LACTIC BACTERIUM FOR TEXTURIZING FOOD PRODUCTS SELECTED ON THE BASIS OF PHAGE RESISTANCE

Abstract

The present invention relates to a bacterial cell with texturizing property, starter cultures comprising the cell, and dairy products fermented with the starter culture.

Claims

1.-48. (canceled)

49. A method for manufacturing a lactic acid bacterium (LAB) having a mutation in the 10 region of a galactokinase (GalK) gene, comprising: producing, from a mother LAB strain, a mutant LAB strain having a mutation in the 10 region of the GalK gene, and then selecting the mutant LAB strain, wherein the mutant LAB strain (i) exhibits enhanced galactose-degrading activity during milk fermentation as compared the mother LAB strain and (ii) produces milk that has a higher viscosity than milk produced with the mother LAB strain under comparable conditions.

50. The method of claim 49, wherein the mother LAB strain has a GalK gene with the nucleotide sequence TACGAT (SEQ ID NO: 7) in the 10 region.

51. The method of claim 50, wherein the method results in the replacement of one or both of C and G in the TACGAT sequence of the mother LAB strain with a nucleotide independently selected from A and T.

52. The method of claim 49, wherein the mutant LAB strain has a GalK gene with a nucleotide sequence selected from TATGAT (SEQ ID NO:8), TATTAT (SEQ ID NO:9), and TACTAT (SEQ ID NO:10) in the 10 region.

53. The method of claim 49, wherein the mutant LAB strain is a Streptococcus thermophilus strain.

54. The method of claim 49, wherein the mutant LAB strain is produced by a method comprising one or more of genetic engineering, radiation treatment, and chemical treatment.

55. A LAB which is obtained by the method of claim 49.

56. A mutated lactic acid bacterium (LAB) having a galactokinase (GalK) gene with a nucleotide sequence selected from TATGAT (SEQ ID NO:8), TATTAT (SEQ ID NO:9), and TACTAT (SEQ ID NO:10) in the 10 region.

57. The mutated LAB of claim 56, wherein the LAB is a Streptococcus thermophilus bacterium.

58. The mutated LAB of claim 57, wherein the Streptococcus thermophilus bacterium is selected from CHCC11379 (DSM 22884), CHCC11342 (DSM 22932), CHCC11976 (DSM22934), and functionally equivalent mutants of any of these.

59. A composition comprising the LAB of claim 56.

60. The composition of claim 59, wherein the composition further comprises one or more additional LAB strains selected from Lactobacillus bulgaricus strains, Lactobacillus johnsonii strains, and Lactobacillus fermentum strains.

61. The composition of claim 60, wherein the additional LAB strain produces a polysaccharide and/or a fructosyl transferase enzyme.

62. The composition of claim 60, wherein the composition comprises at least 10.sup.10 cell forming units (CFU) of the additional LAB strain and at least 10.sup.10 CFU of the mutated LAB.

63. A dairy product produced by a method comprising: adding the mutated LAB strain of claim 56 to a milk substrate, and then fermenting the milk substrate.

64. A dairy product comprising the mutated LAB of claim 56.

65. The dairy product of claim 64, wherein the dairy product is selected from yoghurt, milk, and cheese.

66. The dairy product of claim 64, wherein the dairy product is selected from a stirred-type product, a set-type product, and a drinkable product.

67. The dairy product of claim 64, wherein the dairy product further comprises one or more ingredients selected from a fruit concentrate, a syrup, a probiotic bacterial culture, a coloring agent, a thickening agent, a flavoring agent, and a preserving agent.

68. The dairy product of claim 64, wherein the dairy product has a viscosity of more than 100 Pa, measured as shear stress at 300 s.sup.1.

69. A dairy product produced by a method that comprises: fermenting a milk or dairy substrate with (i) a Streptococcus thermophilus bacterium comprising a galactokinase (GalK) gene having a 10 region having a nucleotide sequence selected from the group consisting of TATGAT (SEQ ID NO:8), TATTAT (SEQ ID NO:9) and TACTAT (SEQ ID NO:10) and (ii) a Lactobacillus delbrueckii ssp. bulgaricus bacterium.

Description

LEGENDS TO THE DRAWING

[0114] FIG. 1 depicts the shear stress of the galactose positive strain CHCC11342 and the galactose positive phage resistant mutant CHCC11977 measured with the StressTech rheometer. Shear stress was measured in coagulated milk after over/night growth in milk at 37 C.

[0115] FIG. 2 depicts the shear stress of phage resistant mutants of CHCC10019 measured with StressTech rheometer. The shear stress was measured in coagulated milk after over/night growth in milk at 37 C.

[0116] FIG. 3 depicts the gel stiffness of CHCC12339, phage resistant mutant of CHCC9204, measured with StressTech rheometer. The gel stiffness was measured in coagulated milk after over/night growth in milk at 37 C.,

[0117] FIG. 4 depicts the shear stress of CHCC13140, phage resistant mutant of CHCC5086, measured with StressTech rheometer. The shear stress was measured in coagulated milk after over/night growth in milk at 37 C.,

EXPERIMENTAL

Example 1

Development of Phage Resistant Streptococcus thermophilus Strains With Improved Texture Properties

[0118] Development of CHCC11977

[0119] The mother strain CHCC11342 was obtained as described in example 5. The strain is a mutant of CHCC6008 and considered to be a galactose fermenting S. thermophilus strain.

[0120] The strain CHCC11977 was isolated on M17 agar plate after plating 0.1 ml of an M17 over night culture of CHCC11342 together with 0.1 ml of phage CHPC1152 containing 10E09 (10exp9) phage particles per ml and incubation for two days at 37 C. One mutant, called CHCC11977, was three times colony purified and retested in plaque test on M17 agar plates at 37 C., using phage CHPC1152 where phage resistance was confirmed (no single plaques observed).

[0121] The mutant strain was then also tested in M17 broth at 37 C. in the presence of phage CHPC1152. CHCC11977 remained its phage resistance also in liquid culture, whereas CHCC11342, as expected, was attacked by CHPC1152.

[0122] CHCC11977 was also tested in milk at different temperatures (without the addition of infecting phage) showing an acidification activity comparable to the mother strain CHCC11342.

[0123] Analysis of CHCC11342 Texture in Fermented Milk

[0124] The day after incubation, the fermented milk was brought to 13 C. and stirred gently by means of a stick fitted with a bored disc until homogeneity of the sample. The rheological properties of the sample were assessed on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measuring system.

[0125] The viscometry test was made with shear rates varying from 0.27 to 300 l/s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were recorded.

[0126] Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s1 was chosen.

[0127] The rheometer results showed that CHCC11342 had a shear stress value of 73.0 Pa compared to CHCC6008 with a shear stress value of 68.0 Pa, see FIG. 1.

[0128] Analysis of CHCC11977 Texture in Fermented Milk

[0129] Fermented milk was obtained, and the texture related properties were analyzed, as described above for the gal-positive phage resistant mutant.

[0130] The rheometer results showed that CHCC11977 had a shear stress value which was furthermore improved by 10% compared to CHCC11342 (shear stress value 80.0 Pa for CHCC11977 compared with 73.0 Pa for mother strain CHCC11342, see FIG. 1).

[0131] Furthermore, the gel stiffness (G*) was increased by 20% for the phage resistant mutant CHCC11977 which showed a value of 126.0 Pa compared to CHCC11342 (gel stiffness 104.0 Pa). With this it was possible to improve the important rheology parameters shear stress and gel stiffness significantly by isolating a phage resistant mutant from a galactose positive mother strain.

[0132] Sequencing of the galK Promoter Region from CHCC11342

[0133] To reveal the type of mutation for the galactose positive mutant CHCC11342 the beginning of the galK gene (coding for the galactokinase from S. thermophilus) was sequenced.

[0134] For CHCC11342 a mutation in the region of the galK promoter was identified (see sequences below). The mutation occurred three nucleotides downstream of the 10-promoter box of the galK gene leading to a C to A nucleotide shift.

TABLE-US-00001 SEQIDNo:1 CHCC11342 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTT AGTATAAACAAAAAGAATAAGTGAGATACATC SEQIDNo:2 CHCC4003 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQIDNo:3 AY704368 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQIDNo:4 Consensus AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC 3510RBS

[0135] Promoter region of the galK gene from CHCC11342. The point mutation within the CHCC11342 galk promoter region is indicated with grey color code. The published galK sequence from S. thermophilus ST111 (Genbank accession no. AY704368) is indicated for comparison. 35: 35-promoter box; 10: 10-promoter box; RBS: ribosome binding site.

[0136] Further Phage Resistant Mutants

[0137] To reveal a possible relationship between phage resistance and galactose positive phenotype five additional phage resistant mutants were isolated on M17 galactose agar plates from strain CHCC6008 (gal) which is the mother strain of CHCC11342 (gal+). All five phage resistant mutants, CHCC11396, CHCC11397, CHCC11398, CHCC11399, and CHCC11340 (resistant to phage CHPC1152) were unable to ferment galactose meaning the gal+ phenotype is not directly related with phage resistance, On the other hand it was demonstrated by plaque assay that CHCC11342 (gal+) was still sensitive to phage CHPC1152.

Example 2

Development of Phage Resistant Lactobacillus delbrueckii subsp. bulgaricus Strains With Improved Texture Properties

[0138] From the mother strain CHCC10019 (DSM19252), phage resistant mutants were isolated as follows:

[0139] Mutants were picked from MRS agar plates containing 10 mM CaCl.sub.2/10 mM MgCl.sub.2 after plating 0.1 ml of an MRS over night culture of CHCC10019 together with 0.1 ml of a CHPC658 phage lysate containing 10E06 phage particles per ml and anaerobic incubation for two days at 37 C. Thirty mutants were isolated and tested in cross-streaking towards phage CHPC658. Twenty-nine mutants appeared resistant in the cross-streaking test, and were afterwards three times colony-purified on MRS agar plates at 37 C.

[0140] The 29 mutants were tested in microtiter plates for acidification profile and phage resistance. Two microtiter plates were prepared with milk and each plate was inoculated with 2% of the respective mutant. For one plate, 2% peptone-salt diluent (control) was added to each well, and to the other microtiter plate 2% CHPC658 containing 10E06 phage particles per ml was added. The two plates were incubated at 37 C. for two days, and pH of each well was recorded every 12 minutes. All mutants were phage resistant compared to the mother strain CHCC10019, which was attacked by phage CHPC658.

[0141] Twelve mutants were chosen based on the acidification profile in MRS and milk (similar to he mother strain) and the viscosity of the strains.

[0142] Analysis of CHCC10019 Phage Resistant Mutants for Texture Properties in Fermented Milk

[0143] After incubating the twelve mutants and mother strain CHCC10019 over night in milk at 37 C., the fermented milk was adjusted to 13 C. and stirred gently by means of a stick fitted with a disc containing holes until homogeneity of each sample. The rheological properties of each sample was assessed on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measuring system.

[0144] The viscometry test was made with shear rates varying from 0.27 to 300 l/s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were recorded. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s1 was chosen.

[0145] The results from the rheology measurements showed that all twelve mutants (such as CHCC12813 and CHCC12841) had an improved viscosity, measured as shear stress, compared to CHCC10019. The highest shear stress value was obtained for CHCC12841 (74.0 Pa) whereas CHCC10019 had a shear stress value of 58.0 Pa, see FIG. 2. On the figure, the rheology data for the twelve phage resistant mutants is shown. All mutants have an increase in shear stress ranging from 10% up to 28% compared to CHCC10019.

[0146] Based on acidification activity and rheology data when the mutants were grown in co-culture with other strains CHCC12813 was selected as most promising candidate of the isolated mutants for further application tests.

[0147] This experiment demonstrates that the important rheological parameter shear stress of a bacterial strain will be significantly improved by isolating phage resistant mutants of the strain.

Example 3

Isolation of Phage Resistant Mutants of Streptococcus thermophilus Strain CHCC9204

[0148] From the mother strain CHCC9204, registered in Chr. Hansen culture collection, a phage resistant mutant was isolated. The mutant was isolated on M17-2% lactose agar plates with 10 mM MgCl.sub.2/CaCl.sub.2 after plating 0.1 ml of an M17 lactose over night culture of CHCC9204 together with 0.1 ml of phage CHPC1057 containing 110exp09 phage particles per ml and incubation overnight at 37 C.

[0149] Among several mutants one strain, called CHCC12339, was three times colony purified and retested in plaque test on M17 lactose agar plates at 37 C. using phage CHPC1057 for phage challenge, and phage resistance was confirmed (no single plaques observed in plaque test). CHCC12339 was also tested in milk showing an acidification activity comparable to the mother strain.

[0150] Analysis of Texture Properties of Phage Resistant Mutant CHCC12339 in Fermented Milk

[0151] After mutant CHCC12339 and mother strain CHCC9204 were incubated over night in milk at 37 C., the fermented milk was brought to 13 C. and stirred gently by means of a stick fitted with a bored disc until homogeneity of each sample. The rheological properties of each sample was assessed on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measuring system.

[0152] The viscometry test was made with shear rates varying from 0.27 to 300 l/s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were recorded. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s1 was chosen.

[0153] The results from the rheology measurements showed that mutant CHCC12339 leads to an increase of gel stiffness (G*) by 22% compared to CHCC9204, see FIG. 3. On the figure, the gel stiffness values (G*) for the phage resistant mutant CHCC12339 (78.0 Pa) and mother strain CHCC9204 (64.0 Pa) are compared.

Example 4

Isolation of Phage Resistant Mutants of Streptococcus thermophilus Strain CHCC5086

[0154] From the mother strain CHCC5086, registered in Chr. Hansen culture collection, a phage resistant mutant was isolated.

[0155] The mutant was isolated on M17-2% lactose agar plates with 10 mM MgCl.sub.2/CaCl.sub.2 after plating 0.1 ml of an M17-2% lactose over night culture of CHCC5086 together with 0.1 ml of phage CHPC1089 containing 110exp08 phage particles per ml and incubation overnight at 37 C.

[0156] Among several mutants one strain, called CHCC13140, was three times colony purified and retested in plaque on M17 lactose agar plates at 37 C. test using phage CHPC1089 for phage challenge, and phage resistance was confirmed (no single plaques observed in plaque test). CHCC13140 was also tested in milk acidification test showing an acidification activity comparable to the mother strain.

[0157] Analysis of Texture Properties of Phage Resistant Mutant CHCC13140 In Fermented Milk

[0158] After mutant CHCC13140 and mother strain CHCC5086 were incubated over night in milk at 37 C., the fermented milk was brought to 13 C. and stirred gently by means of a stick fitted with a bored disc until homogeneity of each sample. The rheological properties of each sample was assessed on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measuring system.

[0159] The viscometry test was made with shear rates varying from 0.27 to 300 l/s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were recorded. Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s1 was chosen.

[0160] The results from the rheology measurements showed that mutant CHCC13140 leads to an increase of shear stress by 14% compared to CHCC5086, see FIG. 4. On the figure, the shear stress data for the phage resistant mutant CHCC13140 (shear stress 33.0 Pa) and mother strain CHCC5086 (28.0 Pa) are compared.

Example 5

Preparation of a Galactose Positive Mutant of a Streptococcus Strain

[0161] General Method for Obtaining gal+ Strains

[0162] Prior to the mutant isolation the mother strain (e.g. CHCC6008) were streaked on M17 agar plates with 2% galactose (M17-gal plates). CHCC5008 did not grow on galactose as sole carbohydrate source, and thus the mother stain is considered to be gal.

[0163] Over night cultures of the mother strain were then plated on M17-gal plates and several colonies could be isolated after two days of growth at 37 C.

[0164] Several mutants were purified on M17-gal plates and retested in M17 broth containing 2% galactose as sole carbohydrate.

[0165] A mutant may be obtained by means of e.g. genetic engineering, radiation and/or chemical treatment, or the mutant may be a spontaneous mutant.

[0166] A mutant was considered galactose positive when the pH was reduced by a value of at least 1.0 after 16 hours incubation at 37 degrees C. in M17 with 2% galactose (galactose added as sole carbohydrate), inoculated in an amount of at least 10E4 cells pr ml of medium.

[0167] Whereas CHCC6008 did not lower the pH in M17-gal broth significantly, CHCC11342, one of the purified mutants, reached a pH of 5.4 after 16 hours at 37 C., and was therefore considered a galactose-fermenting (gal+) mutant of CHCC6008.

[0168] Isolation of Galactose Fermenting Strains

[0169] Mutants were isolated as galactose fermenting mutant of S. thermophilus strain CHCC6008 (=ST6008, DSM18111). The CHCC6008 cells were neither mutagenized with any mutagenic compound nor by UV light prior to the mutant isolation step. The isolated strains resemble therefore spontaneous galactose positive mutants of CHCC6008.

[0170] Prior to the mutant isolation CHCC6008 was streaked on M17 agar plates with 2% galactose (M17-gal plates). CHCC6008 did not grow on galactose as sole carbohydrate source.

[0171] Over night culture of CHCC6008 were then plated on M17-gal plates and several colonies could be isolated after two days of growth at 37 C. Several mutants were purified on M17-gal plates and retested in M17 broth containing 2% galactose as sole carbohydrate.

[0172] Whereas CHCC6008 did not lower the pH in M17-gal broth significantly, CHCC11379, one of the purified mutants, reached a pH of 5.3 after 10 hours at 37 C., and was therefore considered a galactose-fermenting mutant from CHCC6008.

[0173] Strains CHCC11342 and CHCC 976 were isolated the same way.

[0174] Isolation of Mutants by Genetic Engineering

[0175] Galactose positive mutants can also be generated by site directed mutagenesis.

[0176] Oligonucleotides carrying the mutated nucleotide within the galK 10 promoter box is used to amplify a specific DNA fragment by PCR, The PCR fragment carrying the desired mutation is cloned into a vector plasmid and transformed into the S. thermophilus target strain, and the mutation is integrated into the chromosome and exchanging the wild type galK promoter region by recombination. Isolation of strains is done as above.

[0177] Analysis of Texture in Fermented Milk

[0178] The day after incubation, the fermented milk was brought to 13 C. and stirred gently by means of a stick fitted with a bored disc until homogeneity of the sample, The rheological properties of the sample were assessed on a rheometer (StressTech, Reologica Instruments, Sweden) equipped with a C25 coaxial measuring system.

[0179] The viscometry test was made with shear rates varying from 0.27 to 300 l/s in 21 steps. Shear rates were increased and then decreased and the upward and downward curves of shear stress and apparent viscosity were recorded.

[0180] Delay and integration times were 5 s and 10 s, respectively. For further analysis, shear stress at 300 s1 was chosen. The rheometer results showed that CHCC11379 had a shear stress which was improved by 10% compared to CHCC6008 (shear stress value 74.0 Pa (Pascals) for CHCC11379 compared with 67.5 Pa for mother strain CHCC6008.

[0181] Analysis of Texture in Milk

[0182] In another experiment CHCC11379 was used as a part of a yoghurt culture where strains from S. thermophilus are co-cultured in skimmed milk at 43 C. together with a strain from the species Lactobacillus delbrueckii ssp. bulgaricus. When the only difference in the production of yoghurt was the use of CHCC11379 instead of wild type CHCC6008 the shear stress was also increased by 10% (105.0 Pa for the yoghurt culture containing CHCC11379 compared with 94.7 Pa for the yoghurt culture containing CHCC6008).

[0183] Sequencing of the galK Promoter Region From CHCC11379

[0184] To reveal the type of mutation for the gal positive mutant CHCC11379 the beginning of the galK gene (coding for the galactokinase from S. thermophilus) was sequenced.

[0185] For CHCC11379 a mutation in the region of the galK promoter was identified (see below). The respective mutation will most likely lead to a stronger promoter activity compared to the mother strain 6008, explaining the observed gal-positive phenotype. This is based on the fact that the consensus sequence for the 10-promoter box is TATAAT, and that a mutation at nucleotide 3 of the 10 box (region) for CHCC6008 (TACGAT) leads to a 10 box with a higher similarity to the consensus sequence in CHCC11379 (TATGAT).

TABLE-US-00002 SEQIDNo:5 CHCC11379 AAAATATTGATTTTCCATGTGAAAGGGGTTA GATTTCAGTATAAACAAAAAAGAATAAGTGAGATACATC SEQIDNo:2 CHCC6008 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQIDNo:3 AY704568 AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC SEQIDNo:4 Consensus AAAATATTGATTTTCCATGTGAAAGGGGTTACGATTTCAGTATAAACAAAAAGAATAAGTGAGATACATC 3510RBS

[0186] Promoter region of the galK gene from CHCC11379. The point mutation within the CHCC11379 galK promoter is indicated with grey color code. The published galK sequence from S. thermophilus ST111 (Genbank accession no. AY704368) is indicated for comparison. 35: 35-promoter region; 10: 10-promoter region; RBS: ribosome binding site.

[0187] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Deposits and Expert Solution

[0188] The strains Streptococcus thermophilus CHCC11977 and CHCC11342 were deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany) under the accession numbers DSM22935 and DSM22932, resp., on Sep. 8, 2009. CHCC6008 has been deposited at DSMZ under the accession number DSM 18111 on Mar. 29, 2006.

[0189] Bacteriophages CHPC658, CHPC1057 and CHPC1152 were deposited at DSMZ on 27 Aug. 2010, and given the deposit numbers DSM23961, DSM23962, and DSM23994, resp.

[0190] Further deposits at DSMZ: [0191] CHCC10019 (DSM19252) and CHCC3984 (DSM19251): Date of deposit 3 Apr. 2007, [0192] CHCC2008 (DSM22584) and CHCC5086 (DSM22587): date of deposit 19 May 2009, [0193] CHCC11379 (DSM22884): date of deposit 26 Aug. 2009, [0194] CHCC11976 (DSM22934): date of deposit 8 Sep. 2009; [0195] CHCC13140 (DSM 24023), CHCC12813 (DSM24074), and CHPC1089 (DSM 24022): date of deposit 29 Sep. 2010; [0196] CHCC12339 (DSM24090): date of deposit 14 Oct. 2010. [0197] Streptococcus thermophilus CHCC5086 (DSM22587): date of deposit: 19 May 2009. [0198] CHCC9204 (DSM19243): date of deposit 29 Mar. 2007.

[0199] The deposits have been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0200] The Applicant requests that a sample of the deposited microorganisms should be made available only to an expert approved by the Applicant.

REFERENCES

[0201] Appl. Environ. Microbiol. 71, 7, p. 3659-67 (2005); [0202] International Journal of Food Microbiology 113 (2007) 195-200; [0203] Applied And Environmental Microbiology, February, 2002, p. 784-790; [0204] J Dairy Sci 92: 477-482 (2009) [0205] WO2008/040734A1, WO2007/025097A2, U.S. Pat. No. 7,241,610B2, WO2007/144770A2, [0206] WO2004/085607A, WO2008/148561A, WO11000879A, WO11000883A, WO10023178A

[0207] All references cited in this patent document are hereby incorporated herein in their entirety by reference.