected from SEQ ID NOS: 1-5, and 7-75.
(116) In some embodiments, the predicted somaclonal abnormality is an abnormality that reduces fruit yield, oil yield, growth, or reproduction of an oil palm plant. In some cases, the reduction is relative to a control plant, such as a parent plant, or a wild-type plant of the same fruit color (nigrescens or viriscens) or shell thickness (dura, tenera, or pisifera) phenotype. In some cases, the somaclonal abnormality exhibits a Mantled phenotype.
(117) In some cases, the computer program product predicts the presence or absence of a somaclonal abnormality (e.g., the Mantled phenotype) in the plant. In some cases, the computer program product provides the data for another computer program product, or a person of skill in the art, to predict the presence or absence of a somaclonal abnormality in the plant. In some cases, the computer program product calculates a statistical confidence (e.g., a p-value, t-statistic, etc.) for a prediction of the presence or absence of a somaclonal abnormality in the plant.
EXAMPLES
(118) The following examples are offered to illustrate, but not to limit the claimed invention.
Example 1: Global DNA Methylation Profiling Reveals Differential DNA Methylation in Mantled Clonally Propagated Materials
(119) Microarray features were designed based on a genome build of the pisifera oil palm genome (Singh et al. 2013, Nature 500, 340-344). Over 1 million features were designed to unique 61 base sequences across the unique sequence of the oil palm genome. Although repetitive sequences make up approximately 57% of the oil palm genome, unique sequence features could be designed to sequences flanking distinct repetitive elements, as well as unique sequences embedded within specific repetitive elements. Loci that are differentially methylated in Mantled clonal materials relative to phenotypically normal clonal material were identified using a DNA microarray-based technology platform that utilizes the methylation-dependent restriction enzyme McrBC (Ordway et al. 2006 Carcinogenesis 27: 2409-2423; Ordway et al. 2007 PLoS ONE 2: e1314). See, e.g., U.S. Pat. No. 7,186,512. The genomic region in which a given microarray feature can report DNA methylation status is dependent upon the molecular size of the DNA fragments that were labeled for the microarray hybridizations. In the microarray experiments, DNA in the size range of 1 to 4 kb was purified by agarose gel extraction and used as template for cyanogen dye labeling. Therefore, the genomic region interrogated by each microarray feature is 8 kb (i.e., 4 kb upstream and 4 kp downstream of the sequence represented by the microarray feature).
(120) The fruit form phenotypes associated with the mantled abnormality are shown in
(121) Thousands of loci were differentially methylated between genetically identical ortet, parthenocarpic mantled and normal ramet samples, most of which (˜90%) were hypomethylated in mantled, consistent with previously reported reductions in total 5mC levels (Matthes et al. 2001; Jaligot et al. 2002; Jaligot et al. 2004). Interestingly, most of these hypomethylated loci (˜75%) mapped to transposons and repeats, while less frequent hypermethylated loci mapped to both genic and repetitive sequences. These results were consistent with similar maps of cell cultures of Arabidopsis (Vaughn et al. 2007), but differed from epigenomic maps of somaclonal regenerants in rice, in which loss of DNA methylation is largely confined to genes (Stroud et al. 2013), despite the activation of some TEs (Miyao et al. 2012; Cui et al. 2013).). To identify epigenetic differences between mantled and normal clones from multiple clonal lineages, significant differentially methylated regions (DMRs) between normal and fully mantled samples were first identified within each source population independently, based on microarray feature hybridization. Hybridization results were then compared between source populations on a feature by feature basis (
(122) The single feature that distinguishes mantled from normal clones in all 4 populations lies within the ˜35 kb intron 5 of EgDEF1 (
(123) A third, previously unreported, repetitive element lies within intron 5, in the sense orientation, and has homology to rice Karma family LINE elements. Karma elements, along with Tos17 copia-like elements, are activated in rice embryogenic tissue culture, although unlike Tos17, Karma elements only transpose in regenerated plants, in which transgenerational DNA hypomethylation of the element persists (Komatsu et al. 2003). The 3.2 kb oil palm Karma element is flanked by a 13 bp target site duplication (TTCAAAATGATGA) and encodes a reverse transcriptase open reading frame homologous to rice Karma ORF2. As in mammalian LINE elements, ORF2 is preceded by a splice acceptor sequence (GAACAG{circumflex over ( )}ATGC) immediately adjacent to the target site duplication, and is followed by a polyadenylation signal, resembling 5′truncated Karma elements in rice (Komatsu et al. 2003; Cui et al. 2013). The unique 60 nucleotide microarray feature, which consistently detected hypomethylation in mantled clones, not only maps to the Karma element, but serendipitously includes the predicted splice acceptor site. All three additional microarray features mapping within the Karma element also detected significant hypomethylation in mantled clones, albeit in fewer clonal lineages (
(124) The identified differentially methylated region of the genome maps to coordinates 58360 to 61400 of scaffold 13008 of the published E. guineensis genome build (FIG. 1 of Singh et al. 2014, Nature 500, 340-344). The sequences of the four features reporting these differential DNA methylation measurements are provided in SEQ ID NO: 15, 16, 17 and 18. The sequences of 4,061 bp regions spanning the 61mer feature sequence (+/−2 Kb from the 61mer feature sequence) are provided in SEQ ID NO: 43, 44, 45 and 46. A merged sequence from 2 Kb upstream of significant feature 57600 to 2 Kb downstream of significant feature 62840 is provided in SEQ ID NO: 66.
(125) To further analyze DNA methylation across an approximately 95 Kb region spanning the EgDEF1 gene, data generated by microarray features representing from coordinate 33080 to 127680 of scaffold 13008 were analyzed to compare mantled vs. normal clonal material from each clonal propagation event independently (
Example 2: Verification and Validation of Differential DNA Methylation in Normal and Abnormal Cloned Trees
(126) To verify Karma hypomethylation in mantled clones, sample trios comprising genetically identical ortet, parthenocarpic mantled and normal ramets, from 5 independent clonal lineages (15 samples) were subjected to whole genome bisulfite sequencing. The density of CG methylation was strikingly similar in ortet, normal and mantled samples across the entire EgDEF1 locus, including the Karma element (
(127) To further validate the differential CHG methylation in Element 2, four independent MethylScreen assays (See, e.g., U.S. Pat. Nos. 7,910,296; 8,361,719; 7,901,880; and 8,163,485) were designed to monitor CHG sites within methylation sensitive restriction enzyme target sequences that are blocked by CHG methylation but are not sensitive to either CHH or CG methylation. A first amplicon was designed to amplify a 576 bp region within Karma that contains a site for the methylation sensitive enzyme, AlwNI. Forward and reverse primer sequences are provided in SEQ ID NO: 82 and 83, respectively. The sequence of the amplicon is provided in SEQ ID NO: 84. The restriction site includes two CHG sites, and methylation of these cytosines blocks digestion by the enzyme. A second amplicon was designed to amplify a 633 bp region within Karma that contains sites for the methylation sensitive enzymes, BbvI and ScrFI. Forward and reverse primer sequences are provided in SEQ ID NO: 85 and 86, respectively. The sequence of the amplicon is provided in SEQ ID NO: 87. Each of these enzyme sites includes a CHG site, and methylation the site blocks digestion by the enzyme. The same amplicon (SEQ ID NO: 87) was used for each of the two enzyme assays separately. Finally, a third amplicon was designed to amplify a 632 bp region within Karma that contains a site for the methylation sensitive restriction enzyme, RsaI. Forward and reverse primer sequences are provided in SEQ ID NO: 88 and 89, respectively. The sequence of the amplicon is provided in SEQ ID NO: 90. The site includes a CHG site, and methylation of the site blocks digestion by the enzyme. Each of the four MethylScreen assays was performed on genomic DNA from four independent sets of ortet, normal and mantled samples that had been whole genome bisulfite sequenced, as described above. Genomic DNA was split into two equal portions. The first portion was mock treated (excluding the restriction enzyme). The second portion was digested with each of the four methylation sensitive restriction enzymes in separate reactions. Quantitative PCR amplification was performed on each portion in duplicate (alternatively, results can be analyzed by gel electrophoresis, without the use of real-time quantitative PCR). The delta Ct of the enzyme digested portion Ct minus the mock treated protion Ct was calculated for each of the two replicated assays. The % densely methylated was calculated as 2{circumflex over ( )}−dCt. The average % densely methylated, and the standard deviation between the duplicated assays, are provided in
(128) To validate differential CHG methylation in unrelated clonal palms, the Bbv I and the Rsa I qPCR assays were performed on mature leaf samples from a panel of 49 palms. These samples represented 21 clonal lineages from 4 independent industry sources and included 8 ortets and 13 normal clones, 19 parthenocarpic mantled clones, 2 fertile mantled clones and 7 partially revertant clones yielding bunches with both mantled and normal fruits. Although the restriction site assays monitored only 2 of ˜170 CHG sites in the DMR, a threshold value determined by linear discriminant analysis provided 93% sensitivity and 100% specificity for detection of mantling, reflecting the strong association of Karma hypomethylation with the mantled phenotype (
(129) Although CHG methylation density at the two restriction sites was highly predictive, it did not correlate perfectly with the mantled phenotype. The two false negative mantled palms (FN1 an FN2 in
Example 3: Phenotype Reversion in Epigenetic Mosaics
(130) Mantled palms sometimes revert, giving rise to bunches including both normal and mantled fruit (Rao & Donough, 1990). We hypothesized that DNA methylation might sometimes be restored in revertant and mosaic palms, resembling epialleles in maize that are also regulated by transposons (McClintock, 1965; Martienssen et al., 1990; Martienssen & Baron, 1994). Although rare, we identified two clonal lineages giving rise to palms with bunches of both normal and (fertile) mantled fruits. Clone lineage 1 included two revertant clones with 99% and 95% normal fruit per bunch, respectively, in which abnormal fruits had only one or two small pseudocarpels (
(131) As with similar epialleles in maize, Linnaria, Arabidopsis and tomato (Martienssen et al., 1990; Cubas et al., 1999; Manning et al., 2006; Kinoshita et al., 2007), reversion of the abnormal phenotype during development accompanied by restoration of DNA methylation suggests that methylation of the Karma element is the cause of the mantled phenotype. Differential methylation between individual mantled and normal fruits was not observed, however, likely reflecting non-cell autonomy of the weak mantled phenotype (
Example 4: The Mantled Phenotype is Correlated with Changes in Non-Coding Regulatory RNA Expression
(132) In plants, small noncoding regulatory RNAs can impact DNA methylation and gene expression. To determine the correlation between the Mantled phenotype and expression of small noncoding regulatory RNAs, whole transcriptome small RNA sequencing was performed on shoot apex tissues derived from 3 Normal clonal trees and 3 Mantled clonal trees, <2 cm stage inflorescence tissues derived from 3 Normal clonal trees and 3 Mantled clonal trees, and later stage inflorescence tissues derived from 3 Normal clonal trees and 3 Mantled clonal trees. Small RNA sequencing libraries were generated by standard Illumina technology and each library sample was uniquely barcoded so that the transcriptome of each sample could be analyzed individually. Libraries were sequenced in pools of four libraries per HiSeq 2500 lane. 24 nucleotide sequencing reads (representing the 24mer class of small RNA) were mapped back to the reference oil palm genome (Singh et al. 2013). Reads that had an exact match to the sequence within the EgDEF1 gene interval were identified and mapped to their corresponding sequences of the EgDEF1 reference sequence. The number of mapped reads for each distinct 24mer sequence was calculated for each sample, and the read counts were FPKM normalized within each sample by the calculation: (# exact mapped 24mer reads of a distinct 24 mapped to the EgDEF1 locus)/(# of total 24mer reads mapped to the reference oil palm genome)*1,000,000.
(133) To further address differential 24mer siRNA expression, 24mer siRNAs that displayed at least a 2-fold difference in expression in one phenotype relative to the other were identified for each tissue type: shoot apex, <2 cm stage inflorescences and later stage inflorescences. As predicted by the analysis shown in
(134) TABLE-US-00001 TABLE 1 24mer siRNAs Differentially Expressed in Shoot Apex SEQ Genomic Fold Change ID Coord- (Normal/ NO. inate Sequence Abnonnal) 91 922424 CTCTAGCAAGGCGATCAGAAGATT 11.0 92 954273 TCAGGTGTTATGTCAGTTTGGACT 5.9 93 935533 AAGTCTCCACTCTATCTATCCCGA 5.0 94 948570 GGGTCAACAAGGTCTGAGAACACT 4.1 95 933745 CGCAATCAGAATCAACTGGCCAAT 3.8 96 926352 ATGATACACGGTTGCATGCCCTGC 3.4 97 924957 GATCTATGGTGCAAGGAGTTAATT 3.2 98 927895 AGAGAGAGGGTTAAAGGACAATGC 2.9 99 933648 ATAGGGAGAATAGCTTGGCTTCGA 2.9 100 939466 TCGGGTTCTTTTATTCGTGGATTT 2.9 101 932689 AGGGGAGATTGTTGGCTTAGCTTG 2.8 102 928308 AGTAGACTCGATGATGATAAGACT 2.7 103 928688 ACCAGCACGGTCAAGGATAGGCAT 2.7 104 928306 ATAGTAGACTCGATGATGATAAGA 2.7 105 937978 CCTCCAACATCGGCCAAGTTAGTT 2.7 106 927714 AAATCCTACTTGTTTCTCTGACCT 2.5 107 926387 CATGAGGCATGCAAGGTATTGAAT 2.4 108 937739 AAGGCTGGCTAACTCAAAGAAGAG 2.4 109 932932 AATGATCGAGAAGGGCTGGAGACA 2.3 110 933604 TGACCCACCATCGAGAAGGACCGA 2.3 111 936422 ATAACTGACAAGTGGCATTGATCT 2.3 112 945502 AGAAGGATGAGAAGAGAGATTGTC 2.3 113 924825 AAAGATGTTAGCTCCTGTTCGAGA 2.0 114 937738 AAAGGCTGGCTAACTCAAAGAAGA 2.0 115 935465 AGAGATTGTGAACAAATGGAGAGA 0.4
(135) The 24mer siRNA (SEQ ID NO: 91) that maps 152 bp downstream of the splice site of EgDEF1 exon 5 into the Karma element is the most differentially expressed and is expressed at 11-fold higher levels in Normal shoot apex tissue relative to Mantled shoot apex tissue. An additional 23 siRNAs (SEQ ID NO: 92-115) also have higher expression in Normal relative to Mantled shoot apex, with fold differences ranging from 2 to 5.9-fold. A single 24mer siRNA was detected as expressed 2.5-fold higher in Mantled relative to Normal shoot apex tissue (SEQ ID NO: 115). Of the 25 siRNAs differentially expressed in Normal relative to Mantled shoot apex tissue, two (SEQ ID NO: 91 and SEQ ID NO: 97) map within the differentially methylated region. These siRNAs may affect DNA methylation and/or differential splicing of the EgDEF1 gene. Furthermore, the other 23 siRNAs may play roles in aspects of EgDEF1 gene expression.
(136) Consistent with the analyses shown in
(137) TABLE-US-00002 TABLE 2 24mer siRNAs Differentially Expressed in <2 cm Inflorescens SEQ Genomic Fold Change ID Coord- (Normal/ NO. inate Sequence Abnormal) 116 932666 ATATTGTCTGCTCTTCACCAAAGA 4.2 117 951091 CTCGTAAGGCCCAAGGGTAGTCAT 3.1 104 928306 ATAGTAGACTCGATGATGATAAGA 2.8 97 924957 GATCTATGGTGCAAGGAGTTAATT 0.5 118 933595 AAAATAGCTTGACCCACCATCGAG 0.5 119 933643 ATAGAATAGGGAGAATAGCTTGGC 0.4 115 935465 AGAGATTGTGAACAAATGGAGAGA 0.4 120 927834 TCCTGTCCAGATATTTGCGCCTCT 0.4 121 932922 ACAACTAGCCAATGATCGAGAAGG 0.4 122 933686 AACACACTGCTGAAAAGGACTAGG 0.2
(138) These include siRNAs represented by SEQ ID NO: 97, 104 and 115 that were also differentially expressed in shoot apex. The siRNA represented by SEQ ID NO: 104 is overexpressed in Normal relative to Mantled shoot apex (2.7-fold) and <2 cm stage inflorescence (2.8-fold). The siRNA represented by SEQ ID NO: 115 is overexpressed in Mantled relative to Normal shoot apex (2.5-fold) and <2 cm stage inflorescence (2.5-fold). The siRNA represented by SEQ ID NO: 97 is overexpressed in Normal relative to Mantled shoot apex (3.2-fold), but is overexpressed in Mantled relative to Normal <2 cm stage inflorescence (2-fold). An additional 7 siRNAs were detected as differentially expressed in <2 cm stage inflorescence (SEQ ID NO: 116-122), as indicated in Table 2. Finally, two siRNAs were detected as overexpressed in Normal relative to Mantled later stage inflorescence (Table 3, SEQ ID NO: 123 and SEQ ID NO: 124).
(139) TABLE-US-00003 TABLE 3 24mer siRNAs Differentially Expressed in later stage Inflorescens SEQ Genomic Fold Change ID Coord- (Normal/ NO. inate Sequence Abnormal) 123 951590 AAACTCATGGTGTCAAGGGACGTG 3.5 124 951656 GCTACACAGGCACAATCTCGATTT 2.3
(140) Normalized siRNA expression levels (FPKM method) of these siRNAs in Normal and Mantled tissues, along with standard deviations across the three replicates per tissue state per phenotype, are shown graphically in
(141) TABLE-US-00004 TABLE 4 24 mer siRNAs expresses only in tissues of one phenotype and not the other phenotype Phenotype expressing Genomic 24 mer SEQ ID NO. Coordinate Sequence Tissue type siRNA 130 667783 AAATTCTTACTTCTGAGCATAC Shoot apex Normal TT 131 923085 CGAGGTGGTGTCAATGGATAG Shoot apex Normal AAT 132 346343 CTCTTTGTTATACAATCACGGT Shoot apex Normal GT 133 922431 CAAGGCGATCAGAAGATTATC Shoot apex Normal GAA 134 314456 GTGCCATATGTCATAGTCAACT Shoot apex Normal GT 135 923490 AATCTGATATTGGCATCCACAT <2 cm Inflorescence Mantled GA 136 1065423 CCTGACTTTCGGTTGGETGTCT <2 cm Inflorescence Normal CT 137 1065863 AATCCTACTTGTTTCTCTGACC <2 cm Inflorescence Normal TT 138 1066135 CTCTAGCAAGGCGATCAGAAG <2 cm Inflorescence Normal ATT 139 1066138 AAATGGCATACTCTGGCAATT <2 cm Inflorescence Normal CGA 140 314911 TCTATCTCATCCTCTCAACCA later stage Inflorescence Mantled AT 141 314191 GTAGCCCATGTCTTTGTTTTCC later stage Inflorescence Mantled CT 142 334759 TGTGGATGGCTAACGATATGG later stage Inflorescence Normal ACT 143 314753 ACTAGCACCATGTGTCGTTATG later stage lnflorescence Normal GG
(142) Five distinct siRNAs (SEQ ID NO: 130-134) were detected in Normal shoot apex, but not in Mantled shoot apex. One siRNA (SEQ ID NO: 135) was detected in Mantled <2 cm stage inflorescence, but not in Normal <2 cm stage inflorescence. Four siRNAs (SEQ ID NO:136-139) were detected in Normal <2 cm stage inflorescence, but not in Mantled <2 cm stage inflorescence. Two siRNAs (SEQ ID NO: 140 and 141) were detected in Mantled later stage inflorescence, but not in Normal later stage inflorescence. Finally, 2 siRNAs (SEQ ID NO: 142 and 143) were detected in Normal later stage inflorescence, but not in Mantled later stage inflorescence. Therefore, quantitative detection of expression of one or more of these siRNAs (SEQ ID NO: 82-124) may be useful for the prediction of the Mantled phenotype in somaclonal materials, long before field planting and the development of the Mantled abnormal fruit phenotype. Furthermore, ectopic expression of one or more siRNAs (e.g. SEQ ID NO: 91 and SEQ ID NO: 97) during cell culture stages of somaclonal propagation may be useful to maintain or reset the DNA methylation state of the differentially methylated region within the Karma element and/or the appropriate splicing of mRNAs derived from the EgDEF1 locus, thus inhibiting development of the abnormal Mantled fruit phenotype in clonal derived palms.
(143) Because in Arabidopsis and maize, 24nt small interfering (si)RNAs guide CHH and CHG methylation, and DNA methylation in turn is often required for the biosynthesis of 24nt siRNA by RNA polymerase IV (Regulski et al., 2013; Zhong et al., 2012; Hollick 2012), we further analyzed siRNA expression in a time course of inflorescence development in both normal and mantled female flowers. Small RNA sequencing was performed on female inflorescence tissues at stages 0, 2, 3, 4 and 5 (7 mantled and 5 normal biological replicates at stage 0, 6 mantled and 8 normal biological replicates each at stages 2 and 3, 7 mantled and 5 normal biological replicates at stage 4, and 5 mantled and 4 normal biological replicates at stage 5). Stages were histologically classified as stage 0 (terminal meristem); stage 2 (initiation of perianth organs); stage 3 (development of perianth organs and initiation of reproductive organs); stage 4 (development of reproductive organs); stage 5 (fully formed reproductive organs), as previously defined (Adam et al., 2007). siRNA reads mapping to the genomic scaffold including EgDEF1 were identified and normalized as fragments per 1,000 mapped reads (FPKM) to the entire oil palm reference genome (Singh et al. 2013). FPKM values for each 24mer were compared between biological replicates of normal and mantled samples by Student's t-test, two-tailed assuming equal variance. The analysis identified a cluster of 24nt Karma siRNAs in normal inflorescence at stage 0, which were reduced or absent in mantled inflorescence, while other siRNAs matching the EgDEF1 intron, but outside of Karma, were not significantly differentially expressed (
(144) TABLE-US-00005 TABLE 5 24 mer siRNAs downregulated in mantled female inflorescence development Genomic Mantled Normal SEQ ID NO: Coordinate.sup.a Orientation.sup.b Sequence Avg..sup.c Avg..sup.d t-test.sup.e Stage.sup.f 144 922791 ANTISENSE TTCAGTCAGAGACTTCAGGC 27.16 367.54 0.0269 0 CAAT 145 922864 ANTISENSE AGGCTCTCACAGAAAATGA 159.12 565.42 0.0362 0 ATTTG 145 922864 ANTISENSE AGGCTCTCACAGAAAATGA 23.29 233.70 0.0457 2 ATTTG 146 923116 ANTISENSE TTATACAGCTAAATTCTCAG 23.96 282.73 0.0012 0 TCCT 147 923117 ANTISENSE TATACAGCTAAATTCTCAGT 13.97 442.34 0.0000 0 CCTT 148 923120 ANTISENSE ACAGCTAAATTCTCAGTCCT 23.29 290.03 0.0066 2 TATT 149 923123 ANTISENSE GCTAAATTCTCAGTCCTTAT 0.00 332.96 0.0067 2 TAAT 149 923123 ANTISENSE GCTAAATTCTCAGTCCTTAT 67.53 257.59 0.0295 3 TAAT 150 923545 ANTISENSE CATTCTAAACTGAGGAAAA 23.96 236.90 0.0013 0 CTTAT 151 923588 ANTISENSE AGGTTCAGAAGAAATTGAT 397.31 1588.90 0.0128 0 CGGGT 151 923588 ANTISENSE AGGTTCAGAAGAAATTGAT 41.13 278.10 0.0138 2 CGGGT 152 923601 SENSE ATTGATCGGGTAGAAAGGT 114.41 300.01 0.0273 0 AAACT 153 923658 ANTISENSE TGCAGTGCTTACAGGGATCC 22.16 719.92 0.0000 0 CACT 154 923765 SENSE ACGAGGAGTATAACTAAGG 499.49 2836.15 0.0009 0 GCACT 154 923765 SENSE ACGAGGAGTATAACTAAGG 130.63 647.59 0.0301 2 GCACT 155 923780 SENSE AAGGGCACTCTAGAATATG 110.50 1008.90 0.0017 0 TTGGT 156 923780 SENSE AAGGGCACTTTAGAATATGT 88.46 517.53 0.0005 0 TGGT 157 924004 ANTISENSE TGGTTTACAGCACACATGAA 81.33 673.52 0.0066 0 ATAT 157 924004 ANTISENSE TGGTTTACAGCACACATGAA 0.00 191.09 0.0115 2 ATAT 158 924322 ANTISENSE GGCATGAAGGATCTACTATT 110.20 419.35 0.0059 0 TTCT 159 924322 ANTISENSE GGCATGAAGGATCTACTATT 0.00 192.51 0.0500 2 TTCT 160 924604 SENSE ACTTTTATGCATGCTTAACA 73.33 257.62 0.0235 0 CCCT 161 924610 SENSE ATGCATGCTTAACACCCTAT 30.35 240.33 0.0018 0 GGGA .sup.aGenomic coordinate indicates the nucleotide position relative to the reference pisifera oil palm genome build (Singh et al. 2013) corresponding to the 5′-most base of the 24 mer siRNA. .sup.bIndicates whether the siRNA is expressed from the sense or antisense strand relative to EgDEF1 expression. .sup.cThe average FPKM normalized expression value for biological replicates of mantled inflorescense tissues at the indicated stage. .sup.dThe average FPKM normalized expression value for biological replicates of normal inflorescense tissues at the indicated stage. .sup.eSignificance of differential expression determined by Student's t-test, 2 sided, assuming equal variance. .sup.fIndicates the inflorescence development stage at which repressed expression in mantled tissues was detected.
Example 5: The Mantled Phenotype is Correlated with Changes in Alternatively Spliced Transcript Expression
(145) Gene expression in normal and mantled tissues throughout stages of inflorescence development was analyzed by whole transcriptome next-generation sequencing of female inflorescences from normal and parthenocarpic mantled palms (3 biological replicates each of shoot apex, <2 cm inflorescence and late stage inflorescence for each phenotype). Four differentially spliced mRNA transcripts derived from the EgDEF1 locus were detected (
(146) To quantitatively measure expression of cDEF1, tDEF1 and kDEF1, qRT-PCR assays specific to each transcript were designed and optimized (
(147) The qRT-PCR assays were used to quantitatively measure cDEF1, tDEF1 and kDEF expression throughout the female inflorescence time course (
(148) In conclusion, the mantled fruit abnormality phenotype of oil palm, which arises as a consequence of somaclonal propagation, is correlated with multiple molecular abnormalities at the EgDEF1 locus. Tissues from mantled palms have significant CHG hypomethylation of a differentially methylated region that covers a Karma family LINE retrotransposon element embedded within intron 5 of the EgDEF1 gene. Hypomethylation of this region is sensitively and specifically diagnostic of the Mantled phenotype, and assays quantitatively measuring methylation content at any of multiple CHG sites within this region have strong diagnostic power for predicting the abnormality. Four alternatively spliced transcripts derived from the EgDEF1 gene have been detected, one of which (cDEF1) encodes a full-length MIKC family MADS box transcription factor and three of which (kDEF1, tDEF1 and gDEF1) encode truncated proteins that include the MADS box, I and partial K domains, but lack the C-terminal transcription activation domain. In normal tissue, the predominantly expressed transcript encodes the full length cDEF1 protein. However, in Mantled tissue, expression is predominantly derived from the alternatively spliced kDEF1 transcript, and to a lesser extent, the alternatively spliced tDEF1 transcript. These findings support a mechanism by which epigenetic deregulation of the EgDEF1 locus leads to expression of truncated dominant negative proteins that interfere with the normal homeotic floral organ specification pathway, thus leading to the mantled fruit phenotype. Moreover, the expression of small non-coding regulatory RNAs from the EgDEF1 locus are significantly altered in tissues from mantled relative to normal palms, especially at early developmental stages.
Example 6: Detection of Differential DNA Methylation by Methylation Specific PCR
(149) DNA methylation can be quantified by methylation specific PCR (MSP) methods. Using this method, DNA samples are treated with bisulfite to convert unmethylated cytosines (but not methylated cytosines) to uracil. Primers are designed to cover potential methylated cytosine sites, and different primers are designed for methylated vs. unmethylated configurations. An example of analyzing a DMR identified herein in mantled and normal samples using MSP is shown in
(150) A modified approach can be applied in which one of the two PCR primers includes only one, two or three potential methylation sites. Following bisulfite conversion, a site behaves similar to a single nucleotide polymorphism in unconverted DNA. For example, following bisulfite conversion, a methylated cytosine remains cytosine and will base pair with guanine. However, an unmethylated cytosine is converted to uracil and will base pair with adenine. Therefore, a method suitable for detection of a single nucleotide polymorphism is also suitable for monitoring the methylation status of a cytosine within the mantled DMR. These methods may provide quantitative or qualitative measurements.
Example 7: Detection of Differential DNA Methylation by Methylation Dependent Immunoprecipitation
(151) DNA methylation can be quantified by methylation dependent immunoprecipitation (MeDIP) methods. In this method, an antibody specific to methylcytosine is used to immunoprecipitate cytosine methylated DNA molecules, followed by amplification of specific DNA sequences. An example of analyzing a DMR identified herein in Mantled and normal samples using MeDIP is shown in
(152) Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, one of skill in the art will appreciate that certain changes and modifications may be practiced within the scope of the appended claims. In addition, each reference provided herein is incorporated by reference in its entirety to the same extent as if each reference was individually incorporated by reference. Where a conflict exists between the instant application and a reference provided herein, the instant application shall dominate.