On-slide staining by primer extension
11634753 · 2023-04-25
Assignee
Inventors
- Nikolay Samusik (Mountain View, CA, US)
- Garry P. Nolan (Redwood City, CA, US)
- Yury Goltsev (Stanford, CA, US)
- David Robert McIlwain (Palo Alto, CA, US)
Cpc classification
C12Q2565/1015
CHEMISTRY; METALLURGY
C12Q1/6818
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
International classification
Abstract
A method for analyzing planar sample is provided. In some cases the method comprises: (a) labelling the planar sample with a capture agent that is linked to a nucleic acid, wherein the capture agent specifically binds to complementary sites in the planar sample; (b) reading a fluorescent signal caused by extension of a primer that is hybridized to the nucleic acid, using fluorescence microscopy. Several implementations of the method, and multiplexed versions of the same, are also provided.
Claims
1. A method of analyzing a planar sample, the method comprising: obtaining a labeled composition comprising: (a) a biological sample; (b) a plurality of capture agents; (c) a labeled oligonucleotide; and (d) a ligase; wherein, (i) the plurality of capture agents are linked to double-stranded oligonucleotides comprising a first strand and a second strand, wherein the ligase is configured to add the labeled oligonucleotide to the first strand or the second strand, and (ii) the plurality of capture agents are chemically cross-linked directly to the biological sample; and reading a signal generated by the labeled composition.
2. The method of claim 1, wherein the plurality of capture agents are cross-linked to the biological sample via a bifunctional cross-linker.
3. The method of claim 1, wherein the plurality of capture agents are cross-linked to the biological sample via an amine-to-amine crosslinker.
4. The method of claim 1, wherein the plurality of capture agents are cross-linked to the biological sample by formaldehyde or a disuccinimidyl crosslinker.
5. The method of claim 1, wherein the biological sample is planar.
6. The method of claim 1, wherein the biological sample is a tissue section.
7. The method of claim 1, wherein the biological sample is a tissue biopsy.
8. The method of claim 1, wherein the biological sample is a formalin-fixed paraffin embedded tissue section.
9. The method of claim 1, wherein the plurality of capture agents comprises a first capture agent linked to a first double-stranded oligonucleotide and a second capture agent linked to a second double-stranded oligonucleotide.
10. The method of claim 1, wherein the plurality of capture agents comprises at least 10 capture agents, each linked to a different double-stranded oligonucleotide.
11. The method of claim 1, wherein the double-stranded oligonucleotides linked to the plurality of capture agents are at least 10 nucleotides in length.
12. The method of claim 1, wherein the plurality of capture agents are antibodies.
13. The method of claim 12, wherein the antibodies are monoclonal antibodies.
14. The method of claim 1, wherein the plurality of capture agents are aptamers or oligonucleotide probes.
15. The method of claim 1, wherein the double-stranded oligonucleotides comprises an overhang.
16. The method of claim 1, wherein the labeled oligonucleotide comprises a fluorescent label.
17. The method of claim 1, wherein at least one of the plurality of capture agents comprises a fluorescent label.
18. The method of claim 1, wherein the signal is a fluorescent signal.
19. The method of claim 1, wherein reading comprises fluorescence microscopy.
20. The method of claim 1, wherein the method further comprises producing an image showing the pattern of binding of the plurality of capture agents chemically cross-linked directly to the biological sample.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DEFINITIONS
(23) Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
(24) All patents and publications, including all sequences disclosed within such patents and publications, referred to herein are expressly incorporated by reference.
(25) Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.
(26) The headings provided herein are not limitations of the various aspects or embodiments of the invention. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.
(27) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein. Still, certain terms are defined below for the sake of clarity and ease of reference.
(28) As used herein, the term “biological feature of interest” refers to any part of a cell that can be indicated by binding to a capture agent. Exemplary biological features of interest include cell walls, nuclei, cytoplasm, membrane, keratin, muscle fibers, collagen, bone, proteins, nucleic acid (e.g., mRNA or genomic DNA, etc). fat, etc. A biological feature of interest can also be indicated by immunohistological methods, e.g., a capture agent that is linked to an oligonucleotide. In these embodiments, the capture agent binds to an site, e.g., a protein epitope, in the sample. Exemplary epitopes include, but are not limited to carcinoembryonic antigen (for identification of adenocarcinomas, cytokeratins (for identification of carcinomas but may also be expressed in some sarcomas) CD15 and CD30 (for Hodgkin's disease), alpha fetoprotein (for yolk sac tumors and hepatocellular carcinoma), CD117 (for gastrointestinal stromal tumors), CD10 (for renal cell carcinoma and acute lymphoblastic leukemia), prostate specific antigen (for prostate cancer), estrogens and progesterone (for tumour identification), CD20 (for identification of B-cell lymphomas), CD3 (for identification of T-cell lymphomas). Complementary nucleic acid molecules (e.g., DNA and/or RNA) in the sample provide binding complementary sites for oligonucleotide probes.
(29) As used herein, the term “multiplexing” refers to using more than one label for the simultaneous or sequential detection and measurement of biologically active material.
(30) As used herein, the terms “antibody” and “immunoglobulin” are used interchangeably herein and are well understood by those in the field. Those terms refer to a protein consisting of one or more polypeptides that specifically binds an antigen. One form of antibody constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of antibody chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to an antigen, and the constant regions are responsible for the antibody effector functions.
(31) The recognized immunoglobulin polypeptides include the kappa and lambda light chains and the alpha, gamma (IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4), delta, epsilon and mu heavy chains or equivalents in other species. Full-length immunoglobulin “light chains” (of about 25 kDa or about 214 amino acids) comprise a variable region of about 110 amino acids at the NH.sub.2-terminus and a kappa or lambda constant region at the COOH-terminus. Full-length immunoglobulin “heavy chains” (of about 50 kDa or about 446 amino acids), similarly comprise a variable region (of about 116 amino acids) and one of the aforementioned heavy chain constant regions, e.g., gamma (of about 330 amino acids).
(32) The terms “antibodies” and “immunoglobulin” include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, minibodies, single-chain antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein. Also encompassed by the term are Fab′, Fv, F(ab′).sub.2, and or other antibody fragments that retain specific binding to antigen, and monoclonal antibodies. Antibodies may exist in a variety of other forms including, for example, Fv, Fab, and (Fab′).sub.2, as well as bi-functional (i.e. bi-specific) hybrid antibodies (e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)) and in single chains (e. g., Huston et al., Proc. Natl. Acad. Sci. U.S.A., 85, 5879-5883 (1988) and Bird et al., Science, 242, 423-426 (1988), which are incorporated herein by reference). (See, generally, Hood et al., “Immunology”, Benjamin, N.Y., 2nd ed. (1984), and Hunkapiller and Hood, Nature, 323, 15-16 (1986)).
(33) The term “specific binding” refers to the ability of a binding reagent to preferentially bind to a particular analyte that is present in a homogeneous mixture of different analytes. In certain embodiments, a specific binding interaction will discriminate between desirable and undesirable analytes in a sample, in some embodiments more than about 10 to 100-fold or more (e.g., more than about 1000- or 10,000-fold).
(34) In certain embodiments, the affinity between a binding reagent and analyte when they are specifically bound in a capture agent/analyte complex is characterized by a K.sub.D (dissociation constant) of less than 10.sup.−6M, less than 10.sup.−7 M, less than 10.sup.−8 M, less than 10.sup.−9 M, less than 10.sup.−9 M, less than 10.sup.−11 M, or less than about 10.sup.−12 M or less.
(35) A “plurality” contains at least 2 members. In certain cases, a plurality may have at least 2, at least 5, at least 10, at least 100, at least 1000, at least 10,000, at least 100,000, at least 10.sup.6, at least 10.sup.7, at least 10.sup.8 or at least 10.sup.9 or more members.
(36) As used herein, the term “labeling” refers to attaching a detectable fluorophore to specific sites in a sample (e.g., sites containing an epitope for the antibody being used, for example) such that the presence and/or abundance of the sites can be determined by evaluating the presence and/or abundance of the label.
(37) The term “labelling” refers to a method for producing a labeled sample in which any necessary steps are performed in any convenient order, as long as the required labeled sample is produced. For example, in some embodiments and as will be exemplified below, the capture agent may be already linked to a double-stranded nucleic acid prior to binding of the antibody to the sample, in which case a sample can be labeled using relatively few steps. In other embodiments, the capture agent may be linked to the first strand of the double stranded nucleic acid at the time at which it is incubated with the sample. In these embodiments, the second strand of the double stranded nucleic acid may be hybridized to the first strand of the double stranded nucleic acid after the antibody has bound to the sample. Along similar lines, the capture agent may be linked to a rolling circle amplification (RCA) primer at the time at which it is incubated with the sample. In these embodiments, the double-stranded nucleic acid may be produced by: a) hybridizing the sample with a padlock probe having ends that are complementary to the RCA primer, ligating the ends of the padlock probes together, and copying the padlock probe by rolling circle amplification and b) hybridizing an oligonucleotide to the RCA product, as illustrated in
(38) As used herein, the term “planar sample” refers to a substantially planar, i.e., two dimensional, material (e.g. glass, metal, ceramics, organic polymer surface or gel) that contains cells or any combinations of biomolecules derived from cells, such as proteins, nucleic acids, lipids, oligo/polysachharides, biomolecule complexes, cellular organels, cellular debris or excretions (exosomes, microvesicles). A planar cellular sample can be made by, e.g., growing cells on a planar surface, depositing cells on a planar surface, e.g., by centrifugation, by cutting a three dimensional object that contains cells into sections and mounting the sections onto a planar surface, i.e., producing a tissue section, absorbing the cellular components onto the surface that is functionalized with affinity agents (e.g. antibodies, haptens, nucleic acid probes), introducing the biomolecules into a polymer gel or transferring them onto a polymer surface electrophoretically or by other means. The cells or biomolecules may be fixed using any number of reagents including formalin, methanol, paraformaldehyde, methanol:acetic acid, glutaraldehyde, bifunctional crosslinkers such as bis(succinimidyl)suberate, bis(succinimidyl)polyethyleneglycole etc. This definition is intended to cover cellular samples (e.g., tissue sections, etc), electrophoresis gels and blots thereof, Western blots, dot-blots, ELISAs, antibody microarrays, nucleic acid microarrays etc.
(39) As used herein, the term “tissue section” refers to a piece of tissue that has been obtained from a subject, fixed, sectioned, and mounted on a planar surface, e.g., a microscope slide.
(40) As used herein, the term “formalin-fixed paraffin embedded (FFPE) tissue section” refers to a piece of tissue, e.g., a biopsy that has been obtained from a subject, fixed in formaldehyde (e.g., 3%-5% formaldehyde in phosphate buffered saline) or Bouin solution, embedded in wax, cut into thin sections, and then mounted on a microscope slide.
(41) As used herein, the term “spatially-addressable measurements” refers to a set of values that are each associated with a specific position on a surface. Spatially-addressable measurements can be mapped to a position in a sample and can be used to reconstruct an image of the sample.
(42) A “diagnostic marker” is a specific biochemical in the body which has a particular molecular feature that makes it useful for detecting a disease, measuring the progress of disease or the effects of treatment, or for measuring a process of interest.
(43) A “pathoindicative” cell is a cell which, when present in a tissue, indicates that the animal in which the tissue is located (or from which the tissue was obtained) is afflicted with a disease or disorder. By way of example, the presence of one or more breast cells in a lung tissue of an animal is an indication that the animal is afflicted with metastatic breast cancer.
(44) The term “complementary site” is used to refer to an epitope for an antibody or aptamer, or a nucleic acid molecule if the capture agent is an oligonucleotide probe. Specifically, if the capture agent is an antibody, then the complementary site for the capture agent is the epitope in the sample to which the antibody binds. If the capture agent is an oligonucleotide probe, then the complementary site for the capture agent is a complementary sequence in a DNA or RNA molecule in the sample.
(45) The term “epitope” as used herein is defined as small chemical groups on the antigen molecule that is bound to by an antibody. An antigen can have one or more epitopes. In many cases, an epitope is roughly five amino acids or sugars in size. One skilled in the art understands that generally the overall three-dimensional structure or the specific linear sequence of the molecule can be the main criterion of antigenic specificity.
(46) A “subject” of diagnosis or treatment is a plant or animal, including a human Non-human animals subject to diagnosis or treatment include, for example, livestock and pets.
(47) As used herein, the term “incubating” refers to maintaining a planar sample and capture agent under conditions (which conditions include a period of time, a temperature, an appropriate binding buffer and a wash) that are suitable for specific binding of the capture agent to molecules (e.g., epitopes or complementary nucleic acid) in the planar sample.
(48) As used herein, the term “capture agent” refers to an agent that can specifically bind to complementary sites in a planar sample. Exemplary capture agents include, e.g., an antibody, an aptamer, and a nucleic acid (e.g., oligonucleotide) probe (which may be DNA or RNA) that hybridizes to a binding site. If antibodies are used, in many cases the antibodies may bind to protein epitopes. If nucleic acid probes are used, the nucleic acid probes may bind to, for example, genomic DNA or RNA (such that the location and abundance of intracellular RNAs can be detected).
(49) As used herein, the term “extendible”, in the context of, for example, a 3′ end that is “extendible using the other strand as a template”, means that a polymerase or ligase can add to the 3′ end of a nucleic acid molecule, where the template sequence that is immediately downstream of the 3′ end (i.e., on the other strand) determines which nucleotides (if a polymerase is used) or oligonucleotide (if a ligase is used) is added. A “5′ end that is extendible using the other strand as a template” means that a ligase can add an oligonucleotide to the 5′ end of a nucleic acid molecule, where the template sequence that is immediately downstream of the 5′ end (i.e., on the other strand) determines which oligonucleotide is added.
(50) As used herein, the term “template sequence that is immediately downstream to the 3′ end” refers to the sequence on the other strand that use used as a template for extending the 3′ end, starting with the first nucleotide. In embodiments in which the first strand is an RCA product, the template sequence that is immediately downstream of the 3′ end may be a sequence in the RCA product. In embodiments in which the first strand is an oligonucleotide, the template sequence that is immediately downstream of the 3′ end may be a 5′ overhang.
(51) As used herein, the term “capture agent that is linked to a double stranded nucleic acid” refers to a capture agent, e.g., an antibody or an oligonucleotide probe, that is non-covalently (e.g., via a streptavidin/biotin interaction) or covalently (e.g., via a click reaction or the like) linked to an double-stranded nucleic acid (which may be composed of two single-stranded oligonucleotide strands that are hybridized together, or an RCA product that is hybridized to a plurality of oligonucleotides) in a way that the capture agent can still bind to its binding site and the 3′ end of one of the nucleic acids is accessible to a polymerase and/or ligase. The nucleic acid and the capture agent may be linked via a number of different methods, including those that use maleimide or halogen-containing group, which are cysteine-reactive. The capture agent and the nucleic acid may be linked at, proximal to or at the 5′ end of one of the strands of the double stranded nucleic acid, proximal to or at the 3′ end of one of the strands of the double stranded nucleic acid, or anywhere in-between.
(52) The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to describe a polymer of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, up to about 10,000 or more bases composed of nucleotides, e.g., deoxyribonucleotides, ribonucleotides or a combination thereof, and may be produced enzymatically or synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) and which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. Naturally-occurring nucleotides include guanine, cytosine, adenine, thymine, uracil (G, C, A, T and U respectively). DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas PNA's backbone is composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In PNA various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds. A locked nucleic acid (LNA), often referred to as an inaccessible RNA, is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2′ oxygen and 4′ carbon. The bridge “locks” the ribose in the 3′-endo (North) conformation, which is often found in the A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired. The term “unstructured nucleic acid”, or “UNA”, is a nucleic acid containing non-natural nucleotides that bind to each other with reduced stability. For example, an unstructured nucleic acid may contain a G′ residue and a C′ residue, where these residues correspond to non-naturally occurring forms, i.e., analogs, of G and C that base pair with each other with reduced stability, but retain an ability to base pair with naturally occurring C and G residues, respectively. Unstructured nucleic acid is described in US20050233340, which is incorporated by reference herein for disclosure of UNA.
(53) As used herein, the term “oligonucleotide” refers to a multimer of at least 10, e.g., at least 15 or at least 30 nucleotides. In some embodiments, an oligonucleotide may be in the range of 15-200 nucleotides in length, or more.
(54) As used herein, the term “reading” in the context of reading a fluorescent signal, refers to obtaining an image by scanning or by microscopy, where the image shows the pattern of fluorescence as well as the intensity of fluorescence in a field of view.
(55) As used herein, the term “primer” is an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3′ end along the template so that an extended duplex is formed. The sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide. Usually primers are extended by a DNA polymerase. A primer may be at least 10, e.g., at least 15 or at least 30 nucleotides in length.
(56) As used herein, the term “single nucleotide 5′ overhang” refers to a 5′ overhang, where the overhang is a single nucleotide in length. Likewise, a “two nucleotide 5′ overhang” is a 5′ overhang, where the overhang is two nucleotides in length. The 3′ end is recessed in a 5′ overhang.
(57) In certain cases, the various nucleotides of an overhang may be referred to by their position, e.g., “first position” and “second position”. In these cases, the “position” is relative to the recessed 3′ end. As such, in a multiple base 5′ overhang, the “first” position of the overhang is immediately adjacent to the recessed 3′ end and the “second” position of the overhang is immediately adjacent to the first position.
(58) In certain cases, the complementary strands of a double stranded oligonucleotide or nucleic acid may be referred to herein as being the “first” and “second” or the “top” and “bottom” strands. The assignment of a strand as being a “top” or “bottom” strand is arbitrary and does not imply any particular orientation, function or structure.
(59) As used herein, the term “signal generated by”, in the context of reading a fluorescent signal generated by addition of the fluorescent nucleotide, refers to a signal that is emitted directly from the fluorescent nucleotide, a signal that is emitted indirectly via energy transfer to another fluorescent nucleotide (i.e., by FRET).
(60) As used herein, the term “fluorescently labeled oligonucleotide comprising a quencher” refers to an oligonucleotide that contains a fluorophore and a quencher, wherein the quencher quenches the fluorophore in the same oligonucleotide.
(61) As used herein, the term “different” in the context of different 5′ overhangs that are different, refers to overhangs that have a different sequence. Overhangs of different lengths (e.g., GATC vs GAT) implicitly have a different sequence, even through one sequence may be encompassed by the other.
(62) As used herein, the term “overhang” refers to a structure in which one strand of a double stranded nucleic acid ends such that nucleic acid synthesis can be initiated from that strand by a polymerase (or an oligonucleotide can be ligated to the end by a ligase) using the other strand as a template.
(63) As used herein, the term “adding to the extendible 3′ end”, in the context of adding one or more nucleotides or an oligonucleotide to an extendible 3′ end, refers to adding nucleotides (or an oligonucleotide) to an extendible 3′ end using the other strand as a template (e.g., adding to the recessed 3′ end of a 5′ overhang using the overhang as a template).
(64) As used herein, the term “template of the formula 3′-N.sub.4nN.sub.1/N.sub.2/N.sub.3-5′ followed by an optional short stretch (e.g., 1-5 residues) of random nucleotides on the 5′ end to increase the overall polymerase residence on the DNA duplex, where N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C and n is 0, 1 or more”, refers to a population of sequences that potentially contains single nucleotide overhangs of nucleotides N.sub.1, N.sub.2 and N.sub.3 or the population of overhangs comprises two nucleotide overhangs of sequence 3′-N.sub.4N.sub.1-5′, 3′-N.sub.4N.sub.2-5′ and 3′-N.sub.4N.sub.3-5′-5′ and, optionally overhangs of sequence, 3′-N.sub.4N.sub.4N.sub.1-5′, 3′-N.sub.4N.sub.4N.sub.2-5′ and 3′-N.sub.4N.sub.4N.sub.3-5′ and so on (e.g., four nucleotide overhangs of sequence 3′-N.sub.4N.sub.4N.sub.4N.sub.1-5′, 3′-N.sub.4N.sub.4N.sub.4N.sub.2-5′ and 3′-N.sub.4N.sub.4N.sub.4N.sub.3-5′).
(65) As used herein, the term “template of the formula 3′-YN.sub.1/N.sub.2-5′, optionally followed by short stretch (e.g., 1-5 residues) of random nucleotides on the 5′ end to increase the overall polymerase residence on the DNA duplex, wherein Y is a nucleotide sequence of length n (n is 0, 1 or more) composed of bases N.sub.3 and N.sub.4, wherein nucleotide N.sub.3 is in odd positions and nucleotide N.sub.4 is in even positions, counting from the start of the overhang and N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C” refers to a population of sequences that potentially contain sequences 3′-N.sub.1-5′ and 3′-N.sub.2-5′ or optionally 3′-N.sub.3N.sub.1-5′ and 3′-N.sub.3N.sub.2-5′ or 3′-N.sub.3N.sub.4N.sub.1-5′ and 3′-N.sub.3N.sub.4N.sub.2-5′ and, optionally, overhangs of sequence 3′-N.sub.3N.sub.4N.sub.3N.sub.1-5′ and 3′-N.sub.3N.sub.4N.sub.3N.sub.2-5′ and so on (e.g., overhangs of sequence 3′-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.1-5′ and 3′-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.2-5′ and then 3′-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.1-5′ and 3′-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.2-5′).
(66) As used herein, the term “alternating stretches” refers to two nucleotides stretches, where one “stretch” is a contiguous sequence of, e.g., up to 10, of the same nucleotide (e.g., a G, A, T or C), and the second stretch is contiguous sequence of, e.g., up to 10, of a different nucleotide, that alternate with one another, i.e., one stretch (e.g., a string of T's) occupies the odd positions and the other stretch (e.g., a string of A's) occupies the even positions.
(67) As used herein, the term “incomplete nucleotide mix” comprises a nucleotide mix that contains one, two or three nucleotides (but not all four nucleotides) selected from G, A, T and C. The nucleotides may be labeled or unlabeled.
(68) As used herein, the term “reversible terminator” refers to a chemically modified nucleotide base that when incorporated into growing DNA strand by DNA polymerase blocks further incorporation of bases. Such “reversible terminator” base and DNA strand can be deprotected by chemical treatment and following such deprotection DNA strand can be further extended by DNA polymerase.
(69) As used herein, the term “fluorescently labeled reversible terminator” refers to a “reversible terminator” base which is labeled by fluorophore through linker cleavable by same treatment which is used to deprotect the DNA strand which ends with this base. Deprotecting the “fluorescently labeled reversible terminator” simultaneously activates the DNA strand for further extension and removes the fluorescent label from it.
(70) For ease of description, many of the sequences described herein are written out in the 3′ to 5′ direction. While DNA sequences are routinely set forth in 5′ to 3′ direction, for the ease description, certain DNA sequences in the text below are described in the 3′ to 5′ direction. In each such case the directionality is specifically annotated.
(71) Other definitions of terms may appear throughout the specification.
DETAILED DESCRIPTION
(72) In some embodiments the method comprises producing a labeled a planar sample (e.g., an FFPE section mounted on a planar surface such as a microscope slide) using a capture agent that specifically binds to complementary sites in the planar sample. Methods for binding antibodies and/or nucleic acids to sites in the planar sample are well known. In these embodiments, the capture agent in the labeled sample is linked to a double-stranded nucleic acid that comprises a first strand and a second strand (e.g., two oligonucleotide that are hybridized together or an RCA product that is hybridized to oligonucleotides) and the capture agent is linked (covalently or non-covalently via a biotin) to the double-stranded nucleic acid by the first strand of the double-stranded nucleic acid (e.g., by the 5′ end, the 3′ end, or anywhere in-between), and the 3′ end or 5′ end of one of the strands (e.g., the 3′ end of the first strand, any 3′ ends in the second strand, the 5′ end of the first strand or any 5′ ends in the second strand) is extendible using the other strand as a template. In some cases, the 3′ end of the first strand may be recessed relative to the 5′ end of the second strand, thereby defining an overhang. In other cases, the 5′ end of the first strand may be recessed relative to the 3′ end of the second strand, thereby defining an overhang. In many embodiments, the capture agent is cross-linked the planar sample, thereby preventing the capture agent from disassociating during subsequent steps. This crosslinking step may be done using any amine-to-amine crosslinker (e.g. formaldehyde, disuccinimiyllutarate or another reagents of similar action) although a variety of other chemistries can be used to cross-link the capture agent to the planar sample if desired. The method comprises reading a fluorescent signal generated by addition of a nucleotide or short oligonucleotide (e.g., of 2-10 bases) to the extendible end (e.g., the 3′ end) of one of the strands. This step may be done by contacting the planar sample with a polymerase and a nucleotide mix, a ligase and a labeled oligonucleotide, or a combination of the two, thereby adding one or more nucleotides and/or a labeled oligonucleotide to the extendible end; and reading a fluorescent signal generated by addition of the one or more nucleotides or oligonucleotide to the extendible end.
(73) As will be described in greater detail below, the fluorescent signal may be generated by a variety of different methods. For example, in some embodiments, the fluorescent signal may be fluorescence from a fluorescent nucleotide added to the end of the primer, or a FRET (fluorescence resonance energy transfer) signal resulting from the same. In other embodiments, the signal may generated by removing a quencher from a fluorescently labeled oligonucleotide that is also hybridized to the oligonucleotide.
(74) In any implementation of the method, the reading step may be followed by inactivating the fluorescence after reading so that other binding events can be detected and read. In these embodiments, the fluorescence may be inactivated by peroxide-based bleaching, cleavage of fluorophore linked to nucleotide through cleavable linker (e.g. using TCEP as a cleaving reagent), base-exchange by exo+ polymerase such as Vent, or subsequent incorporation of quencher, for example.
(75) Also, as will be described in greater detailed below, the method may be multiplexed in a way that a single planar sample can be interrogated by a plurality of different capture agents, where each antibody is linked to a different oligonucleotide (i.e., oligonucleotides of different sequence). In multiplex embodiments, the planar sample may be labeled using at least 5, at least 10, at least 20, at least 30, at least 50, or at least 100, up to 150 or more capture agents that are each linked to a different oligonucleotide, and binding of the capture agents can be separately read using a fluorescence microscope equipped with an appropriate filter for each fluorophore, or by using dual or triple band-pass filter sets to observe multiple fluorophores. See, e.g., U.S. Pat. No. 5,776,688. As noted below, the oligonucleotides linked to the capture agent may act as a splint for a padlock probe, and as a primer for initiating rolling circle amplification.
(76) The capture agent used in some embodiments of the method may be linked to a double-stranded oligonucleotide that contains a 5′ overhang (i.e., a recessed 3′ end that can be extended by a polymerase or ligase) or a 3′ overhang (i.e., a recessed 5′ end that can be extended by a ligase). An example of such a capture agent is shown in
(77) In certain cases, the fluorophore used may be a coumarin, a cyanine, a benzofuran, a quinoline, a quinazolinone, an indole, a benzazole, a borapolyazaindacene and or a xanthene including fluorescein, rhodamine and rhodol. In multiplexing embodiments, fluorophores may be chosen so that they are distinguishable, i.e., independently detectable, from one another, meaning that the labels can be independently detected and measured, even when the labels are mixed. In other words, the amounts of label present (e.g., the amount of fluorescence) for each of the labels are separately determinable, even when the labels are co-located (e.g., in the same tube or in the same area of the section).
(78) Specific fluorescent dyes of interest include: xanthene dyes, e.g., fluorescein and rhodamine dyes, such as fluorescein isothiocyanate (FITC), 6-carboxyfluorescein (commonly known by the abbreviations FAM and F), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 6-carboxy-4′, 5′-dichloro-2′, 7′-dimethoxyfluorescein (JOE or J), N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA or T), 6-carboxy-X-rhodamine (ROX or R), 5-carboxyrhodamine-6G (R6G.sup.5 or G.sup.5), 6-carboxyrhodamine-6G (R6G.sup.6 or G.sup.6), and rhodamine 110; cyanine dyes, e.g., Cy3, Cy5 and Cy7 dyes; coumarins, e.g., umbelliferone; benzimide dyes, e.g. Hoechst 33258; phenanthridine dyes, e.g., Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes, e.g., BODIPY dyes and quinoline dyes. Specific fluorophores of interest that are commonly used in subject applications include: Pyrene, Coumarin, Diethylaminocoumarin, FAM, Fluorescein Chlorotriazinyl, Fluorescein, R110, Eosin, JOE, R6G, Tetramethylrhodamine, TAMRA, Lissamine, Napthofluorescein, Texas Red, Cy3, and Cy5, etc.
(79) Suitable distinguishable fluorescent label pairs useful in the subject methods include Cy-3 and Cy-5 (Amersham Inc., Piscataway, N.J.), Quasar 570 and Quasar 670 (Biosearch Technology, Novato Calif.), Alexafluor555 and Alexafluor647 (Molecular Probes, Eugene, Oreg.), BODIPY V-1002 and BODIPY V1005 (Molecular Probes, Eugene, Oreg.), POPO-3 and TOTO-3 (Molecular Probes, Eugene, Oreg.), and POPRO3 and TOPRO3 (Molecular Probes, Eugene, Oreg.). Further suitable distinguishable detectable labels may be found in Kricka et al. (Ann Clin Biochem. 39:114-29, 2002), Ried et al. (Proc. Natl. Acad. Sci. 1992: 89: 1388-1392) and Tanke et al. (Eur. J. Hum. Genet. 1999 7:2-11) and others.
(80) In addition to the labeling methods described above, the sample may be stained using a cytological stain, either before or after performing the method described above. In these embodiments, the stain may be, for example, phalloidin, gadodiamide, acridine orange, bismarck brown, barmine, Coomassie blue, bresyl violet, brystal violet, DAPI, hematoxylin, eosin, ethidium bromide, acid fuchsine, haematoxylin, hoechst stains, iodine, malachite green, methyl green, methylene blue, neutral red, Nile blue, Nile red, osmium tetroxide (formal name: osmium tetraoxide), rhodamine, safranin, phosphotungstic acid, osmium tetroxide, ruthenium tetroxide, ammonium molybdate, cadmium iodide, carbohydrazide, ferric chloride, hexamine, indium trichloride, lanthanum nitrate, lead acetate, lead citrate, lead(II) nitrate, periodic acid, phosphomolybdic acid, potassium ferricyanide, potassium ferrocyanide, ruthenium red, silver nitrate, silver proteinate, sodium chloroaurate, thallium nitrate, thiosemicarbazide, uranyl acetate, uranyl nitrate, vanadyl sulfate, or any derivative thereof. The stain may be specific for any feature of interest, such as a protein or class of proteins, phospholipids, DNA (e.g., dsDNA, ssDNA), RNA, an organelle (e.g., cell membrane, mitochondria, endoplasmic recticulum, golgi body, nulear envelope, and so forth), a compartment of the cell (e.g., cytosol, nuclear fraction, and so forth). The stain may enhance contrast or imaging of intracellular or extracellular structures. In some embodiments, the sample may be stained with haematoxylin and eosin (H&E).
(81) The structures of exemplary sulfhydryl-cleavable deoxynucleotide analogues that can be used in the present method are shown below. As would be recognized, these nucleotides are only exemplary and other nucleotides, including nucleotides that are cleavable by other stimuli (e.g., photocleavable nucleotides) can be used in the present method.
(82) ##STR00001##
(83) In order to further illustrate the present invention, the following specific examples are given with the understanding that they are being offered to illustrate the present invention and should not be construed in any way as limiting its scope.
Implementation I
(84) In this example, the fluorescent signal may be produced by a fluorescent nucleotide that is added to (i.e., added by a polymerase or, if the fluorescent nucleotide is in an oligonucleotide, ligated onto) the 3′ end of the primer. This method may comprise reading a signal from the added fluorescent nucleotide, or reading a FRET signal generated by energy transfer between two fluorescent nucleotides that are added to the primer.
(85) The example shown in
(86) After binding the capture agent to the tissue sample, the pattern of binding of the capture agent may be determined using an on-slide end fill-in reaction by using a suitable polymerase (e.g., by exo.sup.− Klenow, Bst, Taq, Klentaq, or an exo.sup.− Klenow-Vent mixture) and fluorescently labeled nucleotide (
(87) If necessary, the signal-to-noise ratio can be increased by: a) multimerization of position complementary to labeling nucleotide (
(88) Fluorescence may be inactivated before addition of subsequent staining reagents by any convenient method including, but not limited to photobleaching, peroxide-based bleaching, inactivation by ozone, cleavage of fluorophore linked to nucleotide through cleavable linker (e.g. using TCEP as a cleaving reagent), base-exchange by exo+ polymerase such as Vent, subsequent incorporation of quencher.
(89) In these embodiments, after fluorescence has been inactivated, the method can be repeated, i.e., the planar sample may be re-stained using a different antibody and fluorescence can be read.
(90) Multiplexing
(91) Multiplexing can be implemented using specially designed oligonucleotides using two different approaches, referred to as the “reversible terminator” and “missing base” approaches, which are described in greater detail below. Both of these methods rely on a composition comprising a plurality of (e.g., at least 5, at least 10, at least 20, at least 30, at least 50, or at least 100, up to 150 or more) capture agents that recognize different complementary sites, wherein: each of the capture agents is linked to a double-stranded nucleic acid (e.g., oligonucleotide) that comprises a first strand and a second strand; the capture agents are linked to a double-stranded nucleic acid by the (e.g., the 5′ end of) the first strand; the 3′ end of one of the strands in each of the double-stranded nucleic acids extendible using the other strand as a template, where the template is different for each of the capture agents. Examples of such compositions are illustrated in
(92) In some embodiments, the multiplex methods may generally comprise: (a) incubating a planar sample with an above-described antibody composition under conditions by which the capture agents bind to complementary sites in the planar sample; (b) cross-linking the capture agents to the planar sample; (c) contacting the planar sample with a polymerase and either an incomplete nucleotide mix of labeled and unlabeled nucleotides or a nucleotide mix where some or all nucleotides are fluorescent and some or all nucleotides are reversible terminator nucleotides or fluorescent reversible terminator nucleotides and optionally, contacting the planar sample with a mixture of labelled and unlabeled oligonucleotides and a DNA ligase enzyme that covalently attaches the short labelled oligonucleotides to the 3′ end of the oligonucleotide duplexes that are attached to the specific capture agents. In these embodiments, oligonucleotides are only added to duplexes that an overhang that is complementary to the oligonucleotide. This method further comprises (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition a nucleotide to some but not all of the capture agents. Following signal registration, this method may comprise (e) removing the fluorescent signals by chemical or photocleavage of a labeled nucleotide if the reversible terminator approach is used, followed by deprotecting the 3′ ends of the oligonucleotides, enabling the addition of further nucleotides and/or oligonucleotides. Step (c) of this method may comprise (c) contacting the planar sample with a polymerase and: (i) a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide that is complementary to N.sub.4 or (ii) a nucleotide mix that comprises fluorescent reversible terminator nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide that is complementary to N.sub.4 or (iii) a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, and N.sub.2, an unlabeled nucleotide that is complementary to N.sub.3, and no nucleotide that is complementary to N.sub.4, thereby adding fluorescent nucleotides onto the double-stranded oligonucleotides of some but not all of the capture agents thereby adding fluorescent nucleotides onto the double-stranded oligonucleotides of some but not all of the capture agents; and (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition of a fluorescent nucleotide to some but not all of the capture agents. Step (c) can also be implemented by adding a labeled oligonucleotide to the duplex using a ligase. Examples of such methods are described in greater detail below.
(93) With reference to
(94) Reversible Terminator Method
(95) This implementation of the method relies on reversible terminators, i.e., chain terminator nucleotides that can be de-protected after incorporation, thereby allowing further nucleotides to be added to that nucleotide.
(96) This method can be implemented using a composition comprising a plurality of capture agents that are linked to a double stranded nucleic acid (e.g., oligonucleotides), as illustrated in
(97) In certain embodiments, this method may comprise: (a) incubating a planar sample with a multiplex antibody composition in which the overhangs are of the formula 5′-N.sub.1/N.sub.2/N.sub.3N.sub.4n, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C and n is 1 or more; under conditions by which the capture agents specifically bind to complementary sites in the planar sample; (b) cross-linking the capture agent to the planar sample; (c) contacting the planar sample with a polymerase and a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide that is complementary to N.sub.4 and/or ligating a oligonucleotide that comprises a labeled nucleotide; and (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition of a nucleotide to some but not all of the capture agents. This cycle may be repeated by (e) inactivating the fluorescent signal, deprotecting the reversible terminator nucleotide and (f) blocking the planar sample; and repeating steps (c) and (d). In certain embodiments, the method may comprise repeating steps (c), (d) (e) and (f) multiple times. The reagent used for blocking may vary depending on the chemistry used. In certain embodiments, the sample may be blocked with a thiol-reactive compounds such as cysteine, glutathione or iodoacetamide.
(98) For example, this method can be implemented using a composition comprising: a first antibody linked to a first double stranded oligonucleotide, wherein the first double stranded oligonucleotide comprises a single nucleotide 5′ overhang comprising base N.sub.1; a second antibody linked to a second double stranded oligonucleotide, wherein the second double stranded oligonucleotide comprises a single nucleotide 5′ overhang comprising base N.sub.2; a third antibody linked to a third double stranded oligonucleotide, wherein the third double stranded oligonucleotide comprises a single nucleotide 5′ overhang comprising base N.sub.3; a fourth antibody linked to a fourth double stranded oligonucleotide comprises a two nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4 and the second position of the overhang is base N.sub.1; a fifth antibody linked to a fifth double stranded oligonucleotide, wherein the fifth double stranded oligonucleotide comprises a two nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4 and the second position of the overhang is base N.sub.2; and a sixth antibody linked to a sixth double stranded oligonucleotide, wherein the sixth double stranded oligonucleotide comprises a two nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4 and the second position of the overhang is base N.sub.3, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C. An example of such a population of capture agents is shown in
(99) In RCA embodiments, the strand linked to the antibodies may be different for each of the antibodies, where the RCA product contains a sequence conforming to the formula described above in each repeat of the RCA product.
(100) In certain implementations, the composition may also contain a seventh antibody linked to a seventh double stranded oligonucleotide, wherein the seventh double stranded oligonucleotide comprises a multiple nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4, the second position of the overhang is base N.sub.4 and third is selected from N.sub.1, N.sub.2, and N.sub.3. The same principle may be applied to overhangs that have more than 7 positions (e.g., 9, 10, 11 up to 20, 30, or 40 ore more) positions.
(101) In this implementation of the method, the planar sample can be co-stained simultaneously using a panel of capture agents, each labeled with one oligonucleotide duplex designed according to the strategy outlined on
(102) Missing Base Method
(103) This implementation of the method relies on a “missing” base design in which, in each cycle, two labeled and one unlabeled nucleotides are added to the reaction, and the “missing base” prevents the primers from being extended by more than a single nucleotide.
(104) This method can be implemented using a composition comprising a plurality of capture agents that are linked to double stranded nucleic acids, as illustrated in
(105) Also a more general formula 3′-YN.sub.1/N.sub.2-5′, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C and Y is a nucleotide sequence of length n (n is 0, 1 or more) composed of alternating random length stretches of bases N.sub.3 and N.sub.4 such that the order number of N.sub.3—stretches is odd and of N.sub.4 stretches is even, may be applicable in this method
(106) In certain embodiments, this method may comprise: (a) incubating a planar sample with a multiplex antibody composition in which the overhangs are of the formula (3′-YN.sub.1/N.sub.2-5′) described in the prior paragraph; under conditions by which the capture agents specifically bind complementary sites in the planar sample; (b) cross-linking the capture agent to the planar sample; (c) contacting the planar sample with a polymerase and a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, and N.sub.2, an unlabeled nucleotide that is complementary to N.sub.3 and no nucleotide that is complementary to N.sub.4 and/or ligating an oligonucleotide that has a labeled nucleotide; and (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition of a nucleotide to some but not all of the capture agents. This cycle may be repeated by (e) inactivating the fluorescent signal, (f) blocking the sample and contacting the planar sample with a polymerase and an unlabeled nucleotide that is complementary to N.sub.4 and/or contacting the sample with a labeled oligonucleotide and a ligase; and repeating steps (c) (d). In certain embodiments, the method may comprise repeating steps (c), (d), (e) and (f) multiple times.
(107) This method can be implemented using a capture agent composition that comprises: a first antibody linked to a first double stranded oligonucleotide, wherein the first double stranded oligonucleotide comprises a single nucleotide 5′ overhang comprising base N.sub.1; a second antibody linked to a second double stranded oligonucleotide, wherein the second double stranded oligonucleotide comprises a single nucleotide 5′ overhang comprising base N.sub.2; a third antibody linked to a fourth double stranded oligonucleotide, wherein the third double stranded oligonucleotide comprises a two nucleotide 5′ overhang, wherein the first from the 3′ position of the overhang comprises base N.sub.4 and the second position comprises N.sub.1; and a fourth antibody linked to a fourth double stranded oligonucleotide, wherein the fourth double stranded oligonucleotide comprises a two nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4 and the second position comprises base N.sub.2, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C. An example of such a population of capture agents is shown in
(108) In certain implementations, the composition may also contain a fifth antibody linked to a fifth double stranded oligonucleotide, wherein the fifth double stranded oligonucleotide comprises a multiple nucleotide 5′ overhang, wherein the first position of the overhang comprises base N.sub.4, the second position comprises base N.sub.3, and the third position comprises N.sub.1 or N.sub.2.
(109) Overall there is no theoretical limits to the number of co-detected complementary sites, e.g., antigens, both in the case of “reversible terminator” and of “missing base” approach
(110) The missing base approach does not use reversible terminators. Instead, extension of a single nucleotide is ensured by using two interchanging bases (e.g., T and C as shown in
(111) In this embodiment, the duplexes can be designed using the strategy shown in
(112) In RCA embodiments, the strand linked to the antibodies may be different for each of the antibodies, where the RCA product contains a sequence conforming to the formula described above in each repeat of the RCA product.
(113) During cycle-to-cycle transition the labeled capture agents from the prior cycle can be bleached/destained in the same way as described above. Optionally, instead of bleaching, a quencher labeled nucleotide can be incorporated after the labeled base. Because, in this embodiment, the position that is labeled is the last position in the overhang, the labeled capture agents from prior cycle cannot be re-labeled in later cycles because all nucleotide positions in the overhang have been filled in. The performance of “reversible terminator method” as exemplified in sequential detection of CD4 and CD8 positive T-cells in smears of mouse splenocytes is illustrated in
Implementation II
(114) In this method, extension of a primer by nick translation removes a quencher from a fluorescently labeled “detector” oligonucleotide that is hybridized to the lower strand oligonucleotide in such a way that is positioned downstream from the upper strand primer. The principles of this method are illustrated in
(115) In certain embodiments, the multiplexed implementations may comprise: (a) incubating the planar sample with a plurality of capture agents that are linked to a double-stranded oligonucleotide; (b) crosslinking the capture agents to the planar sample; (c) extending a primer that is hybridized to the oligonucleotide of a first set of capture agents of the plurality, thereby generating a first set of fluorescent signals (e.g., by removing the quencher from a labeled oligonucleotide that is hybridized to the oligonucleotide downstream from the primer), e.g., by adding a nucleotide using a polymerase or by adding an oligonucleotide using a ligase; (d) reading the first set of fluorescent signals using fluorescence microscopy; (e) inactivating the fluorescence; (f) extending a primer that is hybridized to the oligonucleotide of a second set of capture agents of the plurality, thereby generating a second set of fluorescent signals (e.g., by removing the quencher from a labeled oligonucleotide that is hybridized to the oligonucleotide downstream from the primer); (g) reading the second set of fluorescent signals using fluorescence microscopy; and (h) comparing the images produce in steps (d) and (g).
(116) In this method, the architecture of the double-stranded oligonucleotides linked to the capture agent has a specific design which is effectively enabling rendering of the capture agent binding pattern by “nick translation”. In particular the duplex of the upper strand and the lower strand oligonucleotide with long 5′ overhang of the lower strand is further hybridized to a small detector oligonucleotide labeled both by fluorescent and the quencher. There is a predesigned gap between the initial upper strand and the upper strand detector oligo. During cyclic staining this gap is “walked” by either “reversible terminator” or “missing base” (similar to described in previous sections) until the gap is reduced to a single base nick. Extension and progression through the nick on the upper strand by “nick translating” polymerase such as DNA pol I removes the quencher from some but not all of the quenched fluorescently labeled oligonucleotides, thereby generating a fluorescent signal for some but not all of the capture agents.
(117) In some embodiments the method generally comprises: (i) labeling a planar sample with: i. a first antibody, wherein the first antibody is linked to a first oligonucleotide duplex comprising, lower strand oligonucleotide with a unique sequence hybridized thereto: (i) an oligonucleotide upper strand “primer” and (ii) a labeled upper strand oligonucleotide comprising a 5′ quencher at a site that is downstream from the primer; and a fluorophore downstream from the quencher and ii. a second antibody, wherein the second antibody is linked to a second oligonucleotide duplex comprising, lower strand oligonucleotide with unique sequence hybridized thereto: (i) an oligonucleotide upper strand “primer” and (ii) an upper strand oligonucleotide labeled both by fluorophore and a quencher; wherein the gap between the 3′ end of the primer and the 5′ end of the labeled oligonucleotide is different for the first and second oligonucleotides; (ii) incubating the tissue sample with a first nucleotide mix and a polymerase, thereby removing the quencher from only the labeled oligonucleotide that is hybridized to the first oligonucleotide and producing a first fluorescent signal; (iii) reading the first fluorescent signal using fluorescence microscopy; (iv) inactivating the fluorescent signal by further progression of nick-translating polymerase; (v) incubating the tissue sample with a second nucleotide mix and a polymerase, thereby removing the quencher from only the labeled oligonucleotide that is hybridized to the second oligonucleotide and producing a first fluorescent signal; and (vi) reading the second fluorescent signal from the planar sample using fluorescence microscopy.
(118)
(119) Step 1: The planar sample is stained by capture agents that are coupled to a DNA double-stranded oligonucleotide chemically or through streptavidin (as described in
(120) Step 2: Staining pattern is rendered by a nick-translation reaction carried out by any 5′ exo+ polymerase such as DnaPoll Klenow fragment in the presence of a single letter (A as in
(121) Step 3: For rendering of other staining reagents, the fluorescence is removed by continuing nick translation in the presence of the letters of the stretch bearing the fluorophore.
(122) Step 4: When multiplexing is desired, multiplexing can be achieved by special design of oligonucleotide duplexes attached to detection reagents. In particular each antibody set (two or three per cycle) has a gap of an increasing length between the top strand priming and the detector oligonucleotide. This sequence gap on the strand bearing the quencher/fluorophore pair is filled up to final nick in such a way that single base is extended per cycle, similar to how it is achieved in method 1 (see
Implementation III
(123) In this implementation, the method comprises rending antibody staining by primer extension with a fluorophore labeled base or otherwise reading a FRET signal generated by energy transfer between a first fluorescent nucleotide added to the primer by primer extension and a second nucleotide that is present in the oligonucleotide
(124) In certain embodiments, this method comprises: (a) incubating the planar sample with (i) a first antibody that is linked to a first labeled oligonucleotide and (ii) a second antibody that is linked to a second labeled oligonucleotide, (b) cross-linking the capture agents to the planar sample; (c) hybridizing the first and second labeled oligonucleotides with a first primer, wherein the 3′ end of the first primer anneals to only the first labeled oligonucleotide; (d) extending the primer with a fluorescent nucleotide (which step can be done by adding a labeled nucleotide using polymerase and/or contacting the sample with a labeled oligonucleotide and a ligase); (e) reading, by fluorescence microscopy, a FRET signal generated by energy transfer between the label of the first oligonucleotide and the fluorescent nucleotide added to the first primer; (f) inactivating the fluorescent nucleotide added to the first primer; (g) hybridizing the first and second labeled oligonucleotides with a second primer, wherein the 3′ end of the second primer anneals to only the second labeled oligonucleotide; (h) extending the second primer with a fluorescent nucleotide; and (i) reading, by fluorescence microscopy, a FRET signal generated by energy transfer between the label of the second oligonucleotide and the fluorescent nucleotide added to the second primer.
(125)
(126) Step 1: The planar sample is stained using a capture agent that is coupled to a single stranded oligonucleotide. The oligonucleotide could be either unlabeled or labeled by FRET acceptor (e.g. Cy5) fluorophore on the 3′ end.
(127) Step 2: The binding pattern can be determined by an on-slide hybridization of a complementary probe followed a primer extension reaction in which a fluorescently labeled nucleotide fills in the overhang in the extended strand. In this example (see
(128) Step 3: The binding pattern of other capture agents can be determined by removing the fluorescence by cleavage of lower strand by exo+ DNA polymerase such as Vent (
(129) Step 4: Multiplexing can be achieved by staining of the sample with a library of capture agents each labeled with specific oligonucleotides and cycling through Steps 1-3, as described above, each time using a different detection oligonucleotide that is complementary to one of the capture agent-conjugated oligonucleotides. Only duplexes where primers are annealed specifically will be properly extended (
Further Implementations
(130) As schematically illustrated in
(131)
(132)
(133) Utility
(134) The methods and compositions described herein find general use in a wide variety of application for analysis of any planar sample (e.g., in the analysis of tissue sections, sheets of cells, spun-down cells, blots of electrophoresis gels, Western blots, dot-blots, ELISAs, antibody microarrays, nucleic acid microarrays etc).
(135) In particular embodiments, the planar sample may be a section of a tissue biopsy obtained from a patient. Biopsies of interest include both tumor and non-neoplastic biopsies of skin (melanomas, carcinomas, etc.), soft tissue, bone, breast, colon, liver, kidney, adrenal, gastrointestinal, pancreatic, gall bladder, salivary gland, cervical, ovary, uterus, testis, prostate, lung, thymus, thyroid, parathyroid, pituitary (adenomas, etc.), brain, spinal cord, ocular, nerve, and skeletal muscle, etc.
(136) In certain embodiments, capture agents specifically bind to biomarkers, including cancer biomarkers, that may be proteinaceous or a nucleic acid. Exemplary cancer biomarkers, include, but are not limited to carcinoembryonic antigen (for identification of adenocarcinomas), cytokeratins (for identification of carcinomas but may also be expressed in some sarcomas), CD15 and CD30 (for Hodgkin's disease), alpha fetoprotein (for yolk sac tumors and hepatocellular carcinoma), CD117 (for gastrointestinal stromal tumors), CD10 (for renal cell carcinoma and acute lymphoblastic leukemia), prostate specific antigen (for prostate cancer), estrogens and progesterone (for tumour identification), CD20 (for identification of B-cell lymphomas) and CD3 (for identification of T-cell lymphomas).
(137) The above-described method can be used to analyze cells from a subject to determine, for example, whether the cell is normal or not or to determine whether the cells are responding to a treatment. In one embodiment, the method may be employed to determine the degree of dysplasia in cancer cells. In these embodiments, the cells may be a sample from a multicellular organism. A biological sample may be isolated from an individual, e.g., from a soft tissue. In particular cases, the method may be used to distinguish different types of cancer cells in FFPE samples.
(138) The method described above finds particular utility in examining planar samples using a plurality of antibodies, each antibodies recognizing a different marker. Examples of cancers, and biomarkers that can be used to identify those cancers, are shown below. In these embodiments, one does not need to examine all of the markers listed below in order to make a diagnosis.
(139) TABLE-US-00001 Acute Leukemia IHC Panel CD3, CD7, CD20, CD34, CD45, CD56, CD117, MPO, PAX-5, and TdT. Adenocarcinoma vs. Mesothelioma IHC Pan-CK, CEA, MOC-31, BerEP4, TTF1, calretinin, and WT-1. Panel Bladder vs. Prostate Carcinoma IHC Panel CK7, CK20, PSA, CK 903, and p63. Breast IHC Panel ER, PR, Ki-67, and HER2. Reflex to HER2 FISH after HER2 IHC is available. Burkitt vs. DLBC Lymphoma IHC panel BCL-2, c-MYC, Ki-67. Carcinoma Unknown Primary Site, Female CK7, CK20, mammaglobin, ER, TTF1, CEA, CA19-9, S100, (CUPS IHC Panel - Female) synaptophysin, and WT-1. Carcinoma Unknown Primary Site, Male CK7, CK20, TTF1, PSA, CEA, CA19-9, S100, and (CUPS IHC Panel - Male) synaptophysin. GIST IHC Panel CD117, DOG-1, CD34, and desmin. Hepatoma/Cholangio vs. Metastatic HSA (HepPar 1), CDX2, CK7, CK20, CAM 5.2, TTF-1, and Carcinoma IHC Panel CEA (polyclonal). Hodgkin vs. NHL IHC Panel BOB-1, BCL-6, CD3, CD10, CD15, CD20, CD30, CD45 LCA, CD79a, MUM1, OCT-2, PAX-5, and EBER ISH. Lung Cancer IHC Panel chromogranin A, synaptophysin, CK7, p63, and TTF-1. Lung vs. Metastatic Breast Carcinoma IHC TTF1, mammaglobin, GCDFP-15 (BRST-2), and ER. Panel Lymphoma Phenotype IHC Panel BCL-2, BCL-6, CD3, CD4, CD5, CD7, CD8, CD10, CD15, CD20, CD30, CD79a, CD138, cyclin D1, Ki67, MUM1, PAX- 5, TdT, and EBER ISH. Lymphoma vs. Carcinoma IHC Panel CD30, CD45, CD68, CD117, pan-keratin, MPO, S100, and synaptophysin. Lymphoma vs. Reactive Hyperplasia IHC BCL-2, BCL-6, CD3, CD5, CD10, CD20, CD23, CD43, cyclin Panel D1, and Ki-67. Melanoma vs. Squamous Cell Carcinoma CD68, Factor XIIIa, CEA (polyclonal), S-100, melanoma IHC Panel cocktail (HMB-45, MART-1/Melan-A, tyrosinase) and Pan- CK. Mismatch Repair Proteins IHC Panel MLH1, MSH2, MSH6, and PMS2. (MMR/Colon Cancer) Neuroendocrine Neoplasm IHC Panel CD56, synaptophysin, chromogranin A, TTF-1, Pan-CK, and CEA (polyclonal). Plasma Cell Neoplasm IHC Panel CD19, CD20, CD38, CD43, CD56, CD79a, CD138, cyclin D1, EMA, kappa, lambda, and MUM1. Prostate vs. Colon Carcinoma IHC Panel CDX2, CK 20, CEA (monoclonal), CA19-9, PLAP, CK 7, and PSA. Soft Tissue Tumor IHC Panel Pan-CK, SMA, desmin, S100, CD34, vimentin, and CD68. T-Cell Lymphoma IHC panel ALK1, CD2, CD3, CD4, CD5, CD7, CD8, CD10, CD20, CD21, CD30, CD56, TdT, and EBER ISH. T-LGL Leukemia IHC panel CD3, CD8, granzyme B, and TIA-1. Undifferentiated Tumor IHC Panel Pan-CK, S100, CD45, and vimentin.
(140) In some embodiments, the method may be employed to detect the location and, optionally, the abundance of DNA molecules and/or RNA molecules in situ. In one exemplary embodiment, the method may be used to detect intracellular RNAs. In these embodiments, the capture agent may be a nucleic acid, and the intracellular location and, optionally, the abundance of RNA molecules (e.g., mRNAs or lncRNAs) may be detected in situ. Such hybridization methods may be adapted from known RNA or DNA FISH methods (see, e.g., Mahadevaiah et al (Methods Mol Biol. 2009 558:433-44), Shaffer et al (PLoS One. 2013 8:e75120) and Pollex et al (Methods Mol. Biol. 2013 1042:13-31), which are incorporated by reference herein.
(141) In some embodiments, the method may involve obtaining an image as described above (an electronic form of which may have been forwarded from a remote location) and may be analyzed by a doctor or other medical professional to determine whether a patient has abnormal cells (e.g., cancerous cells) or which type of abnormal cells are present. The image may be used as a diagnostic to determine whether the subject has a disease or condition, e.g., a cancer. In certain embodiments, the method may be used to determine the stage of a cancer, to identify metastasized cells, or to monitor a patient's response to a treatment, for example.
(142) The compositions and methods described herein can be used to diagnose a patient with a disease. In some cases, the presence or absence of a biomarker in the patient's sample can indicate that the patient has a particular disease (e.g., cancer). In some cases, a patient can be diagnosed with a disease by comparing a sample from the patient with a sample from a healthy control. In this example, a level of a biomarker, relative to the control, can be measured. A difference in the level of a biomarker in the patient's sample relative to the control can be indicative of disease. In some cases, one or more biomarkers are analyzed in order to diagnose a patient with a disease. The compositions and methods of the disclosure are particularly suited to identifying the presence or absence of, or determining expression levels, of a plurality of biomarkers in a sample.
(143) In some cases, the compositions and methods herein can be used to determine a treatment plan for a patient. The presence or absence of a biomarker may indicate that a patient is responsive to or refractory to a particular therapy. For example, a presence or absence of one or more biomarkers may indicate that a disease is refractory to a specific therapy and an alternative therapy can be administered. In some cases, a patient is currently receiving the therapy and the presence or absence of one or more biomarkers may indicate that the therapy is no longer effective.
(144) In any embodiment, data can be forwarded to a “remote location”, where “remote location,” means a location other than the location at which the image is examined. For example, a remote location could be another location (e.g., office, lab, etc.) in the same city, another location in a different city, another location in a different state, another location in a different country, etc. As such, when one item is indicated as being “remote” from another, what is meant is that the two items can be in the same room but separated, or at least in different rooms or different buildings, and can be at least one mile, ten miles, or at least one hundred miles apart. “Communicating” information references transmitting the data representing that information as electrical signals over a suitable communication channel (e.g., a private or public network). “Forwarding” an item refers to any means of getting that item from one location to the next, whether by physically transporting that item or otherwise (where that is possible) and includes, at least in the case of data, physically transporting a medium carrying the data or communicating the data. Examples of communicating media include radio or infra-red transmission channels as well as a network connection to another computer or networked device, and the internet or including email transmissions and information recorded on websites and the like. In certain embodiments, the image may be analyzed by an MD or other qualified medical professional, and a report based on the results of the analysis of the image may be forwarded to the patient from which the sample was obtained.
(145) In some cases, the method may be employed in a variety of diagnostic, drug discovery, and research applications that include, but are not limited to, diagnosis or monitoring of a disease or condition (where the image identifies a marker for the disease or condition), discovery of drug targets (where the a marker in the image may be targeted for drug therapy), drug screening (where the effects of a drug are monitored by a marker shown in the image), determining drug susceptibility (where drug susceptibility is associated with a marker) and basic research (where is it desirable to measure the differences between cells in a sample).
(146) In certain embodiments, two different samples may be compared using the above methods. The different samples may be composed of an “experimental” sample, i.e., a sample of interest, and a “control” sample to which the experimental sample may be compared. In many embodiments, the different samples are pairs of cell types or fractions thereof, one cell type being a cell type of interest, e.g., an abnormal cell, and the other a control, e.g., normal, cell. If two fractions of cells are compared, the fractions are usually the same fraction from each of the two cells. In certain embodiments, however, two fractions of the same cell may be compared. Exemplary cell type pairs include, for example, cells isolated from a tissue biopsy (e.g., from a tissue having a disease such as colon, breast, prostate, lung, skin cancer, or infected with a pathogen etc.) and normal cells from the same tissue, usually from the same patient; cells grown in tissue culture that are immortal (e.g., cells with a proliferative mutation or an immortalizing transgene), infected with a pathogen, or treated (e.g., with environmental or chemical agents such as peptides, hormones, altered temperature, growth condition, physical stress, cellular transformation, etc.), and a normal cell (e.g., a cell that is otherwise identical to the experimental cell except that it is not immortal, infected, or treated, etc.); a cell isolated from a mammal with a cancer, a disease, a geriatric mammal, or a mammal exposed to a condition, and a cell from a mammal of the same species, preferably from the same family, that is healthy or young; and differentiated cells and non-differentiated cells from the same mammal (e.g., one cell being the progenitor of the other in a mammal, for example). In one embodiment, cells of different types, e.g., neuronal and non-neuronal cells, or cells of different status (e.g., before and after a stimulus on the cells) may be employed. In another embodiment of the invention, the experimental material is cells susceptible to infection by a pathogen such as a virus, e.g., human immunodeficiency virus (HIV), etc., and the control material is cells resistant to infection by the pathogen. In another embodiment, the sample pair is represented by undifferentiated cells, e.g., stem cells, and differentiated cells.
(147) The images produced by the method may be viewed side-by-side or, in some embodiments, the images may be superimposed or combined. In some cases, the images may be in color, where the colors used in the images may correspond to the labels used.
(148) Cells any organism, e.g., from bacteria, yeast, plants and animals, such as fish, birds, reptiles, amphibians and mammals may be used in the subject methods. In certain embodiments, mammalian cells, i.e., cells from mice, rabbits, primates, or humans, or cultured derivatives thereof, may be used.
(149) Computer Systems
(150) The invention also provides a computer system that is configured to implement the methods of the disclosure. The system can include a computer server (“server”) that is programmed to implement the methods described herein.
(151) The storage unit 1615 can store files, such as individual images, time lapse images, data about individual cells, data about individual biomarkers, images showing a pattern of binding of capture agents to a sample, or any aspect of data associated with the invention. The data storage unit 1615 may be coupled with data relating to locations of cells in a virtual grid.
(152) The server can communicate with one or more remote computer systems through the network 1630. The one or more remote computer systems may be, for example, personal computers, laptops, tablets, telephones, Smart phones, or personal digital assistants.
(153) In some situations the system 1600 includes a single server 1601. In other situations, the system includes multiple servers in communication with one another through an intranet, extranet and/or the Internet.
(154) Methods as described herein can be implemented by way of machine (e.g., computer processor) computer readable medium (or software) stored on an electronic storage location of the server 1601, such as, for example, on the memory 1610, or electronic storage unit 1615. During use, the code can be executed by the processor 1605. In some cases, the code can be retrieved from the storage unit 1615 and stored on the memory 1610 for ready access by the processor 1605. In some situations, the electronic storage unit 1615 can be precluded, and machine-executable instructions are stored on memory 1610. Alternatively, the code can be executed on a second computer system 1640.
(155) Aspects of the systems and methods provided herein, such as the server 1601, can be embodied in programming Various aspects of the technology may be thought of as “products” or “articles of manufacture” typically in the form of machine (or processor) executable code and/or associated data that is carried on or embodied in a type of machine readable medium (e.g., computer readable medium). Machine-executable code can be stored on an electronic storage unit, such memory (e.g., read-only memory, random-access memory, flash memory) or a hard disk. “Storage” type media can include any or all of the tangible memory of the computers, processors or the like, or associated modules thereof, such as various semiconductor memories, tape drives, disk drives and the like, which may provide non-transitory storage at any time for the software programming. All or portions of the software may at times be communicated through the Internet or various other telecommunication networks. Such communications, for example, may enable loading of the software from one computer or processor into another, for example, from a management server or host computer into the computer platform of an application server. Thus, another type of media that may bear the software elements includes optical, electrical, and electromagnetic waves, such as used across physical interfaces between local devices, through wired and optical landline networks and over various air-links. The physical elements that carry such waves, such as wired or wireless likes, optical links, or the like, also may be considered as media bearing the software. As used herein, unless restricted to non-transitory, tangible “storage” media, terms such as computer or machine “readable medium” refer to any medium that participates in providing instructions to a processor for execution.
(156) Hence, a machine readable medium, such as computer-executable code, may take many forms, including but not limited to, tangible storage medium, a carrier wave medium, or physical transmission medium. Non-volatile storage media can include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such may be used to implement the system. Tangible transmission media can include: coaxial cables, copper wires, and fiber optics (including the wires that comprise a bus within a computer system). Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include, for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD, DVD-ROM, any other optical medium, punch cards, paper tame, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables, or links transporting such carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.
(157) The results of the sample staining or labeling can be presented to a user with the aid of a user interface, such as a graphical user interface.
(158) Kits
(159) In some aspects, the disclosure herein provides for kits. The kits can comprise any number of compositions to perform the methods of the disclosure, each of which have been described herein. For example, a kit may comprise at least one capture agent. The capture agent can be an antibody, an aptamer, or an oligonucleotide probe. The capture agent can be custom-made to specifically bind to a desired target. For example, a user may custom-order one or more capture agents to be included in the kit. In some cases, the capture agents can be sold separately. The capture agents can specifically bind to a target molecule of interest. Additionally or alternatively, capture agents can be ordered as a panel (i.e., a pre-determined selection of capture agents). The panel can be specific for a particular type of disease (e.g., cancer) or a particular sub-type of a disease (e.g., colon cancer). A kit of the disclosure can also include one or more oligonucleotides. The oligonucleotides can comprise a first strand and a double strand, as described herein. The oligonucleotides can be provided as single-stranded oligonucleotides or as double-stranded oligonucleotides. In the latter case, the kit can include reagents and/or instructions for annealing the first strand and the second strand of oligonucleotides to produce double-stranded oligonucleotides. The single- or double-stranded oligonucleotides can be conjugated to the capture agents or can be provided unconjugated. In the latter case, reagents can be included in the kit for conjugating the double-stranded oligonucleotides to the capture agents (e.g., reagents to perform Click chemistry). In some cases, the kit may provide a plurality of oligonucleotides wherein each of the first strands is the same and each of the second strands is different. The kit can further comprise any nucleotide mixture disclosed herein. Nucleotide mixtures can comprise any combination of fluorescent nucleotides, unlabeled nucleotides, reversible terminator nucleotides, and the like. Generally, the nucleotide mixture provided in the kit will be compatible with the provided oligonucleotides. The kit can further comprise, without limitation, a polymerase for performing primer extension, a reagent for inactivating a signal (e.g., TCEP), a blocking solution (e.g., iodoacetamide solution), and any buffer or solution suitable to perform the methods herein. The kit can comprise any reagent for preparing a sample for labeling such as a fixative (e.g., formaldehyde) or reagents for embedding a sample (i.e., paraffin wax). The kit can further comprise a control sample for comparison with a test sample. The control sample can be a healthy sample or a diseased sample. The control sample may be matched to the tissue or cell type under investigation or to the disease being studied. In some cases, the control sample may be a positive control or a negative control.
EMBODIMENTS
(160) A method for analyzing a planar sample is provided. In certain embodiments, the method comprises: (a) incubating the planar sample with a capture agent under conditions by which the capture agent specifically binds to complementary sites in the planar sample, wherein: (i) the capture agent is linked to a double-stranded oligonucleotide that comprises a first strand and a second strand; (ii) the capture agent is linked to a double-stranded oligonucleotide by the 5′ end of the first strand; and (iii) the 3′ end of the first strand is recessed relative to the 5′ end of the second strand, thereby producing an overhang; (b) crosslinking the capture agent to planar sample; (c) contacting the planar sample with a polymerase and a nucleotide mix, thereby adding one or more nucleotides to the overhang; and/or contacting the planar sample with a mixture of short oligonucleotides, some of which may be labelled or not, and a DNA ligase and (d) reading a fluorescent signal generated by addition of the one or more nucleotides to the overhang using fluorescence microscopy, thereby producing an image showing the pattern of binding of the capture agent to the planar sample. In some embodiments, after the sample has been read, this method may involve removing the fluorescent moiety and deprotecting an added fluorescent nucleotide, thereby allowing the method to be repeated.
(161) In any embodiment, step (c) may comprise contacting the planar sample with a polymerase and a nucleotide mix that comprises a fluorescent nucleotide, thereby adding the fluorescent nucleotide to the overhang, or contacting to planar sample with one or more fluorescently labeled oligonucleotides, thereby adding a fluorescently labeled oligonucleotide to the overhang; and step (d) comprises reading a fluorescent signal generated by addition of the fluorescent nucleotide or oligonucleotide to the overhang. In this embodiment, the fluorescent signal may be: emitted directly from the added nucleotide or oligonucleotide, a FRET signal generated by energy transfer between two fluorescent nucleotides that are added to the overhang or a FRET signal generated by energy transfer between a first fluorescent nucleotide added to overhang and a second fluorescent nucleotide that is present in the second strand.
(162) In some embodiments, extension of the first strand removes a quencher from a quenched fluorescently labeled oligonucleotide that is hybridized to the second strand, downstream from the first strand.
(163) In any embodiment, the sample may be a formalin-fixed, paraffin-embedded (FFPE) section.
(164) Also provided herein is a capture agent that is linked to a double-stranded oligonucleotide, wherein: (i) the double-stranded oligonucleotide comprises a first strand and a second strand; (ii) the capture agent is linked to the 5′ end of the first strand; and (iii) the 3′ end of the first strand is recessed relative to the 5′ end of the second strand, thereby producing an overhang or (iiii) the 5′ end is recessed relative to the 3′ end of the second strand, there producing and overhang
(165) Also provided herein is a capture agent composition comprising a plurality of capture agents that recognize different complementary sites, wherein: each of the capture agents is linked to a double-stranded oligonucleotide that comprises a first strand and a second strand; the capture agents are linked to a double-stranded oligonucleotide by the 5′ end of first strand; the 3′ end of the first strand in each of the double-stranded oligonucleotides is recessed relative to the 5′ end of the second strand, thereby producing an overhang; and the overhang is different for each of the capture agents. Alternatively, the 5′ end is recessed relative to the 3′ end of the second strand, there producing and overhang that is specific to each capture agent. In this embodiment, the sequence of the first strand may be the same for each of the capture agents; and the sequence of the second strand may be different for each of the capture agents.
(166) In these embodiments, the overhangs may be of the formula 3′-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C and n is 1 or more, or the formula 3′-YN.sub.1/N.sub.2-5′, optionally followed by short stretch of random nucleotides on the 5′ end to increase the overall polymerase residence on the DNA duplex, wherein Y is composed of alternating stretches of bases N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C.
(167) A method for analyzing a tissue sample is also provided. In these embodiments, the method may comprise (a) incubating a planar sample with a capture agent composition of a prior embodiment under conditions by which the capture agents specifically bind to sites in the planar sample; (b) crosslinking capture agents to planar sample; (c) contacting the planar sample with a polymerase and either an incomplete nucleotide mix or a nucleotide mix that comprises a reversible terminator nucleotide and/or a ligase and a labeled oligonucleotide; and (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition a nucleotide to some but not all of the capture agents.
(168) In this embodiment, the method may comprise: (c) contacting the planar sample with a polymerase and: (i) a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide that is complementary to N.sub.4 or (ii) a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, and N.sub.2, an unlabeled nucleotide that is complementary to N.sub.3, and no nucleotide that is complementary to N.sub.4, thereby adding fluorescent nucleotides onto the double-stranded oligonucleotides of some but not all of the capture agents. This step can also be done by ligation, i.e., by contacting the planar sample with a labeled oligonucleotide (or a mixture of the same), where addition of the labeled oligonucleotide depends on the underlying sequence of the overhang. This method also comprises: (d) reading, using fluorescence microscopy, a fluorescent signal generated by addition of a fluorescent nucleotide to some but not all of the capture agents. In these embodiments, the overhangs may be of the formula 3′-N.sub.4n/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C and n is 1 or more; and step (c) comprises contacting the planar sample with a polymerase and a nucleotide mix that comprises fluorescent nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide that is complementary to N.sub.4. This step can also be implemented by addition of a labeled oligonucleotide using a ligase. In these embodiments, the method may comprise (e) inactivating the fluorescent signal, deprotecting the reversible terminator nucleotide and blocking the sample; and (f) repeating steps (c) and (d). In some cases, step (f) may comprise repeating steps (c), (d) and (e) multiple times. Alternatively, the overhangs may be of the formula 3′-YN.sub.1/N.sub.2-5′, optionally followed by short stretch of random nucleotides on the 5′ end to increase the overall polymerase residence on the DNA duplex, wherein Y is composed of alternating stretches of bases N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T and C. In these embodiments, the method may further comprise (e) inactivating the fluorescent signal and contacting the planar sample with a polymerase and an unlabeled nucleotide that is complementary to N.sub.4; and (f) repeating steps (c) and (d). In some cases, step (f) may comprise repeating steps (c), (d) and (e) multiple times.
(169) In some embodiments, the double-stranded oligonucleotides each comprise a fluorescently labeled oligonucleotide hybridized to the second strand downstream from first strand, wherein the fluorescently labeled oligonucleotide comprises a quencher and extension of the first strand removes the quencher from some but not all of the quenched fluorescently labeled oligonucleotides, thereby generating a fluorescent signal for some but not all of the capture agents.
Example I
(170) Materials and Methods
(171) Spleen cells fixed in 2% formaldehyde, permeablized and stored in methanol at −80 were spun from methanol, resuspended and washed with buffer 4 (10 mM Tris & 0.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Triton x100) for 5 min on a rotator. To block against non-specific binding of ab-oligonucleotide complexes cells were further spun, resuspended in 1 ml PBS, 0.5% BSA (SM) and supplemented up to additional 0.5M NaCl (0.9 ml SM+100 ul 5M NaCl). 20 ul of sheared ssDNA (10 mg/ml), 50 ul of mouse IgG (10 mg/ml) and 20 ul of 0.5M EDTA were further added to 1 ml of cells and the mix was incubated for 30 min on a rotator. For staining cells were redistributed into 30 250 ul tubes (PCR strip tubes is a convenient choice for that matter) with premade antibody/oligonucleotide complexes (0.2 ug of CD45-146 complex was annealed with 1 ul of specific oligonucleotide (147 etc) per tube 30 min at 40 C) and incubated for 1 h with rotation. Cells were washed in (PBS, 0.1% Triton 0.5M salt 5 mM EDTA) twice, placed on poly-lysine treated glass coverslips, allowed to stand/attach for 10 min and further fixed with 5 mM BS3 (7.4 mg per 4 ml) in PBS, 0.1% Triton, 0.5M NaCl, 5 mM EDTA for 1 hour.
(172) Staining was rendered in cycles. For odd cycles (1, 3, 5, 7, 9, 11, 13, 15) coverslips were incubated for 2 min in dG/dU mix (150 nM dG, 150 nM dUssCy5, 150 nM dCssCy3, 25 ul NEB exo− Klenow per ml in buffer #4 (10 mM Tris 7.5, 0.5M NaCl, 0.1% Triton x100, 10 mM MgCl2)), washed twice with 405 (buffet #4 supplemented up to 0.65M NaCl); and imaged by confocal microscopy. Following imaging the fluorophores were cleaved off cells by incubation in 50 mM TCEP for 2 min in buffer 405E (10 mM Tris 7.5, 0.5M NaCl, 0.1% Triton x100, 5 mM EDTA). After cleavage cells were washed in 405E and blocked for for 1 min in iodoacetamide solution (FRESHLY made 100 mM iodoacetamide in buffer 405E). The blocking solution was removed by two washes with buffer #4. Before proceeding to next cycle cells were again imaged by confocal microscopy. Even cycles (2, 4, 6, 8, 10, 12, 14) were performed same as odd cycles except for substitution of dG with dA in labeling step and extension of cleavage to 4 min at room temperature.
(173) Preliminary Data.
(174) To explore the possibility of in situ staining by primer extension expression of CD4 was visualized in mouse spleen cells in suspension (
(175)
(176)
(177) To prove the possibility of multiplexed detection of several antigens by primer extension, the expression of CD4 and CD8 was co-analyzed in mouse spleen cells immobilized on a slide by Method 1 and, specifically, the multiplexing approach based on “reversible terminators”. The cells were simultaneously stained by CD4 and CD8 antibodies conjugated to oligonucleotide duplexes as in (
(178)
(179) The “missing base” multiplexing approach was tested on a model of heterogeneous tissue containing multiplicity of distinct cellular subsets (
(180) In order to test the performance and multiplexing capacity of “missing base” method the following model approach was employed, as shown in
Example 2
(181) Antibody Signal Amplification In Situ with Rolling Circle Amplification
(182) Materials and Methods
(183) Rat anti-mouse B220 antibody conjugate to oligonucleotide 146v2 was prepared as described. The conjugate were hybridized to a padlock oligonucleotide (PatgctaccgttAATTATTACTGAAACATACACTAAAGATAACATTA ttctgcaag: SEQ NO:125) that is designed to form a circular hybrid on 146v2. Mouse spleen cells were stained with either of the conjugates and then those cells that were stained with the padlock construct were incubated with T4 RNA ligase (NEB) in manufacturer's ligation buffer at 37 C for 1 hour and then with phi29 polymerase and dNTP mix for 15 minutes. Cells were washed 3 times with PBS and then incubated with 10 nM RCA product detection oligonucleotide (TGAAACATACACTAAAGA; SEQ ID NO:126) for 10 minutes. After that, cells were incubated with fluorescent dUTP-Cy5 (Jena Biosciences) was incorporated into the cells by incubating with 200 nM dUTP-Cy in buffer #4 and 1 ul of exo− Klenow polymerase (Thermo Scientific). An aliquot of cells was left out and not subject to the rolling circle amplification (RCA) step and then used as a reference to assess the effect of RCA on staining.
(184) Results
(185) The efficiency of rolling circle amplification of multiplexing DNA barcode attached to the antibody for enhancing antibody staining was tested. A special antibody-DNA conjugate based on anti-B220 antibody that contained a circularized ‘padlock’ oligonucleotide annealed to the linker (146v2) oligonucleotide hybrid was assembled and mouse cells were stained with it. After staining, the padlock oligonucleotide was ligated with T4 ligase and amplified using the rolling circle protocol with phi29 polymerase, resulting in a long repetitive DNA stretch attached to each antibody that contained the repetitive sequence complementary to the detection primer. After annealing of the primer, multiple molecules of dUTP-Cy5 could be incorporated into the amplified DNA molecule, due to its repetitive nature.
Example 3
(186) Co-Detecting 22 Antigens on Dispersed Spleen Cells
(187) Materials and Methods
(188) Antibody conjugates were prepared using the following protocol. Antibodies were subject to partial reduction of disulfide by 30 min incubation at room temperature with TCEP (final concentration 1 mM) in PBS pH 7.4. The antibodies were purified from TCEP by buffer exchange on BioGel P-30 spin-columns saturated with conjugation buffer (PBS pH 7.0). Oligonucleotide 146v2 (5′ Maleimide-ATAGCAGTCCAGCCGAACGGTA GCATCTTGCAGAA; SEQ ID NO: 27) bearing a protected maleimide group were ordered from Trilink Inc. To prepare for covalent crosslinking to antibodies per instruction from manufacturer the maleimide group residing on an oligonucleotide was de-protected/activated by Adler reaction (4 h at 90 C in toluene). Toluene was removed from the oligonucleotide by several washes in absolute ethanol. Activated oligonucleotides were dissolved in conjugation buffer and mixed with reduced antibodies at a molar ratio of 50:1. Sodium Chloride was added to conjugation reaction to final concentration of 1M. Conjugation reaction was allowed to proceed for 1 h. To remove the unbound oligonucleotide the conjugated antibodies were filtered 4 times on molecular weight cutoff filters (Amicon 50 KDa). Final wash and storage were performed in phosphate buffer with 0.5M sodium chloride and 0.1% Tween-20.
(189) To assemble DNA duplex tag 0.2 ug of conjugated antibodies was mixed with 100 pmoles of bottom strand oligonucleotide in phosphate buffer with 0.6M Sodium Chloride and incubated for 30 min at 40° C.
(190) TABLE-US-00002 v2_C_cycle1 SEQ ID NO: 128: TTTTGTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle2 SEQ ID NO: 129: TTTTGtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle3 SEQ ID NO: 130: TTTTGCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle4 SEQ ID NO: 131: TTTTGTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle5 SEQ ID NO: 132: TTTTGCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle6 SEQ ID NO: 133: TTTTGtttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle7 SEQ ID NO: 134: TTTTGcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle8 (SEQ ID NO: 135) TTTTGttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle9 (SEQ ID NO: 136) TTTTGcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle10 (SEQ ID NO: 137) TTTTGtcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle11 (SEQ ID NO: 138) TTTTGcctcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle1 SEQ ID NO: 139: TTTTATTCTGCAAGATGCTACCGTTCGGz v2_U_cycle2 SEQ ID NO: 140: TTTTAtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle3 SEQ ID NO: 141: TTTTACtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle4 SEQ ID NO: 142: TTTTATCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle5 SEQ ID NO: 143: TTTTACcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle6 SEQ ID NO: 144: TTTTAtttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle7 SEQ ID NO: 145: TTTTAcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle8 (SEQ ID NO: 146) TTTTAttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle9 (SEQ ID NO: 147) TTTTActtcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle10 (SEQ ID NO: 148) TTTTAtcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle11 (SEQ ID NO: 149) TTTTAcctcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz
(191) Mouse spleen and bone marrow cells were prepared according to standard procedure and fixed in 2% formaldehyde for 10 min at room temperature. Following fixation, cells were spun and either stored frozen at −80 in PBS with 5% DMSO or permeabilized by incubation in ice-cold methanol for 10 min. and further stored at −80° C. in methanol.
(192) Before staining stored cells were washed with SM (0.5% BSA in PBS, 5mMEDTA) once and blocked for 30 min at room temperature in staining buffer (0.6M NaCl, 0.5% BSA, 50 ug/ml rat IgG, 200 ug/ml ssDNA, 5mMEDTA, 3 nmoles per ml of blocking oligonucleotide TTTTccctctcctcttcctttCcTCt-ddC in phosphate buffer pH 7.4). In case frozen sections were used tissue sections were picked by warm coverslips and immediately placed into dry ice without allowing the section to dry. Coverslips with sections were dipped for 30 sec into ethanol pre-chilled to dry-ice temperature, and transferred to SME with 4% formaldehyde for 20 min After that the fixed sections were washed twice in SM and further blocked in staining buffer for 30 min. Mouse spleen cells were stained in staining buffer for 2-3 h at room temperature with a mixture of conjugated antibodies taken at 0.2 ug of each antibody per 100 ul of solution. After staining cells were washed twice with SM05 (SM supplemented with NaCl up to 0.65M final concentration), then were allowed to adhere to poly-L-lysin coated coverslips and further fixed to coverslip surface by 20 min incubation with 5 mM BS3 crosslinker in PBS. Following methanol fixation/permeabilization cells were washed once with SM05, allowed to adhere to coverslip surface and further fixed to coverslip surface by 20 min incubation with 5 mM BS3 crosslinker in PBS. If frozen sections were used—following staining sections were washed twice by SM05 and fixed by 20 min incubation with 5 mM BS3 crosslinker in PBS. Following staining procedure and converting into planar form (in case of suspension cells) all kinds of samples were subjected to similar ABseq rendering protocol.
(193) Coverslips with cells were washed twice with buffer 4 (10 mM Tris pH 6.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Triton x100).
(194) Staining was rendered by iterative incubation with polymerase reaction mixes. In odd cycles (1, 3, 5 . . . )-cells were incubated for 2 min in G-mix (150 nM dG, 150 nM dUssCy5, 150 nM dCssCy3, 25 ul NEB exo− Klenow per ml in buffer 4); wash 3 times with 405 (buffet 4 without MgCl and supplemented with NaCl up to final 0.65M); photographed; incubated 2 min in 50 mM TCEP in buffer 405; washed twice with 405; photographed; incubated for 1 min in freshly made 100 mM iodoacetamide in buffer 405; washed three times with buffer 4. In even cycles (2, 4, 6 . . . )-cells were incubated for 2 min in A-mix (150 nM dATP, 150 nM dUTPssCy5, 150 nM dCTPssCy3, 25 ul NEB exo− Klenow per ml in buffer 4); wash 3 times with 405 (buffet 4 without MgCl and supplemented with NaCl up to final 0.65M); photographed; incubated 4 min in 50 mM TCEP in buffer 405; washed twice with 405; photographed; incubated for 1 min in freshly made 100 mM iodoacetamide in buffer 405; washed three times with buffer #4. Reversibly labelled fluorescent nucleotide triphosphates were custom synthesized by Jena Bioscience.
(195) Results
(196) ABseq was used to explore the variety of cellular subsets in mouse spleen and bone marrow using 22-antibody panel. Isolated spleen and bone marrow cells were barcoded by whole cell staining with NHS-PacBlu and NHS-Ax-488 dyes, mixed, stained with a panel of 22 antibodies tagged with DNA duplexes, attached to slide and rendered by ABseq in 11 primer extension and imaging iterations (
Example 4
Multipanel Design with Spacers
(197) Materials and Methods
(198) Antibody conjugation, cell staining and rendering was performed following the same experimental procedures as in section 4 (Co-detecting 22 antigens on dispersed spleen cells). Nine aliquots of spleen cells were stained separately with a different CD45 antibody-DNA conjugate. Conjugates for each panel were formed in the following way.
(199) TABLE-US-00003 Panel1: CD45 conjugated to 146v2 (5′Maleimide- ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA (SEQ ID NO: 174) and forming a DNA duplex with: 1. (SEQ ID NO: 150) TTTTATTCTGCAAGATGCTACCGTTCGG-dideoxyC 2. (SEQ ID NO: 151) TTTTAtTTCTGCAAGATGCTACCGTTCGGz-dideoxyC 3. (SEQ ID NO: 152) TTTTACtTTCTGCAAGATGCTACCGTTCGGz-dideoxyC Panel2 CD45 conjugated to 146v2-ddC (5′Maleimide- ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA-dideoxyC) (SEQ ID NO: 153) and forming a DNA duplex with: 4. (SEQ ID NO: 154) TTTTAGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCGG- dideoxyC 5. (SEQ ID NO: 155) TTTTAtGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCGGz- dideoxyC 6. (SEQ ID NO: 156) TTTTACtGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCGGz- dideoxyC Panel3 CD45 conjugated to 146v2-ddC (5′Maleimide- ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA-dideoxyC) (SEQ ID NO: 157) and forming a DNA duplex with: 7. (SEQ ID NO: 158) TTTTACGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCGG- dideoxyC 8. (SEQ ID NO: 159) TTTTAtCGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCGGz- dideoxyC 9. (SEQ ID NO: 160) TTTTACtCGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCGGz- dideoxyC
(200) After staining the cells were washed with washed twice with buffer 4 (10 mM Tris pH 6.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Triton x100) to remove unbound antibody-DNA conjugates and then the aliquots of cells were mixed together and attached to a lysine-coated coverslip. Antigen staining was rendered in the following sequence of incubations: dGTP+dUTP-Cy5.fwdarw.dATP+dUTP-Cy5.fwdarw.dGTP+dUTP-Cy5.fwdarw.Incubation with 1 uM spacer1 (GTTCACGCTTAATCGC; SEQ ID NO:161) in buffer #4 for 20 minutes.fwdarw.dGTP+dUTP-Cy5.fwdarw.dATP+dUTP-Cy5.fwdarw.dGTP+dUTP-Cy5.fwdarw.Incubation with 1 uM spacer2 (CGCTAATTCGCACTTG; SEQ ID NO:162) in buffer #4 for 20 minutes.fwdarw.dGTP+dUTP-Cy5.fwdarw.dATP+dUTP-Cy5.fwdarw.dGTP+dUTP-Cy5 Imaging, fluorophore inactivation with 50 mM TCEP pH 7.0 and background blocking with iodoacetamide were performed after each step of rendering.
(201) Results
(202) Due to polymerase misincorporation errors the signal intensity of rendering by ABseq is expected to fall with increasing cycle numbers as observed in other studies on development of deep sequencing protocols utilizing sequential addition of individual nucleotides. To circumvent that and to avoid the use of extensively long DNA fragments linked to antibody the following amendment to the design was tested (
Example 5
Multiplexed Single Molecule RNA Detection
(203) Materials and Methods
(204) NALM and Jurkat cell lines were grown to a density of 1 million/ml, fixed with 1.6% formaldehyde for 10 minutes and then transferred to ice-cold methanol. An aliquot of 200K cells was washed with PBSTR (PBS, 0.1% Tween-20 and 1:1000 Rnasin) and transferred to a hybridization buffer (1×SSC, 10% formamide, 10% vanadyl-ribonucleotide complex, 10% polyvinylsulfonic acid). DNA probe mixture was added to the final concentration of 100 nM and incubated at 40 C for 1 hour. Cells were washed 2 times with PBSTR at room temperature for 5 minutes and 2 times with a high salt buffer (4×SSC in PBSTR) at 40 degrees for 20 minutes, once again washed with PBSTR and transferred to a ligation solution (0.1 ul T4 DNA ligase (New England Biosciences), 5 ul 10× T4 ligase buffer (New England Biosciences), 45 ul H2O). Ligation proceeded for 1 h at 37 C. Then cells were transferred to amplification solution (1 ul of phi29 polymerase (Thermo Scientific), 5 ul of 10× polymerase buffer (Thermo Scientific), 1 ul of 10 mM dNTP mix, 43 ul of H.sub.2O) and incubated at 30 C for 1 h. Cells were washed with PBSTR and incubated with 1 mM “RCA detection” oligonucleotide for 10 minutes at 37 C and transferred to Sequencing buffer (10 mM Tris pH 7.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Triton x100, 1:50 Klenow polymerase (Thermo Scientific), 200 mM dUTP-Cy5 (Jena Biosciences)). Cells were washed twice with high salt wash buffer (10 mM Tris pH 7.5, 10 mM MgCl2, 650 mM NaCl, 0.1% Triton x100) and imaged using a florescent microscope.
(205) TABLE-US-00004 HLA-DR padlock1 PACATTAaaatcctagcacagggactcAATTATTACTGAAACATACACTAAAGAT Apa (SEQ ID NO: 163) HLA-DR splint-primer1 ctcatcagcacagctatgatgaTAATGTTATCTT (SEQ ID NO: 164) HLA-DR padlock2 PACATTAtagaactcggcctggatgatAATTATTACTGAAACATACACTAAAGAT A (SEQ ID NO: 165) HLA-DR splint-primer2 ctgattggtcaggattcagaTAATGTTATCTT (SEQ ID NO: 166) HLA-DR padlock3 PACATTAtcaaagctggcaaatcgtccAATTATTACTGAAACATACACTAAAGAT A (SEQ ID NO: 167) HLA-DR splint-primer2 tggccaatgcaccttgagccTAATGTTATCTT (SEQ ID NO: 168) HLA-DR padlock4 PACATTAtgatttccaggttggctttgAATTATTACTGAAACATACACTAAAGAT A (SEQ ID NO: 169) HLA-DR splint-primer2 atagttggagcgctttgtcaTAATGTTATCTT (SEQ ID NO: 170) HLA-DR padlock5 PACATTAtttcgaagccacgtgacattAATTATTACTGAAACATACACTAAAGAT A (SEQ ID NO: 171) HLA-DR splint-primer2 ctgtggtgacaggttttccaTAATGTTATCTT (SEQ ID NO: 172) RCA detect CATACACTAAAGATAACAT (SEQ ID NO: 173)
Results
(206) An on-slide primer extension protocol was applied to detect single molecules of human HLADRA mRNA in NALM pro-B-cell line. Jurkat T-cell lymphoma line was used as a negative control to assess the background. In order to enable single molecule mRNA detection, a signal amplification system was designed based on proximity ligation and rolling circle amplification (RCA). Five pairs of probes were designed in a way that the two oligos of each pair were complementary to directly adjacent 20-nt stretches of HLADRA mRNA and that the 3′ region of the upstream oligonucleotide served as a splint for circularization of the downstream padlock oligonucleotide (