Methods and compositions related to a retinoid receptor-selective pathway

09611235 ยท 2017-04-04

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are methods and compositions related to a retinoid receptor-selective pathway. As described herein, this pathway can be targeted to manipulate a tumor microenvironment. For example, the methods and compositions described herein can be used to induce apoptosis in a cancer cell. Further, the compositions described herein, including Sulindac and analogs thereof, can be used to target this pathway for the treatment or prevention of cancer in human patients.

Claims

1. A compound of formula (I), or a sodium salt thereof, having the structure: ##STR00061## wherein A is a phenyl, and wherein A is substituted by one or two substituents independently selected from the group consisting of C2-3 alkyl, n-butyl, iso-butyl, sec-butyl, CF.sub.3, a C3-C4 cycloalkyl, and a C4-C5 cycloalkylalkyl; wherein B is a fused phenyl, and wherein B is substituted by a fluoro; wherein R.sub.1 is (CR.sub.5R.sub.6).sub.nCOOH; wherein R.sub.2 is CH.sub.3; wherein R.sub.5 and R.sub.6 are H; and wherein n is 1 or 2.

2. A compound of formula (II), or a sodium salt thereof, having the structure: ##STR00062## wherein R.sub.1 is selected from the group consisting of CH.sub.2COOH and CH.sub.2CH.sub.2COOH; wherein R.sub.2 is CH.sub.3; and wherein R.sub.3 is selected from the group consisting of 4-CH.sub.2CH.sub.3, and 4-CH(CH.sub.3).sub.2.

3. The compound of claim 2, or a sodium salt thereof, selected from the group consisting of: ##STR00063##

4. The compound of claim 2, or a sodium salt thereof, selected from the group consisting of: ##STR00064##

5. The compound of claim 2, or a sodium salt thereof, having the structure: ##STR00065##

6. A compound, or a sodium salt thereof, having the structure: ##STR00066##

7. A pharmaceutical composition comprising a compound of claim 1, or a sodium salt thereof, and a pharmaceutically acceptable excipient.

8. A pharmaceutical composition comprising a compound of claim 2, or a sodium salt thereof, and a pharmaceutically acceptable excipient.

9. A pharmaceutical composition comprising a compound of claim 6, or a sodium salt thereof, and a pharmaceutically acceptable excipient.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows Sulindac binding to RXR. (a) Sulindac binding to RXR LBD protein incubated with [.sup.3H]9-cis-RA or unlabeled 9-cis-RA. (b) Sulindac binding to RXR in HEK293 cells stably expressing RXR, Nur77 or RAR as determined by HPLC analysis. (c) Altered sensitivity of RXR LBD or GST-RXR to chymotrypsin by Sulindac. (d) Comparison of .sup.19F NMR spectra of Sulindac in the absence and presence of RXR LBD or Nur77 protein. Sulindac inhibits transactivation of RXR homodimers and heterodimers as determined by (TREpal)2-tk-CAT activity (Zhang et al., Nature 358, 587-591 (1992a)) (e) or RARE-tk-CAT activity (Zhang et al., Nature 355, 441-446 (1992b)) (f).

(2) FIG. 2 shows Sulindac inducing RXR-dependent apoptosis and Bax activation. Apoptotic effects of Sulindac in F9 or F9 cells lacking RXR (F9 RXR.sup./) as analyzed by DAPI staining (a), PARP cleavage (b), and DNA fragmentation (c). RXR siRNA inhibits apoptosis induction by Sulindac. H460 lung cancer cells transfected with control or RXR siRNA (d) treated with Sulindac and analyzed by DAPI staining for apoptosis (e). (f) Transfection of RXR enhances the apoptotic effect of Sulindac. CV-1 cells transfected with GFP-RXR were treated with Sulindac and analyzed by DAPI staining. (g) Disruption of the RXR LBP impairs the apoptotic effect of Sulindac. CV-1 cells transfected with GFP-RXR or GFP-RXR/F313S/R316E were treated with Sulindac and analyzed by DAPI staining. Apoptosis scored in receptor transfected cells. Role of Bax in apoptosis induction. HCT116 cells or HCT116 cells lacking Bax (Bax.sup./) were treated with or without Sulindac. Apoptosis determined by PARP cleavage (h) and DAPI staining (i). (j,k) RXR siRNA inhibits sulindac-induced Bax activation. Knocking down RXR in HCT116 cells by RXR siRNA revealed by immunoblotting. HCT116 cells transfected with or without RXR siRNA or control siRNA were treated with Sulindac, and analyzed for Bax oligomerization (j) and Bax conformational change and mitochondrial targeting by immunostaining/confocal microscopy using Bax/21, Bax/6A7, or anti-Hsp60 antibody (k).

(3) FIG. 3 shows Sulindac inhibiting TNF-induced AKT activation and tRXR-p85 interaction. (a) Inhibition of AKT activation by Sulindac. HCT116, SW480, HepG2, ZR75-1, MCF-7, PC3, LNCaP, HaCat, and RAW264.7 cells starved overnight and treated with Sulindac were analyzed for AKT activation by immunoblotting. (b) Inhibition of basal AKT activation by RXR siRNA. HepG2 cells transfected with RXR siRNA were treated with Sulindac. AKT activation and RXR expression were analyzed by immunoblotting. (c) Inhibition of TNF-induced AKT activation by Sulindac and RXR siRNA. A549 lung cancer cells transfected with RXR or control siRNA were pretreated with Sulindac and exposed to TNF. AKT activation and RXR expression were analyzed by immunoblotting. (d) Synergistic inhibition of AKT activation by TNF and Sulindac. ZR-75-1 and PC3 cells were pretreated with Sulindac and exposed to TNF. AKT activation was analyzed by immunoblotting. (e) Schematic representation of anti-RXR antibodies used in co-immunoprecipitation and immunoblotting assays (above). D20 antibody recognized amino acids 2-21 in the N-terminal A/B domain, while N197 antibody recognizes the C-terminal E/F domain (below). A RXR truncated protein with about 44 kDa is also shown. (f) Expression of tRXR in various cancer cell lines. HCT116, SW480, ZR75-1, MCF-7, PC3, LNCaP, HepG2, HaCat, Caco2, MEF, RAW, and BHK cell lines treated with or without 9-cis-RA were analyzed by immunoblotting using the N197 RXR antibody.

(4) FIG. 4 shows the role of tRXR in AKT activation and anchorage-independent cell growth. (a) Cell density-dependent production of tRXR and AKT activation. MEFs seeded at different cell densities were analyzed for RXR expression using N197 antibody and for AKT activation by immunoblotting. (b) Subcellular localization of endogenous RXR in MEFs was visualized by confocal microscopy after immunostaining using anti-RXR (N197). Cells were also stained with DAPI to visualize the nucleus. (c) Stable expression of RXR/1-134 induces RXR cleavage and AKT activation. HeLa or HeLa cells stably expressing RXR/1-134 were treated with 9 cis-RA and analyzed for AKT activation and expression of RXR. (d) Growth of HeLa/RXR/1-134 and HeLa cells in soft agar. (e) Sulindac inhibits clonogenic survival of HeLa/RXR/1-134 cells. (f) Production of tRXR in human tumor tissues of breast (5 out of 6) or liver (4 out of 6) compared to tumor surrounding and normal tissues. (g) Cytoplasmic localization of RXR in liver tumor specimens immunostained by N197 antibody. T: tumor tissue; S: tumor surrounding tissue.

(5) FIG. 5 shows the role of N-terminally truncated RXR in PI3K/AKT activation by TNF and cancer cell growth. (a) HEK293T cells were transfected with Flag-p85 and RXR, RXR/80, or RXR/100 tagged with the Myc epitope, treated with TNF, and analyzed for by co-immunoprecipitation using anti-Flag antibody. (b) N-terminal A/B domain of RXR interacts with p85. Flag-p85 was cotransfected with GFP-RXR-1-134 and GFP-RXR-224-462 into HEK293T cells, and analyzed for their interaction by co-immunoprecipitation using anti-Flag antibody. (c) RXR/80 is a potent AKT activator. AKT activation of HEK293T, HeLa, A549, and MCF-7 cells transfected with RXR/80 or RXR/100 as determined by immunoblotting. (d) Cytoplasmic co-localization of RXR/80 and p85. Myc-RXR/80 and p85 were cotransfected into PC3 and ZR-75-1 cell lines, immunostained with anti-Myc and anti-p85 antibody, and their subcellular localization revealed by confocal microscopy. (e) Activation of PI3K by RXR/80 immunoprecipitates. A549 cells transfected with Flag-p85 and Myc-RXR/80 were treated with TNF and/or Sulindac, immunoprecipitated with anti-Myc antibody, and subjected to an in vitro PI3K assay. (f) Stable expression of RXR/80. Cells stably transfected with GFP-RXR/80 or control GFP vector were analyzed by immunoblotting. (g) RXR/80 promotes clonogenic survival of cancer cells. (h,i) RXR/80 promotes cancer cell growth in nude mice.

(6) FIG. 6 shows the activation of a TNF-induced extrinsic apoptotic pathway by Sulindac. (a) Synergistic induction of apoptosis by Sulindac/TNF combination and its inhibition by RXR ligand. HepG2 cells cultured in medium with 1% FBS were treated with SR11237, then TNF and/or Sulindac, and analyzed by immunoblotting. (b) Inhibition of Sulindac/TNF-induced caspase-8 cleavage by RXR siRNA. HepG2 cells transfected with control or RXR siRNA were treated with TNF and/or Sulindac and analyzed by immunoblotting. Inhibition of Sulindac/TNF-induced PARP cleavage by caspase-8 inhibitor (c) and siRNA (d). HepG2 cells transfected with control or caspase-8 siRNA or pretreated with ZIETD-fmk were treated with TNF and Sulindac and analyzed by immunoblotting. (e) Activation of Bax by Sulindac and TNF. HepG2 cells treated with TNF and/or Sulindac were immunostained with Bax/6A7 antibody. (f) Regulation of Sulindac/TNF-induced PARP cleavage by AKT. PC3 cells transfected with CA-AKT or DN-AKT were treated with TNF and/or Sulindac, and analyzed by immunoblotting. Activation of caspase-8 (g) and Bax (h) by Sulindac and TNF. HepG2 cells transfected with CA-AKT were treated with TNF and Sulindac, and immunostained with anti-cleaved caspase-8 or Bax/6A7 antibody. (i) Regulation of c-FLIP expression by TNF and Sulindac. Cells treated with TNF and/or Sulindac were analyzed by immunoblotting.

(7) FIG. 7 shows the design, synthesis, and evaluation of RXR-selective Sulindac analogs. (a) Docking of sulindac sulfide to the LBP of RXR in reference to 9-cis-RA. Side chains within 4 of the ligands are displayed in grey. (b) Comparison of orientation and position of docked sulindac sulfide to the crystal structures of 9-cis-RA, DHA, and BMS649. (c) RXR binding and inhibition of COX-1 and COX-2 activities by Sulindac analogs. RXR binding was measured by competition ligand-binding assays. (d) Inhibition of PGE2 production by Sulindac and analogs. A549 cells stimulated with TNF were treated with Sulindac or analogs. (e) Comparison of .sup.19F NMR spectra of K-80003 in the absence and presence of RXR LBD.

(8) FIG. 8 shows that K-80003 is a potent inhibitor of RXR-dependent AKT activation. (a) Inhibition of AKT activation by Sulindac or K-80003 in the presence of TNF. (b) RXR-dependent inhibition of AKT activation by K-80003. PC3 cells transfected with RXR or RAR siRNA were pre-treated with K-80003 before exposure to TNF (pRXR: phosphorylated RXR). (c) Inhibition of RXR/80 interaction with p85 by Sulindac and K-80003. A549 cells were transfected with Flag-p85 and Myc-RXR/80, treated with Sulindac or K-80003 before exposure to TNF, and analyzed by coimmunoprecipitation using anti-Flag antibody. (d) Induction of PARP cleavage by Sulindac or K-80003 in the presence of TNF. ZR-75-1 cells treated with TNF and/or Sulindac or K-80003 were analyzed by immunoblotting. (e) Activation of caspase-8 by K-80003 in the presence of TNF. Cells treated with TNF and/or K-80003 were analyzed by immunoblotting. (f) Inhibition of clonogenic survival of RXR/1-134 cells and RXR/80 stable clones by Sulindac and K-80003. (g) Inhibition of RXR/80 tumor growth in animals by Sulindac and K-80003.

(9) FIGS. 9A-C are related to FIG. 1 and show the binding of Sulindac to RXR and its effect on RXR transactivation.

(10) FIG. 10 is related to FIG. 1B and shows binding of Sulindac to RXR protein as determined by HPLC analysis.

(11) FIGS. 11A-D are related to FIG. 2G and show an impaired ability of RXR mutant, RXR/F313S/R316E to mediate the apoptotic effect of Sulindac.

(12) FIG. 12A-E are related to FIG. 3 and show that the inhibitory effect of Sulindac on AKT activation and tRXR-p85 interaction.

(13) FIG. 13 is related to FIGS. 4B and 5D and shows the cytoplasmic localization of tRXR using cellular fractionation assays.

(14) FIG. 14 is related to FIG. 4 and shows the production of endogenous tRXR by stable expression of RXR/1-134.

(15) FIGS. 15A-B are related to FIG. 5E and show that tRXR immunoprecipitates from A549 lung cancer cells.

(16) FIGS. 16A-D are related to FIG. 6 and show that Sulindac-induced apoptosis is mediated by a death receptor-dependent extrinsic apoptotic pathway.

(17) FIGS. 17A-B are related to FIG. 6 and show synergistic activation of caspase-8 by the Sulindac/TNF combination in both HepG2 and HCT116 cancer cell lines, and shows that activation of AKT inhibits apoptosis induced by Sulindac/TNF combination.

(18) FIGS. 18A-B are related to FIG. 7 and show the design of some of the RXR-selective Sulindac analogs described herein.

(19) FIG. 19 is related to FIG. 8 and shows a synthesis of Sulindac analog K-80003.

(20) FIG. 20 is related to FIG. 8 and shows that K-80003 is more effective than Sulindac in inhibiting AKT activation by all-trans-retinoic acid.

(21) FIGS. 21A-C show the growth inhibitory effect of oral administration of K-80003 on MCF-7 breast tumor grown in mice. (A) Breast tumor volume over time in mice treated with oral K-80003 or a control. (B) Breast tumor tissue from mice treated with control. (C) Breast tumor tissue from mice treated with K-80003.

(22) FIGS. 22A-C show toxicity and PK profiles for preclinical studies of K-80003. (A) Toxicity data. (B) Bioavailability data. (C) Pharmacokinetic data.

DETAILED DESCRIPTION

(23) Various embodiments disclosed herein are generally directed towards compositions and methods related to a retinoid receptor-selective pathway. This pathway can be manipulated as described herein to treat or reduce the risk of developing cancer.

(24) As shown herein, tRXR constitutively resides in the cytoplasm, interacts with p85, activates AKT, and confers anchorage-independent growth of cells. These observations reveal a tRXR-mediated survival pathway in cancer cells, providing new insights into the role of RXR and its ligands in cancer. Such activation of the PI3K/AKT survival pathway by proteolytic processing of RXR is similar to the activation of apoptotic pathways by truncated Bid (tBid) and the activation of the Notch pathway by truncated Notch protein. Interestingly, cleavage of Bid and Notch also alters their subcellular localization, similar to the effect on RXR truncation. The finding that RXR serves as an intracellular target of Sulindac action prompted the design of RXR-selective Sulindac derivatives for suppressing AKT activity described herein. For example, provided herein is the design and synthesis of a Sulindac-derived RXR ligand, K-80003, with greater affinity to RXR, and enhanced efficacy in inhibiting AKT, but lacking COX inhibitory activity. In addition, as described herein, the upregulation of endogenous TNF and/or the introduction of exogenous TNF may be useful in priming cancer cells for responsiveness.

(25) In some embodiments, the composition comprises a core structure having formula I:

(26) ##STR00003##

(27) In some embodiments, A is an aryl or a heteroaryl, and can optionally be substituted by R.sub.3 and 0, 1, or 2 R.sub.4. In some embodiments, B is an aryl or a heteroaryl, and can optionally be substituted by 0, 1, or 2 R.sub.4. In some embodiments, R.sub.1 is (CR.sub.5R.sub.6).sub.nCOOH. In some embodiments, R.sub.2 is selected from the group consisting of H, a C.sub.1-10 alkyl, an arylalkyl, a cycloalkyl, a cycloalkylalkyl, a haloalkyl, alkylO, alkylS, haloalkylO, NH.sub.2, and alkylN. In some embodiments, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, a C.sub.1-10 alkyl, a haloalkyl, a halo, CN, an aryl, a heteroaryl, an arylalkyl, a heteroarylalkyl, alkylO, alkylS, (CR.sub.4R.sub.6).sub.nCONR.sub.7R.sub.8, OH, a cycloalkyl, a cycloalkylalkyl, cycloalkylO, and an alkoxyalkyl. In some embodiments, R.sub.5 and R.sub.6 are independently selected from the group consisting of H, a C.sub.1-7alkyl, OH, an alkoxy, and a cycloalkyl; or together form a cycloalkyl or heterocyclyl group. In some embodiments, n is selected from the group consisting of 0, 1, 2, and 3.

(28) In some embodiments, the composition comprises a core structure having formula II:

(29) ##STR00004##

(30) In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.2COOH and CH.sub.2CH.sub.2COOH. In some embodiments, R.sub.2 is selected from the group consisting of CH.sub.3 and H. In some embodiments, R.sub.3 is selected from the group consisting of 4-SCH.sub.3, 4-CH.sub.3, 4-CH.sub.2CH.sub.3, and 4-CH(CH.sub.3).sub.2.

(31) In some embodiments, the composition comprises a core structure having formula III:

(32) ##STR00005##

(33) In some embodiments, n=2. In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.3, F, and Cl. In some embodiments, R.sub.2 is selected from the group consisting of H, CH.sub.3, Cl, and F. In some embodiments, R.sub.3 is selected from the group consisting of CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C(CH.sub.3).sub.3, CH.sub.2Cl, OCH.sub.3, and SCH.sub.3. In some embodiments, B and/or D is a hetero ring (e.g., limited to a hetero atom).

(34) In some embodiments, COOH from formula III is replaced with tetrazole. For example, in some embodiments, the composition comprises a core structure having formula IV:

(35) ##STR00006##

(36) In some embodiments, n=2. In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.3, F, and Cl. In some embodiments, R.sub.2 is selected from the group consisting of H, CH.sub.3, Cl, and F. In some embodiments, R.sub.3 is selected from the group consisting of CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C(CH.sub.3).sub.3, CH.sub.2Cl, OCH.sub.3, and SCH.sub.3. In some embodiments, B and/or D is a hetero ring (e.g., limited to a hetero atom).

(37) In some embodiments, the composition comprises a core structure having formula V:

(38) ##STR00007##

(39) In some embodiments, R.sub.1 is selected from the group consisting of COOH, CH.sub.2CH.sub.2COOH, CHCHCOOH, CH.sub.2-Tetrazole, CH.sub.2CH.sub.2-Tetrazole, CH.sub.2COOCH.sub.3, CH.sub.3, CH.sub.2CONH.sub.2, CH.sub.2CONHCH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, and CH.sub.2NH.sub.2. In some embodiments, R.sub.2 is selected from the group consisting of H, Cl, CH.sub.2CH.sub.3, OCH.sub.3, NH.sub.2, NHCH.sub.3, CF.sub.3, CH.sub.2NH.sub.2, CH.sub.2OH, CH.sub.2Cl, CH(CH.sub.3).sub.2, and OCH.sub.2CH.sub.3. In some embodiments, R.sub.3 is selected from the group consisting of H, CHCH.sub.2, CCH, C(CH.sub.3).sub.3, CF.sub.3, OH, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, NHCH.sub.3, CN, NHCOCH.sub.3,

(40) ##STR00008##

(41) In some embodiments, R.sub.4 is selected from the group consisting of H, Cl, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, OCH.sub.3, OCHCH.sub.3, NH.sub.2, and NHCH.sub.3. Further, any of R.sub.1 to R.sub.4 can be any other suitable group known to one of skill in the art.

(42) In some embodiments, the composition comprises a core structure having formula VI:

(43) ##STR00009##
where R.sub.1 is selected from the group consisting of COOH, CH.sub.2CH.sub.2COOH, CHCHCOOH, CH.sub.2-Tetrazole, CH.sub.2CH.sub.2-Tetrazole, CH.sub.2COOCH.sub.3, CH.sub.3, CH.sub.2CONH.sub.2, CH.sub.2CONHCH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, and CH.sub.2NH.sub.2.

(44) In some embodiments, the composition comprises a core structure having formula VII:

(45) ##STR00010##
where R.sub.2 is selected from the group consisting of H, Cl, CH.sub.2CH.sub.3, OCH.sub.3, NH.sub.2, NHCH.sub.3, CF.sub.3, CH.sub.2NH.sub.2, CH.sub.2OH, CH.sub.2Cl, CH(CH.sub.3).sub.2, and OCH.sub.2CH.sub.3

(46) In some embodiments, the composition comprises a core structure having formula VIII:

(47) ##STR00011##
where R.sub.3 is selected from the group consisting of H, CHCH.sub.2, CCH, C(CH.sub.3).sub.3, CF.sub.3, OH, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, NHCH.sub.3, CN, NHCOCH.sub.3,

(48) ##STR00012##

(49) In some embodiments, the composition comprises a core structure having formula IX:

(50) ##STR00013##
where R.sub.4 is selected from the group consisting of H, Cl, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, OCH.sub.3, OCHCH.sub.3, NH.sub.2, and NHCH.sub.3.

(51) Some embodiments of the invention additionally provide analogs of compounds, including analogs and derivatives of the compounds shown in Example 16, having a core structure of any of formulas I to IX, and/or otherwise provided herein. It is understood that various modifications can be made to the compounds described herein to generate analogs using known methods. It is further understood that the R groups in the various core structures can be varied. It is also understood that analogs of the compounds disclosed herein can be readily prepared by one skilled in the art using known methods of chemical synthesis and performing structure activity relationship (SAR) studies. Furthermore, one skilled in the art can readily determine the activity of various analogs using the methods described herein.

(52) In some embodiments, the IC.sub.50 of the analog bound to RXR is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the IC.sub.50 of Sulindac when bound to RXR.

(53) In some embodiments, the IC.sub.50 of the analog bound to COX-1 is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% greater than the IC.sub.50 of Sulindac when bound to COX-1. In some embodiments, the IC.sub.50 of the analog bound to COX-1 is about 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 50, 100, 250, 500, or 1000 greater than the IC.sub.50 of Sulindac when bound to COX-1.

(54) In some embodiments, the IC.sub.50 of the analog bound to COX-2 is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% greater than the IC.sub.50 of Sulindac when bound to COX-2. In some embodiments, the IC.sub.50 of the analog bound to COX-2 is about 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 50, 100, 250, 500, or 1000 greater than the IC.sub.50 of Sulindac when bound to COX-2.

(55) The following definitions are set forth to illustrate and define the meaning and scope of the various terms used to describe the invention herein.

(56) As used herein, alkoxy refers to an alkyl group attached to the parent molecular moiety through an oxygen atom.

(57) As used herein, alkoxyalkyl refers to an alkyl group substituted with one, two, or three alkoxy groups.

(58) As used herein, alkyl refers to a group derived from a straight or branched chain saturated hydrocarbon containing from one to ten carbon atoms.

(59) As used herein, aryl refers to a phenyl group, or a bicyclic fused ring system wherein one or both of the rings is a phenyl group. Bicyclic fused ring systems consist of a phenyl group fused to a four- to six-membered aromatic or non-aromatic carbocyclic ring. The aryl groups of the present disclosure can be attached to the parent molecular moiety through any substitutable carbon atom in the group. Representative examples of aryl groups include, but are not limited to, indanyl, indenyl, naphthyl, phenyl, and tetrahydronaphthyl.

(60) As used herein, arylalkyl refers to an alkyl group substituted with one, two, or three aryl groups.

(61) As used herein, cycloalkyl refers to a saturated monocyclic or bicyclic hydrocarbon ring system having three to ten carbon atoms and zero heteroatoms. Representative examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, and cyclopentyl.

(62) As used herein, cycloalkylalkyl refers to an alkyl group substituted with one, two, or three cycloalkyl groups.

(63) As used herein, halo and halogen refer to F, Cl, Br, and I.

(64) As used herein, haloalkyl refers to an alkyl group substituted with one, two, three, or four halogen atoms.

(65) As used herein, heterocyclyl refers to a five-, six-, or seven-membered ring containing one, two, or three heteroatoms independently selected from nitrogen, oxygen, and sulfur. The five-membered ring has zero to two double bonds and the six- and seven-membered rings have zero to three double bonds. The term heterocyclyl also includes bicyclic groups in which the heterocyclyl ring is fused to a four- to six-membered aromatic or non-aromatic carbocyclic ring or another monocyclic heterocyclyl group. The heterocyclyl groups of the present disclosure can be attached to the parent molecular moiety through a carbon atom or a nitrogen atom in the group. Examples of heterocyclyl groups include, but are not limited to, benzothienyl, furyl, imidazolyl, indolinyl, indolyl, isothiazolyl, isoxazolyl, morpholinyl, oxazolyl, piperazinyl, piperidinyl, pyrazolyl, pyridinyl, pyrrolidinyl, pyrrolopyridinyl, pyrrolyl, thiazolyl, thienyl, and thiomorpholinyl.

(66) As used herein, pharmaceutically or therapeutically acceptable carrier refers to a carrier medium which does not interfere with the effectiveness of the biological activity of the active ingredients and which is minimally toxic to the host or patient.

(67) As used herein, stereoisomer refers to a chemical compound having the same molecular weight, chemical composition, and constitution as another, but with the atoms grouped differently. That is, certain identical chemical moieties are at different orientations in space and, therefore, when pure, have the ability to rotate the plane of polarized light. However, some pure stereoisomers can have an optical rotation that is so slight that it is undetectable with present instrumentation. The compounds described herein can have one or more asymmetrical carbon atoms and therefore include various stereoisomers. All stereoisomers are included within the scope of the present invention.

(68) As used herein, suppressing the activity of AKT refers to the prevention, amelioration, elimination, or any other reduction of AKT activity. For example, suppressing the activity of AKT can include decreasing basal levels of AKT or inhibiting AKT activation.

(69) As used herein, therapeutically- or pharmaceutically-effective amount as applied to the disclosed compositions refers to the amount of composition sufficient to induce a desired biological result. That result can be prevention, alleviation, or amelioration of the signs, symptoms, causes of a disease, or any other desired alteration of a biological system. For example, the result can involve a decrease and/or reversal of cancerous cell growth.

(70) As used herein, the term inhibitor is interchangeably used to denote antagonist. Both these terms define compositions which have the capability of decreasing certain enzyme activity or competing with the activity or function of a substrate of said enzyme.

(71) As used herein, cancer and cancerous refer to any malignant proliferation of cells in a mammal.

(72) The pharmaceutical compositions disclosed herein can be used for prevention and treatment of any malignancy known to one of skill in the art, including hormone-refractory-prostate cancer, prostate cancer, breast cancer, ovarian cancer, colon cancer, melanoma or other skin cancer, lung cancer, hepatocarcinoma, acute myelogenous leukemia, bladder cancer, cervical cancer, cholangiocarcinoma, chronic myelogenous leukemia, colorectal cancer, gastric sarcoma, glioma, leukemia, lymphoma, multiple myeloma, osteosarcoma, pancreatic cancer, stomach cancer, or tumors at localized sites (including inoperable tumors or in tumors where localized treatment of tumors would be beneficial, and solid tumors).

(73) For in vivo applications, the appropriate dose of a given cytotoxic agent depends on the agent and its formulation, and it is well within the ordinary skill of the art to optimize dosage and formulation for a given patient. Thus, for example, such agents can be formulated for administration via oral, subcutaneous, parenteral, submucosal, intravenous, or other suitable routes using standard methods of formulation. The effective amount and method of administration of compounds will vary based upon the sex, age, weight and disease stage of the patient, whether the administration is therapeutic or prophylactic, and other factors apparent to those skilled in the art.

(74) Those skilled in the art will derive appropriate dosages and schedules of administration to suit the specific circumstances and needs of the patient, e.g., dependent on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician. Typically, the dose range of the composition administered to the patient can be from about 0.5 to 1000 mg/kg of the patient's body weight. The dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient. In some embodiments, the present invention will use the same dosages, or dosages that are between about 0.1% and 500%, more preferably between about 25% and 250% of the established human dosage for analogs. Suitable human dosages can also be inferred from ED.sub.50 or ID.sub.50 values, or other appropriate values derived from in vitro or in vivo studies, e.g., as qualified by toxicity studies and efficacy studies in animals.

(75) Although the exact dosage will be determined on a drug-by-drug basis, in most cases, some generalizations regarding the dosage can be made. The daily dosage regimen for an adult human patient may be, for example, an oral dose of between 0.1 mg and 500 mg, preferably between about 1 mg and about 250 mg, e.g., about 150 to about 200 mg. In some embodiments, the oral dosage form is about 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1000 mg. Compounds can be administered for a period of continuous therapy, for example for a week or more, or for months or years.

(76) Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain the modulating effects, or minimal effective concentration (MEC). The MEC will vary for each compound but can be estimated from in vitro data. Dosages for achieving the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations.

(77) The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, may be the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert. Compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.

EXAMPLES

Example 1

Sulindac Binding to RXR

(78) Competitive ligand-binding assays (FIG. 1A) and HPLC analysis of Sulindac binding to RXR, Nur77, or RAR in HEK293T cells (FIG. 1B) were performed. RXR LBD protein was incubated with [.sup.3H]9-cis-RA in the presence or absence of Sulindac or unlabeled 9-cis-RA. Bound [.sup.3H]9-cis-RA was quantitated by liquid scintillation counting (FIG. 1A). HEK293T cells stably expressing RXR fused to a C-terminal TAP tag (Stratagene, La Jolla, Calif.) were treated with or without 100 M sulindac sulfide for 3 hr. After treatment, cells were purified and analyzed by HPLC for the presence of sulindac sulfide. A standard solution of sulindac sulfide was used to obtain the calibration curve. Characteristic peak spectrum and retention time was used for identification, and peak areas at max used for quantification were calculated (FIGS. 1B and 10). Sulindac sulfide bound to RXR with an IC.sub.50 of 80 M (FIG. 1A), which is in the concentration range that induces apoptosis. HPLC analysis showed a direct binding of Sulindac to RXR, but not other nuclear receptors such as RAR and Nur77 in cells (FIGS. 1B and 10).

(79) Purified RAR protein was incubated with [.sup.3H]all-trans-RA in the presence or absence of Sulindac or unlabeled all-trans RA. Bound [.sup.3H]all-trans-RA was quantitated by liquid scintillation counting. Sulindac did not bind to RAR, consistent with the cell-based experiment shown in FIG. 1B (FIG. 9A).

(80) Receptor expression vectors and a reporter gene (TREpal.sub.2-tk-CAT for RXR/TR heterodimers (FIG. 9B), and DR1 tk-CAT for RXR/PPAR heterodimer (FIG. 9C)) were transiently transfected into CV-1 cells. Cells were treated with or without ligands (ciglitazone, 10.sup.6 M; T.sub.3, 10.sup.7 M) in the presence or absence of Sulindac. CAT activity was determined. Sulindac inhibited transactivation of RXR/PPAR heterodimers, but not RXR/TR heterodimers FIGS. 9B, C)

(81) Altered sensitivity of RXR ligand-binding domain (LBD) to chymotrypsin (ug/ml) by Sulindac (100 M) (FIG. 1C) and differential scanning calorimetry (DSC) scans comparing .sup.19F NMR spectra of Sulindac (100 M) in the absence and presence of 10 M RXR LBD or Nur77 protein (FIG. 1D) were also determined. Binding to RXR was confirmed by altered sensitivity of RXR to chymotrypsin digestion by Sulindac (FIG. 1C) and differential scanning calorimetry (DSC) (FIG. 1D). In addition, inhibition of SR11237 (10.sup.6 M)-activated RXR transactivation by Sulindac was measured (FIG. 1F, see Example 2).

(82) Nur77 and/or RXR were transiently transfected into CV-1 cells. Cells were treated with or without SR11237 (10.sup.6 M), a RXR-selective agonist, in the presence or absence of Sulindac. (TREpal)2-tk-CAT (Zhang et al., Nature 358, 587-591 (1992a))) (FIG. 1E) and RARE-tk-CAT (Zhang et al., Nature 355, 441-446 (1992b)) (FIG. 1F) CAT activity were determined. Sulindac binding inhibited RXR homodimer and heterodimer transactivation in the reporter assays (FIGS. 1E,F and FIG. 10), demonstrating that Sulindac is a RXR transcriptional antagonist.

Example 2

Death Effect of Sulindac

(83) To determine the role of RXR in Sulindac-induced apoptosis, the death effect of Sulindac in F9 cells and F9 cells lacking RXR (F9-RXR/) was examined.

(84) For nuclear morphological change analysis, cells were trypsinized, washed with PBS, fixed with 3.7% paraformaldehyde, and stained with DAPI (4,6-diamidino-2-phenylindole) (1 mg/ml) to visualize the nuclei by fluorescent microscopy. The percentages of apoptotic cells were determined by counting at least 300 GFP-positive cells having nuclear fragmentation and/or chromatin condensation. For the determination of DNA fragmentation, the Cell Death Detection ELISA.sup.PLUS (Roche Applied Science, Penzberg, Bavaria, Germany) was used.

(85) RXR siRNA siGENOME SMARpool (M-003443-02), RAR siRNA siGENOME SMARpool (M-003439-01), and siRNA Non-specific Control IX (D-001206-09-05) were purchased from DHARMACON (Lafayette, Colo.). A 2.5 l aliquot of 20 mM siRNA per well was transfected into cells grown in 12-well plates by using oligofectamine reagent (Invitrogen, Carlsbad, Calif.) according to manufacturer's recommendations. Two days after transfection, the cells were harvested for Western blotting.

(86) F9 or F9 cells lacking RXR (F9 RXR/) were treated with Sulindac (75 M) for 24 hr and analyzed by DAPI staining (FIG. 2A), poly (ADP-ribose) polymerase (PARP) cleavage (FIG. 2B), and DNA fragmentation (FIG. 2C). H460 lung cancer cells were transfected with control or RXR siRNA, treated with Sulindac (75 M) for 24 hr, and analyzed by DAPI staining for apoptosis (FIGS. 2D and 2E).

(87) CV-1 cells were transfected with GFP-RXR (FIG. 2F) or GFP-RXR/F313S/R316E (FIG. 2G), treated with Sulindac (75 M) for 24 hr, and analyzed by DAPI staining. GFP-RXR-transfected cells underwent extensive nuclear fragmentation and condensation (FIG. 2F). Apoptosis was scored in receptor-transfected cells (FIGS. 2G and 11). Disruption of RXRcustom character ligand-binding pocket impaired its homodimer transactivation (FIGS. 11A and 11B). Further, disruption of RXRcustom character ligand-binding pocket impaired its heterodimer transactivation (FIGS. 11C, 11D). RXRcustom character (20 ng), RXR/F313S/R316E (20 ng), -galactosidase (100 ng), and/or Nur77 (100 ng) expression vectors were transiently transfected together with (TREpal)2-tk-CAT (100 ng) (FIGS. 11A, 11B) or RARE-tk-CAT (100 ng) (FIGS. 11C,D) into CV-1 cells. Cells were treated with or without SR11237 (10.sup.6 M) in the presence or absence of increasing concentrations of Sulindac (10, 37.5 75, 150 300 M). CAT activity was determined.

(88) Sulindac induced extensive apoptosis in F9 cells, while it had little effect in F9-RXR/ cells (FIGS. 2A-2C). The apoptotic effect of Sulindac was also reduced in cells transfected with RXR siRNA (FIG. 2E), whereas transfection of RXR enhanced its death effect (FIGS. 2F, G). RXR/F313S/R316E failed to respond to ligandinduced homodimer or heterodimer transactivation (FIG. 11) and showed reduced apoptotic responses to Sulindac (FIG. 2G). Thus, RXR was found to be involved in Sulindac-induced apoptosis.

(89) HCT116 cells or HCT116 cells lacking Bax (Bax/) were treated with or without Sulindac (75 M) for 24 hr. Apoptosis was determined by PARP cleavage (FIG. 2H) and DAPI staining (FIG. 2I). HCT116 cells transfected with or without RXR siRNA or control siRNA for 48 hr were treated with Sulindac for 6 hr, and analyzed for Bax oligomerization (FIG. 2J) and Bax conformational change and mitochondrial targeting by immunostaining/confocal microscopy using Bax/21, Bax/6A7, or anti-Hsp60 antibody (FIG. 2K). About 60% of cells showed BAX conformational change.

(90) Sulindac induced cleavage of PARP (FIG. 2H) and apoptosis (FIG. 2I) in HCT116 colon cancer cells, but not HCT116 cells lacking Bax (Bax/). The fact that HCT116 cells are deficient of COX-2 demonstrated that Sulindac-induced apoptosis can be COX-2-independent. Immunoblotting assays showed that Bax underwent extensive oligomerization on mitochondria, which was abrogated by RXR siRNA (FIG. 2J). In addition, immunostaining using anti-Bax antibody (Bax/21) and a Bax conformation sensitive antibody Bax/6A7 (Nechushtan et al., Biochem Biophys Res Commun 254, 388-394 (1999)) demonstrated that Sulindac induced Bax conformational change and mitochondrial targeting were impaired by RXR siRNA (FIG. 2K). Together, these results demonstrate that RXR can act as an intracellular target mediating the apoptotic effect of Sulindac.

Example 3

RXR Mutant

(91) To address the role of Sulindac binding to RXR, a RXR mutant (RXR/F313S/R316E) was constructed in which amino acids essential for maintaining the functional integrity of RXR ligand-binding-pocket (LBP) (Bourguet, W. et al., Mol Cell 5 (2), 289-298 (2000)) were altered.

(92) Flag-p85 was constructed by polymerase chain reaction (PCR) using forward primer, 5-ccggaattccatgagtgctgaggggtacc-3 (SEQ ID NO:1) and the reverse primer, 5-acgcgtcgactcatcgcctctgctgtgcat-3 (SEQ ID NO:2). PCR product was digested with Eco RI and Sal I and cloned into pCMV-Flag vector. RXR mutants were constructed using the QUIKCHANGE mutagenesis kit (Stratagene, La Jolla, Calif.) with the following oligonucleotides as primers: RXR/F313S/R316E, 5-GGAACGAGCTGCTGATCGCCTCCTCCTCCCACGAGTCCATAGCTGTGAAAGATGGG (forwardSEQ ID NO: 3) and 5-CCCATCTTTCACAGCTATGGACTCGTGGGAGGAGGAGGCGATCAGCAGCTCGTTCC (reverseSEQ ID NO: 4); RXR/80, 5-CCGGAATTCGGaccacacccaccctgggc-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6); and RXR/100, 5-CCGGAATTCGGgtcagcagcagcgaggac-3 (forwardSEQ ID NO:5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO:6). PCR products were digested with EcoR I and Xho I, and ligated into pCMV-Myc vector.

(93) RXR (20 ng), RXR/F313S/R316E (20 ng), -galactosidase (100 ng), and/or Nur77 (100 ng) expression vectors were transiently transfected together with (TREpal) 2-tk-CAT (100 ng) (FIG. 11A) or RARE-tk-CAT (100 ng) (FIG. 11B) into CV-1 cells. Cells were treated with or without SR11237 (10.sup.6 M). CAT activity was determined.

(94) The mutant failed to respond to ligand-induced transactivation (FIG. 11) and showed reduced responses to Sulindac (FIG. 2G) (see Example 2).

Example 4

Inhibition of AKT Activation by Sulindac

(95) The inhibition of AKT (a key protein responsible for cancer cell survival) activation by Sulindac was investigated.

(96) HepG2, SW480, RAW264.7, HCT116, LNCaP, PC3, ZR-75-1, and HaCat cells were starved overnight and treated with Sulindac (100 M) for 1 hr and analyzed for AKT activation by immunoblotting (FIG. 3A). HepG2 cells were also transfected with RXR siRNA for 48 hours, treated with Sulindac (100 M) for 1 hour, and analyzed for AKT activation and RXR expression by immunoblotting (FIG. 3B).

(97) MEF and MCF-7 cells were starved overnight, pretreated with Sulindac for 1 hr, and stimulated with EGF (100 ng/ml) for 15 min. AKT activation was analyzed by immunoblotting (FIG. 12A). MEF and Caco-2 cells were starved overnight and pretreated with Sulindac for 30 min before exposure to all-trans-retinoic acid (ATRA) (10.sup.7 M) for 30 min and analyzed for AKT activation (FIG. 12B). AKT activation in ZR-75-1 breast cancer cells transfected with RXR siRNA for 48 hr before exposure to 9-cis-RA (10.sup.7 M) for 30 min was also analyzed by immunoblotting (FIG. 13C). A549 lung cancer cells transfected with RXR or control siRNA (FIG. 3C) and ZR-75-1 and PC3 cells (FIG. 3D) were pretreated with Sulindac (100 M) for 1 hr before exposure to TNF (10 ng/ml) for 30 min and analyzed for AKT activation and RXR expression by immunoblotting.

(98) Significant inhibition of basal AKT activation by Sulindac was observed in various cancer cells lines, including COX-2-negative SW480 and HCT116 colon cancer cells (FIG. 3A), suggesting a COX-2-independent mechanism. Sulindac failed to inhibit AKT activation by EGF, but potently inhibited AKT activation by retinoic acid. Transfection of RXR siRNA significantly reduced the constitutive AKT activation (FIG. 3B), similar to the effect of Sulindac. Treatment of cells with all-trans-RA (ATRA) for 30 min strongly induced AKT activation, which was inhibited by Sulindac in a dose dependent manner (FIG. 12B) and by RXR siRNA (FIG. 12C). Although Sulindac failed to inhibit AKT activation induced by epidermal growth factor (FIG. 12A), it potently inhibited AKT activation induced by retinoic acid in a RXR-dependent manner (FIGS. 12B,C). Thus, Sulindac can interfere with RA-induced rapid RXR-dependent AKT activation.

(99) Sulindac was examined for suppression of TNF induced AKT activation. TNF strongly activated AKT in A549 lung cancer cells, which was potently inhibited by Sulindac and RXR siRNA (FIG. 3C), suggesting that TNF activation of AKT was RXR-dependent. Although TNF failed to activate AKT in cells with high basal AKT activation (such as ZR-75-1 and PC3 cells) and Sulindac showed little inhibitory effect on AKT activation in these cells, a Sulindac combination with TNF synergistically, and almost completely, inhibited AKT activation (FIG. 3D). Thus, TNF is able to sensitize cancer cells to AKT inhibition by Sulindac, suggesting that TNF can prime cancer cells for their responsiveness to Sulindac, possibly by converting AKT activation from a RXR-independent to RXR-dependent manner.

(100) MCF-7 and baby hamster kidney (BHK) cells treated with 9-cis-RA (10.sup.7 M) for 30 min were analyzed for RXR-p85 interaction by co-immunoprecipitation using D20 or N197 anti-RXR antibody (FIG. 12D). H292 lung cancer cells treated with 9-cis-RA and/or Sulindac (100 M) for 30 min were analyzed for RXR-p85 interaction by co-immunoprecipitation using N197 antibody (FIG. 12E). Sulindac failed to inhibit AKT activation by EGF, but potently inhibited AKT activation by retinoic acid. Further, 9-cis-retinoic acid promoted tRXR interaction with p85 when N197 anti-RXR, but not D20 anti-RXR antibody, was used.

Example 5

Interaction of p85 with tRXR and RXR

(101) RXR interaction with p85 was examined. Anti-RXRcustom character antibodies (Santa Cruz Biotechnology, Santa Cruz, Calif.) were used in co-immunoprecipitation (Co-IP) and Western blotting (WB) assays. BHK cells were treated with ATRA (10.sup.7 M) for 30 min. Lysates were prepared and analyzed for RXR-p85custom character interaction using either D20 anti-RXR or N197 anti-RXR antibody (FIG. 12D).

(102) An initial attempt using anti-RXR antibody against sequences in the NH2 terminus of RXR (D20) by co-immunoprecipitation assays failed to detect clear interaction, although the antibody effectively immunoprecipitated the RXR protein. However, when another anti-RXR antibody against the COOH-terminal ligand-binding domain (LBD) of RXR (N197) was used, p85 was readily co-immunoprecipitated in a TNF (FIG. 3E) or RA-dependent manner (FIGS. 12D,E). D20 anti-RXR antibody recognized amino acids 2-21 in the N-terminal A/B domain, while N197 anti-RXR antibody recognized the C-terminal E/F domain (FIG. 3E). Co-immunoprecipitation of p85 by the N197 anti-RXR antibody was accompanied by immunoprecipitation of a truncated RXR (tRXR), which was not detected by D20 RXR antibody, indicating its lack of N-terminal sequences (FIG. 12D). Using the N197 anti-RXR antibody, interaction of p85 with tRXR and/or RXR was enhanced by TNF and inhibited by Sulindac (FIG. 3E). Interaction of p85 with tRXR in the presence of TNF was also inhibited by Sulindac (FIG. 12E). These results suggest that tRXR binds to p85, leading to AKT activation.

Example 6

Amino Acids 80 to 100 of RXR are Critical for Binding to p85

(103) Intracellular proteolytic cleavage was examined. Cells were treated with or without 9-cis-RA (10.sup.7 M) for 30 min and lysates were analyzed by immunoblotting using the N197 RXR antibody (FIG. 3F). The immunoblots demonstrated that RXR is often cleaved at its amino terminus in different cellular contexts and biological processes (FIG. 3F).

(104) A549 lung cancer cells were also treated with or without 9-cis-RA for 30 min. Nuclear (Nu) and cytoplasmic (Cyt) fractions were analyzed by immunoblotting using D20 or N197 anti-RXR antibody. To ensure the purity of preparations, fractions were also immunoblotted for the presence of Hsp60 (cytoplasmic specific) and PARP (nuclear specific) proteins (FIG. 13). Subcellular localization of endogenous RXR in MEFs was visualized by confocal microscopy after immunostaining using anti-RXR (N197). Cells were also stained with DAPI to visualize the nucleus (FIG. 4B).

(105) RXR was found at the plasma membrane (FIG. 4A, top panel) and displayed punctate structure on cell membrane in some cells (FIG. 4A, bottom panel). The production of a 44-kDa tRXRcustom character in MEFs was also regulated by cell density (FIG. 4A). Level of the 44-kDa tRXRcustom character observed in cells cultured at low density was reduced when cells were grown at high density, which was accompanied with appearance of a smaller RXRcustom character fragment. Interestingly, the levels of the 44-kDa tRXRcustom character protein correlated with AKT activation (FIG. 4A), suggesting that cell density-dependent proteolytic cleavage of RXRcustom character might be an important mechanism regulating AKT activation. Consistent with cytoplasmic localization of tRXRcustom character (FIG. 13), RXRcustom character was mainly found in the cytoplasm when MEF cells were immunostained by the N197 anti-RXRcustom character antibody (FIG. 4B). Thus, deletion of the very N-terminal end sequences of RXRcustom character could alter its subcellular localization, conferring its ability to interact with p85. Observations that p85 was co-immunoprecipitated with tRXR as described herein suggest that tRXR might bind to p85, leading to tRXR-dependent AKT activation.

(106) MEF cells were seeded at different cell densities and lysates were prepared and analyzed for AKT activation by immunoblotting. Lysates were also examined by immunoblotting using N197 anti-RXRcustom character antibody (FIG. 4A). Levels of tRXR in mouse embryonic fibroblasts (MEFs) correlated with AKT activation in a cell density-dependent manner (FIG. 4A). Consistent with the cytoplasmic localization of tRXR, MEFs often displayed plasma membrane localization of RXR (FIG. 4B).

(107) To directly address the role of tRXR in p85 interaction and AKT activation, a RXR mutant lacking its N-terminal 80 amino acids (RXR/80) was constructed, which produced a RXR mutant protein with a molecular weight similar to the endogenous tRXR. When Myc-tagged RXR/80 was cotransfected with Flag-p85 into cells, they interacted strongly, which was further enhanced by TNF (FIG. 5A). In contrast, the full-length RXR or RXR mutant lacking 100 N-terminal amino acids (RXR/100) failed to interact with Flag-p85 under the same conditions. Thus, amino acids 80 to 100 of RXR are critical for binding to p85. In support of this, the RXR N-terminal A/B domain (RXR/1-134), but not its LBD (RXR/224-462), interacted with p85 (FIG. 5B). Consistent with cytoplasmic localization of tRXR (FIG. 13) RXR/80 predominantly resided in the cytoplasm, displaying diffused and sometimes punctate plasma membrane localization (FIG. 5D). Transfection of RXR/80, but not RXR/100, also strongly activated AKT in various cell types (FIG. 5C).

(108) The RXR/80 immunocomplex was examined for PI3K activity in vitro. Myc-tagged RXR/80 and p85custom character were cotransfected into A549 cells, and the Myc-RXR/80-containing complex was immunoprecipitated by anti-Myc antibody and assayed for PI3K activity. Specific Myc-RXR/80 immunoprecipitates prepared from cells exhibited strong PI3K activity in a TNF-dependent manner (FIGS. 5E and 15), which correlated well with its ability to interact with p85custom character (FIG. 5A) and activation of AKT (FIG. 5C). Thus, TNF-induced tRXR/p85custom character interaction was found to activate PI3K/AKT signaling.

(109) RXR/80 was stably expressed in SW480 and HCT116 colon cancer cells, and the resulting stable clones, SW480/RXR/80 and HCT116/RXR/80, showed elevated AKT activation and induction of its downstream targets c-Myc and cyclin D1 (FIG. 5F). Clonogenic survival assays were used to evaluate the growth of SW480/RXR/80 and HCT116/RXR/80. The stable clones formed much more colonies than the control cells (FIG. 5G). The effect of RXR/80 on the growth of cancer cells was examined in animals. To this end, the same number of RXR/80-expressing cells or control cells were injected into different flanks of same nude mice and their growth was determined. Tumors formed by SW480/RXR/80 and HCT116/RXR/80 grew much faster than those formed by the control cells in animals (FIGS. 5H-I). Together, these results demonstrate that the N-terminally truncated RXRcustom character is a potent promoter of cancer cell growth in vivo.

Example 7

Endogenous tRXR in AKT Activation and Cell Transformation

(110) The observation that full-length RXR failed to interact with p85 suggested that the p85-binding motif in the A/B domain is masked in RXR. Thus, the N-terminal A/B domain of RXR could interact with the full-length RXR (Supp. FIG. 8a), revealing an intramolecular interaction.

(111) Expression vectors GFP-RXR/1-134 and Myc-RXR were transfected into HEK293T cells. Interaction was analyzed by Co-IP using anti-Myc antibody (Supp. FIG. 8a). The full-length RXR or RXR/1-134 fused with GFP at its N-terminal end and the full-length RXR tagged with the Myc epitope at its C-terminal end were cotransfected into HEK293T cells. Thirty-six hrs later, cell lysates were analyzed by IP and WB with an anti-Myc antibody.

(112) The N-terminal A/B domain bound to RXR (Supp. FIG. 8a). Expression of RXR N-terminal fragment induced RXR cleavage (Supp. FIG. 8b). Transfection of RXR/1-134 together with the full-length RXR enhanced levels of tRXR (Supp. FIG. 8b), likely due to its disruption of the intramolecular interaction by competition, resulted in the exposure of proteolytic sites in the RXR N-terminus.

(113) Transfection of the N-terminal region of RXR, RXR/1-134, could enhance the tRXR level (FIG. 14). To study the role of endogenous tRXR, RXR/1-134 was stably expressed in HeLa cells, and significantly increased tRXR protein in cells stably expressing RXR/1-134, which was accompanied by a decrease in endogenous full-length RXR protein (FIG. 4C). Compared to parental HeLa cells, the HeLa/RXR/1-134 stable clone had higher AKT activation (FIG. 4C) and grew rapidly in soft agar (FIG. 4D), suggesting a role for endogenous tRXR in AKT activation and cell transforming activity. In the colony formation assay, Sulindac strongly inhibited colonies formed by the stable clone (FIG. 4E). The clinical relevance of tRXR was illustrated by the presence of tRXR in tumor tissues from breast cancer patients, but not in the corresponding tumor surrounding tissues and normal tissues (FIG. 4F). Similar results were obtained in liver cancer patients. Immunohistochemical analysis of RXR in human liver cancer specimens revealed strong cytoplasmic RXR staining in tumor tissue, but not in the corresponding tumor surrounding tissue (FIG. 4G). Together, these results demonstrate that tRXR may contribute to the growth and survival of cancer cells by activating AKT, and that tRXR-mediated activities can be negatively regulated by Sulindac.

Example 8

Synthesis of Sulindac Analogs

(114) The finding that RXR served as an intracellular target of Sulindac action provided an opportunity to identify RXR-selective Sulindac derivatives for suppressing AKT activity. The binding of Sulindac to RXR and COX-2 (FIGS. 7A, 18B) was compared to design Sulindac analogs, which favor RXR binding, but disfavor COX-binding. Two dimensional structures of sulindac sulfide and indomethacin were compared (FIG. 18A). An overlay of Sulindac and indomethacin bound in the active site of COX-2 was generated (FIG. 18B). Sulindac was intuitively modeled to bind to COX-2 similar to indomethacin.

(115) Analogs were designed and synthesized (FIG. 19). Substituted indanone derivatives (4) were prepared using substituted benzaldehyde (1) as starting material. In a Perkin-reaction, derivative (1) was treated with appropriate anhydride to give derivative (2), which was then reduced by catalytic hydrogenation to give derivative (3). A polyphosphoric acid (PPA)-catalyzed intramolecular Friedel-Crafts acylation closed the 5-membered ring to give the 1-indanone derivative (4). Treatment of derivative (4) with the enolate generated from ethyl acetate and lithium hexamethyldisilylamide (LHMDS), followed by dehydration under acidic conditions gave the desired acetate (5). The produced indene-3-acetate (5) reacted with substituted benzaldehyde (Claisen-Schmidt-reaction) to give, after acidification, the Sulindac analogs (Z-6). One step for the synthesis of Sulindac analogs (9) is the samarium diiodide (SmI.sub.2)-mediated reductive coupling of 1-indanone derivative (4) with methyl acrylate, which gave spirolactone (7). Treatment of a methanolic solution of (7) with a catalytic amount of para-toluenesulfonic acid (p-TsOH) yielded the dehydrated product (8), which was subjected to Claisen-Schmidt-reaction and acidification to give Sulindac analogs (9). Noteworthy is that, in the Claisen-Schmidt-reactions of compounds (5/8), when R.sub.2CH.sub.3, cis (Z)-isomers of compounds (6/9) formed predominantly; while in the case of R.sub.2H, trans (E)-isomers of compounds (6/9) formed predominantly.

Example 9

Evaluation of Sulindac Analogs

(116) Docking of Sulindac to the LBP of RXR in reference to 9-cis-RA was evaluated to identify strategies for structural modifications of Sulindac to dissociate its COX inhibition from RXR-binding activity. The docking of Sulindac to RXR is shown in FIG. 7A. The orientation and position of docked Sulindac was compared to the crystal structures of 9-cis-RA, DHA and BMS649 (FIG. 7B). Sulindac bound in a mode where its carboxylate group was aligned with the carboxylate group found in all RXRcustom character ligands examined (FIG. 7B), interacting with Arg316 in the RXRcustom character LBP. The benzyl methyl sulfide portion of Sulindac bound to the hydrophobic region of the RXRcustom character LBP, overlapping with the a-ionone ring of 9-cis-RA. In this binding mode, Van der Waals interaction of the SCH3 group at position 4 (FIG. 7C) with the RXRcustom character protein was not optimal and there was space for modification to improve the binding to RXR The idea of making use of position 4 to design RXR-selective analogs was fully supported by the fact that sulindac prodrug, sulindac sulfoxide and the metabolite sulindac sulfone show no COX-inhibiting activity, whereas the metabolite sulindac sulfide (used herein) is a potent COX inhibitor (Haanen, 2001). As shown in FIG. 7A, the carboxylate group of Sulindac was positioned away from Arg316 compared to the equivalent ones in RXRcustom character ligands DHA, BMS649, and 9-cis-RA. Replacing CH2COOH at position D with a bulkier group such as CH2CH2COOH would help place the carboxylate group closer to Arg316 to achieve good charge-charge interaction with RXRcustom character as observed in 9-cis-RA.

(117) Candidate compounds were also examined by docking to the crystal structure of COX-2 (FIG. 18) to identify non-COX binders. Based on these considerations, five analogs were designed and synthesized (FIGS. 7C and 19). Their evaluation showed that all analogs retained RXR-binding activity, with K-80003 being the most potent (about 34-fold higher than Sulindac), likely due to its iso-propyl (i-Pr) group at position 4, which has improved interaction with the hydrophobic residues on Helix7 of RXR Significantly, K-80003 and K-80005 had no detectable inhibition of COX activities (FIG. 7C) and failed to inhibit constitutive and TNFcustom character (FIG. 7D) or IL-1 (not shown)-induced prostaglandin E2 (PGE2) production. The binding of K-80003 to RXR was also confirmed by 19F NMR binding assays (FIG. 7E). Thus, Sulindac's RXR-binding can be dissociated from its COX-binding.

(118) A549 cells were seeded in 24-well plates in DMEM with 10% fetal bovine serum. After overnight culture, cells were stimulated with 10 ng/ml IL-1 in DMEM medium without serum for 24 hr. After 10 min pretreatment with the indicated concentrations of Sulindac or analog, cells were co-treated with 10 M arachidonic acid and Sulindac or its analog for 30 min at 37 C. Medium was collected and immediately assayed. PGE2 production was measured with Prostaglandin E2 EIA Kit-Monoclonal according to the manufacturer's instructions (Cayman Chemical, Ann Arbor, Mich.). PGE2 production (%) is expressed as the ratio of PGE2 produced in the presence of compound to that with vehicle alone.

(119) Evaluation of the analogs showed that they all retained RXR-binding activity, with K-80003 being the most potent (about 34-fold higher than Sulindac) (FIG. 7C), likely due to the iso-propyl (i-Pr) group at position 4, which showed improved interaction with the hydrophobic residues on Helix7 of RXR. K-80003 and K-80005 had no detectable inhibition of COX activities (FIG. 7C) and did not inhibit constitutive or TNF- (FIG. 7D) or IL-1-induced prostaglandin E2 (PGE2) production (not shown). .sup.19F NMR spectra of K-80003 (100 M) were compared in the absence and presence of 10 M RXRcustom character LBD (FIG. 7E). Caco-2 and MEF cells were treated with the indicated concentration of Sulindac or K-80003 for 30 min, then stimulated with all-trans-RA (10.sup.7 M) for 15 min. AKT activation was analyzed by immunoblotting. PC3 cells transfected with RXR or RAR siRNA were pre-treated with K-80003 (50 M) for 1 hr before exposed to TNF (10 ng/ml) for 30 min (pRXR: phosphorylated RXR). A549 cells were transfected with Flag-p85 and Myc-RXR/80, treated with Sulindac (50 M) or K-80003 (50 M) for 1 hr, exposed to TNF for 30 min, and analyzed by coimmunoprecipitation using an anti-Flag antibody. K-80003 (50 M) was much more effective than Sulindac (50 M) in inhibiting ATRA-induced AKT activation (FIG. 20), and TNF-induced AKT activation (FIG. 8A), the colony formation of a HeLa/RXR/1-134 stable clone (FIG. 8B), and the interaction of p85 with RXR/80 (FIG. 8C). Reducing RXRcustom character expression by siRNA largely impaired the inhibitory effect of K-80003 on AKT activation in PC3 cells. In comparison, a reduction of RAR expression by RAR siRNA did not show such an effect. Thus, inhibition of AKT activation by K-80003 was also dependent on RXR expression (FIG. 8B).

(120) Co-immunoprecipitation assays demonstrated that the interaction of RXR/80 with p85custom character either in the absence or presence of TNFcustom character was potently inhibited by K-80003 as compared to the effect of Sulindac (FIG. 8C).

(121) ZR-75-1 cells were treated with TNF and/or Sulindac (75 M) or K-80003 (50 M) for 6 hr and analyzed by immunoblotting. K-80003 was also more effective than Sulindac in inducing PARP cleavage when used together with TNF in ZR-75-1 cells (FIG. 8D). Similar to Sulindac, K-80003 in combination with TNF synergistically induced PARP cleavage and caspase-8 activation in HepG2 and PC3 cells (FIG. 8E).

(122) In clonogenic survival assays, colony formation of HeLa/RXR/1-134 stable clone and RXR/80 stable clones was almost completely suppressed by K-80003, revealing its ability to inhibit cell growth (FIG. 8F). The inhibitory effect of K-80003 on AKT activation was abrogated by RXR, but not RAR siRNA (FIG. 8F), suggesting a role of RXR in mediating its effects.

(123) Mice (n=6) were treated intraperitoneally with corn oil, Sulindac (60 mg/kg), or K-80003 (60 mg/kg) for two weeks. Tumors were removed and measured. Significantly, K-80003 exhibited a much more potent inhibitory effect than Sulindac on the growth of RXR/80 tumor in animals (FIG. 8G). Together, the RXR-selective Sulindac analog K-80003 is a potent inhibitor of RXR-mediated PI3K/AKT signaling and cancer cell growth.

Example 10

Screening Sulindac Analogs in a Mammal

(124) A panel of Sulindac analogs is selected to screen for a compound with the ability to induce apoptosis in cells. Each candidate compound is introduced to a mouse and analyzed to determine whether it is capable of suppressing the activity of AKT, activating caspase-8, activating BAX, inhibiting cFLIP, and/or degrading Bid in cells. Compounds identified during the screening can be used for further screening assays or methods of treatment as disclosed herein.

Example 11

Treating Cancer in a Human Patient

(125) A human patient in need treatment for cancer is identified and administered a compound known to interact with RXR and function independent of the COX-2 pathway. The patient is monitored for stabilization or improvement of cancer resulting from administration of the compound. An antitumorigenic effect is observed in the patient following administration of the compound.

Example 12

Preventing Cancer in a Human Patient

(126) A human patient with an elevated risk of developing cancer relative to the general population is identified and instructed to take a 150 mg tablet containing the active ingredient K-80003 twice daily. The patient is monitored and does not develop cancer following administration of the compound.

Example 13

Sulindac Activation of TNF-Induced Extrinsic Apoptotic Pathway

(127) HepG2 cells cultured in medium with 1% FBS were treated with SR11237 (1 M) for 1 hr, then TNFcustom character (10 ng/ml) and/or Sulindac (75 M) for 4 hr, and analyzed by immunoblotting. HepG2 cells transfected with control or RXRcustom character siRNA were treated with TNFcustom character and/or Sulindac and analyzed by immunoblotting.

(128) Treatment of HepG2 liver cancer cells (FIG. 6A) and other cancer cell lines (FIGS. 16 and 17) with Sulindac and TNF effectively induced PARP cleavage and caspase-8 activation (indicated by cleaved caspase-8 products, p43/p41), while treatment of these cells with either Sulindac or TNF alone had little effect. The apoptotic effect of Sulindac/TNF combination was partially suppressed by RXR-selective ligand SR11237 (FIG. 6A) or transfection of RXR siRNA (FIG. 6B), again demonstrating a role for RXR.

(129) HepG2 cells transfected with control or caspase-8 siRNA or pretreated with ZIETD-fmk (40 M) for 1 hr were treated with TNFcustom character and Sulindac and analyzed by immunoblotting. a complete suppression of Sulindac/TNF-induced PARP cleavage (FIGS. 6C and 16B-C). Similar results were obtained when cells were transfected with Caspase-8 siRNA (FIGS. 6D and 16D). Thus, Sulindac/TNF-induced apoptosis is mediated by the extrinsic apoptotic pathway.

(130) Activation of Bax by Sulindac and TNF HepG2 cells treated with TNF and/or Sulindac were immunostained with Bax/6A7 antibody. About 15% Sulindac-treated cells while about 60% Sulindac/TNF-treated cells showed Bax staining. Potential Sulindac activation of the extrinsic apoptotic pathway resulted in Bax activation was also examined. HepG2 cells treated with TNF or Sulindac alone or together were examined for Bax activation by immunostaining using conformation-sensitive Bax/6A7 antibody. Significant Bax staining was observed only when cells were treated with both TNF and Sulindac (FIG. 6E). Cross-talk between extrinsic and intrinsic apoptotic pathways can be linked through Bid cleavage and activation (Li et al., Cell 94 (4), 491-501 (1998)). Indeed, Bid was significantly degraded in cells treated with TNF and Sulindac (FIG. 6A), suggesting that Sulindac/TNF-induced Bax activation might be mediated through Bid activation.

(131) PC3 cells transfected with CA-AKT or DN-AKT were treated with TNF and/or Sulindac, and analyzed by immunoblotting (FIG. 6F). Activation of caspase-8 (FIG. 6G) and Bax (FIG. 6H) by Sulindac and TNF HepG2 cells transfected with CA-AKT were treated with TNFcustom character and Sulindac, and immunostained with anti-cleaved caspase-8 or Bax/6A7 antibody. About 80% nontransfected and 15% CA-AKT-transfected cells showed caspase-8 staining. About 60% nontransfected and about 13% CA-AKT-transfected cells exhibited Bax staining. Sulindac/TNF-induced PARP cleavage was inhibited by transfection of constitutive-active AKT (CA-AKT) but enhanced by transfection of dominant-negative AKT (DN-AKT) (FIG. 6F). Consistently, induction of apoptosis (FIG. 17B) and activation of caspase-8 (FIG. 6G) and Bax (FIG. 6H) by Sulindac/TNF combination was inhibited by CA-AKT.

(132) Cells treated with TNF and/or Sulindac for 6 hr were analyzed by immunoblotting (FIG. 6I). The expression of c-FLIP, a downstream target gene of AKT signaling, which acts as a potent inhibitor of the extrinsic apoptotic pathway by inhibiting caspase-8 activation, was examined. Treatment of HepG2, A549, and SW480 cells with TNF resulted in strong induction of both short form (c-FLIPS) and long form (c-FLIPL) of c-FLIP, which was inhibited by Sulindac (FIG. 6I). Thus, Sulindac may induce apoptosis by suppressing the inducing effect of TNF on c-FLIP expression.

Example 14

Growth Inhibition in Breast Tumor with K-80003

(133) The growth inhibitory effect of oral administration of K-80003 on MCF-7 breast tumor tissue grown in mice was investigated. K-80003 was dissolved in NaHCO.sub.3 (pH 8.0). Mice with MCF-7 breast tumor tissue were administered 15 mg/kg K-80003, 30 mg/kg K-80003, 60 mg/kg K-80003, or a control in 100 ul total volume by gavage once daily. Tumor volume measured over 20 days indicated that mice treated with oral K-80003 exhibited a dose-dependent decrease in tumor volume compared to mice treated with control (FIG. 21A).

Example 15

Preclinical Studies of K-80003

(134) Preclinical studies of K-80003 were performed, including the investigation of toxicity, bioavailability, and pharmacokinetics. K-80003 exhibited very low toxicity (FIG. 22A), increased bioavailability in oral compared to intravenous formulation (FIG. 22B), and desirable PK profiles (FIG. 22C).

Example 16

Production of Analogs

3-(4-Fluorophenyl)-2-methylacrylic acid (2a)

(135) ##STR00014##

(136) Propionic anhydride (31.0 mL, 242 mmol) was added to potassium carbonate (18.2 g, 132 mmol) at 0 C. After stirring for 5 min to mix up, p-fluorobenzaldehyde (1a) (13.0 mL, 120 mmol) was added. The mixture was heated at 160 C. for 12 h. After cooling with an ice bath, to the reaction mixture was added water. The resultant yellow precipitate was filtered, and washed with EtOAc to yield the crude acid 2a, which was used in the next step as it was. An analytical sample of the known acrylic acid 2a ((40) was obtained by recrystallization from MeOH. 2a: pale yellow crystals. M.p. 155-158 C. (MeOH). IR (KBr): .sub.max=3429, 3076, 2972, 1665, 1596, 1508, 1425, 1313, 1298, 1224 cm.sup.1; .sup.1H NMR (400 MHz, CD.sub.3OD) : 2.09 (s, 3H, CCH.sub.3), 7.22-7.11 (m, 2H, Ph-H), 7.52-7.43 (m, 1H, Ph-H), 7.69 (s, 1H, CHCCH.sub.3) ppm; .sup.13C NMR (100 MHz, CD.sub.3OD) : 12.7, 114.8, 115.1, 131.4, 131.5, 132.1, 132.2, 137.5, 161.3, 163.75, 170.4 ppm; MS (ESI) m/z 179 (M-H.sup.+).

3-(4-Fluorophenyl)-2-methylpropanoic acid (3a)

(137) ##STR00015##

(138) A mixture of the crude acrylic acid 2a (14.3 g, 79.4 mmol) and 10% Pd/C (1.35 g) in methanol (190 mL) was hydrogenated under 20 atm of hydrogen for 10 h. The catalyst was filtered off and the filtrate concentrated to give crude 3a, which was used in the next step as it was. An analytical sample of compound 3a (40) was obtained by flash column chromatography on silica gel (ethyl acetate:PE, 1:2). 3a: colorless oil. IR (film): .sub.max=3406, 2972, 2933, 1701, 1560, 1509, 1460, 1406, 1223 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.17 (d, J=6.82 Hz, 3H, CHCH.sub.3), 2.77-2.61 (m, 2H, CH.sub.2CH), 3.02 (dd, J=13.18, 6.35 Hz, 1H, CH.sub.2CH), 7.00-6.93 (m, 2H, Ph-H), 7.16-7.11 (m, 2H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 16.4, 38.4, 41.4, 115.1, 115.1, 130.3, 130.4, 134.5, 134.6, 160.4, 162.8, 182.6 ppm; MS (ESI) m/z 181 (M-H.sup.+).

6-Fluoro-2-methyl-2,3-dihydroinden-1-one (4a)

(139) ##STR00016##

(140) A mixture of the crude propanoic acid derivative 3a (3.20 g), and polyphosphoric acid (47.0 g) was heated at 80 C. for 4 hours. The resulting mixture was poured into ice water and extracted with EtOAc. The combined extracts were washed with a saturated aqueous NaHCO.sub.3 to remove the starting acids, and then washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentration under reduced pressure. The residue was purified by flash column chromatography (ethyl acetate:PE, 1:30) to give compound 4a (40) as a pale yellow oil (1.44 g, 50%). The NaHCO.sub.3 layer was acidified with conc. HCl, extracted with EtOAc (330 mL). The combined extracts were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to give the recovered starting material 3a (34%). The data for 4a: IR (film) .sub.max=3064, 2968, 2932, 2873, 1716, 1611, 1509, 1486, 1444, 1264, 1158 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.32 (d, J=7.37 Hz, 3H, CHCH.sub.3), 2.82-2.65 (m, 2H, CH.sub.2CH), 3.37 (dd, J=16.71, 7.55 Hz, 1H, CH.sub.2CH), 7.33-7.26 (m, 1H, Ph-H), 7.44-7.36 (m, 2H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 16.2, 34.4, 42.9, 76.3, 109.7, 109.9, 122.2, 122.5, 127.8, 127.9, 138.1, 148.8, 149.6, 161.1, 163.6, 208.5 ppm; MS (ESI) m/z 187 (M+Na.sup.+).

Ethyl 2-(6-Fluoro-2-methyl-3H-inden-1-yl)acetate (5a)

(141) ##STR00017##

(142) To a solution of HMDS (15.0 mL, 56.9 mmol) in anhydrous THF (38.0 mL) at 0 C. was added dropwise n-BuLi (2.5 M solution in n-hexane, 17.0 mL, 42.8 mmol). After stirring for about 30 min, the mixture was cooled to 78 C. and was added EtOAc (4.20 mL, 42.8 mmol). The mixture was stirred at 78 C. for another 30 min. To the resulting mixture was added dropwise a solution of indenone 4a in anhydrous THF (40 mL). The mixture was stirred at 78 C. for another 4 h and then quenched with a saturated aqueous NH.sub.4Cl. The mixture was extracted with EtOAc (320 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentration under reduced pressure. To the residue was added HOAc/H.sub.2SO.sub.4 (10/1, 55 mL). After stirring for 5 hours at r.t., the mixture was extracted with CH.sub.2Cl.sub.2 (315 mL). The combined extracts were washed successively with water, saturated NaHCO.sub.3, and brine, dried over Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:30) to give compound 5a (40) as a colorless oil (3.26 g, 70%). IR (film) .sub.max=2981, 2911, 1736, 1614, 1590, 1473, 1368, 1329, 1308, 1256, 1154, 1034 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.25 (t, J=7.13 Hz, 3H, COOCH.sub.2CH.sub.3), 2.12 (s, 3H, CCH.sub.3), 3.29 (s, 2H, PhCH.sub.2C), 3.48 (s, 2H, PhCCH.sub.2), 4.14 (q, J=7.13 Hz, 2H, COOCH.sub.2CH.sub.3), 6.79 (ddd, J=9.62, 8.12, 2.41 Hz, 1H, Ph-H), 6.96 (dd, J=9.33, 2.40 Hz, 1H, Ph-H), 7.25 (dd, J=8.17, 4.93 Hz, 1H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.1, 14.3, 31.5, 42.1, 60.9, 105.6, 105.9, 110.2, 110.4, 123.6, 123.7, 129.6, 129.6, 137.2, 137.2, 144.6, 147.8, 147.9, 161.2, 163.6, 170.7 ppm; MS (ESI) m/z 257 (M+Na.sup.+).

(Z)-2-(3-(4-(Methylthio)benzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (Sulindac sulfide) (6a)

(143) ##STR00018##

(144) To a solution of indene 5a (650 mg, 3 mmol) in MeOH (4.6 mL) was added 2N NaOMe (4.6 mL, 9 mmol) at room temperature to get an orange mixture. After stirring for 20 min, to the mixture was added p-(methylthio)benzaldehyde (0.8 mL, 7.5 mmol). The resulting mixture was refluxed at 80 C. for 3.5 h. After concentration under reduced pressure, the residue was poured into a 1N HCl solution. After stirring for another 10 h at room temperature, the mixture was extracted with EtOAc (315 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash chromatography (ethyl acetate:PE, 1:2.5) to give predominantly the cis (Z) isomer 6a (Sulindac sulfide) (40) as a yellow solid (868 mg, 85%). The trans (E) isomer was obtained in about 2%. M.p. 182-185 C. (EtOAc) (lit. (40) M.p. 180-184 C.). IR (KBr) .sub.max=3445, 3012, 2914, 2850, 1702, 1602, 1589, 1465, 1410, 1320, 1240, 1171, 1085 cm.sup.1; .sup.1H NMR (400 MHz, DMSO-d.sub.6) : 2.15 (s, 3H, CCCH.sub.3), 2.54 (s, 3H, SCH.sub.3), 3.57 (s, 2H, CH.sub.2COO), 6.77-6.71 (m, 1H, vinyl H), 7.01 (dd, J=9.31, 2.25 Hz, 1H, vinyl H), 7.25-7.46 (m, 5H, Ph-H), 12.40 (s, 1H, COOH) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.7, 14.7, 31.5, 106.1, 106.4, 110.6, 110.8, 123.4, 123.5, 125.8, 130.0, 130.3, 131.0, 132.1, 132.6, 138.5, 139.5, 139.5, 139.5, 147.2, 147.3, 161.5, 161.6, 172.1 ppm; MS (ESI) m/z 331 (M+Na.sup.+).

(145) Following the procedure described for Sulindac sulfide (6a), and by condensation of indene 5a with an appropriate aromatic aldehyde, compounds K-80001 to K-80003 were synthesized, respectively.

(Z)-2-(3-(4-Methylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6b) (K-80001)

(146) ##STR00019##

(147) Yellow solid. M.p. 155-158 C. yield: 87%. IR (KBr) .sub.max=3426, 3022, 2959, 2915, 1733, 1717, 1655, 1599, 1512, 1470, 1408, 1381, 1214, 1172 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.19 (s, 3H, CCCH.sub.3), 2.41 (s, 3H, Ph-CH.sub.3), 3.58 (s, 2H, CH.sub.2CO.sub.2H), 6.59-6.53 (m, 1H, vinyl H), 6.87 (dd, J=8.98, 2.40 Hz, 1H, vinyl H), 7.44-7.16 (m, 6H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.61, 21.43, 29.73, 31.44, 105.54, 105.77, 110.48, 110.71, 123.73, 123.83, 129.21, 129.32, 129.78, 129.80, 129.84, 129.87, 131.00, 131.02, 133.48, 138.29, 138.95, 139.76, 146.13, 146.22, 161.84, 164.29, 176.68 ppm; MS (ESI) m/z 363 (M+Na.sup.+). Anal. Calcd for C.sub.20H.sub.17FO.sub.2: C, 77.90; H, 5.56. Found: C, 77.88; H, 5.99.

(Z)-2-(3-(4-Ethylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6c) (K-80002)

(148) ##STR00020##

(149) Yellow solid. M.p. 159-162 C. yield: 83%. IR (KBr) .sub.max=3082, 3024, 2965, 2923, 1705, 1604, 1473, 1465, 1413, 1312, 1229, 1168 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.29 (t, J=7.61 Hz, 3H, CH.sub.2CH.sub.3), 2.20 (s, 3H, CCCH.sub.3), 2.71 (q, J=7.60 Hz, 2H, CH.sub.2CH.sub.3), 3.59 (s, 2H, CH.sub.2COO), 6.60-6.54 (m, 1H, aromatic vinyl H), 6.88 (dd, J=8.97, 2.39 Hz, 1H, aromatic vinyl H), 7.19-7.44 (m, 5H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.6, 15.4, 28.7, 31.4, 105.5, 105.7, 110.5, 110.7, 123.7, 123.8, 128.0, 129.4, 129.7, 129.9, 131.0, 133.7, 138.9, 139.7, 144.6, 161.8, 164.2, 176.4 ppm; MS (ESI) m/z 345 (M+Na.sup.+). Anal. Calcd for C.sub.21H.sub.19FO.sub.2: C, 78.24; H, 5.94. Found: C, 78.21; H, 5.55.

(Z)-2-(3-(4-Iso-propylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6d) (K-80003)

(150) ##STR00021##

(151) Yellow solid. M.p. 146-149 C.; yield: 79%. IR (KBr) .sub.max=3025, 2958, 2871, 1701, 1629, 1603, 1507, 1464, 1412, 1315, 1293, 1171, 1134 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.31 (d, J=6.95 Hz, 6H, CH(CH.sub.3).sub.2), 2.20 (s, 3H, CCCH.sub.3), 2.97 (td, J=13.81, 6.91 Hz, 1H, CH(CH.sub.3)2), 3.59 (s, 2H, CH.sub.2COO), 6.61-6.88 (m, 2H, aromatic vinyl H), 7.19-7.46 (m, 6H, Ph-H); .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.6, 23.9, 31.3, 34.0, 76.7, 105.5, 105.7, 110.5, 110.7, 123.7, 123.8, 126.5, 129.4, 129.7, 129.8, 131.0, 133.7, 139.0, 139.6, 146.1, 146.2, 149.3, 161.8, 164.2, 176.1 ppm; MS (ESI) m/z 359 (M+Na.sup.+). Anal. Calcd for C.sub.22H.sub.21FO.sub.2: C, 78.55; H, 6.29. Found: C, 78.13; H, 6.02.

Ethyl 2-(6-fluoro-3H-inden-1-yl)acetate (5b)

(152) ##STR00022##

(153) To a solution of iso-propylamine (0.27 mL, 2 mmol) in anhydrous THF (4 mL) at 0 C. was added dropwise n-BuLi (2.5 M solution in n-hexane, 0.8 mL, 2 mmol). After stirring for about 30 min., the mixture was cooled to 78 C. and EtOAc (0.2 mL, 2 mmol) was added. After stirring at 78 C. for another 30 min., indenone 4b (150 mg, 1 mmol) in anhydrous THF (0.7 mL) was added dropwise. The mixture was stirred at 78 C. for another 2 h and then was quenched with saturated NH.sub.4Cl. The mixture was extracted with EtOAc (35 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was taken with AcOH/H.sub.2SO.sub.4 (10/1, 3 mL). After stirring for 3 h at r.t., the mixture was extracted with CH.sub.2Cl.sub.2 (35 mL). The combined extracts were washed successively with water, saturated NaHCO.sub.3, and brine. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:30) to give 5b as a colorless oil (99 mg, 49%). IR (film) .sub.max=3054, 2982, 2931, 1704, 1636, 1486, 1446, 1369, 1345, 1288, 1276 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.28 (t, J=7.15 Hz, 3H, CH.sub.2CH.sub.3), 3.35 (s, 2H, CH.sub.2CO.sub.2Et), 3.56 (dd, J=2.93, 1.51 Hz, 2H, CH.sub.2CH), 4.19 (q, J=7.15 Hz, 2H, CH.sub.3CH.sub.2), 6.52 (s, 1H, CCH), 6.93-7.36 (m, 3H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.2, 34.1, 37.4, 61.0, 106.4, 106.7, 111.4, 111.6, 124.3, 124.4, 134.1, 136.3, 136.4, 139.2, 139.3, 146.3, 146.4, 161.1, 163.5, 170.72 ppm. Anal. Calcd for C.sub.13HFO: C, 70.90; H, 5.95. Found: C, 71.30; H, 6.23.

(E)-2-(3-(4-(Methylthio)benzylidene)-6-fluoro-3H-inden-1-yl)acetic acid (6e) (K-80004)

(154) ##STR00023##

(155) To a solution of indene derivative 5b (506 mg, 2.50 mmol) in MeOH (4 mL) was added 2N NaOMe (4 mL, 4 mmol) at room temperature. After stirring for 20 min, to the resulting mixture was added p-(methylthio)benzaldehyde (0.65 mL, 2.50 mmol). The mixture was refluxed at 80 C. for 3.5 h. The resulting solution was concentrated under reduced pressure, and then poured into 1N HCl. After stirring for 10 hours at r.t., the mixture was extracted with EtOAc (310 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:2.5) to give trans (E) isomer 6e (K-80004) as a yellow solid (429 mg, 48%). M.p. 180-182 C. (EtOAc). .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.54 (s, 3H, SCH.sub.3), 3.69 (s, 2H, CH.sub.2COO), 7.09-7.84 (m, 9H, Ph-H), 12.52 (s, 1H, COOH) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 13.6, 115.5, 115.7, 127.3, 131.7, 131.8, 139.9, 161.5, 163.9, 174.0 ppm. Anal. Calcd for C.sub.19H.sub.15FO.sub.2S: C, 69.92; H, 4.63; F, 5.82; 0, 9.80; S, 9.82. Found: C, 70.16; H, 4.92.

Spiro(dihydro-2(3H)furanone-5-1(2H)(3H)-6-fluoro-indane (7a)

(156) ##STR00024##

(157) A solution of 6-fluoro-1-indanone 4b (75.0 mg, 0.50 mmol), iso-propanol (0.190 mL, 2.50 mmol), and methyl acrylate (0.45 mL, 5 mmol) in THF (10 mL) was purged with argon for 20 min and cooled to 0 C. A SmI.sub.2 (1.50 mmol) solution in THF (15 mL) was added through transfer needle. After 5 min, the reaction was quenched with sat. K.sub.2CO.sub.3 (2 mL). The resulting mixture was extracted with EtOAc (33 mL). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:6) to give compound 7a (74.5 mg, 0.37 mmol, 73%) as a colorless oil; IR (film) .sub.max: 3058, 2945, 2856, 1766, 1603, 1494, 1155 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.28-2.52 (m, 4H, ArCCH.sub.2), 2.77 (dt, J=8.0, 1.2 Hz, 2H, ArCCH.sub.2CH.sub.2CO), 2.81-2.90 (m, 1H, ArCH.sub.2), 3.00-3.09 (m, 1H, ArCH.sub.2), 6.96-7.03 (m, 2H, ArH), 7.18-7.23 (m, 1H, ArH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 28.7, 29.5, 33.3, 39.4, 94.1, 109.7 (d, J.sub.C-F=22.4 Hz) 116.6 (d, J.sub.C-F=22.5 Hz), 126.2 (d, J.sub.C-F=8.3 Hz), 138.8, 144.7 (d, J.sub.C-F=7.4 Hz), 162.2 (d, J.sub.C-F=233.5 Hz), 176.0 ppm; Anal. Calcd for C.sub.12H.sub.11FO.sub.2: C, 69.89; H, 5.38. Found: C, 69.97; H, 5.62.

Methyl 3-(6-Fluoro-3H-inden-1-yl) propanoate (8a)

(158) ##STR00025##

(159) To a solution of spiro(dihydro-2(3H)furanone-5-1(2H)(3H)-6-fluoro-indane 7a (61 mg, 3 mmol) in CH.sub.3OH (1.5 mL) was added p-TsOH (6 mg). The mixture was refluxed for 2 hours. The reaction was quenched with a saturated aqueous solution of NaHCO.sub.3 (2.0 mL). The resulting mixture was extracted with EtOAc (32 mL). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:300) to give compound 8a (61 mg, 0.28 mmol, 94%) as a pale yellow oil. IR (film) .sub.max: 2959, 2901, 1739, 1585, 1606, 1473, 1254, 1162 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.68-2.73 (m, 2H, CH.sub.2COO), 2.82-2.88 (m, 2H, ArCCH.sub.2), 3.28-3.31 (m, 2H, ArCH.sub.2), 3.71 (s, 3H, COOCH.sub.3), 6.30 (t, 1H, J=1.6 Hz, ArCCH), 6.83-6.91 (m, 1H, ArH), 7.02-7.06 (m, 1H, ArH), 7.33-7.38 (m, 1H, ArH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 22.9, 32.4, 37.3, 51.7, 106.0 (d, J.sub.C-F=23.1 Hz), 111.4 (d, J.sub.C-F=22.8 Hz), 124.4 (d, J.sub.C-F=8.9 Hz), 130.3, 139.5, 142.4 (d, J.sub.C-F=3.0 Hz), 146.9 (d, J.sub.C-F=8.5 Hz), 162.4 (d, J.sub.C-F=240.6 Hz), 173.4 ppm; Anal. Calcd for C.sub.13H.sub.13FO.sub.2: C, 70.90; H, 5.95. Found: C, 70.50; H, 5.97.

(E)-Methyl 3-(3-(4-(methylthio)benzylidene)-6-fluoro-3H-inden-1-yl)propanoate (9a) (K-80005)

(160) ##STR00026##

(161) A solution of methyl 3-(6-fluoro-3H-inden-1-yl) propanoate 8a (110 mg, 0.5 mmol) in CH.sub.3OH (1 mL) was purged with nitrogen for 10 min and cooled to 0 C. A freshly prepared CH.sub.3ONa (0.75 mmol) in CH.sub.3OH (1 mL) was added dropwise. After stirring for 30 min., 4-(methylthio)benzaldehyde (63 L, 0.6 mmol) was added dropwise. The mixture was refluxed for 2 hours. After cooling, the reaction was quenched with water (3 mL) and stirred at room temperature for 10 min. The mixture was acidified with 1 M HCl to reach pH=4. The solvent was evaporated under reduced pressure, and the residue was extracted with EtOAc (35 mL). The combined organic layers were washed with brine (2 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:4) to give trans (E)-isomer 9a (112 mg, 66%) as a yellow solid. M.p.: 182-184 C. (EtOAc); IR (KBr) .sub.max: 3055, 2988, 2925, 1711, 1640, 1488, 1445, 1656, 1290, 1277 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.53 (s, 3H, SCH.sub.3), 2.68 (t, 2H, J=7.6 Hz, CH.sub.2COO), 2.84 (t, 2H, J=7.6 Hz, ArCCH.sub.2), 6.96-7.84 (m, 9H, ArH), 12.21 (s, COOH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.3, 22.6, 32.0, 106.1 (d, J.sub.C-F=23.4 Hz), 111.5 (d, J.sub.C-F=23.0 Hz), 120.5 (d, J.sub.C-F=9.2 Hz), 122.6, 125.8 (2C), 127.3, 130.4 (2C), 132.8, 134.1, 136.4, 139.4, 143.2 (d, J.sub.C-F=8.8 Hz), 146.3, 162.2 (d, J.sub.C-F=240.5 Hz), 173.8 ppm; Anal. Calcd for C.sub.20H.sub.17FO.sub.2S: C, 70.57; H, 5.03; S, 9.42. Found: C, 70.20; H, 4.62; S, 9.01.

(162) K-80003 Analog No. 1 (R1 Variant; Yellow Solid):

(163) ##STR00027##
K-80003 Analog No. 2 (R1 Variant; Yellow Solid):

(164) ##STR00028##
K-80003 Analog No. 3 (R1 Variant; Yellow Solid):

(165) ##STR00029##
K-80003 Analog No. 4 (R1 Variant; Yellow Solid):

(166) ##STR00030##
K-80003 Analog No. 5 (R1 Variant; Yellow Solid):

(167) ##STR00031##
K-80003 Analog No. 6 (R1 Variant; Yellow Solid):

(168) ##STR00032##
K-80003 Analog No. 7 (R1 Variant; Yellow Solid):

(169) ##STR00033##
K-80003 Analog No. 8 (R2 Variant; Yellow Solid):

(170) ##STR00034##
K-80003 Analog No. 9 (R2 Variant; Yellow Solid):

(171) ##STR00035##
K-80003 Analog No. 10 (R2 Variant; Yellow Solid):

(172) ##STR00036##
K-80003 Analog No. 11 (R3 Variant; Yellow Solid):

(173) ##STR00037##
K-80003 Analog No. 12 (R3 Variant; Yellow Solid):

(174) ##STR00038##
K-80003 Analog No. 13 (R3 Variant; Yellow Solid):

(175) ##STR00039##
K-80003 Analog No. 14 (R3 Variant; Yellow Solid):

(176) ##STR00040##
K-80003 Analog No. 15 (R3 Variant; Yellow Solid):

(177) ##STR00041##
K-80003 Analog No. 16 (R3 Variant; Yellow Solid):

(178) ##STR00042##
K-80003 Analog No. 17 (R3 Variant; Yellow Solid):

(179) ##STR00043##
K-80003 Analog No. 18 (R3 Variant; Yellow Solid):

(180) ##STR00044##
K-80003 Analog No. 19 (R3 Variant; Yellow Solid):

(181) ##STR00045##
K-80003 Analog No. 20 (R3 Variant; Yellow Solid):

(182) ##STR00046##
K-80003 Analog No. 21 (R3 Variant; Yellow Solid):

(183) ##STR00047##
K-80003 Analog No. 22 (R4 Variant; Yellow Solid):

(184) ##STR00048##
K-80003 Analog No. 23 (R4 Variant; Yellow Solid):

(185) ##STR00049##
K-80003 Analog No. 24 (R4 Variant; Yellow Solid):

(186) ##STR00050##
K-80003 Analog No. 25 (R1 Variant):

(187) ##STR00051##
K-80003 Analog No. 26 (R1 Variant):

(188) ##STR00052##
K-80003 Analog No. 27 (R3 Variant):

(189) ##STR00053##
K-80003 Analog No. 28 (R3 Variant):

(190) ##STR00054##
K-80003 Analog No. 29 (R3 Variant):

(191) ##STR00055##
K-80003 Analog No. 30 (R3 Variant):

(192) ##STR00056##
K-80003 Analog No. 31 (R4 Variant):

(193) ##STR00057##
where R.sub.4=Et.
K-80003 Analog No. 32 (R4 Variant):

(194) ##STR00058##
where R.sub.4=EtO.
K-80003 Analog No. 33 (R4 Variant):

(195) ##STR00059##
where R.sub.4=i-Pr.
K-80003 Analog No. 34 (R4 Variant):

(196) ##STR00060##
where R.sub.4=Cl.
Summary of Methods
Plasmids

(197) The construction of RXR and Myc-RXR has been described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Cao, X., et al., Retinoid X receptor regulates Nur77/TR3-dependent apoptosis [corrected] by modulating its nuclear export and mitochondrial targeting. Mol Cell Biol 24(22), 9705-9725 (2004); Masia, S. et al., Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol Endocrinol 21 (10), 2391-2402 (2007); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009); Balkwill, F., Nat Rev Cancer 9 (5), 361-371 (2009); Han, Y. H. et al., Oncogene 25 (21), 2974-2986 (2006)). Flag-p85 was constructed by polymerase chain reaction (PCR) using forward primer, 5-ccggaattccatgagtgctgaggggtacc-3 (SEQ ID NO:1) and the reverse primer, 5-acgcgtcgactcatcgcctctgctgtgcat-3 (SEQ ID NO:2). PCR product was digested with Eco RI and Sal I and cloned into pCMV-Flag vector. RXR mutants were constructed using the QUIKCHANGE mutagenesis kit (Stratagene, La Jolla, Calif.) with the following oligonucleotides as primers: RXR/F313S/R316E, 5-GGAACGAGCTGCTGATCGCCTCCTCCTCCCACGAGTCCATAGCTGTGAAAGATGGG (forwardSEQ ID NO: 3) and 5-CCCATCTTTCACAGCTATGGACTCGTGGGAGGAGGAGGCGATCAGCAGCTCGTTCC (reverseSEQ ID NO: 4); RXR/A80, 5-CCGGAATTCGGaccacacccaccctgggc-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6); and RXR/100, 5-CCGGAATTCGGgtcagcagcagcgaggac-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6). PCR products were digested with EcoR I and Xho I, and ligated into pCMV-Myc vector.

(198) Cell Culture

(199) ZR-75-1 human breast cancer, LNCaP and PC3 prostate cancer, and H460 lung cancer cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS). HepG2 liver cancer and MCF-7 human cancer cells were maintained in MEM containing 10% FBS. HEK293T human embryonic kidney cells, CV-1 green monkey kidney cells, MEF cells, A549 human lung cancer cells, HaCat human keratinocyte cells, BHK baby hamster kidney cells, Caco2 human colon cancer carcinoma cells, SW480 human colon adenocarcinoma cells, and HCT116 human colon cells were maintained in DMEM supplemented with 10% FBS. The F9 murine embryonal carcinoma cell line had both alleles of RXR disrupted (Clifford, J. et al., Embo J 15 (16), 4142-4155 (1996)). The cell cultures were maintained at 37 C. in a 5% CO.sub.2 humidified atmosphere.

(200) Antibodies and Reagents

(201) Anti-phospho-Akt (Ser 473, D9E, #4060) was from Cell Signaling Technology (Danvers, Mass.). Anti--actin (A1978) and anti-Flag (M2, F3165) antibodies were obtained from Sigma-Aldrich (St. Louis, Mo.). Anti-p85 (#06-195) antibody was purchased from Millipore (Billerica, Mass.). Antibodies for Akt1(C-20) sc-1618, GFP (B-2) sc-9996, HSP60 (N-20) sc-1052, c-Myc (9E10) sc-40PI3, RAR (C-19) sc-550, RXR (D20) sc-553, RXR (N197) sc-774, PARP (H-250) sc-7150 were from Santa Cruz Biotechnology (Santa Cruz, Calif.). ECL, Anti-rabbit and anti-mouse IgG, Horseradish Peroxidase-Linked Species-Specific antibodies were from GE Healthcare (Little Chalfont, Buckinghamshire, UK). ALEXA FLUOR 594 goat anti-rabbit IgG (A-11012) and ALEXA FLUOR 488 goat anti-mouse IgG (A-10667) were purchased from Invitrogen (Carlsbad, Calif.). Protein A/G Plus-Agarose (sc-2003) was from Santa Cruz Biotechnology (Santa Cruz, Calif.). Recombinant Human TNF (210-TA) was from R&D Systems (Minneapolis, Minn.). Protease Inhibitor Cocktail Tablets were from Roche (Basel, Switzerland). 9-cis-retinoic acid (9-cis-RA) (R4643). Sulindac sulfide and its analogues were dissolved in dimethyl sulfoxides (DMSO) in stock solutions of 100 mM. All-trans-retinoic acid (ATRA) (R2625) and chymotrypsin were from Sigma-Aldrich (St. Louis, Mo.). SR11237 was kindly provided by Dr. Marcia I. Dawson (Burnham Institute).

(202) Ligand-Binding Assay

(203) Bacterially expressed His-tagged RXR ligand-binding domain (LBD) (aa 223-462) was incubated with [.sup.3H]-9-cis-RA (Amersham Biosciences, Amersham, UK) in ligand binding assay buffer in the presence or absence of various concentrations of unlabeled 9-cis-RA or sulindac sulfide. The RXR LBD protein was captured by nickel-coated beads. Bound radiolabeled 9-cis-RA was determined in a scintillation counter as described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005)).

(204) HPLC Analysis of Sulindac Sulfide Binding to RXR Protein in Cells

(205) Expression vector containing receptor fused to C-terminal TAP fusion (Stratagene, La Jolla, Calif.) was transfected into HEK293 cells using FuGene 6 transfection reagent (Roche, Basel, Switzerland). The cells were maintained in exponential growth in complete medium, DMEM (Mediatech Inc., Herndon, Va.) supplemented with 10% calf serum (SCS, Hyclone Logan, Utah), 2 mM glutamine, penicillin (100 U/ml) and streptomycin (100 g/ml). At two days post-transfection cells were switched into medium containing 400 mg/ml G418 until 20 days post-transfection, when dishes were scored for drug-resistant colonies. Expression of RXR fusion protein was determined by immunoblotting. Cells were grown to confluency in four 150 mm plates and subsequently treated with or without 100 mM sulindac sulfide for 3 hr. After treatment, cells were twice washed in 50 ml cold PBS and streptavidin based purification carried out as described in INTERPLAY Mammalian TAP System (Stratagene, La Jolla, Calif.) manual up through initial wash of streptavidin beads with provided streptavidin binding buffer. A 0.1 ml portion of dilute sulfuric acid solution (pH 2) was then added followed by 1.0 ml of acetonitrile. The samples were then vortexed for 30 sec on a vortex mixer and subsequently centrifuged (1000 g5 min). The liquid sample was then transferred to a second tube and evaporated to dryness under a stream of nitrogen. The residue was redissolved in 0.12 ml of chromatographic mobile phase, and a 0.1 ml portion was injected into the HPLC. HPLC analysis was performed using microsorb-mv 100-3 C18 1004.6 column (Varian, Palo Alto, Calif.). The mobile phase consisted of 4% v/v aqueous acetic acid and acetonitrile (30:70) pumped at flow rate of 1.0 ml/min. Detection of sulindac sulfide was performed using a photoarray detector (Waters model 2996, Waters Corporation, Milford, Mass.), which collected spectra between 200 and 450 nM. A standard solution of sulindac sulfide was used to obtain the calibration curve. Characteristic peak spectrum and retention time was used for identification, and peak areas at 4max used for quantification were calculated by using MILLENNIUM CHROMATOGRAPHY MANAGER software (Waters Corporation, Milford, Mass.). One of three similar experiments was shown.

(206) Proteolytic Protection Assay

(207) RXR LBD was synthesized by in vitro transcription-translation using rabbit reticulocyte lysates (Promega, Fitchburg, Wis.) as described previously (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Zhang, X. K. et al., Nature 355 (6359), 441-446 (1992); Zhang, X.-K. et al., Nature. 358 (6387), 587-591 (1992)). In vitro translated .sup.35[S]methionine labeled RXR-LBD was preincubated with solvent (1% DMSO), Sulindac (100 M) or 9-cis-RA (10.sup.7 M) for 30 min. and then digested with indicated concentration of chymotrypsin. Digested fragments were separated by PAGE.

(208) Transient Transfection Assays

(209) Cells (110.sup.5 cells/well) seeded in 24-well plates were transiently transfected using a modified calcium phosphate precipitation procedure as described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Cao, X., et al., Mol Cell Biol 24(22), 9705-9725 (2004)).

(210) Apoptosis Assays

(211) For nuclear morphological change analysis, cells were trypsinized, washed with PBS, fixed with 3.7% paraformaldehyde, and stained with DAPI (4,6-diamidino-2-phenylindole) (1 mg/ml) to visualize the nuclei by fluorescent microscopy (Masia, S. et al., Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol Endocrinol 21 (10), 2391-2402 (2007); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009); Balkwill, F., Nat Rev Cancer 9 (5), 361-371 (2009)). The percentages of apoptotic cells were determined by counting at least 300 GFP-positive cells having nuclear fragmentation and/or chromatin condensation. For the determination of DNA fragmentation, the Cell Death Detection ELISA.sup.PLUS (Roche Applied Science, Penzberg, Bavaria, Germany) was used. One of three similar experiments was shown.

(212) RXR and RAR siRNA

(213) RXR siRNA siGENOME SMARpool (M-003443-02), RAR siRNA siGENOME SMARpool (M-003439-01), and siRNA Non-specific Control IX (D-001206-09-05) were purchased from DHARMACON (Lafayette, Colo.). A 2.5 l aliquot of 20 mM siRNA/per well was transfected into cells grown in 12-well plates by using oligofectamine reagent (Invitrogen, Carlsbad, Calif.) according to manufacturer's recommendations. Two days after transfection the cells were harvested for Western blotting.

(214) Immunoblotting

(215) For immunoblotting, cell lysates were boiled in SDS sample buffer, resolved by SDS-polyacrylamide gel electrophoresis, and transferred to nitrocellulose. After transfer, the membranes were blocked in 5% milk in TBST (10 mM Tris-HCl, pH. 8.0, 150 mM NaCl, 0.05% Tween 20) containing antibody. The membranes were then washed three times with TBST, then incubated for 1 hr at room temperature in 5% milk in TBST containing horseradish peroxide-linked anti-immunoglobulin.

(216) Coimmunoprecipitation (CoIP) Assays

(217) For the CoIP assay, cells or cells transfected with indicated expression vectors were suspended in lysis buffer (50 mM Tris-HCl, pH 7.4; 150 mM NaCl; 20 mM EDTA; 1% NP-40; 1 mM PMSF; 50 mg/ml Leupeptin; 20 mg/ml Aprotinin; 0.1 mM Na.sub.3VO.sub.4; and 1 mM DTT). Cell extracts were cleared by incubation with the Protein A/G plus Agarose beads (Santa Cruz Biotechnology, Santa Cruz, Calif.) and then incubated with appropriate antibody and 30 ml of Protein A or G plus Agarose beads overnight at 4 C. Beads were then washed and boiled in Laemmli gel-loading solution before performing SDS-PAGE/immunoblotting using polyclonal or monoclonal antibodies. Immunoreactive products were detected by chemiluminescence with an enhanced chemiluminescence system (ECL) (Amersham Biosciences, Amersham, UK).

(218) HeLa-RXR/1-134 Stable Clone and Soft Agar Assay

(219) RXR N-terminal fragment, 1-134, was cloned into pNTAP vector (Stratagene, La Jolla, Calif.). The resulting pNTAP-RXR/1-134 was transfected into HeLa cells. 48 hr after transfection, cells were selected with 400 mg/ml G418 for 2 weeks. Single clones were picked up and examined by immunoblotting. HeLa RXR/1-134 stable clone and HeLa cells transfected with control pNTAP vector were seeded at 510.sup.3 cells/well (6 well plate) in DMEM supplemented with 10% FBS and 0.35% agarose with 0.5% bed agar. After 12 days incubation at 37 C., colonies were stained with 0.005% crystal violet for 1 h and counted.

(220) Colony Formation Assay

(221) HeLa RXR/1-134 stable clone and control HeLa cells were seeded in 6-well plate, 350 cells/well. Five days later, cells were treated with Sulindac (50 M) and K-80003 (25 M) in 0.5% serum medium for 3 days. After washed with PBS, cells were fixed with 4% paraformaldehyde in PBS for 20 min. Colonies were stained with 0.1% crystal violet for 30 min, and pictures were taken and colonies were counted.

(222) Human Tissues and Evaluation

(223) Breast and liver tumor tissues and their surrounding tissues were obtained by surgical resection from cancer patients. Histological normal specimens, which were about at least 35 cm distant from the tumor nodule, were obtained from the corresponding patients. The study was approved by Xiamen University Institute for Biomedical Research Ethics Committee, and all of the patients gave informed consent.

(224) Tissues from patients with primary hepatocellular carcinoma (HCC, n=6) or breast cancer (n=6) were collected for detecting the expression of RXR. For the immunoblotting assay, tumor and its surrounding tissues were separately prepared and lysed in a modified RIPA buffer. The lysates were electrophoresed on an 8% SDS-PAGE gel and transferred onto PVDF membranes. The membranes were sequentially incubated with N197 anti-RXR antibody (1:1000) overnight at 4 C. and horseradish peroxidase conjugated anti-rabbit IgG antibody (1:5000) at room temperature for 1 hr, and detected by enhanced chemiluminescence (ECL) (Amersham Biosciences, Amersham, UK). The stripped blots were reprobed with monoclonal anti-GAPDH antibody (1:2000) for loading control. For immunohistochemistry analysis, tissue sections were incubated with the N197 anti-RXR antibody (1:500) overnight at 4 C. and detected with goat antirabbit-specific immunoglobulins (1:100) at room temperature for 30 minutes. The slides were counterstained with hematoxylin.

(225) Confocal Microscopy

(226) Cells transfected with Myc-tagged RXR/80 and Flag-tagged p85 were seeded on chamber slides overnight. Cells were fixed in PBS containing 3.7% paraformaldehyde for 10 min and washed twice with PBS. Cells were then permeabilized with 0.1% triton X-100 in PBS for 5 min. Fixed cells were pre-incubated for 30 min in PBS containing 5% BSA at room temperature. Cells were stained with polyclonal anti-Myc antibody (1:500 dilution) and anti-Flag antibody (1:500 dilution) followed by Cy3-conjugated antirabbit IgG (1:1000, Sigma-Aldrich, St. Louis, Mo.) or FITC-labeled anti-mouse IgG (1:500, Sigma-Aldrich, St. Louis, Mo.). Confocal microscopy data shown in the manuscript are representative of at least three similar experiments.

(227) Subcellular Fractionation

(228) Subcellular fractionation was performed as described with minor modifications (Cao, X., et al., Mol Cell Biol 24(22), 9705-9725 (2004); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009)).

(229) Briefly, cells (110.sup.7 cells) suspended in 0.5 ml hypotonic buffer (250 mM sucrose, 20 mM HEPES-KOH, pH 7.4, 10 mM KCl, 10 mM MgCl.sub.2, 0.5 mM EGTA, 1.5 mM EDTA, pH 8.0, and 1 mM DTT) with proteinase inhibitors were homogenized and cell extracts were centrifuged at 800g for 10 min. The pellet containing nuclei was resuspended in 200 l 1.6 M sucrose in hypotonic buffer plus protease inhibitors and laid over 1 ml 2.0 M sucrose in the same buffer, then centrifuged at 150,000g for 90 min at 4 C. to obtain the nuclear fraction. The supernatant was centrifuged at 10,000g for 30 min at 4 C. to obtain cytoplasmic fractions. Nuclear and cytoplasmic fractions were resuspended in 100 l lysis buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 5 mM EDTA, pH 8.0) with a cocktail of proteinase inhibitors for immunoblotting analysis.

(230) COX Assays

(231) COX Fluorescent Activity Assay Kit (700200), COX Fluorescent Inhibitor Screening Assay Kit (700100) and Prostaglandin E2 Enzyme Immunoassay (EIA) Kit (514010) were obtained from Cayman Chemical (Ann Arbor, Mich.). COX-1 and COX-2 activity assay were performed according to the manufacturer's protocol.

(232) Chemical Synthesis

(233) The .sup.1H NMR and .sup.13C NMR spectra were recorded on a Bruker AV 400 spectrometer (Bremen, Germany). .sup.1H NMR spectra were registered in the indicated solvent, and chemical shifts are expressed in parts per million () relative to internal Me.sub.4Si. IR spectra were recorded on a Nicolet Avatar 360 FT-IR spectrophotometer (Thermo Fisher Scientific, Waltham, Mass.). Mass spectra were recorded with a Bruker Dalton Esquire 3000 plus (ESI direct injection) (Bremen, Germany). Elemental analyses were performed using a Vario RL analyzer. Melting points were determined on an X-4 Micromelting point apparatus and are uncorrected. The 6-fluoro-1-indanone 4b used in this study is commercially available. Tetrahydrofuran was distilled prior to use from sodium benzophenone ketyl. Dichloromethane was distilled from phosphorus pentoxide. Methanol was distilled from magnesium turnings and iodine. Silica gel (zhifu, 300-400 mesh) from Yantai Silica Gel Factory (China) was used for column chromatography, eluting (unless otherwise stated) with ethyl acetate/petroleum ether (PE) (60-90 C.) mixture or dichloromethane/methanol.

* * * * *

(234) While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, patents, patent applications and publications referred to herein are hereby incorporated by reference in their entireties.