Oligonucleotide complex compositions and methods of use as gene alteration tools
09617535 ยท 2017-04-11
Assignee
Inventors
- David R. Tabatadze (Worcester, MA)
- Paul C. Zamecnik (Boston, MA)
- Malay K. Raychowdhury (Lexington, MA)
- Horacio F. Cantiello (Rowley, MA)
Cpc classification
C12N15/1024
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C07K2319/10
CHEMISTRY; METALLURGY
C07K2319/07
CHEMISTRY; METALLURGY
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Compositions and methods of treatments of cells are provided for altering the phenotype of a cell by administering an oligonucleotide complex to the cell, the complex having two strands and chemical modifications.
Claims
1. An oligonucleotide about 33 nucleotides in length comprising the sequence AUCAUAGGAAACACCAAAGAUGAUAUUUUCUUU (SEQ ID NO:1), wherein the oligonucleotide comprises an RNase H-resistant modification.
2. The oligonucleotide of claim 1, wherein said oligonucleotide is 33 nucleotides in length.
3. The oligonucleotide of claim 2, wherein said modification is a 2-O-methyl ribosyl modification.
4. The oligonucleotide of claim 3, wherein each nucleotide in said oligonucleotide is a 2-O-methylribosyl nucleotide.
5. A composition comprising the oligonucleotide of claim 1.
6. The oligonucleotide of claim 1, wherein said modification is a 2-O-methyl ribosyl modification.
7. The oligonucleotide of claim 6, wherein each nucleotide in said oligonucleotide is a 2-O-methylribosyl nucleotide.
8. A composition comprising the oligonucleotide of claim 2.
9. A composition comprising the oligonucleotide of claim 3.
10. A composition comprising the oligonucleotide of claim 4.
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7) Scheme 1 is a drawing of (A) a hypothetical scheme for repair of CFTR 508 mRNA by CF4/CF6 duplex (SEQ ID NO: 21 corresponding to the Wild Type sequence, SEQ ID NO: 22 corresponding to the 508 mRNA sequence, SEQ ID NO: 1 corresponding to the CF4 sequence, and SEQ ID NO: 2 corresponding to the CF6 sequence), and (B) sequences found in restored mRNA (SEQ ID NO: 58 corresponding to the N1 sequence, SEQ ID NO: 59 corresponding to the NF1 sequence, SEQ ID NO: 60, corresponding to the SNF1 sequence). Bold italic type corresponds to bases of 2-O-methyl ribosyl oligonucleotides with normal internucleoside phosphate bonds (CF4 oligonucleotide). Regular type corresponds to natural RNA. Bold plus underlined type corresponds to inserted bases of ribonucleotides. Shaded bases in the CF4 and 508 mRNA indicate non-complementary Watson-Crick base pairs. Sequence analysis of RT-PCR products obtained by using different primers is also shown. (a) in square indicates that in 7 out of 10 sequencing this A was present, but in 3 other sequencings was absent, leaving 3 deletions. (b) Dashes indicate deletions, possibly induced by PCR. (c) There are no deletions.
in square indicates that in this position U sometimes is replaced by another nucleotide.
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) The present invention is directed to a method for targeted gene repair, comprising contacting a non-repaired target RNA with an RNA oligonucleotide complex comprising a first oligonucleotide and a second oligonucleotide, the first oligonucleotide comprising a sequence complementary to a repaired target RNA, wherein the RNA sequence of the first oligonucleotide comprises an RNase H-resistant modification, and the second oligonucleotide comprises an RNA sequence complementary to at least 6 nucleotides of the first oligonucleotide at the site on the sequence of the first oligonucleotide which is not complementary to the non-repaired target RNA; and hybridizing the complex to the non-repaired target RNA in the presence of an RNase, wherein a repaired RNA is produced. Preferably, any genetic defect, e.g., a substitution, deletion, or addition of at least one basepair, compared to a normal wild type sequence, is phenotypically changed.
(24) The first oligonucleotide and the second oligonucleotide are annealed. The repaired target RNA is an optionally wild-type sequence, and the non-repaired target RNA is a mutated sequence. The mutation is a substitution, deletion or insertion of at least one base pair compared to a normal wild type sequence. In one embodiment, prior to contacting a non-repaired target RNA with an RNA oligonucleotide complex the non-repaired target RNA is contacted with a phosphorothioate (PS) containing sequence comprising a deoxynucleotide with RNase H resistant flanking ends. The RNase H-resistant modification is the addition of a 2-O-methyl moiety. The first oligonucleotide is at least 10 nucleotides in length. In a preferred embodiment, the first oligonucleotide comprises about 33 nucleotides. In another embodiment, the second oligonucleotide comprises at least 7 nucleotides. In a preferred embodiment, the second oligonucleotide comprises about 11 nucleotides. Contacting the target RNA occurs within a cell. In preferred embodiment, cell is in vitro, ex vivo or in vivo. In another preferred embodiment, the cell is a mammalian cell. In a more preferred embodiment, the cell is a human cell.
(25) The present invention is also directed to a method for treating or ameliorating cystic fibrosis in a subject in need thereof, comprising administering an RNA oligonucleotide complex directed to a non-repaired target RNA, the complex comprising a first oligonucleotide and a second oligonucleotide, the first oligonucleotide comprising a sequence complementary to a repaired target RNA, wherein the RNA sequence of the first oligonucleotide comprises an RNase H-resistant modification, and the second oligonucleotide comprises an RNA sequence complementary to at least 6 nucleotides of the first oligonucleotide at the site on the sequence of the first oligonucleotide which is not complementary to the non-repaired target RNA; and wherein administration produces a repaired targeted RNA, thereby treating or ameliorating cystic fibrosis.
(26) The first oligonucleotide and the second oligonucleotide are annealed.
(27) The repaired target RNA is a wild-type sequence. In another embodiment, the non-repaired target RNA is a mutated sequence. In a preferred embodiment, mutation is a substitution, deletion or insertion of at least one base pair compared to a normal wild type sequence.
(28) Prior to administering an RNA oligonucleotide complex, a phosphorothioate (PS) containing sequence comprising a deoxynucleotide with RNase H resistant flanking ends is administered. RNase H-resistant modification is the addition of a 2-O-methyl moiety. The first oligonucleotide is at least 10 nucleotides in length. In a preferred embodiment, the first oligonucleotide comprises about 33 nucleotides. In another embodiment, the second oligonucleotide comprises at least 7 nucleotides. In a preferred embodiment, the second oligonucleotide comprises about 11 nucleotides.
(29) The present invention is also directed to an RNA oligonucleotide complex for modulating the expression or activity of a disease-associate gene product cystic fibrosis transmembrane conductance regulator (CFTR) gene product, the complex comprising a first oligonucleotide and a second oligonucleotide, the first oligonucleotide comprising the nucleic acid sequence of SEQ ID NO:1 and the second oligonucleotide comprising the nucleic acid sequence of SEQ ID NO:2, wherein the first and second oligonucleotide are annealed.
(30) The present invention includes method for targeted gene repair, comprising contacting a target RNA of a cell with a hybrid DNA/RNA oligonucleotide complex, the complex comprising a first strand and a second strand, the first strand comprising a flanking sequence complementary to the target RNA and central sequence comprising at least one non-complementary nucleotide in a location opposite a defect of the target RNA, wherein the flanking sequence of the first strand comprises an RNase H-resistant modification 3 and 5 to the nucleotide, the first strand and the second strand being annealed; and hybridizing the complex to the target RNA, wherein a repaired RNA is produced, the RNA comprising a sequence alteration opposite the defect of the target RNA, wherein the genomic target DNA sequence is unaltered.
(31) The complex contains a first strand and a second strand. The first and second strand is annealed to one another to form the complex. The first strand contains a flanking sequence that is complementary to sequence of the target RNA (hybridized ends) and a central sequence (located between the flanking sequence) that contains at least one non-complementary nucleotide or deletion in a location opposite a defect of the target RNA. The nucleotide sequence of the first strand is complementary to the sequence of a normal wild type gene. The central sequence, which is RNase-sensitive, is at least a triplet, and is preferably at least 4, 5, 6, or more nucleotides in length. The flanking sequence of the first strand includes an RNase H-resistant modification, e.g., addition of a 2-O-methyl moiety, or other modifications, to both a 3 and 5 to the nucleotide hybridizable to the target sequence of the gene.
(32) The second strand of the complex is of the same length as the first strand, or is shorter than first strand of the complex, and the second and first strands are complementary to and annealed to one another. The complex is allowed to hybridize to target genomic RNA of the target cell, and a repaired RNA is produced in the cell. The repaired RNA contains a sequence alteration opposite the defect of the target RNA, and the genomic target DNA sequence remains unaltered. The RNA alteration or phenotypic change accomplished by the method is not maintained in a progeny of the cell, i.e., is not heritable.
(33) The flanking sequence of the first strand contains at least four complementary nucleotides (relative to the genomic target RNA) 3 to the hybridizable sequence of the targeted gene (of the target RNA and first strand RNA oligonucletide) and at least four complementary nucleotides (relative to the genomic target RNA) 5 to the hybridizable sequence of the targeted gene. The flanking portion of the complex sequence contains an RNase H-resistant modification, whereas the central portion of the sequence (opposite the defect) does not contain such a modification and is therefore nuclease and RNase sensitive, i.e., the nucleotide bonds in the central region are enzymatically cleaved.
(34) The first strand is at least 10 nucleotides in length. For example, the first strand contains at least about 10, 12, 14, 15, 16, 18, 20, 30, 40, or 50 or more nucleotides, the flanking sequence of which contains at least 2 nucleotides that are complementary to target RNA in the region of the defect. The complementary flanking sequence on either side of the defect is about 5, 10, 15, 20, 25 or more nucleotides in length. The second strand of the oligonucleotide complex is at least about 7 nucleotides in length and is optionally longer, e.g., 9, 11, 12, 15, or 20 nucleotides.
(35) Another approach involves hybridization of a PS containing segment of a deoxyribonucleotide with RNase H resistant flanking ends, resulting in an RNase-catalized deletion of a small central segment of mRNA. This oligonucleotide is then washed out of the incubation medium and is replaced by a double-stranded, annealed hybrid oligonucleotide. The double-stranded, annealed hybrid oligonucleotide hybridizes with the targeted mRNA, and inserts an oligonucleotide segment complementary to the hybridizable oligonucleotide part of the duplex repair complex.
(36) Nucleotide modifications are selected from the group 2-O-methyl ribosyl; phosphorothioate; peptide nucleic acid; 2-halo, 2-fluoro, 2-alkyl, 2-alkoxylalkyl, bridged sugars and similar chemical moieties; methylphosphonate, ethylphosphonate, phosphoramidate, thiophosphate, dithiophosphate, morpholino, boronophosphate, morpholinophosphate internucleoside linkages and similar chemical moieties; derivatized heterocycles, and sugars.
(37) The method is utilized in analytical research applications as well as in preventative, diagnostic and therapeutic applications. Complexes are administered to a subject, e.g., a human patient, suffering from a disorder associated with a genetic defect, or to a cell obtained from a patient having a genetic disease. Cells or tissue are contacted in vitro, in vivo or ex vivo. In some embodiments, the cell is an isolated cell in a culture. The method can further involve isolating and sequencing RNA from a contacted cell having a different phenotype from cells from the patient or the culture, wherein altering expression of the target gene is altering an RNA nucleotide sequence.
(38) A target gene such as one associated with a disease state is diagnosed by detecting a mutation compared to the sequence of a normal wild type gene. The central segment of the oligonucleotide repair complex has a normal sequence compared to the target gene. A modification confers ribonuclease resistance. Alternatively, a modification confers induction of ribonuclease activity in the cell. At least one nucleotide of the complex is a 2-O-methyl ribosyl nucleotide. For example, there is a plurality of 2-O-methyl ribosyl nucleotides. The second strand can further contain a small chemical group at a 5 or 3 terminus, or the second strand further contains a small chemical group at both 5 and 3 termini. The modification can be located at a nucleotide in a 3 or a 5 terminus, or both. The second strand further comprises a modification comprising a small chemical group in a 3 or a 5 terminus. For example, the small chemical group is selected from phosphate, diphosphate, triphosphate, thiophosphate, dithiophosphate, aldehyde, carboxy, dihydroxy, hydroxyl, methyl, ethyl, sulfhdryl, sulfate, and boronate. The central segment comprises at least one modification, which is a phosphorothioate.
(39) The genetic disease is selected from the group of albinism, cystic fibrosis, muscular dystrophy, myotonic dystrophy, muscular atrophy, sickle cell anemia, hepatic disorder, hemophilia, Crigler-Najjar syndrome, renal tubular acidosis, -thalassemia, atherosclerosis, Huntington's disease, spinocerebellar ataxia, Machado-Joseph disease, Fragile X, Frederich's ataxia, adenosine deaminase deficiency, hepatocellular carcinoma, hepatoblastoma, osteosarcoma, adenocarcinoma, breast cancer, adrenocortical carcinoma, non-Hodgkin lymphoma, glioblastoma, rhabdomyosarcoma, glioma, sickle cell anemia, haemolytic anaemia, retinoblastoma, ovarian cancer, cystic fibrosis, congential absence of vas deferens, melanoma, adenomatous polyposis, colorectal cancer, factor V deficiency, thrombosis, haemophilia A, haemophilia B, warfarin sensitivity, thalassaemia alpha, haemoglobin variant, haemoglobin H disease, non-polyposis colorectal cancer, endometrial cancer, early onset colorectal cancer, apolipoprotein E, hypercholesterolaemia, Gilbert syndrome, Alzheimer's disease and Schizophrenia.
(40) The methods and compositions of the present invention are used to treat or ameliorate cystic fibrosis, Huntington's disease or albinism. More specifically, methods and compositions of the present invention are used to treat or ameliorate at least one symptom of cystic fibrosis, Huntington's disease or albinism.
(41) Cystic fibrosis can be diagnosed at birth, but most often is diagnosed during the early childhood years in young children (by the age of 3 years) who have had a history of respiratory infections, excessive fat in their stools, and who have poor weight gain. Nearly 8 percent of people with cystic fibrosis are diagnosed at 18 years of age or older because they have experienced only mild symptoms of cystic fibrosis. Because one of cystic fibrosis's major symptoms is respiratory infection, a cystic fibrosis diagnosis sometimes may be confused with other respiratory conditions such as asthma, pneumonia, or chronic bronchitis.
(42) The methods and compositions of the present invention limit, reduce, lessen or eliminate one or more symptoms of cystic fibrosis. Symptoms of cystic fibrosis include but are not limited to: thick, viscous mucus secretions in the lungs; repeated infections: The accumulation of sticky, thick mucus in the lungs creates a favorable environment for infectious microorganisms to inhabit and flourish; stools, pale or clay colored, foul smelling, or stools that float; recurrent pneumonia; chronic cough, possibly with blood streaking; wheezing; bronchitis; chronic sinusitis; asthma; nasal polyps (fleshy growths inside the nose); weight loss, failure to thrive in infants, abdominal swelling; excessive salt in sweat, dehydration; failure of newborn to pass stool; abdominal pain, flatulence; fatigue; enlarged fingertips (clubbing); changes in color and amount of sputum (material coughed up from the lungs)
(43) Conditions such as late onset of puberty, intestinal obstruction, inflammation of the pancreas, cirrhosis (a liver condition), and infertility may also be signs of cystic fibrosis. Cystic fibrosis symptoms does not follow the same pattern in all patients but affects different people in different ways and to varying degrees. However, the basic problem is the samean abnormality in the glands, which produce or secrete sweat and mucus. Sweat cools the body; mucus lubricates the respiratory, digestive, and reproductive systems, and prevents tissues from drying out, protecting them from infection.
(44) People with Cystic fibrosis lose excessive amounts of salt when they sweat. This can upset the balance of minerals in the blood, which may cause abnormal heart rhythms. Going into shock is also a risk.
(45) Mucus in Cystic fibrosis patients is very thick and accumulates in the intestines and lungs. The result is malnutrition, poor growth, frequent respiratory infections, breathing difficulties, and eventually permanent lung damage. Lung disease is the usual cause of death in most patients. (Loss of lung function is a major medical problem in most patients with cystic fibrosis. The average person with cystic fibrosis experiences a gradual worsening of lung function each year due to infection and inflammation. In people with cystic fibrosis, loss of lung function primarily is caused by blockage of air passages with infected mucus. The thick mucus plugs the air passages of the lungs and must be broken up and removed. The repeated lung infections also can cause permanent scarring of the lungs. Many adults with cystic fibrosis also develop symptoms of chronic sinus infections.)
(46) Cystic fibrosis can cause various other medical problems. These symptoms may include sinusitis (inflammation of the nasal sinuses, which are cavities in the skull behind, above, and on both sides of the nose), nasal polyps (fleshy growths inside the nose), clubbing (rounding and enlargement of fingers and toes), pneumothorax (rupture of lung tissue and trapping of air between the lung and the chest wall), hemoptysis (coughing of blood), cor pulmonale (enlargement of the right side of the heart), abdominal pain and discomfort, gassiness (too much gas in the intestine), and rectal prolapse (protrusion of the rectum through the anus). Liver disease, diabetes, inflammation of the pancreas and gallstones also occur in some people with Cystic fibrosis. (The pancreas secretes enzymes into the intestines to aid in the digestion of foods and liquids. However, patients with cystic fibrosis who suffer from pancreatic insufficiency do not secrete enough enzymes to derive proper nutritional benefit from their food. Also, the intestines are lined with thick, sticky mucus that prevents any secreted enzymes from reaching the food to be digested. Due to the inability to properly digest food, a person with cystic fibrosis produces large, greasy stools, which are lighter in color than normal and have a very foul odor. Patients also may suffer from abdominal cramping. To treat this problem, patients are given supplemental pancreatic enzymes that help them digest their food.
(47) The pancreas also secretes insulin to process sugars. Some people with cystic fibrosis develop a specific type of diabetes called Cystic Fibrosis-Related Diabetes. Cystic fibrosis also can result in damage to the liver. In some patients with cystic fibrosis, the bile ducts, which transport bile from the liver to the intestines, become blocked. This condition can result in irreversible liver damage).
(48) Huntington's disease is caused by a faulty gene and is diagnosed by detecting defective gene sequnce.
(49) Most genes in the body are present in two copies, one from the mother and one from the father. The gene (which is called Huntington) that causes Huntington's disease is dominant. This means that if a person inherits one copy of this gene from either parent, they will go on to develop the disease at some point in their life. A person who has one parent with Huntington's disease has a 50% chance of inheriting the faulty gene. This risk is 50% for each child and is not altered by gender or whether brothers and sisters are affected. Only people who have the faulty gene are capable of passing it on to their own children. Occasionally some people can develop the condition even though there is no family history of it. This is usually because previous generations were not diagnosed as a result of early death from other causes, or loss of contact through adoption.
(50) Huntington's disease causes damage to brain cells in the areas of the brain involved in the control of movement, planning and motivation. People usually have symptoms for up to 10 years before they find out they have Huntington's disease. Most people are diagnosed between the ages of 30 and 50, although this can happen much earlier or later. Symptoms are often overlooked, as they are mild and commonly experienced by well people.
(51) The methods and compositions of the present invention limit, reduce, lessen or eliminate one or more symptoms of Huntington's disease. Symptoms of Huntington's disease include but are not limited to: mild tremor, clumsiness, lack of concentration, difficulty remembering things, mood changes, including depression, sometimes, aggressive antisocial behavior.
(52) As the disease continues, the symptoms become progressively worse, and lead to incapacitation. Physical symptoms include chorea (involuntary movements of the limbs, face and body). Chorea may lead to difficulty walking, speaking and swallowing. Choking is a particular hazard, due to reduced ability to control the muscles of the tongue, neck and diaphragm. People often lose weight because they have difficulty eating and burn more calories due to the continuous movement.
(53) Emotional symptoms include depression, not only because of the burden of having a progressive disorder, but also as a direct result of the damage to certain brain cells. People often become frustrated at being unable to work or carry out previously simple tasks. They also seem to behave stubbornly, probably due to a reduced ability to react flexibly and to understand the needs and emotions of others. People with Huntington's may also become more irritable and antisocial than usual, or make inappropriate sexual advances.
(54) Cognitive symptoms include a loss of drive and initiative. People with Huntington's may appear to be lazy or uninterested in life, spending days doing little or neglecting personal hygiene. They may also lose the ability to organise themselves, as planning skills and ability to carry out more than one task at once deteriorate. In later stages, people may get memory loss and be less able to understand speech. The behavioral changes that occur in people with Huntington's disease are often the most distressing for them, their family and their carriers. People with previously full and active lives gradually lose their independence and mobility. At the same time, their personality may become gradually more self-centered and apathetic, straining personal relationships.
(55) A juvenile form of Huntington's disease also exists. Symptoms start before the age of 21 and the condition is usually inherited from the father. Symptoms are similar to those of adult Huntington's, but develop more rapidly and include muscular rigidity and fits.
(56) The methods and compositions of the present invention limit, reduce, lessen or eliminate one or more symptoms of albinism. Albinism includes Hypopigmentation, oculocutaneous albinism and ocular albinism. Symptoms of nalbinism include but are not limited to: absence of pigment from the hair, skin, or iris of eyes; patchy absence of pigment (skin color, patchy); lighter than normal skin and hair, complete albinism; rapid eye movements (nystagmus); strabismus (eyes not tracking properly); photophobia (avoidance of light because of discomfort); decreased visual acuity and functional blindness. The disorders diagnosed by detection of physical symptoms or detection of the underlying genetic defects.
(57) The oligonucleotide complex technique provided herein is a novel approach to modulation of genetic diseases, including but not limited to those diseases mentioned above. The oligonucleotide complex technique provides functional restoration of the mutated genes by deletion/insertion of a segment of RNA (or DNA). The oligonucleotide complex technique method inserts one or more deleted nucleotide(s) into the targeted region of specific RNA (or DNA). The oligonucleotide complex technique facilitates simultaneous correction of more then one mutation with a single set of oligonucleotide complex into a single targeted RNA (or DNA) gene.
(58) Site-specific insertion of the specific RNA (or DNA) genes with the oligonucleotide complex technique may require one or more treatment steps with the oligonucleotide complex. Site-specific alteration of gene with the oligonucleotide complex technique may be performed in one or more targeted genes by using several oligonucleotide complex sets consecutively as required, or even simultaneously. For enhancing targeted gene repair efficiency using the oligonucleotide complex technique this complex is used synergistically with other known or potential therapeutic compounds. The oligonucleotide complex technique is used for targeting one or several harmful genes one by one or simultaneously. The oligonucleotide complex technique is used for extension of translation of targeted genes (by elimination of undesirable stop codons). The oligonucleotide complex technique is used for creation of new genes by insertion of transcription or translation sites in certain regions of the mammalian genome
(59) The oligonucleotide complex technique is used for deletion or insertion of purine or pyrimidine repeats at the ends of different genomic RNA or DNAs. The oligonucleotide complex technique is used for the deletion or diminution of a region of RNA containing a reiteration of excess triplets. The oligonucleotide complex technique provides insertion of UGU in a sufficient fraction of 508 mRNA to induce phenotypic reversion in a tissue culture cell line. The oligonucleotide complex technique according to SPQ data indicates suppression of the chloride anion conductance, or in the other words phenotypic restoration of a mutated 508 gene. The oligonucleotide complex technique according to subcloning data presented herein shows approximately 30 percent insertion of UGU in the site of the 508 mRNA UUU triplet deletion. The oligonucleotide complex technique is used for deletion or insertion of purine or pyrimidine repeats at the ends of specific genomic RNA or DNAs. The oligonucleotide complex technique inserts UGU in the site of the 508 mRNA UUU triplet deletion with one step addition of the oligonucleotide deletion/insertion hybridized RNA/modified RNA duplex. The oligonucleotide complex technique inserts UGU in the site of the 508 mRNA UUU triplet deletion with more than one (two) step treatment. The first step treatment was performed with RNase H (or other endonucleolytic enzyme) deleting single strand RNA. The second step of the treatment was performed by the oligonucleotide deletion/insertion RNA/modified RNA duplex. The oligonucleotide complex technique may require more then one step treatment (i.e. consecutive steps) for the restoration of targeted RNA (DNA) gene(s). RNase H (or other endonucleolytic enzyme) deletes a specific region of RNA, plus the pre-hybridized duplex of oligonucleotides involved in the oligonucleotide complex technique include, but are not limited to, standard oligonucleotides, modified oligonucleotides, standard and modified oligonucleotides with different sequential alteration, standard or modified oligonucleotide in the middle and flanked by different derivatives of oligonucleotides, derivatives of oligonucleotides facilitating different endonucleolytic deletions and/or some other gene insertion/deletion catalysis, oligonucleotides conjugated with different chemical groups (such as, but not limited to, intercalators, groove binders, alkylating reagents, photoactive groups (such as psoraren) and other moieties).
(60) Compositions of oligonucleotide derivatives in the oligonucleotide complex technique include, but are not limited to standard and modified oligonucleotides with different sequential alteration. Oligonucleotide derivatives in the oligonucleotide complex technique may contain small chemical groups at the 5- and/or 3-end, including but not limited to, phosphate, diphosphate, triphosphate, thiophosphate, dithiophosphate, aldehyde, carboxyl, dihydroxyl, hydroxyl, methyl, ethyl, sulfhydryl, sulfate, Boronates, and similar chemical moieties. Oligonucleotide derivatives in the oligonucleotide complex technique may include, but are not limited to PNA; 2-halo, 2-fluoro, 2-alkil, 2-alkoxylalkyl, bridged sugars and similar chemical moieties; methylphosphonate, ethylphosphonate, phosphoramidate, thiophosphate, dithiophosphate, morpholino, Boronophosphate, morpholinophosphate internucleoside linkages and similar chemical moieties; oligonucleotides with derivatized heterocycles, sugars and/or internucleoside linkages and similar chemical moieties. Oligonucleotide derivatives in the oligonucleotide complex technique may include, but are not limited only to derivatized heterocycles, sugars or internucleoside linkages, but also to combination of these moieties mentioned above.
(61) RNase H- (or other endonucleolytic enzyme-) activating single stranded oligonucleotide and pre-hybridized duplex of oligonucleotides involved in the oligonucleotide complex technique method may be four or more (up to three hundred) base long. The deletion/insertion oligonucleotide duplex used in the oligonucleotide complex technique method maybe composed of oligonucleotides of different length. The deletion/insertion oligonucleotide duplex employed in the oligonucleotide complex technique may possess the 5- and/or 3- sticky ends. The length of the sticky ends in the deletion/insertion oligonucleotide duplex employed in the oligonucleotide complex technique may be one base and more (up to 40-60 bases). The double strand part of the deletion/insertion oligonucleotide duplex employed in the oligonucleotide complex technique may be 4-5 base pairs or more (up to 100 base pairs).
(62) Sources of the derivatives of oligonucleotide used in the oligonucleotide complex technique method are chemically or biologically synthesized. The oligonucleotide complex technique is also useful to target with an oligonucleotide sequence specifically the deletion or insertion of a portion of a gene from a pathogenic bacterium, virus, insect, arthropod, parasite, land or marine plant or other living organism; to silence a virulence factor, thereby rendering that organism into a non-pathogenic one. This technique is used for preparation of a vaccine against the pathogen, or a therapeutic treatment by spray or other means of obtaining entry to the pathogen.
(63) The oligonucleotide complex technique is used for the suppression/inactivation of biological pathogens in body fluids either in vitro, in vivo or ex vivo. The oligonucleotide complex technique is used for therapeutic purposes, diagnostic analytical purposes or as a tool for a laboratory research.
(64) Cystic Fibrosis
(65) Cystic Fibrosis (CF) is a lethal disorder caused by mutations in the CFTR gene encoding the CFTR channel [Riordan, et al., J. R., (1989) Science, 245, 1066-1073; Kerem et al., (1989) Science, 245, 1073-1080]; Burke (2003), Eng. J. Med. 349, 969-974]. CFTR, a cAMP-activated anion channel [Anderson et al., (1991) Science, 251, 679-682; Bear et al., (1992) Cell, 68, 809-818], is associated with the dysfunctionality of epithelia in several tissues [Crawford et al., (1991) Proc. Natl. Acad. Sci. USA 88, 9262-9266] including lungs, pancreas, intestine, sweat glands and kidneys. CF is the most common lethal genetic disease of Caucasians, affecting 1 in 2000 individuals. More than 150 mutations have been identified in the CFTR gene [Tsui, (1992) Trends Genet. 8, 391-398], associated with a pleiotropic spectrum of CF phenotypes [Cutting, (1993), J. Bioenerg. Biomembr. 25, 7-10; Strandvik et al., (2001), Genet. Test. 5, 235-242]. New mutations have been found with distinctive impacts on CF populations [Gilfillan et al., (1998), J. Med. Genet. 35, 122-125; Onay et al., (1998), Hum. Genet. 102, 224-230; Visich et al., (2002), Clin. Genet. 61, 207-213]. However, the most frequent CFTR mutation, accounting for almost 75% of all cases of the disease, is a deletion of three bases (TTT), encoding the amino acid phenylalanine in position 508 of the translation sequence, accompanied by C to U replacement immediately 5 to the deletion. This deletion is often accompanied by a mismatch immediately adjacent in the 5 direction to the deletion: in a U in place of a C.
(66) The 508 CFTR is a misfolded but partially functional channel protein [Li et al., (1993) Nature Genet. 3, 311-316; Pasyk et al., (1995) J. Biol. Chem. 270, 12347-12350], unable to translocate perfectly to target plasma membranes [Denning et al., (1992) Nature, 358, 761-764; Cheng at al., (1990), Cell, 63, 827-834]. Several chemical and pharmacological strategies have been attempted, to rescue the CF phenotype at the cellular level, to bring 508 CFTR to the plasma membrane. Partial success has also been achieved by adenoviral vector infection [Boucher et al., (1994), Hum. Gene Ther. 5, 615-639; Teramoto et al., (1998), J. Virol. 72, 8904-8912] and re-insertion of the wild type CFTR gene into a CF genetic background. More recently, a novel repair strategy was used, based on trans-splicing of the 508CFTR pre-mRNA [Liu at al., (2002), Biotechnol. 20, 47-52; Puttaraju et al., (2001), Mol. Ther. 4, 105-114; Mansfield et al., (2000) Gene Ther. 7, 1885-1895]. Gentamycin has also been found to induce a correction of faulty CFTR function in CF, caused by CFTR stop mutations [Bedwell et al., (1997) Nature Med., 3, 1280-1284], rather than by the TTT deletion.
(67) Loss or suppression of disease-associated gene function by antisense oligonucleotide technologies involves specific inhibition of DNA, RNA and protein expression [Zamecnik et al., (1978), Proc. Natl. Acad. Sci. USA 74, 280-284; Stephenson et al., (1978) Proc. Natl. Acad. Sci. USA 75, 285-288]. This is based in good part on complementary hybridization of synthetic oligonucleotides with the natural sequences in either DNA or RNA [Temsamani et al., (1994) Antisense Res. Devel. 4, 279-284]. Triplex-forming oligonucleotides have also been used for the modification of cellular gene function [Felsenfeld et al., (1957) J. Am. Chem. Soc., 79, 2023-2024; Thoung et al., (1993) Angewandte Chemie. Intl. Ed. Eng., 32, 666-690; Agrawal et al., (1990). Proc. Natl. Acad. Sci. USA 87, 1401-1405]. The consequence of such interaction is a competitive blockade of either DNA or RNA synthesis at replication or transcription, respectively and, in the case of exons, at the translational steps in protein synthesis. Upon cell entry, exogenous complementary deoxyoligonucleotides hybridize with a target mRNA, inducing an excision endonucleolytic effect on the mRNA, a so-called ribonuclease H (RNAse H) effect resulting in synergism with hybridization inhibition [Zamecnik et al., (1996) Ed. By Sudhir Agrawal, Humana Press, NJ, 1-11]. Likewise, RNA editing [Simpson et al., (1996) Annu. Rev. Neurosci. 19, 27-52] has been reported in numerous cell systems where nucleotide sequences can also be modified at the RNA level. RNA editing encompasses various mechanisms, including base substitutions and deletions [Simpson et al., (1996) Annu. Rev. Neurosci. 19, 27-52]. RNA duplexes with internal and external guide sequences in some cases are required to drive these reactions.
(68) Double stranded RNA sequences have a role in RNA interference (RNAi) and gene silencing at the transcriptional level [Hannon, (2002) Nature, 418, 244-251]. RNAi mediated gene silencing was discovered in C. elegans [Fire et al., (1998), Nature, 391, 806-811; Montgomery et al., (1998), Proc. Natl. Acad. Sci. USA 95, 15502-15507; Grishok et al., (2000), Science, 287, 2494-2497] and has been observed in numerous cell models and organisms [Hannon, (2002) Nature, 418, 244-251; Hammond et al., (2000), Nature, 404, 293-296; Silva at al., (2002), Trends Mol. Med. 8, 505-508]. Gene silencing results from successive cleavage of long dsRNA, particularly originating from viruses, to oligonucleotide siRNAs by DICER enzymes [Zamore et al., (2000) Cell, 101, 25-33; Bernstein et al., (2001), Nature, 409, 363-366]. After oligonucleotide hybridization of siRNA with mRNA, the cleavage of target mRNA is catalyzed [Hammond et al., (2000), Nature, 404, 293-296; Zamore et al., (2000) Cell, 101, 25-33]. RNAi phenomena have been used for target gene silencing from nematodes and plants to mammals [Hannon, (2002) Nature, 418, 244-251]. Separate from the above is CpG stimulation of host immunomodulatory mechanisms, in both prokaryotic and eukaryotic organisms [Krieg (2003) Nat. Med., 9, 831-835; Kandimalla et al., (2003) Biochemical Society Transactions, 31, 654-658].
(69) The gain of function and/or correction of defective genes present a continuing challenge for gene therapy. Partial restoration of function in the 508 CFTR background has been shown to occur by membrane insertion of 508 CFTR without changes in either phenotype or genotype [Brown et al., (1996) Cell Stress & Chaperones, 1, 117-125; Arispe et al., (1998) J. Biol. Chem. 273, 5727-3574]. This is based on the capacity of 508 CFTR to function even as a misfolded protein [Welsh et al., (1993), Cell, 73, 1251-1254; Ward et al., (1994), J. Biol. Chem. 269, 25710-25718]. Its translocation to a plasma membrane may incompletely restore functionality of the phenotype RNA/DNA oligonucleotide hybrids [Cole-Strauss et al., (1996), Science, 273, 1386-1389; Yoon at al., (1996), Proc. Natl. Acad. Sci. USA 93, 2071-2076; Alexeev et al., (1998), Nature Biotech. 15, 1343-1346; Parekh-Olmedo et al., (2001), Sci. STKE 73, PL1] and single stranded oligonucleotides [Igoucheva et al., (2001) Gene Therapy, 8, 391-399] have been used for the correction of defective genes. Substituted, circular, single stranded RNA/DNA chimeras have been employed to insert base pairs in deficient genomic DNA [Cole-Strauss et al., (1996), Science, 273, 1386-1389; Yoon at al., (1996), Proc. Natl. Acad. Sci. USA 93, 2071-2076]. Nucleotide exchange of target episomic and genomic DNA is shown using chimeric RNA/DNA oligonucleotides. Some attempts at replicating this work, however, showed no nucleotide exchange in the targeted loci by cloning of the PCR products [Zhang et al., (1998) Antisense & Nucleic Acid Drug Developm. 8, 531-536]. Results were viewed by these and other investigators as PCR artifacts created by the RNA/DNA oligonucleotides themselves [Zhang et al., (1998) Antisense & Nucleic Acid Drug Developm. 8, 531-536; Taubes, (2002) Science, 298, 2116-2120]. Transcriptional repair has been used for repair of mRNA. Spliceosome mediated cis-splicing of pre-mRNA is an essential step in gene expression [Jurica et al., (2003), Mol. Cell, 12, 5-14]. Other trans-splicing mechanisms in pre-mRNA molecules have been shown to form functional hybrid mRNA molecules in different mammalian systems [Spector, (1993), Curr. Opin. Cell Biol. 5, 442-447; Harris et al., (1990), Nucleic Acids Res. 18, 3015-3019]. Spliceosome mediated RNA transplicing (SmaRT) technology has also been used to modify 508 CFTR transcripts in human CF airway epithelia [Liu at al., (2002), Biotechnol. 20, 47-52].
(70) An mRNA hybridized to a single stranded synthetic short piece of DNA was used to activate RNase H [Agrawal et al., (1990). Proc. Natl. Acad. Sci. USA 87, 1401-1405], which then specifically hydrolyzed only the hybridized segment of mRNA. RNase H as an ubiquitous enzyme had been previously known [[Agrawal et al., (1990). Proc. Natl. Acad. Sci. USA 87, 1401-1405]]. The present invention defines nucleotide limits of RNase H activity in a precise way. At least a 4-6 nucleotide internally located region in an mRNA, which is hybridized to a phosphorothioate modified (PS) oligodeoxyribonucleotide, is needed for Rnase-mediated excision. If a precise small segment of mRNA, which included the deleted UUU region (the ribosomal substitute for TTT) were synthesized and annealed to the larger chimera, which induced/activated a small deletion in mRNA, an insertion of the somewhat larger total piece excised might restore the phenotypic effect at the mRNA level.
(71) Initially, a modified oligodeoxyribonucleotide with a central segment containing a phosphorothioate (PS) modification was constructed, with flanking segments PS plus 2-O-methyl modifications. This was designed to hybridize in Watson-Crick base complementarity to the region of 508 mRNA where the PS section would be directly opposite the 508 mRNA position, flanked 3- and 5- by an adjacent few nucleotides complementary to the 508 mRNA. In this way the PS segment would activate endogenous RNase H, and cleave those bases opposite the PS complementary oligonucleotide. The 2-O-methyl PS, plus segments on both sides of the RNase H sensitive section would be generally nuclease and RNase H resistant and would serve in this way as a genetic band aid. Without being limited by any particular mechanism, the flanking segments are intended to hold the 5- and 3-segments of 508 mRNA in place, in position for a possible insertion or repair of bases in a second step. For the possible repair step two single complementary strand oligonucleotides were constructed: Cystic Fibrosis 4 (CF4) and Cystic Fibrosis 6 (CF6), as shown in Scheme 1. This combination was annealed to form a duplex. The duplex was added to growing 508 CFTR cell cultures. Patch clamp examination [Reisin et al., (1994) J. Biol. Chem. 269, 20584-20591] showed evidence of phenotypic reversion (
(72) CF4 and CF6 were annealed to form an oligonucleotide duplex (CF4/CF6) (Table 1) and were then added to the 508 cells in tissue culture. There was restoration of the CFTR channel to functional normality, as determined by patch clamping and 6-methoxy-N-(3-sulfopropyl)quinolinium (SPQ) quenching techniques. Under those conditions, restoration of function was found to occur in 8-18 hours (
(73) Under Rose experimental conditions there was complete restoration of CFTR function, whereas non-insertion reversions have been only partial. [Rose D M et al, Eur J Res 2000; 5, 9-12] On replication of the human tissue culture cells and washing out of the oligonucleotide after a few days incubation, the restoration of CFTR function was lost. This strongly indicated a phenotypic but not genotypic (i.e. RNA but not DNA) restoration of functionality of the CFTR channel. Amplification and sequencing technology was used to determine whether trinucleotide insertion into 508 mRNA has been made. Scheme 1 is a schematic diagram of the insertional mechanism.
(74) An oligonucleotide complex (CF4/CF6, respectively 2-O-methyl RNA/unmodified RNA oligonucleotide duplex) was used herein to restore CFTR function by insertion of missing bases in 508CFTR mRNA from a cultured (508) cell line. Cyclic AMP-activated (cAMP) whole cell currents and Cl-transport were detected in CF4/CF6 treated, rather than control 508 cells by the patch clamping and by SPQ fluorescence quenching analysis, respectively. Further, the nucleotide addition in the deleted region of 508 CFTR was determined after amplification by the Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). Insertion of UGU and replacement of U by C immediately 5 to the deletion site in 508 mRNA appear to have taken place, with phenotypic but not genotypic reversion in tissue culture of treated cells.
(75) Genetic Diseases/Disorders
(76) Suitable genetic diseases and sequences of appropriate targets in genes, such as those listed in U.S. Patent Application Publications 20030051270, 20030217377 and 20040014057, each incorporated herein by reference in there entireties, are treated using designed oligonucleotide complexes and the methods provided herein.
(77) Several genetic diseases relate to disorders in the sequences of mutated genes and genes with inborn errors. Other major sources of genetic diseases, shown above, are due to switch on silent genes or presence of viral genes in the mammalian genome.
(78) The cause of a fatal or serious genetic disease may be as small as a single mismatch in base pair (one mismatch, one inserted/deleted base pair in the whole gene sequence) or absence of a partial or whole gene in the genome. Consequently, availability of the highly specific oligonucleotide complex technique for the restoration of the targeted (defected) gene could be a powerful tool to combat currently incurable genetic diseases.
(79) Oligonucleotide complexes and methods for their use for the functional restoration of the mutated genes by deletion/insertion mechanism of the segment of RNA are provided. Site-specific insertion of the genes with the oligonucleotide complex technique (as shown herein as replacement of a cystic fibrosis phenotype in a cultured 508CFTR cell line experiments) can occur with a one or two step oligonucleotide complex treatment. Below are shown schemes for restoration of mutated and inborn error genes (Schemes 2-7), and schemes of switch-on and/or switch-off targeted genes (Schemes 8-10) using an oligonucleotide complex technique.
(80) One step and two step oligonucleotide complex treatment of targeted RNA (or DNA) are shown in the Schemes 3, 5, 7, 9 and 2, 4, 6, 8, 10 respectively.
(81) Scheme 2 shows a site-specific deletion/insertion mechanism at the targeted region of RNA with the two-step oligonucleotide complex technique. The targeted region in this scheme could be one (or a few) mismatched bases or one (or a few) inserted bases in the RNA sequence. On the first step, oligonucleotide for RNase-H activation deletes the target region of RNA, and on the second step insertion of the desirable sequence takes place. The RNase H deleted region could be a few or more bases, depending on the extend of RNase induced deletion, as a result of which the RNA oligonucleotide from the insertion duplex might be spliced into the deleted region, or alternatively serve as a triplex backbone sequence for a one-by-one insertion mechanism.
(82) Scheme 3 shows a site-specific deletion/insertion mechanism of the targeted region of RNA with the one step oligonucleotide complex technique. There are different possibilities of one step restoration: triplex backbone sequence formation by a one-by-one insertion mechanism, with specific docking and cleavage of selective nucleotide sequences, which are hybridized to an RNA (or DNA) sequence. The cleavage might by induced by either a new enzyme or the Dicer enzyme, and as a result, production of RNA (or DNA) with a corrected (inserted) region.
(83) Scheme 4 shows site-specific insertion mechanism of the deleted region of RNA with the two-step oligonucleotide complex technique. Schemes 6, 8 and 10 show a site-specific insertion/deletion mechanism at the targeted regions of RNA (or DNA) with the two-step oligonucleotide complex technique. RNA (such as Huntington's disease) in Scheme 6 contains reiteration of excess triplets, and accordingly the purpose of the deletion step is to cut out the excess repeats. RNA shown in Scheme 8 is a model of active (harmful) RNAs and the goal of the insertion is to switch off these RNAs. The purpose of the insertion shown in Scheme 10 (opposite of Scheme 8) is to wake up a silent gene or to create new one. The insertion shown in Schemes 2, 4, 6, 8 and 10 could proceed with similar mechanisms, but goals achieved for each of the approach would be different.
(84) The purpose of the approaches shown in Schemes 5, 7 and 9 is identical to the Schemes 4, 6 and 8. The deletion/insertion mechanism of the targeted region of RNA, shown on Schemes 5, 7 and 9, proceeds with the one step oligonucleotide complex technique, as described for Scheme 3.
(85) Schemes 11 and 12 show schemes for repair of an inactive tyrosinase gene by one and two step oligonucleotide complex approaches, respectively. The schemes contain one of the possible versions of the oligonucleotide complex which may be used for the replacement of mutated C with G in inactive tyrosinase mRNA. This type of alteration can achieve a phenotypic restoration of the mutated tyrosinase gene.
(86) Schemes 13 and 14 show schemes for repair of Cystic Fibrosis 508 mRNA by one and two step oligonucleotide complex treatment approach. As described herein, mutated 508 mRNA contains two defects: first, absence of a UUU triplet at 508 region and change of U to a C immediately 5 to the same 508 position. Because of the close location of both mutations one set of oligonucleotide complex was sufficient for repair of both defects.
(87) In some cases the targeted gene might contain more then one mismatch or inserted (deleted) region, which may be distantly located. For restoration of such genes it would be appropriate to use two or more oligonucleotide complex sets consecutively or simultaneously.
(88) For enhancing targeted gene repair efficiency of oligonucleotide complex, the complex could be used synergistically with other known or potential therapeutic compounds.
(89) This application claims priority to U.S. Ser. No. 60/557,732, filed on Mar. 29, 2004 and U.S. Ser. No. 60/560,026, filed on Apr. 7, 2004, each of which is incorporated herein by reference in their entireties. Further, the contents of all references cited are incorporated in their entireties herein by reference. Practice of the invention will be more fully understood from the following examples, which are presented herein for illustration only and should not be considered as limiting the invention in any way.
EXAMPLES
(90) The examples provided herein demonstrate feasibility of using an oligonucleotide complex technique as a therapeutic and/or prophylactic agent for the phenotypic and restoration of function of a mutated gene. The following Material and Methods were used throughout the Examples.
(91) Oligonucleotide Synthesis
(92) DNA and RNA oligonucleotides (Table 1) were synthesized on a 394 DNA/RNA synthesizer (Applied Biosystems) with phosphoramidite chemistry and standard phosphoramidite monomers from Glen Research. For the introduction of 3 and 5 phosphate groups on the CF4 oligonucleotide (Table 1), 5- and 3-phosphorylation reagents were used accordingly (Glen Research). Phosphorothioate bonds were introduced by sulfurization with Beaucage thiolating reagent [Padmapriya et al., (1994) Antisense Res. Dev. 4, 185-199]. 2-O-methyl modifications, oligoribonucleotides and phosphorothioate oligonucleotides were synthesized, and HPLC purified as described [Metelev et al., (1994) Bioorg. Med. Chem. Lett. 4, 2929-2934; Agrawal et al., (1998) Antisense Nucleic Acid Drug Dev. 8, 135-139].
(93) Annealing of CF4/CF6 Oligonucleotide Duplex
(94) Stock solutions of CF4 (1 mM) and CF6 (1 mM) were prepared by dissolving compounds in high ionic strength buffer (0.2 M NaCl, 20 mM MgCl.sub.2, 20 mM Tris-HCl, pH 7.0). Duplex formation was prepared with 1:1 (v:v) mixture of compounds, by heating to 75-80 C., and cooling down gradually to room temperature. All duplexes and compounds were sterilized by passage through 0.45 m cellulose acetate centrifuge filters (Costar).
(95) Cell Culture and Incubation
(96) Mouse mammary carcinoma cells (c127i) transfected with human epithelial CFTR wild type (WT1) or 508 CFTR cells [Cantiello et al., (1994), J. Biol. Chem. 269, 11224-11232; Dechecchi et al., (1993) J. Biol. Chem. 268, 11321-11325] were used for these studies. The transfected c127i cells are high level producers of 508 CFTR mRNA. Cells were grown and maintained in Dulbecco's medium (DMEM), supplemented with 10% fetal bovine serum and 1% L-glutamine, as previously reported [Verkman, (1990) Am. J. Physiol. 259, C375-C388].
(97) Electrophysiology
(98) Whole-cell and excised inside-out patches were obtained to assess cAMP-PKA dependent anion currents in treated 508 cells. Currents and command voltages were obtained and driven. respectively, with a Dagan 3900 amplifier using a 1 gigaohm headstage. The excised patch-clamp configuration was carried out as previously described [Reisin et al., (1994) J. Biol. Chem. 269, 20584-20591]. Single channel data were obtained between 100 mV in symmetrical Cl.sup.. Data were further analyzed as previously described [Reisin et al., (1994) J. Biol. Chem. 269, 20584-20591]. The pipette and bathing solution contained, in mmol/L, either: NaCl 140, MgCl.sub.2 1.0, KCl 5, and N-2-hydroxyethylpiperazine N-2-ethanesulfonic acid (HEPES) 10, at pH 7.4, or MgCl.sub.2 70, HEPES 10, pH 7.4. The bathing solution also contained 1.0 mmol/L CaCl.sub.2. Whenever indicated, the patch-pipette was filled up to at least one third of its height with either MgATP or TrisATP (100 mmol/L, pH 7.4 adjusted with N-methyl-glucamine) as previously reported [Reisin et al., (1994) J. Biol. Chem. 269, 20584-20591]. Experiments were conducted at room temperature. The cAMP stimulatory mixture contained 8-Br-cAMP, isobutyl-methyl-xanthine (IBMX) and forskolin. Final concentrations were 500 mol/L, 200 mol/L, and 10 mol/L, respectively. The catalytic subunit of PKA was used at a final concentration of 20 g/ml. The Cl.sup. channel blocker, diphenylamine-2-carboxylate (DPC) was kept in a 100-fold stock solution (20 mmol/L) in 50% water/ethanol. DPC was used at a final concentration of 500 M.
(99) SPQ Fluorescence
(100) Cyclic-AMP-stimulated CF transport was also followed by fluorescence changes of cells loaded with the Cl.sup. sensitive dye 6-methoxy-N-(3-sulfopropyl)quinolinium (SPQ) [Verkman, (1990) Am. J. Physiol. 259, C375-C388]. Briefly, cells were grown to partial confluence on glass coverslips. SPQ cell loading was conducted by a15-min incubation in a Cl.sup. free diluted salt solution containing SPQ (5 mM). The saline solution contained 135 mM Natgluconate, 2.0 mM KH.sub.2PO.sub.4, 1.0 mM MgSO.sub.4, 1.0 mM Ca.sup.2+-gluconate, and 10 mM HEPES (pH 7.4). In some experiments, gluconate was replaced by either isethionate or aspartate with similar results. SPQ fluorescence was determined under an oil immersion X20 objective in a Nikon E-800 fluorescence microscope (Tokyo, Japan), with an UV filter (96101C UV-2E/C). Images were captured with a Hamamatsu (C4742-95) digital camera and stored as TIFF files in a Macintosh computer with the IPLab Spectrum software (Signal Analysis Corp.). Pictures were analyzed digitally with the NIH Image 1.62b7 software. SPQ cytoplasmic fluorescence values were normalized between intra-nuclear (considered as zero quenching, i.e. low Cl.sup.), and extracellular background. Data were expressed as percent fluorescence with respect to time zero, the time when cells were placed in an isotonic saline solution. The solution contained 135 mM NaCl, 2.0 mM KH.sub.2PO.sub.4, 1.0 mM MgSO.sub.4, 1.0 mM Ca.sup.2-gluconate, 10 mM HEPES (pH 7.4), with or without the cAMP stimulatory combination mixture.
(101) Primers and RT-PCR of 508CFTR mRNA
(102) Total RNA isolated by Trizol reagent according to the manufacturer's protocol (Invitrogen, CA) from either WT1 or 508 cells treated with or without CF6/CF4 annealed duplex oligonucleotides (final concentration of duplex in reaction mixture 10 M) was used to perform the RT-PCR assay [Kleppe et al., (1971) J. Mol. Biol. 56, 341-361] in two steps by using a ThermoScript RT-PCR system (GIBCO, BRL). Several sets of primers were used (see CF Table 1). In the first step, total RNA (2 g) was incubated for 60 min at 55 C. with amplification refractory mutation system (ARMS) [Ferric et al., (1992) Am. J. Hum. Genet. 51, 251-262] reverse mutant (M1) and normal (N1) primers (0.5 g each) separately for the first-strand synthesis. In a second step, after heating at 94 C. for 5 min, 35 cycles of PCR were carried out on the samples. PCR cycles were performed first by denaturation at 94 C. for 2 min, annealing at 62 C. for 1 min, and extension at 72 C. for 2 min, followed by a final extension for 10 min at 72 C. Two ARMS reverse primers (N1 and M1) [Ferric et al., (1992) Am. J. Hum. Genet. 51, 251-262], and a forward (F1) primer were used (Table 1). Similarly RT-PCR was performed with ARMS PS reverse primer (SCFR) and PS forward primer (SNF1, Table 1). RT-PCR products were separated in 3% agarose gel and subjected to automated DNA sequence analysis.
(103) Similarly, RT-PCR was conducted using allele specific primers (Scheme 1B, Table 1) as follows. In the first step, total RNA (2 g) was incubated for 60 min at 55 C. with reverse (CFR) primer (0.5 g each) for the first-strand synthesis. In a second step, samples were heated at 94 C. for 1 min. PCR was performed for thirty cycles at 60 C. including denaturation at 94 C. (45 sec), annealing at 60 C. (45 sec), and extension at 72 C. for 1 min. This procedure was ended with a seven-minute final extension at 72 C. Two forward primers (CFW and CFM) and one reverse primer (CFR) were used for allele specific RT-PCR (Table 1). The RT-PCR assay was performed with the MasterAmp RT-PCR system (Epicentre, WI). In this procedure, combined reverse transcription and PCR were performed in the presence of forward normal (NF1) and mutant (MF2) and reverse (CFR) primers (0.5 g each) separately. First, samples were incubated for 20 min at 60 C. PCR was performed for 40 cycles at 94 C., denaturation for 30 sec, annealing at 62 C. for 30 sec and 72 C. extension for 1 min. The reaction ended by a final extension for 6 min at 72 C. Two forward primers (NF1 and MF2) and a reverse primer (CFR) were used for this procedure. RT-PCR products were separated in a 3% agarose gel and were then subjected to automated DNA sequence analysis. ThermoScript RT-PCR products obtained by ARMS primers were subcloned for further separation and purification of possible heterogeneity of oligomers so obtained in pCR-Blunt vector, according to the manufacturer's protocol (Invitrogen, CA). The resulting clones were subjected to automated DNA sequence analysis using a T7 promoter primer.
Example 1
Restoration of 508CFTR Phenotype
(104) To restore the normal (wild type) phenotype in cells expressing 508CFTR, modified oligonucleotides were constructed and their effect on ion transport was assessed in 508 cells treated with these constructs. In a first step, a modified oligodeoxyribonucleotide was synthesized, containing phosphorothioate (PS) and PS plus 2-O-methyl modifications for the central and flanking segments, respectively. This oligonucleotide was designed to hybridize in Watson-Crick base complementarity to the region of 508 mRNA where the PS section would be directly opposite the 508 mRNA position, flanked 3- and 5- by adjacent nucleotides complementary to the 508 mRNA. Accordingly, the PS segment would activate endogenous RNase H, and cleave those bases opposite the PS complementary oligonucleotide (10 M). The insertion of bases then occurs in a second step.
(105) For the second or insertion step, two complementary single strand oligonucleotides, CF4 and CF6 (Table 1, Scheme 1A) were constructed. The annealed CF4/CF6 duplex (10 M final concentration) was added to the 508 CFTR cells after 2 hours incubation, then washout, in the deletion step. Next, following overnight or up to 72 hour incubation in the second (insertion) step, patch clamp examination was conducted on the treated cells.
(106) Whole cell currents of two step treated 508 cells (
(107) When the CF4/CF6 annealed duplex was, however, added to the tissue culture cells without performing a first oligonucleotide treatment step as described above, phenotypic reversion was likewise found, as determined by the patch clamp technique. Thus, a one step phenotypic reversion technique was chosen as a simpler model for the sequencing studies described below.
(108) Surprisingly, CF4/CF6 cells sporadically showed large, DPC inhibitable whole-cell currents in the absence of cAMP simulation (data not shown). Both WT1 and CF4/CF6 treated 508 cells responded with a comparably similar change in SPQ fluorescence in response to cAMP stimulation (
Example 2
Sequencing Analysis of PCR Products
(109) In order to determine the extent of restored phenotype in the CF4/CF6 treated 508 cells, total RNA was isolated and CFTR specific primers were used to amplify the predicted region. CFTR wild type specific primers efficiently amplified single bands of the expected size in the CF4/CF6 oligonucleotide treated cells. The sequence region after this treatment did not show changes in the PCR amplified oligonucleotides when wild type primers were used. Because the number of 508 mRNA copies that are potentially repaired may be low, allele specific primers for either wild type or mutated CFTR were used next (CFFW and CFFM, Table 1).
(110) Allele specific primers detected mRNA from serial dilutions of wild and 508 total RNA by means of a shift of the amplified band (
(111) To analyze this observation further, the PCR products were subcloned in pCR-Blunt vector and subjected to DNA sequence analysis. The fraction of control RNAs isolated from untreated 508 cells showed no oligonucleotide insertion. However, mRNA isolated from CF4/CF6 treated 508 cells showed 20-30% UGU insertion, based on analysis of the percentage of subclones showing TGT insertion into the RT-PCR generated 508 DNA. This percentage of insertion is apparently sufficient for phenotypic reversion in the tissue culture system. None of the subcloned untreated 508 cells displayed false positives (three-base insertion) in the region flanking the initial deletion (
(112) Without being limited by any particular mechanism, the hypothesis was tested as to whether base insertion in the treated 508 cells has occurred at the RNA level. It was possible that the repair mechanism was carried out instead of/or in addition to, the DNA level, by way of reverse transcription extending back to the genome. This was tested by RT-PCR analysis of DNA from subcloned 508 cells originally treated with CF4/CF6. No evidence was obtained that the restored phenotype was carried back to the inheritable DNA genome level was obtained. Western blot analysis was conducted with antibodies targeted to epitopes upstream and downstream of the 508 deletion, respectively. The data indicate that the full-length protein was made in the presence of the oligonucleotides.
(113) Further, the data rule out that partially degraded protein was being translated after treatment with the oligonucleotides because of stop codon missing signals in the treated mRNA [Bedwell et al., (1997) Nature Med., 3, 1280-1284]. Both antibodies showed the same level of protein, without shorter, truncated or degraded peptides. Thus, treatment with CF4/CF6 does not act as an inhibitor of protein synthesis.
Example 3
Mechanism of Insertion
(114) As an initial step, restoration was sought of the most common CF phenotype by antisense oligodeoxynucleotide hybridization to the region immediately adjacent to the trinucleotide deletion, on both sides of the 508CFTR mRNA. The double-stranded synthetic 2-O-methyl-RNA/unmodified-RNA oligonucleotide chimera (CF4/CF6) was constructed and used to anneal, selectively cut, and repair the missing region (Scheme 1B). This duplex, as shown, contains a single stranded 2-O-methyl-substituted 33-mer oligoribonucleotide (CF4) hybridized to an unmodified 11-mer oligoribonucleotide with 5 and 3 monophosphate termini (CF6). The role of the 5- and 3-phosphate termini of CF6, if any, remains to be determined. The CF4/CF6 chimera may theoretically hybridize with the mRNA bearing the deletion (Scheme 1B), followed by an mRNA cleavage step, as a result of which CF6 might theoretically be spliced into this region or alternatively, serve as a triplex backbone sequence for a one-by-one insertion mechanism.
(115) Without being limited by any particular mechanism, the mismatch created by using the oligonucleotides provided herein and found immediately proximal in the 5-direction to the 508 mRNA UUU deletion may induce an as yet unknown deletion mechanism. For one, the deletion step may be induced by either a new enzyme or by the Dicer enzyme. Another possibility is that RNAse H, in the presence of a triplex, may induce the deletion. There may conceivably be a deletion in RNA analogous to the MutS DNA mismatch mechanism [Wang et al., (2003) Proc. Natl. Acad. Sci. USA 100, 14822-14827]. The process by which CF4/CF6 restores the phenotype is consistent with specific docking and cleavage of selective nucleotide sequences hybridized to an mRNA sequence. A -TTT- insertion into the PCR amplified deoxyoligonucleotide would be expected, if the -UUU- from CF6 had been inserted into the 508 mRNA. However, TGT (UGU in the 508 mRNA) insertion was consistently observed in clones obtained by ARMS primers amplification RT-PCR products (Scheme 1B and
(116) Initial sequencing of RT-PCR oligodeoxynucleotides obtained with ARMS primers specific for the CFTR wild type sequence (N1, Table 1) revealed the presence of a mixture of residues rich in G's in the 508 site. Subcloning of this oligodeoxynucleotide band resulted in the finding that some but not all of the sequenced cDNA material expressed a TGT at this 508 site. Since it was mRNA that was subjected to RT-PCR amplification, the corresponding bases in the 508 region were actually UGU. The G residue in the UGU could be accounted for by a restoration mechanism with other than Watson-Crick complementarity in insertion [Yang et al., (2003) Proc. Natl. Acad. Sci. USA 100, 15376-15380]. The 3 hybridization initial steps enabled by the ARMS primers may also be flawed by exonucleotide-induced primer degradation in the reverse transcriptase step of the RT-PCR amplification procedure [Skerra, (1992) Nucleic Acid Res. 20, 3551-3554; Smith at al., (2003) Proc. Natl. Acad. Sci. USA 100, 15440-15445]. Other possibilities of error introduction [Kobayashi et al., (1990) Am. J. Hum. Genet. 47, 611-615], may explain the apparently artifactual deletions shown in Scheme 1B which accompany insertions. This consideration was partially confirmed by wild type ARMS primer-RT-PCR product amplification of the sequence in WT1 cells, which only carries wild type CFTR. In this reaction, the expected -TTT- was found by sequence analysis of the wild type RT-PCR material, in contrast to the TGT (actually UGU in mRNA) when the repaired 508 mRNA was sequenced.
(117) For further clarification of the above results, new sets of primers were constructed with an initial phosphorothioate substituted nucleotide in the 3 end, followed by several (PO) standard nucleotides. This improved primer selectively amplified CF4/CF6 treated, but not control (untreated) RT-PCR product in 508 cells. The ARMS forward PS primer (SNF1) inserts UGU without a concomitant new deletion (Scheme 1B, Table 1), thus presenting the best case for phenotypic reversion to wild type. Just 5 to the UUU in the wild type CFTR is a C residue, while in the mutant 508 CFTR this residue is a U. This may conceivably result in replacement failure 5 to the inserted UGU using the ARMS reverse primer (N1). The purpose in using CF4/CF6 complex, which has a G residue rather than U proximal to the 5 end of the 508 deletion, was to make this residue complementary to that in the wild type sequence rather than in the deleted 508 sequence. Both AUC and AUU code for isoleucine. This base mismatch for the 508 mRNA (CF Scheme 1) may however induce a single strand break, analogous to that found for single DNA mismatches as mentioned above [Wang et al., (2003) Proc. Natl. Acad. Sci. USA 100, 14822-14827], necessary for a subsequent repair mechanism to be initiated. This eliminates the possibility that the change of C to a U, immediately 5 to the TTT in the same position in the 508 gene may contribute, in addition to the 508 TTT deletion, to the phenotypic change in CFTR.
(118) DNA polymerase has a high degree of Watson-Crick fidelity in synthesizing complementary strands. Reverse transcriptase, which starts at the 3-end of the PCR amplification, however, has a lower level of this specific type of fidelity. This property of reverse transcriptase may be a possible explanation for the UGU (the equivalent of TGT) found in the amplified, restored 508 mRNA. In relation to phenotypic restoration, benign mutations of the TTT present in the wild type gene do exist. TGT is one of these, coding for cysteine, which appears to be an acceptable substitute for phenylalanine in the 508 region [Kobayashi et al., (1990) Am. J. Hum. Genet. 47, 611-615]. The 2-O-methyl group, plus the 5-methyl of thymidine, which uridine does not have, may also alter the tertiary structure of the CF4 chimera. Such factors may influence the nucleophilicity, electrophilicity, and polarizability of the bases, which make up the mRNA-CF4/CF6 triple-stranded structure. Tinoco and colleagues have described numerous double stranded DNA/RNA base complementarities which conformational and other experimental molecular conditions may cause to favor over the standard Watson-Crick AT and GC ones [Burkard at al., (1999) In The RNA World. editors. Cold Spring Harbor Lab. Press, New York. 675-680]. The highly sensitive nanosphere/gold procedure of Letsinger and colleagues [Taton et al., (2000) Science, 289, 1757-1759; Letsinger at al., (2000) Bioconj. Chem. 1, 289-291] may in the future be applicable as an alternative to the PCR technique, avoiding possible artifacts introduced by PCR amplification, or else may be used following subcloning.
(119) The data herein indicate that specific base insertion in 508 mRNA has been made. Certain PCR-introduced artifacts have been avoided by phosphorothioate modification of the 3-terminal residues of ARMS specific primers. Under our best conditions thus far, insertion of UGU has taken place in a sufficient fraction of 508 mRNA to induce phenotypic but not genotypic reversion in a tissue culture cell line. The subcloning data showed 20-30 percent insertion of UGU in the site of the 508 mRNA UUU triplet deletion.
Example 4
Regulation of Huntingtin Protein Gene and Oculocutaneous Albinism Aim-1 Gene
(120) The methods of the instant invention have also been applied to the genetic disorders Huntington's disease and Albinism. Specifically, the gene deletion/insertion mechanism has been applied to the Huntingtin protein gene [Cell 72: 971-983, 1993] and the Oculocutaneous Albinism Aim-1 gene [J Biol Chem. 2002 Jan. 4; 277(1):402-6].
(121) The gene deletion/insertion for the Huntingtin gene inhibits translation of Huntingtin protein, which synthesizes too many consecutive glutamine residues. Oligonucleotide compounds have been prepared for this inhibitory purpose (Table 2). Deletion of two codons of mRNA (+10+15 from translation site) and insertion stop codons (UAA) can inhibit translation of Huntingtin protein. Table 2 shows the HT3 and HT4/HT6 oligonucleotides and Scheme 15 shows the insertion into the gene for Huntingtin protein with HT3 followed by HT4/HT6 duplex oligonucleotides. Scheme 15 can presumably be carried out in a one step process using the HT4/HT6 oligonucleotide complex.
(122) Absence of 7 bases in Aim-1 gene is the cause of Oculocutaneous albinism. The gene deletion/insertion mechanism can be utilized for the Aim-1 gene as shown in Scheme 16. Oligonucleotide compounds have been prepared for this purpose (Table 2). Table 2 shows the Alb3 and Alb4/Alb6 oligonucleotides and Scheme 16 shows the insertion into the Aim-1 gene with Alb3 followed by Alb4/Alb6 duplex oligonucleotides. Scheme 16 can presumably be carried out in a one step process using the Alb4/Alb6 oligonucleotide complex.
(123) TABLE-US-00001 TABLE1 Sequencesofoligonucleotidesused(5 > 3) (SEQIDNO:1) CF4 aucauaggaaacaccaaagaugauauuuucuuu (SEQIDNO:2) CF6 pCAUCUUUGGUGp (SEQIDNO:3) F1 GGGAGAACTGGAGCCTTCA (SEQIDNO:4) N1 GTATCTATATTCATCATAGGAAACACCACA (SEQIDNO:5) M1 GTATCTATATTCATCATAGGAAACACCATT (SEQIDNO:6) NF1 GCCTGGCACCATTAAAGAAAATATCATCTT (SEQIDNO:7) MF2 GCCTGGCACCATTAAAGAAAATATCATTGG (SEQIDNO:8) CFR GTTGGCATGCTTTGATGACGCTTC (SEQIDNO:9) CFFW GGCACCATTAAAGAAAATATCATCTT (SEQIDNO:10) CFFM GGCACCATTAAAGAAAATATCATTGG (SEQIDNO:11) SCFR
(124) Primers and constructs used to repair CFTR mRNA. Lower case letter are a nucleotide sequence in CF4 corresponding to bases of 2-O-methylribosyl oligonucleotides, with internucleoside phosphate bonds. Upper case letter are a nucleotide sequence in CF6 corresponds to natural RNA sequences and small case p corresponds to the terminal phosphate groups. Bold type corresponds to the natural DNA sequences. Shaded region in SCFR, SNF1 and SMF2 corresponds to internucleoside phosphorothioate bonds.
(125) TABLE-US-00002 TABLE2 Sequencesofoligonucleotidesused(5 > 3) (SEQIDNO:14) HT3
(126) Primers and constructs used to repair Huntingtin protein gene and the Oculocutaneous Albinism Aim-1 gene
OTHER EMBODIMENTS
(127) Although particular embodiments have been disclosed herein in detail, this has been done by way of example for purposes of illustration only, and is not intended to be limiting with respect to the scope of the appended claims, which follow. In particular, it is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. Other aspects, advantages, and modifications are considered to be within the scope of the following claims. The claims presented are representative of the inventions disclosed herein. Other, unclaimed inventions are also contemplated. Applicants reserve the right to pursue such inventions in later claims.