Methods and compositions related to a retinoid receptor-selective pathway
09611235 ยท 2017-04-04
Assignee
Inventors
- Xiao-kun Zhang (San Diego, CA)
- Ying Su (San Diego, CA)
- Hu Zhou (San Diego, CA)
- Wen Liu (La Jolla, CA)
- Pei-Qiang Huang (Xiamen, CN)
Cpc classification
C07C57/62
CHEMISTRY; METALLURGY
C07D295/112
CHEMISTRY; METALLURGY
G01N2333/70567
PHYSICS
C07C255/57
CHEMISTRY; METALLURGY
C07C59/72
CHEMISTRY; METALLURGY
A61K38/191
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
C07D295/112
CHEMISTRY; METALLURGY
C07C59/72
CHEMISTRY; METALLURGY
C07C255/57
CHEMISTRY; METALLURGY
C07C57/62
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
Abstract
Provided herein are methods and compositions related to a retinoid receptor-selective pathway. As described herein, this pathway can be targeted to manipulate a tumor microenvironment. For example, the methods and compositions described herein can be used to induce apoptosis in a cancer cell. Further, the compositions described herein, including Sulindac and analogs thereof, can be used to target this pathway for the treatment or prevention of cancer in human patients.
Claims
1. A compound of formula (I), or a sodium salt thereof, having the structure: ##STR00061## wherein A is a phenyl, and wherein A is substituted by one or two substituents independently selected from the group consisting of C2-3 alkyl, n-butyl, iso-butyl, sec-butyl, CF.sub.3, a C3-C4 cycloalkyl, and a C4-C5 cycloalkylalkyl; wherein B is a fused phenyl, and wherein B is substituted by a fluoro; wherein R.sub.1 is (CR.sub.5R.sub.6).sub.nCOOH; wherein R.sub.2 is CH.sub.3; wherein R.sub.5 and R.sub.6 are H; and wherein n is 1 or 2.
2. A compound of formula (II), or a sodium salt thereof, having the structure: ##STR00062## wherein R.sub.1 is selected from the group consisting of CH.sub.2COOH and CH.sub.2CH.sub.2COOH; wherein R.sub.2 is CH.sub.3; and wherein R.sub.3 is selected from the group consisting of 4-CH.sub.2CH.sub.3, and 4-CH(CH.sub.3).sub.2.
3. The compound of claim 2, or a sodium salt thereof, selected from the group consisting of: ##STR00063##
4. The compound of claim 2, or a sodium salt thereof, selected from the group consisting of: ##STR00064##
5. The compound of claim 2, or a sodium salt thereof, having the structure: ##STR00065##
6. A compound, or a sodium salt thereof, having the structure: ##STR00066##
7. A pharmaceutical composition comprising a compound of claim 1, or a sodium salt thereof, and a pharmaceutically acceptable excipient.
8. A pharmaceutical composition comprising a compound of claim 2, or a sodium salt thereof, and a pharmaceutically acceptable excipient.
9. A pharmaceutical composition comprising a compound of claim 6, or a sodium salt thereof, and a pharmaceutically acceptable excipient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) Various embodiments disclosed herein are generally directed towards compositions and methods related to a retinoid receptor-selective pathway. This pathway can be manipulated as described herein to treat or reduce the risk of developing cancer.
(24) As shown herein, tRXR constitutively resides in the cytoplasm, interacts with p85, activates AKT, and confers anchorage-independent growth of cells. These observations reveal a tRXR-mediated survival pathway in cancer cells, providing new insights into the role of RXR and its ligands in cancer. Such activation of the PI3K/AKT survival pathway by proteolytic processing of RXR is similar to the activation of apoptotic pathways by truncated Bid (tBid) and the activation of the Notch pathway by truncated Notch protein. Interestingly, cleavage of Bid and Notch also alters their subcellular localization, similar to the effect on RXR truncation. The finding that RXR serves as an intracellular target of Sulindac action prompted the design of RXR-selective Sulindac derivatives for suppressing AKT activity described herein. For example, provided herein is the design and synthesis of a Sulindac-derived RXR ligand, K-80003, with greater affinity to RXR, and enhanced efficacy in inhibiting AKT, but lacking COX inhibitory activity. In addition, as described herein, the upregulation of endogenous TNF and/or the introduction of exogenous TNF may be useful in priming cancer cells for responsiveness.
(25) In some embodiments, the composition comprises a core structure having formula I:
(26) ##STR00003##
(27) In some embodiments, A is an aryl or a heteroaryl, and can optionally be substituted by R.sub.3 and 0, 1, or 2 R.sub.4. In some embodiments, B is an aryl or a heteroaryl, and can optionally be substituted by 0, 1, or 2 R.sub.4. In some embodiments, R.sub.1 is (CR.sub.5R.sub.6).sub.nCOOH. In some embodiments, R.sub.2 is selected from the group consisting of H, a C.sub.1-10 alkyl, an arylalkyl, a cycloalkyl, a cycloalkylalkyl, a haloalkyl, alkylO, alkylS, haloalkylO, NH.sub.2, and alkylN. In some embodiments, R.sub.3 and R.sub.4 are independently selected from the group consisting of H, a C.sub.1-10 alkyl, a haloalkyl, a halo, CN, an aryl, a heteroaryl, an arylalkyl, a heteroarylalkyl, alkylO, alkylS, (CR.sub.4R.sub.6).sub.nCONR.sub.7R.sub.8, OH, a cycloalkyl, a cycloalkylalkyl, cycloalkylO, and an alkoxyalkyl. In some embodiments, R.sub.5 and R.sub.6 are independently selected from the group consisting of H, a C.sub.1-7alkyl, OH, an alkoxy, and a cycloalkyl; or together form a cycloalkyl or heterocyclyl group. In some embodiments, n is selected from the group consisting of 0, 1, 2, and 3.
(28) In some embodiments, the composition comprises a core structure having formula II:
(29) ##STR00004##
(30) In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.2COOH and CH.sub.2CH.sub.2COOH. In some embodiments, R.sub.2 is selected from the group consisting of CH.sub.3 and H. In some embodiments, R.sub.3 is selected from the group consisting of 4-SCH.sub.3, 4-CH.sub.3, 4-CH.sub.2CH.sub.3, and 4-CH(CH.sub.3).sub.2.
(31) In some embodiments, the composition comprises a core structure having formula III:
(32) ##STR00005##
(33) In some embodiments, n=2. In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.3, F, and Cl. In some embodiments, R.sub.2 is selected from the group consisting of H, CH.sub.3, Cl, and F. In some embodiments, R.sub.3 is selected from the group consisting of CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C(CH.sub.3).sub.3, CH.sub.2Cl, OCH.sub.3, and SCH.sub.3. In some embodiments, B and/or D is a hetero ring (e.g., limited to a hetero atom).
(34) In some embodiments, COOH from formula III is replaced with tetrazole. For example, in some embodiments, the composition comprises a core structure having formula IV:
(35) ##STR00006##
(36) In some embodiments, n=2. In some embodiments, R.sub.1 is selected from the group consisting of CH.sub.3, F, and Cl. In some embodiments, R.sub.2 is selected from the group consisting of H, CH.sub.3, Cl, and F. In some embodiments, R.sub.3 is selected from the group consisting of CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C(CH.sub.3).sub.3, CH.sub.2Cl, OCH.sub.3, and SCH.sub.3. In some embodiments, B and/or D is a hetero ring (e.g., limited to a hetero atom).
(37) In some embodiments, the composition comprises a core structure having formula V:
(38) ##STR00007##
(39) In some embodiments, R.sub.1 is selected from the group consisting of COOH, CH.sub.2CH.sub.2COOH, CHCHCOOH, CH.sub.2-Tetrazole, CH.sub.2CH.sub.2-Tetrazole, CH.sub.2COOCH.sub.3, CH.sub.3, CH.sub.2CONH.sub.2, CH.sub.2CONHCH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, and CH.sub.2NH.sub.2. In some embodiments, R.sub.2 is selected from the group consisting of H, Cl, CH.sub.2CH.sub.3, OCH.sub.3, NH.sub.2, NHCH.sub.3, CF.sub.3, CH.sub.2NH.sub.2, CH.sub.2OH, CH.sub.2Cl, CH(CH.sub.3).sub.2, and OCH.sub.2CH.sub.3. In some embodiments, R.sub.3 is selected from the group consisting of H, CHCH.sub.2, CCH, C(CH.sub.3).sub.3, CF.sub.3, OH, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, NHCH.sub.3, CN, NHCOCH.sub.3,
(40) ##STR00008##
(41) In some embodiments, R.sub.4 is selected from the group consisting of H, Cl, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, OCH.sub.3, OCHCH.sub.3, NH.sub.2, and NHCH.sub.3. Further, any of R.sub.1 to R.sub.4 can be any other suitable group known to one of skill in the art.
(42) In some embodiments, the composition comprises a core structure having formula VI:
(43) ##STR00009##
where R.sub.1 is selected from the group consisting of COOH, CH.sub.2CH.sub.2COOH, CHCHCOOH, CH.sub.2-Tetrazole, CH.sub.2CH.sub.2-Tetrazole, CH.sub.2COOCH.sub.3, CH.sub.3, CH.sub.2CONH.sub.2, CH.sub.2CONHCH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, and CH.sub.2NH.sub.2.
(44) In some embodiments, the composition comprises a core structure having formula VII:
(45) ##STR00010##
where R.sub.2 is selected from the group consisting of H, Cl, CH.sub.2CH.sub.3, OCH.sub.3, NH.sub.2, NHCH.sub.3, CF.sub.3, CH.sub.2NH.sub.2, CH.sub.2OH, CH.sub.2Cl, CH(CH.sub.3).sub.2, and OCH.sub.2CH.sub.3
(46) In some embodiments, the composition comprises a core structure having formula VIII:
(47) ##STR00011##
where R.sub.3 is selected from the group consisting of H, CHCH.sub.2, CCH, C(CH.sub.3).sub.3, CF.sub.3, OH, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, NHCH.sub.3, CN, NHCOCH.sub.3,
(48) ##STR00012##
(49) In some embodiments, the composition comprises a core structure having formula IX:
(50) ##STR00013##
where R.sub.4 is selected from the group consisting of H, Cl, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, OCH.sub.3, OCHCH.sub.3, NH.sub.2, and NHCH.sub.3.
(51) Some embodiments of the invention additionally provide analogs of compounds, including analogs and derivatives of the compounds shown in Example 16, having a core structure of any of formulas I to IX, and/or otherwise provided herein. It is understood that various modifications can be made to the compounds described herein to generate analogs using known methods. It is further understood that the R groups in the various core structures can be varied. It is also understood that analogs of the compounds disclosed herein can be readily prepared by one skilled in the art using known methods of chemical synthesis and performing structure activity relationship (SAR) studies. Furthermore, one skilled in the art can readily determine the activity of various analogs using the methods described herein.
(52) In some embodiments, the IC.sub.50 of the analog bound to RXR is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the IC.sub.50 of Sulindac when bound to RXR.
(53) In some embodiments, the IC.sub.50 of the analog bound to COX-1 is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% greater than the IC.sub.50 of Sulindac when bound to COX-1. In some embodiments, the IC.sub.50 of the analog bound to COX-1 is about 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 50, 100, 250, 500, or 1000 greater than the IC.sub.50 of Sulindac when bound to COX-1.
(54) In some embodiments, the IC.sub.50 of the analog bound to COX-2 is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% greater than the IC.sub.50 of Sulindac when bound to COX-2. In some embodiments, the IC.sub.50 of the analog bound to COX-2 is about 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 50, 100, 250, 500, or 1000 greater than the IC.sub.50 of Sulindac when bound to COX-2.
(55) The following definitions are set forth to illustrate and define the meaning and scope of the various terms used to describe the invention herein.
(56) As used herein, alkoxy refers to an alkyl group attached to the parent molecular moiety through an oxygen atom.
(57) As used herein, alkoxyalkyl refers to an alkyl group substituted with one, two, or three alkoxy groups.
(58) As used herein, alkyl refers to a group derived from a straight or branched chain saturated hydrocarbon containing from one to ten carbon atoms.
(59) As used herein, aryl refers to a phenyl group, or a bicyclic fused ring system wherein one or both of the rings is a phenyl group. Bicyclic fused ring systems consist of a phenyl group fused to a four- to six-membered aromatic or non-aromatic carbocyclic ring. The aryl groups of the present disclosure can be attached to the parent molecular moiety through any substitutable carbon atom in the group. Representative examples of aryl groups include, but are not limited to, indanyl, indenyl, naphthyl, phenyl, and tetrahydronaphthyl.
(60) As used herein, arylalkyl refers to an alkyl group substituted with one, two, or three aryl groups.
(61) As used herein, cycloalkyl refers to a saturated monocyclic or bicyclic hydrocarbon ring system having three to ten carbon atoms and zero heteroatoms. Representative examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, and cyclopentyl.
(62) As used herein, cycloalkylalkyl refers to an alkyl group substituted with one, two, or three cycloalkyl groups.
(63) As used herein, halo and halogen refer to F, Cl, Br, and I.
(64) As used herein, haloalkyl refers to an alkyl group substituted with one, two, three, or four halogen atoms.
(65) As used herein, heterocyclyl refers to a five-, six-, or seven-membered ring containing one, two, or three heteroatoms independently selected from nitrogen, oxygen, and sulfur. The five-membered ring has zero to two double bonds and the six- and seven-membered rings have zero to three double bonds. The term heterocyclyl also includes bicyclic groups in which the heterocyclyl ring is fused to a four- to six-membered aromatic or non-aromatic carbocyclic ring or another monocyclic heterocyclyl group. The heterocyclyl groups of the present disclosure can be attached to the parent molecular moiety through a carbon atom or a nitrogen atom in the group. Examples of heterocyclyl groups include, but are not limited to, benzothienyl, furyl, imidazolyl, indolinyl, indolyl, isothiazolyl, isoxazolyl, morpholinyl, oxazolyl, piperazinyl, piperidinyl, pyrazolyl, pyridinyl, pyrrolidinyl, pyrrolopyridinyl, pyrrolyl, thiazolyl, thienyl, and thiomorpholinyl.
(66) As used herein, pharmaceutically or therapeutically acceptable carrier refers to a carrier medium which does not interfere with the effectiveness of the biological activity of the active ingredients and which is minimally toxic to the host or patient.
(67) As used herein, stereoisomer refers to a chemical compound having the same molecular weight, chemical composition, and constitution as another, but with the atoms grouped differently. That is, certain identical chemical moieties are at different orientations in space and, therefore, when pure, have the ability to rotate the plane of polarized light. However, some pure stereoisomers can have an optical rotation that is so slight that it is undetectable with present instrumentation. The compounds described herein can have one or more asymmetrical carbon atoms and therefore include various stereoisomers. All stereoisomers are included within the scope of the present invention.
(68) As used herein, suppressing the activity of AKT refers to the prevention, amelioration, elimination, or any other reduction of AKT activity. For example, suppressing the activity of AKT can include decreasing basal levels of AKT or inhibiting AKT activation.
(69) As used herein, therapeutically- or pharmaceutically-effective amount as applied to the disclosed compositions refers to the amount of composition sufficient to induce a desired biological result. That result can be prevention, alleviation, or amelioration of the signs, symptoms, causes of a disease, or any other desired alteration of a biological system. For example, the result can involve a decrease and/or reversal of cancerous cell growth.
(70) As used herein, the term inhibitor is interchangeably used to denote antagonist. Both these terms define compositions which have the capability of decreasing certain enzyme activity or competing with the activity or function of a substrate of said enzyme.
(71) As used herein, cancer and cancerous refer to any malignant proliferation of cells in a mammal.
(72) The pharmaceutical compositions disclosed herein can be used for prevention and treatment of any malignancy known to one of skill in the art, including hormone-refractory-prostate cancer, prostate cancer, breast cancer, ovarian cancer, colon cancer, melanoma or other skin cancer, lung cancer, hepatocarcinoma, acute myelogenous leukemia, bladder cancer, cervical cancer, cholangiocarcinoma, chronic myelogenous leukemia, colorectal cancer, gastric sarcoma, glioma, leukemia, lymphoma, multiple myeloma, osteosarcoma, pancreatic cancer, stomach cancer, or tumors at localized sites (including inoperable tumors or in tumors where localized treatment of tumors would be beneficial, and solid tumors).
(73) For in vivo applications, the appropriate dose of a given cytotoxic agent depends on the agent and its formulation, and it is well within the ordinary skill of the art to optimize dosage and formulation for a given patient. Thus, for example, such agents can be formulated for administration via oral, subcutaneous, parenteral, submucosal, intravenous, or other suitable routes using standard methods of formulation. The effective amount and method of administration of compounds will vary based upon the sex, age, weight and disease stage of the patient, whether the administration is therapeutic or prophylactic, and other factors apparent to those skilled in the art.
(74) Those skilled in the art will derive appropriate dosages and schedules of administration to suit the specific circumstances and needs of the patient, e.g., dependent on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician. Typically, the dose range of the composition administered to the patient can be from about 0.5 to 1000 mg/kg of the patient's body weight. The dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient. In some embodiments, the present invention will use the same dosages, or dosages that are between about 0.1% and 500%, more preferably between about 25% and 250% of the established human dosage for analogs. Suitable human dosages can also be inferred from ED.sub.50 or ID.sub.50 values, or other appropriate values derived from in vitro or in vivo studies, e.g., as qualified by toxicity studies and efficacy studies in animals.
(75) Although the exact dosage will be determined on a drug-by-drug basis, in most cases, some generalizations regarding the dosage can be made. The daily dosage regimen for an adult human patient may be, for example, an oral dose of between 0.1 mg and 500 mg, preferably between about 1 mg and about 250 mg, e.g., about 150 to about 200 mg. In some embodiments, the oral dosage form is about 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1000 mg. Compounds can be administered for a period of continuous therapy, for example for a week or more, or for months or years.
(76) Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain the modulating effects, or minimal effective concentration (MEC). The MEC will vary for each compound but can be estimated from in vitro data. Dosages for achieving the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations.
(77) The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, may be the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert. Compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
EXAMPLES
Example 1
Sulindac Binding to RXR
(78) Competitive ligand-binding assays (
(79) Purified RAR protein was incubated with [.sup.3H]all-trans-RA in the presence or absence of Sulindac or unlabeled all-trans RA. Bound [.sup.3H]all-trans-RA was quantitated by liquid scintillation counting. Sulindac did not bind to RAR, consistent with the cell-based experiment shown in
(80) Receptor expression vectors and a reporter gene (TREpal.sub.2-tk-CAT for RXR/TR heterodimers (
(81) Altered sensitivity of RXR ligand-binding domain (LBD) to chymotrypsin (ug/ml) by Sulindac (100 M) (
(82) Nur77 and/or RXR were transiently transfected into CV-1 cells. Cells were treated with or without SR11237 (10.sup.6 M), a RXR-selective agonist, in the presence or absence of Sulindac. (TREpal)2-tk-CAT (Zhang et al., Nature 358, 587-591 (1992a))) (
Example 2
Death Effect of Sulindac
(83) To determine the role of RXR in Sulindac-induced apoptosis, the death effect of Sulindac in F9 cells and F9 cells lacking RXR (F9-RXR/) was examined.
(84) For nuclear morphological change analysis, cells were trypsinized, washed with PBS, fixed with 3.7% paraformaldehyde, and stained with DAPI (4,6-diamidino-2-phenylindole) (1 mg/ml) to visualize the nuclei by fluorescent microscopy. The percentages of apoptotic cells were determined by counting at least 300 GFP-positive cells having nuclear fragmentation and/or chromatin condensation. For the determination of DNA fragmentation, the Cell Death Detection ELISA.sup.PLUS (Roche Applied Science, Penzberg, Bavaria, Germany) was used.
(85) RXR siRNA siGENOME SMARpool (M-003443-02), RAR siRNA siGENOME SMARpool (M-003439-01), and siRNA Non-specific Control IX (D-001206-09-05) were purchased from DHARMACON (Lafayette, Colo.). A 2.5 l aliquot of 20 mM siRNA per well was transfected into cells grown in 12-well plates by using oligofectamine reagent (Invitrogen, Carlsbad, Calif.) according to manufacturer's recommendations. Two days after transfection, the cells were harvested for Western blotting.
(86) F9 or F9 cells lacking RXR (F9 RXR/) were treated with Sulindac (75 M) for 24 hr and analyzed by DAPI staining (
(87) CV-1 cells were transfected with GFP-RXR ( ligand-binding pocket impaired its homodimer transactivation (
ligand-binding pocket impaired its heterodimer transactivation (
(20 ng), RXR/F313S/R316E (20 ng), -galactosidase (100 ng), and/or Nur77 (100 ng) expression vectors were transiently transfected together with (TREpal)2-tk-CAT (100 ng) (
(88) Sulindac induced extensive apoptosis in F9 cells, while it had little effect in F9-RXR/ cells (
(89) HCT116 cells or HCT116 cells lacking Bax (Bax/) were treated with or without Sulindac (75 M) for 24 hr. Apoptosis was determined by PARP cleavage (
(90) Sulindac induced cleavage of PARP (
Example 3
RXR Mutant
(91) To address the role of Sulindac binding to RXR, a RXR mutant (RXR/F313S/R316E) was constructed in which amino acids essential for maintaining the functional integrity of RXR ligand-binding-pocket (LBP) (Bourguet, W. et al., Mol Cell 5 (2), 289-298 (2000)) were altered.
(92) Flag-p85 was constructed by polymerase chain reaction (PCR) using forward primer, 5-ccggaattccatgagtgctgaggggtacc-3 (SEQ ID NO:1) and the reverse primer, 5-acgcgtcgactcatcgcctctgctgtgcat-3 (SEQ ID NO:2). PCR product was digested with Eco RI and Sal I and cloned into pCMV-Flag vector. RXR mutants were constructed using the QUIKCHANGE mutagenesis kit (Stratagene, La Jolla, Calif.) with the following oligonucleotides as primers: RXR/F313S/R316E, 5-GGAACGAGCTGCTGATCGCCTCCTCCTCCCACGAGTCCATAGCTGTGAAAGATGGG (forwardSEQ ID NO: 3) and 5-CCCATCTTTCACAGCTATGGACTCGTGGGAGGAGGAGGCGATCAGCAGCTCGTTCC (reverseSEQ ID NO: 4); RXR/80, 5-CCGGAATTCGGaccacacccaccctgggc-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6); and RXR/100, 5-CCGGAATTCGGgtcagcagcagcgaggac-3 (forwardSEQ ID NO:5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO:6). PCR products were digested with EcoR I and Xho I, and ligated into pCMV-Myc vector.
(93) RXR (20 ng), RXR/F313S/R316E (20 ng), -galactosidase (100 ng), and/or Nur77 (100 ng) expression vectors were transiently transfected together with (TREpal) 2-tk-CAT (100 ng) (
(94) The mutant failed to respond to ligand-induced transactivation (
Example 4
Inhibition of AKT Activation by Sulindac
(95) The inhibition of AKT (a key protein responsible for cancer cell survival) activation by Sulindac was investigated.
(96) HepG2, SW480, RAW264.7, HCT116, LNCaP, PC3, ZR-75-1, and HaCat cells were starved overnight and treated with Sulindac (100 M) for 1 hr and analyzed for AKT activation by immunoblotting (
(97) MEF and MCF-7 cells were starved overnight, pretreated with Sulindac for 1 hr, and stimulated with EGF (100 ng/ml) for 15 min. AKT activation was analyzed by immunoblotting (
(98) Significant inhibition of basal AKT activation by Sulindac was observed in various cancer cells lines, including COX-2-negative SW480 and HCT116 colon cancer cells (
(99) Sulindac was examined for suppression of TNF induced AKT activation. TNF strongly activated AKT in A549 lung cancer cells, which was potently inhibited by Sulindac and RXR siRNA (
(100) MCF-7 and baby hamster kidney (BHK) cells treated with 9-cis-RA (10.sup.7 M) for 30 min were analyzed for RXR-p85 interaction by co-immunoprecipitation using D20 or N197 anti-RXR antibody (
Example 5
Interaction of p85 with tRXR and RXR
(101) RXR interaction with p85 was examined. Anti-RXR antibodies (Santa Cruz Biotechnology, Santa Cruz, Calif.) were used in co-immunoprecipitation (Co-IP) and Western blotting (WB) assays. BHK cells were treated with ATRA (10.sup.7 M) for 30 min. Lysates were prepared and analyzed for RXR-p85
interaction using either D20 anti-RXR or N197 anti-RXR antibody (
(102) An initial attempt using anti-RXR antibody against sequences in the NH2 terminus of RXR (D20) by co-immunoprecipitation assays failed to detect clear interaction, although the antibody effectively immunoprecipitated the RXR protein. However, when another anti-RXR antibody against the COOH-terminal ligand-binding domain (LBD) of RXR (N197) was used, p85 was readily co-immunoprecipitated in a TNF (
Example 6
Amino Acids 80 to 100 of RXR are Critical for Binding to p85
(103) Intracellular proteolytic cleavage was examined. Cells were treated with or without 9-cis-RA (10.sup.7 M) for 30 min and lysates were analyzed by immunoblotting using the N197 RXR antibody (
(104) A549 lung cancer cells were also treated with or without 9-cis-RA for 30 min. Nuclear (Nu) and cytoplasmic (Cyt) fractions were analyzed by immunoblotting using D20 or N197 anti-RXR antibody. To ensure the purity of preparations, fractions were also immunoblotted for the presence of Hsp60 (cytoplasmic specific) and PARP (nuclear specific) proteins (
(105) RXR was found at the plasma membrane ( in MEFs was also regulated by cell density (
observed in cells cultured at low density was reduced when cells were grown at high density, which was accompanied with appearance of a smaller RXR
fragment. Interestingly, the levels of the 44-kDa tRXR
protein correlated with AKT activation (
might be an important mechanism regulating AKT activation. Consistent with cytoplasmic localization of tRXR
(
was mainly found in the cytoplasm when MEF cells were immunostained by the N197 anti-RXR
antibody (
could alter its subcellular localization, conferring its ability to interact with p85. Observations that p85 was co-immunoprecipitated with tRXR as described herein suggest that tRXR might bind to p85, leading to tRXR-dependent AKT activation.
(106) MEF cells were seeded at different cell densities and lysates were prepared and analyzed for AKT activation by immunoblotting. Lysates were also examined by immunoblotting using N197 anti-RXR antibody (
(107) To directly address the role of tRXR in p85 interaction and AKT activation, a RXR mutant lacking its N-terminal 80 amino acids (RXR/80) was constructed, which produced a RXR mutant protein with a molecular weight similar to the endogenous tRXR. When Myc-tagged RXR/80 was cotransfected with Flag-p85 into cells, they interacted strongly, which was further enhanced by TNF (
(108) The RXR/80 immunocomplex was examined for PI3K activity in vitro. Myc-tagged RXR/80 and p85 were cotransfected into A549 cells, and the Myc-RXR/80-containing complex was immunoprecipitated by anti-Myc antibody and assayed for PI3K activity. Specific Myc-RXR/80 immunoprecipitates prepared from cells exhibited strong PI3K activity in a TNF-dependent manner (
(
interaction was found to activate PI3K/AKT signaling.
(109) RXR/80 was stably expressed in SW480 and HCT116 colon cancer cells, and the resulting stable clones, SW480/RXR/80 and HCT116/RXR/80, showed elevated AKT activation and induction of its downstream targets c-Myc and cyclin D1 ( is a potent promoter of cancer cell growth in vivo.
Example 7
Endogenous tRXR in AKT Activation and Cell Transformation
(110) The observation that full-length RXR failed to interact with p85 suggested that the p85-binding motif in the A/B domain is masked in RXR. Thus, the N-terminal A/B domain of RXR could interact with the full-length RXR (Supp.
(111) Expression vectors GFP-RXR/1-134 and Myc-RXR were transfected into HEK293T cells. Interaction was analyzed by Co-IP using anti-Myc antibody (Supp.
(112) The N-terminal A/B domain bound to RXR (Supp.
(113) Transfection of the N-terminal region of RXR, RXR/1-134, could enhance the tRXR level (
Example 8
Synthesis of Sulindac Analogs
(114) The finding that RXR served as an intracellular target of Sulindac action provided an opportunity to identify RXR-selective Sulindac derivatives for suppressing AKT activity. The binding of Sulindac to RXR and COX-2 (
(115) Analogs were designed and synthesized (
Example 9
Evaluation of Sulindac Analogs
(116) Docking of Sulindac to the LBP of RXR in reference to 9-cis-RA was evaluated to identify strategies for structural modifications of Sulindac to dissociate its COX inhibition from RXR-binding activity. The docking of Sulindac to RXR is shown in ligands examined (
LBP. The benzyl methyl sulfide portion of Sulindac bound to the hydrophobic region of the RXR
LBP, overlapping with the a-ionone ring of 9-cis-RA. In this binding mode, Van der Waals interaction of the SCH3 group at position 4 (
protein was not optimal and there was space for modification to improve the binding to RXR The idea of making use of position 4 to design RXR-selective analogs was fully supported by the fact that sulindac prodrug, sulindac sulfoxide and the metabolite sulindac sulfone show no COX-inhibiting activity, whereas the metabolite sulindac sulfide (used herein) is a potent COX inhibitor (Haanen, 2001). As shown in
ligands DHA, BMS649, and 9-cis-RA. Replacing CH2COOH at position D with a bulkier group such as CH2CH2COOH would help place the carboxylate group closer to Arg316 to achieve good charge-charge interaction with RXR
as observed in 9-cis-RA.
(117) Candidate compounds were also examined by docking to the crystal structure of COX-2 ( (
(118) A549 cells were seeded in 24-well plates in DMEM with 10% fetal bovine serum. After overnight culture, cells were stimulated with 10 ng/ml IL-1 in DMEM medium without serum for 24 hr. After 10 min pretreatment with the indicated concentrations of Sulindac or analog, cells were co-treated with 10 M arachidonic acid and Sulindac or its analog for 30 min at 37 C. Medium was collected and immediately assayed. PGE2 production was measured with Prostaglandin E2 EIA Kit-Monoclonal according to the manufacturer's instructions (Cayman Chemical, Ann Arbor, Mich.). PGE2 production (%) is expressed as the ratio of PGE2 produced in the presence of compound to that with vehicle alone.
(119) Evaluation of the analogs showed that they all retained RXR-binding activity, with K-80003 being the most potent (about 34-fold higher than Sulindac) ( LBD (
expression by siRNA largely impaired the inhibitory effect of K-80003 on AKT activation in PC3 cells. In comparison, a reduction of RAR expression by RAR siRNA did not show such an effect. Thus, inhibition of AKT activation by K-80003 was also dependent on RXR expression (
(120) Co-immunoprecipitation assays demonstrated that the interaction of RXR/80 with p85 either in the absence or presence of TNF
was potently inhibited by K-80003 as compared to the effect of Sulindac (
(121) ZR-75-1 cells were treated with TNF and/or Sulindac (75 M) or K-80003 (50 M) for 6 hr and analyzed by immunoblotting. K-80003 was also more effective than Sulindac in inducing PARP cleavage when used together with TNF in ZR-75-1 cells (
(122) In clonogenic survival assays, colony formation of HeLa/RXR/1-134 stable clone and RXR/80 stable clones was almost completely suppressed by K-80003, revealing its ability to inhibit cell growth (
(123) Mice (n=6) were treated intraperitoneally with corn oil, Sulindac (60 mg/kg), or K-80003 (60 mg/kg) for two weeks. Tumors were removed and measured. Significantly, K-80003 exhibited a much more potent inhibitory effect than Sulindac on the growth of RXR/80 tumor in animals (
Example 10
Screening Sulindac Analogs in a Mammal
(124) A panel of Sulindac analogs is selected to screen for a compound with the ability to induce apoptosis in cells. Each candidate compound is introduced to a mouse and analyzed to determine whether it is capable of suppressing the activity of AKT, activating caspase-8, activating BAX, inhibiting cFLIP, and/or degrading Bid in cells. Compounds identified during the screening can be used for further screening assays or methods of treatment as disclosed herein.
Example 11
Treating Cancer in a Human Patient
(125) A human patient in need treatment for cancer is identified and administered a compound known to interact with RXR and function independent of the COX-2 pathway. The patient is monitored for stabilization or improvement of cancer resulting from administration of the compound. An antitumorigenic effect is observed in the patient following administration of the compound.
Example 12
Preventing Cancer in a Human Patient
(126) A human patient with an elevated risk of developing cancer relative to the general population is identified and instructed to take a 150 mg tablet containing the active ingredient K-80003 twice daily. The patient is monitored and does not develop cancer following administration of the compound.
Example 13
Sulindac Activation of TNF-Induced Extrinsic Apoptotic Pathway
(127) HepG2 cells cultured in medium with 1% FBS were treated with SR11237 (1 M) for 1 hr, then TNF (10 ng/ml) and/or Sulindac (75 M) for 4 hr, and analyzed by immunoblotting. HepG2 cells transfected with control or RXR
siRNA were treated with TNF
and/or Sulindac and analyzed by immunoblotting.
(128) Treatment of HepG2 liver cancer cells (
(129) HepG2 cells transfected with control or caspase-8 siRNA or pretreated with ZIETD-fmk (40 M) for 1 hr were treated with TNF and Sulindac and analyzed by immunoblotting. a complete suppression of Sulindac/TNF-induced PARP cleavage (
(130) Activation of Bax by Sulindac and TNF HepG2 cells treated with TNF and/or Sulindac were immunostained with Bax/6A7 antibody. About 15% Sulindac-treated cells while about 60% Sulindac/TNF-treated cells showed Bax staining. Potential Sulindac activation of the extrinsic apoptotic pathway resulted in Bax activation was also examined. HepG2 cells treated with TNF or Sulindac alone or together were examined for Bax activation by immunostaining using conformation-sensitive Bax/6A7 antibody. Significant Bax staining was observed only when cells were treated with both TNF and Sulindac (
(131) PC3 cells transfected with CA-AKT or DN-AKT were treated with TNF and/or Sulindac, and analyzed by immunoblotting ( and Sulindac, and immunostained with anti-cleaved caspase-8 or Bax/6A7 antibody. About 80% nontransfected and 15% CA-AKT-transfected cells showed caspase-8 staining. About 60% nontransfected and about 13% CA-AKT-transfected cells exhibited Bax staining. Sulindac/TNF-induced PARP cleavage was inhibited by transfection of constitutive-active AKT (CA-AKT) but enhanced by transfection of dominant-negative AKT (DN-AKT) (
(132) Cells treated with TNF and/or Sulindac for 6 hr were analyzed by immunoblotting (
Example 14
Growth Inhibition in Breast Tumor with K-80003
(133) The growth inhibitory effect of oral administration of K-80003 on MCF-7 breast tumor tissue grown in mice was investigated. K-80003 was dissolved in NaHCO.sub.3 (pH 8.0). Mice with MCF-7 breast tumor tissue were administered 15 mg/kg K-80003, 30 mg/kg K-80003, 60 mg/kg K-80003, or a control in 100 ul total volume by gavage once daily. Tumor volume measured over 20 days indicated that mice treated with oral K-80003 exhibited a dose-dependent decrease in tumor volume compared to mice treated with control (
Example 15
Preclinical Studies of K-80003
(134) Preclinical studies of K-80003 were performed, including the investigation of toxicity, bioavailability, and pharmacokinetics. K-80003 exhibited very low toxicity (
Example 16
Production of Analogs
3-(4-Fluorophenyl)-2-methylacrylic acid (2a)
(135) ##STR00014##
(136) Propionic anhydride (31.0 mL, 242 mmol) was added to potassium carbonate (18.2 g, 132 mmol) at 0 C. After stirring for 5 min to mix up, p-fluorobenzaldehyde (1a) (13.0 mL, 120 mmol) was added. The mixture was heated at 160 C. for 12 h. After cooling with an ice bath, to the reaction mixture was added water. The resultant yellow precipitate was filtered, and washed with EtOAc to yield the crude acid 2a, which was used in the next step as it was. An analytical sample of the known acrylic acid 2a ((40) was obtained by recrystallization from MeOH. 2a: pale yellow crystals. M.p. 155-158 C. (MeOH). IR (KBr): .sub.max=3429, 3076, 2972, 1665, 1596, 1508, 1425, 1313, 1298, 1224 cm.sup.1; .sup.1H NMR (400 MHz, CD.sub.3OD) : 2.09 (s, 3H, CCH.sub.3), 7.22-7.11 (m, 2H, Ph-H), 7.52-7.43 (m, 1H, Ph-H), 7.69 (s, 1H, CHCCH.sub.3) ppm; .sup.13C NMR (100 MHz, CD.sub.3OD) : 12.7, 114.8, 115.1, 131.4, 131.5, 132.1, 132.2, 137.5, 161.3, 163.75, 170.4 ppm; MS (ESI) m/z 179 (M-H.sup.+).
3-(4-Fluorophenyl)-2-methylpropanoic acid (3a)
(137) ##STR00015##
(138) A mixture of the crude acrylic acid 2a (14.3 g, 79.4 mmol) and 10% Pd/C (1.35 g) in methanol (190 mL) was hydrogenated under 20 atm of hydrogen for 10 h. The catalyst was filtered off and the filtrate concentrated to give crude 3a, which was used in the next step as it was. An analytical sample of compound 3a (40) was obtained by flash column chromatography on silica gel (ethyl acetate:PE, 1:2). 3a: colorless oil. IR (film): .sub.max=3406, 2972, 2933, 1701, 1560, 1509, 1460, 1406, 1223 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.17 (d, J=6.82 Hz, 3H, CHCH.sub.3), 2.77-2.61 (m, 2H, CH.sub.2CH), 3.02 (dd, J=13.18, 6.35 Hz, 1H, CH.sub.2CH), 7.00-6.93 (m, 2H, Ph-H), 7.16-7.11 (m, 2H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 16.4, 38.4, 41.4, 115.1, 115.1, 130.3, 130.4, 134.5, 134.6, 160.4, 162.8, 182.6 ppm; MS (ESI) m/z 181 (M-H.sup.+).
6-Fluoro-2-methyl-2,3-dihydroinden-1-one (4a)
(139) ##STR00016##
(140) A mixture of the crude propanoic acid derivative 3a (3.20 g), and polyphosphoric acid (47.0 g) was heated at 80 C. for 4 hours. The resulting mixture was poured into ice water and extracted with EtOAc. The combined extracts were washed with a saturated aqueous NaHCO.sub.3 to remove the starting acids, and then washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentration under reduced pressure. The residue was purified by flash column chromatography (ethyl acetate:PE, 1:30) to give compound 4a (40) as a pale yellow oil (1.44 g, 50%). The NaHCO.sub.3 layer was acidified with conc. HCl, extracted with EtOAc (330 mL). The combined extracts were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to give the recovered starting material 3a (34%). The data for 4a: IR (film) .sub.max=3064, 2968, 2932, 2873, 1716, 1611, 1509, 1486, 1444, 1264, 1158 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.32 (d, J=7.37 Hz, 3H, CHCH.sub.3), 2.82-2.65 (m, 2H, CH.sub.2CH), 3.37 (dd, J=16.71, 7.55 Hz, 1H, CH.sub.2CH), 7.33-7.26 (m, 1H, Ph-H), 7.44-7.36 (m, 2H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 16.2, 34.4, 42.9, 76.3, 109.7, 109.9, 122.2, 122.5, 127.8, 127.9, 138.1, 148.8, 149.6, 161.1, 163.6, 208.5 ppm; MS (ESI) m/z 187 (M+Na.sup.+).
Ethyl 2-(6-Fluoro-2-methyl-3H-inden-1-yl)acetate (5a)
(141) ##STR00017##
(142) To a solution of HMDS (15.0 mL, 56.9 mmol) in anhydrous THF (38.0 mL) at 0 C. was added dropwise n-BuLi (2.5 M solution in n-hexane, 17.0 mL, 42.8 mmol). After stirring for about 30 min, the mixture was cooled to 78 C. and was added EtOAc (4.20 mL, 42.8 mmol). The mixture was stirred at 78 C. for another 30 min. To the resulting mixture was added dropwise a solution of indenone 4a in anhydrous THF (40 mL). The mixture was stirred at 78 C. for another 4 h and then quenched with a saturated aqueous NH.sub.4Cl. The mixture was extracted with EtOAc (320 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentration under reduced pressure. To the residue was added HOAc/H.sub.2SO.sub.4 (10/1, 55 mL). After stirring for 5 hours at r.t., the mixture was extracted with CH.sub.2Cl.sub.2 (315 mL). The combined extracts were washed successively with water, saturated NaHCO.sub.3, and brine, dried over Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:30) to give compound 5a (40) as a colorless oil (3.26 g, 70%). IR (film) .sub.max=2981, 2911, 1736, 1614, 1590, 1473, 1368, 1329, 1308, 1256, 1154, 1034 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.25 (t, J=7.13 Hz, 3H, COOCH.sub.2CH.sub.3), 2.12 (s, 3H, CCH.sub.3), 3.29 (s, 2H, PhCH.sub.2C), 3.48 (s, 2H, PhCCH.sub.2), 4.14 (q, J=7.13 Hz, 2H, COOCH.sub.2CH.sub.3), 6.79 (ddd, J=9.62, 8.12, 2.41 Hz, 1H, Ph-H), 6.96 (dd, J=9.33, 2.40 Hz, 1H, Ph-H), 7.25 (dd, J=8.17, 4.93 Hz, 1H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.1, 14.3, 31.5, 42.1, 60.9, 105.6, 105.9, 110.2, 110.4, 123.6, 123.7, 129.6, 129.6, 137.2, 137.2, 144.6, 147.8, 147.9, 161.2, 163.6, 170.7 ppm; MS (ESI) m/z 257 (M+Na.sup.+).
(Z)-2-(3-(4-(Methylthio)benzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (Sulindac sulfide) (6a)
(143) ##STR00018##
(144) To a solution of indene 5a (650 mg, 3 mmol) in MeOH (4.6 mL) was added 2N NaOMe (4.6 mL, 9 mmol) at room temperature to get an orange mixture. After stirring for 20 min, to the mixture was added p-(methylthio)benzaldehyde (0.8 mL, 7.5 mmol). The resulting mixture was refluxed at 80 C. for 3.5 h. After concentration under reduced pressure, the residue was poured into a 1N HCl solution. After stirring for another 10 h at room temperature, the mixture was extracted with EtOAc (315 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash chromatography (ethyl acetate:PE, 1:2.5) to give predominantly the cis (Z) isomer 6a (Sulindac sulfide) (40) as a yellow solid (868 mg, 85%). The trans (E) isomer was obtained in about 2%. M.p. 182-185 C. (EtOAc) (lit. (40) M.p. 180-184 C.). IR (KBr) .sub.max=3445, 3012, 2914, 2850, 1702, 1602, 1589, 1465, 1410, 1320, 1240, 1171, 1085 cm.sup.1; .sup.1H NMR (400 MHz, DMSO-d.sub.6) : 2.15 (s, 3H, CCCH.sub.3), 2.54 (s, 3H, SCH.sub.3), 3.57 (s, 2H, CH.sub.2COO), 6.77-6.71 (m, 1H, vinyl H), 7.01 (dd, J=9.31, 2.25 Hz, 1H, vinyl H), 7.25-7.46 (m, 5H, Ph-H), 12.40 (s, 1H, COOH) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.7, 14.7, 31.5, 106.1, 106.4, 110.6, 110.8, 123.4, 123.5, 125.8, 130.0, 130.3, 131.0, 132.1, 132.6, 138.5, 139.5, 139.5, 139.5, 147.2, 147.3, 161.5, 161.6, 172.1 ppm; MS (ESI) m/z 331 (M+Na.sup.+).
(145) Following the procedure described for Sulindac sulfide (6a), and by condensation of indene 5a with an appropriate aromatic aldehyde, compounds K-80001 to K-80003 were synthesized, respectively.
(Z)-2-(3-(4-Methylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6b) (K-80001)
(146) ##STR00019##
(147) Yellow solid. M.p. 155-158 C. yield: 87%. IR (KBr) .sub.max=3426, 3022, 2959, 2915, 1733, 1717, 1655, 1599, 1512, 1470, 1408, 1381, 1214, 1172 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.19 (s, 3H, CCCH.sub.3), 2.41 (s, 3H, Ph-CH.sub.3), 3.58 (s, 2H, CH.sub.2CO.sub.2H), 6.59-6.53 (m, 1H, vinyl H), 6.87 (dd, J=8.98, 2.40 Hz, 1H, vinyl H), 7.44-7.16 (m, 6H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.61, 21.43, 29.73, 31.44, 105.54, 105.77, 110.48, 110.71, 123.73, 123.83, 129.21, 129.32, 129.78, 129.80, 129.84, 129.87, 131.00, 131.02, 133.48, 138.29, 138.95, 139.76, 146.13, 146.22, 161.84, 164.29, 176.68 ppm; MS (ESI) m/z 363 (M+Na.sup.+). Anal. Calcd for C.sub.20H.sub.17FO.sub.2: C, 77.90; H, 5.56. Found: C, 77.88; H, 5.99.
(Z)-2-(3-(4-Ethylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6c) (K-80002)
(148) ##STR00020##
(149) Yellow solid. M.p. 159-162 C. yield: 83%. IR (KBr) .sub.max=3082, 3024, 2965, 2923, 1705, 1604, 1473, 1465, 1413, 1312, 1229, 1168 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.29 (t, J=7.61 Hz, 3H, CH.sub.2CH.sub.3), 2.20 (s, 3H, CCCH.sub.3), 2.71 (q, J=7.60 Hz, 2H, CH.sub.2CH.sub.3), 3.59 (s, 2H, CH.sub.2COO), 6.60-6.54 (m, 1H, aromatic vinyl H), 6.88 (dd, J=8.97, 2.39 Hz, 1H, aromatic vinyl H), 7.19-7.44 (m, 5H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.6, 15.4, 28.7, 31.4, 105.5, 105.7, 110.5, 110.7, 123.7, 123.8, 128.0, 129.4, 129.7, 129.9, 131.0, 133.7, 138.9, 139.7, 144.6, 161.8, 164.2, 176.4 ppm; MS (ESI) m/z 345 (M+Na.sup.+). Anal. Calcd for C.sub.21H.sub.19FO.sub.2: C, 78.24; H, 5.94. Found: C, 78.21; H, 5.55.
(Z)-2-(3-(4-Iso-propylbenzylidene)-6-fluoro-2-methyl-3H-inden-1-yl)acetic acid (6d) (K-80003)
(150) ##STR00021##
(151) Yellow solid. M.p. 146-149 C.; yield: 79%. IR (KBr) .sub.max=3025, 2958, 2871, 1701, 1629, 1603, 1507, 1464, 1412, 1315, 1293, 1171, 1134 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.31 (d, J=6.95 Hz, 6H, CH(CH.sub.3).sub.2), 2.20 (s, 3H, CCCH.sub.3), 2.97 (td, J=13.81, 6.91 Hz, 1H, CH(CH.sub.3)2), 3.59 (s, 2H, CH.sub.2COO), 6.61-6.88 (m, 2H, aromatic vinyl H), 7.19-7.46 (m, 6H, Ph-H); .sup.13C NMR (100 MHz, CDCl.sub.3) : 10.6, 23.9, 31.3, 34.0, 76.7, 105.5, 105.7, 110.5, 110.7, 123.7, 123.8, 126.5, 129.4, 129.7, 129.8, 131.0, 133.7, 139.0, 139.6, 146.1, 146.2, 149.3, 161.8, 164.2, 176.1 ppm; MS (ESI) m/z 359 (M+Na.sup.+). Anal. Calcd for C.sub.22H.sub.21FO.sub.2: C, 78.55; H, 6.29. Found: C, 78.13; H, 6.02.
Ethyl 2-(6-fluoro-3H-inden-1-yl)acetate (5b)
(152) ##STR00022##
(153) To a solution of iso-propylamine (0.27 mL, 2 mmol) in anhydrous THF (4 mL) at 0 C. was added dropwise n-BuLi (2.5 M solution in n-hexane, 0.8 mL, 2 mmol). After stirring for about 30 min., the mixture was cooled to 78 C. and EtOAc (0.2 mL, 2 mmol) was added. After stirring at 78 C. for another 30 min., indenone 4b (150 mg, 1 mmol) in anhydrous THF (0.7 mL) was added dropwise. The mixture was stirred at 78 C. for another 2 h and then was quenched with saturated NH.sub.4Cl. The mixture was extracted with EtOAc (35 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was taken with AcOH/H.sub.2SO.sub.4 (10/1, 3 mL). After stirring for 3 h at r.t., the mixture was extracted with CH.sub.2Cl.sub.2 (35 mL). The combined extracts were washed successively with water, saturated NaHCO.sub.3, and brine. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:30) to give 5b as a colorless oil (99 mg, 49%). IR (film) .sub.max=3054, 2982, 2931, 1704, 1636, 1486, 1446, 1369, 1345, 1288, 1276 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 1.28 (t, J=7.15 Hz, 3H, CH.sub.2CH.sub.3), 3.35 (s, 2H, CH.sub.2CO.sub.2Et), 3.56 (dd, J=2.93, 1.51 Hz, 2H, CH.sub.2CH), 4.19 (q, J=7.15 Hz, 2H, CH.sub.3CH.sub.2), 6.52 (s, 1H, CCH), 6.93-7.36 (m, 3H, Ph-H) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.2, 34.1, 37.4, 61.0, 106.4, 106.7, 111.4, 111.6, 124.3, 124.4, 134.1, 136.3, 136.4, 139.2, 139.3, 146.3, 146.4, 161.1, 163.5, 170.72 ppm. Anal. Calcd for C.sub.13HFO: C, 70.90; H, 5.95. Found: C, 71.30; H, 6.23.
(E)-2-(3-(4-(Methylthio)benzylidene)-6-fluoro-3H-inden-1-yl)acetic acid (6e) (K-80004)
(154) ##STR00023##
(155) To a solution of indene derivative 5b (506 mg, 2.50 mmol) in MeOH (4 mL) was added 2N NaOMe (4 mL, 4 mmol) at room temperature. After stirring for 20 min, to the resulting mixture was added p-(methylthio)benzaldehyde (0.65 mL, 2.50 mmol). The mixture was refluxed at 80 C. for 3.5 h. The resulting solution was concentrated under reduced pressure, and then poured into 1N HCl. After stirring for 10 hours at r.t., the mixture was extracted with EtOAc (310 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (ethyl acetate:PE, 1:2.5) to give trans (E) isomer 6e (K-80004) as a yellow solid (429 mg, 48%). M.p. 180-182 C. (EtOAc). .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.54 (s, 3H, SCH.sub.3), 3.69 (s, 2H, CH.sub.2COO), 7.09-7.84 (m, 9H, Ph-H), 12.52 (s, 1H, COOH) ppm; .sup.13C NMR (100 MHz, CDCl.sub.3) : 13.6, 115.5, 115.7, 127.3, 131.7, 131.8, 139.9, 161.5, 163.9, 174.0 ppm. Anal. Calcd for C.sub.19H.sub.15FO.sub.2S: C, 69.92; H, 4.63; F, 5.82; 0, 9.80; S, 9.82. Found: C, 70.16; H, 4.92.
Spiro(dihydro-2(3H)furanone-5-1(2H)(3H)-6-fluoro-indane (7a)
(156) ##STR00024##
(157) A solution of 6-fluoro-1-indanone 4b (75.0 mg, 0.50 mmol), iso-propanol (0.190 mL, 2.50 mmol), and methyl acrylate (0.45 mL, 5 mmol) in THF (10 mL) was purged with argon for 20 min and cooled to 0 C. A SmI.sub.2 (1.50 mmol) solution in THF (15 mL) was added through transfer needle. After 5 min, the reaction was quenched with sat. K.sub.2CO.sub.3 (2 mL). The resulting mixture was extracted with EtOAc (33 mL). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:6) to give compound 7a (74.5 mg, 0.37 mmol, 73%) as a colorless oil; IR (film) .sub.max: 3058, 2945, 2856, 1766, 1603, 1494, 1155 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.28-2.52 (m, 4H, ArCCH.sub.2), 2.77 (dt, J=8.0, 1.2 Hz, 2H, ArCCH.sub.2CH.sub.2CO), 2.81-2.90 (m, 1H, ArCH.sub.2), 3.00-3.09 (m, 1H, ArCH.sub.2), 6.96-7.03 (m, 2H, ArH), 7.18-7.23 (m, 1H, ArH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 28.7, 29.5, 33.3, 39.4, 94.1, 109.7 (d, J.sub.C-F=22.4 Hz) 116.6 (d, J.sub.C-F=22.5 Hz), 126.2 (d, J.sub.C-F=8.3 Hz), 138.8, 144.7 (d, J.sub.C-F=7.4 Hz), 162.2 (d, J.sub.C-F=233.5 Hz), 176.0 ppm; Anal. Calcd for C.sub.12H.sub.11FO.sub.2: C, 69.89; H, 5.38. Found: C, 69.97; H, 5.62.
Methyl 3-(6-Fluoro-3H-inden-1-yl) propanoate (8a)
(158) ##STR00025##
(159) To a solution of spiro(dihydro-2(3H)furanone-5-1(2H)(3H)-6-fluoro-indane 7a (61 mg, 3 mmol) in CH.sub.3OH (1.5 mL) was added p-TsOH (6 mg). The mixture was refluxed for 2 hours. The reaction was quenched with a saturated aqueous solution of NaHCO.sub.3 (2.0 mL). The resulting mixture was extracted with EtOAc (32 mL). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:300) to give compound 8a (61 mg, 0.28 mmol, 94%) as a pale yellow oil. IR (film) .sub.max: 2959, 2901, 1739, 1585, 1606, 1473, 1254, 1162 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.68-2.73 (m, 2H, CH.sub.2COO), 2.82-2.88 (m, 2H, ArCCH.sub.2), 3.28-3.31 (m, 2H, ArCH.sub.2), 3.71 (s, 3H, COOCH.sub.3), 6.30 (t, 1H, J=1.6 Hz, ArCCH), 6.83-6.91 (m, 1H, ArH), 7.02-7.06 (m, 1H, ArH), 7.33-7.38 (m, 1H, ArH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 22.9, 32.4, 37.3, 51.7, 106.0 (d, J.sub.C-F=23.1 Hz), 111.4 (d, J.sub.C-F=22.8 Hz), 124.4 (d, J.sub.C-F=8.9 Hz), 130.3, 139.5, 142.4 (d, J.sub.C-F=3.0 Hz), 146.9 (d, J.sub.C-F=8.5 Hz), 162.4 (d, J.sub.C-F=240.6 Hz), 173.4 ppm; Anal. Calcd for C.sub.13H.sub.13FO.sub.2: C, 70.90; H, 5.95. Found: C, 70.50; H, 5.97.
(E)-Methyl 3-(3-(4-(methylthio)benzylidene)-6-fluoro-3H-inden-1-yl)propanoate (9a) (K-80005)
(160) ##STR00026##
(161) A solution of methyl 3-(6-fluoro-3H-inden-1-yl) propanoate 8a (110 mg, 0.5 mmol) in CH.sub.3OH (1 mL) was purged with nitrogen for 10 min and cooled to 0 C. A freshly prepared CH.sub.3ONa (0.75 mmol) in CH.sub.3OH (1 mL) was added dropwise. After stirring for 30 min., 4-(methylthio)benzaldehyde (63 L, 0.6 mmol) was added dropwise. The mixture was refluxed for 2 hours. After cooling, the reaction was quenched with water (3 mL) and stirred at room temperature for 10 min. The mixture was acidified with 1 M HCl to reach pH=4. The solvent was evaporated under reduced pressure, and the residue was extracted with EtOAc (35 mL). The combined organic layers were washed with brine (2 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography on silica gel eluting with EtOAc-PE (1:4) to give trans (E)-isomer 9a (112 mg, 66%) as a yellow solid. M.p.: 182-184 C. (EtOAc); IR (KBr) .sub.max: 3055, 2988, 2925, 1711, 1640, 1488, 1445, 1656, 1290, 1277 cm.sup.1; .sup.1H NMR (400 MHz, CDCl.sub.3) : 2.53 (s, 3H, SCH.sub.3), 2.68 (t, 2H, J=7.6 Hz, CH.sub.2COO), 2.84 (t, 2H, J=7.6 Hz, ArCCH.sub.2), 6.96-7.84 (m, 9H, ArH), 12.21 (s, COOH); .sup.13C NMR (100 MHz, CDCl.sub.3) : 14.3, 22.6, 32.0, 106.1 (d, J.sub.C-F=23.4 Hz), 111.5 (d, J.sub.C-F=23.0 Hz), 120.5 (d, J.sub.C-F=9.2 Hz), 122.6, 125.8 (2C), 127.3, 130.4 (2C), 132.8, 134.1, 136.4, 139.4, 143.2 (d, J.sub.C-F=8.8 Hz), 146.3, 162.2 (d, J.sub.C-F=240.5 Hz), 173.8 ppm; Anal. Calcd for C.sub.20H.sub.17FO.sub.2S: C, 70.57; H, 5.03; S, 9.42. Found: C, 70.20; H, 4.62; S, 9.01.
(162) K-80003 Analog No. 1 (R1 Variant; Yellow Solid):
(163) ##STR00027##
K-80003 Analog No. 2 (R1 Variant; Yellow Solid):
(164) ##STR00028##
K-80003 Analog No. 3 (R1 Variant; Yellow Solid):
(165) ##STR00029##
K-80003 Analog No. 4 (R1 Variant; Yellow Solid):
(166) ##STR00030##
K-80003 Analog No. 5 (R1 Variant; Yellow Solid):
(167) ##STR00031##
K-80003 Analog No. 6 (R1 Variant; Yellow Solid):
(168) ##STR00032##
K-80003 Analog No. 7 (R1 Variant; Yellow Solid):
(169) ##STR00033##
K-80003 Analog No. 8 (R2 Variant; Yellow Solid):
(170) ##STR00034##
K-80003 Analog No. 9 (R2 Variant; Yellow Solid):
(171) ##STR00035##
K-80003 Analog No. 10 (R2 Variant; Yellow Solid):
(172) ##STR00036##
K-80003 Analog No. 11 (R3 Variant; Yellow Solid):
(173) ##STR00037##
K-80003 Analog No. 12 (R3 Variant; Yellow Solid):
(174) ##STR00038##
K-80003 Analog No. 13 (R3 Variant; Yellow Solid):
(175) ##STR00039##
K-80003 Analog No. 14 (R3 Variant; Yellow Solid):
(176) ##STR00040##
K-80003 Analog No. 15 (R3 Variant; Yellow Solid):
(177) ##STR00041##
K-80003 Analog No. 16 (R3 Variant; Yellow Solid):
(178) ##STR00042##
K-80003 Analog No. 17 (R3 Variant; Yellow Solid):
(179) ##STR00043##
K-80003 Analog No. 18 (R3 Variant; Yellow Solid):
(180) ##STR00044##
K-80003 Analog No. 19 (R3 Variant; Yellow Solid):
(181) ##STR00045##
K-80003 Analog No. 20 (R3 Variant; Yellow Solid):
(182) ##STR00046##
K-80003 Analog No. 21 (R3 Variant; Yellow Solid):
(183) ##STR00047##
K-80003 Analog No. 22 (R4 Variant; Yellow Solid):
(184) ##STR00048##
K-80003 Analog No. 23 (R4 Variant; Yellow Solid):
(185) ##STR00049##
K-80003 Analog No. 24 (R4 Variant; Yellow Solid):
(186) ##STR00050##
K-80003 Analog No. 25 (R1 Variant):
(187) ##STR00051##
K-80003 Analog No. 26 (R1 Variant):
(188) ##STR00052##
K-80003 Analog No. 27 (R3 Variant):
(189) ##STR00053##
K-80003 Analog No. 28 (R3 Variant):
(190) ##STR00054##
K-80003 Analog No. 29 (R3 Variant):
(191) ##STR00055##
K-80003 Analog No. 30 (R3 Variant):
(192) ##STR00056##
K-80003 Analog No. 31 (R4 Variant):
(193) ##STR00057##
where R.sub.4=Et.
K-80003 Analog No. 32 (R4 Variant):
(194) ##STR00058##
where R.sub.4=EtO.
K-80003 Analog No. 33 (R4 Variant):
(195) ##STR00059##
where R.sub.4=i-Pr.
K-80003 Analog No. 34 (R4 Variant):
(196) ##STR00060##
where R.sub.4=Cl.
Summary of Methods
Plasmids
(197) The construction of RXR and Myc-RXR has been described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Cao, X., et al., Retinoid X receptor regulates Nur77/TR3-dependent apoptosis [corrected] by modulating its nuclear export and mitochondrial targeting. Mol Cell Biol 24(22), 9705-9725 (2004); Masia, S. et al., Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol Endocrinol 21 (10), 2391-2402 (2007); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009); Balkwill, F., Nat Rev Cancer 9 (5), 361-371 (2009); Han, Y. H. et al., Oncogene 25 (21), 2974-2986 (2006)). Flag-p85 was constructed by polymerase chain reaction (PCR) using forward primer, 5-ccggaattccatgagtgctgaggggtacc-3 (SEQ ID NO:1) and the reverse primer, 5-acgcgtcgactcatcgcctctgctgtgcat-3 (SEQ ID NO:2). PCR product was digested with Eco RI and Sal I and cloned into pCMV-Flag vector. RXR mutants were constructed using the QUIKCHANGE mutagenesis kit (Stratagene, La Jolla, Calif.) with the following oligonucleotides as primers: RXR/F313S/R316E, 5-GGAACGAGCTGCTGATCGCCTCCTCCTCCCACGAGTCCATAGCTGTGAAAGATGGG (forwardSEQ ID NO: 3) and 5-CCCATCTTTCACAGCTATGGACTCGTGGGAGGAGGAGGCGATCAGCAGCTCGTTCC (reverseSEQ ID NO: 4); RXR/A80, 5-CCGGAATTCGGaccacacccaccctgggc-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6); and RXR/100, 5-CCGGAATTCGGgtcagcagcagcgaggac-3 (forwardSEQ ID NO: 5) and 5-CCGCTCGAGctaagtcatttggtgcggcg-3 (reverseSEQ ID NO: 6). PCR products were digested with EcoR I and Xho I, and ligated into pCMV-Myc vector.
(198) Cell Culture
(199) ZR-75-1 human breast cancer, LNCaP and PC3 prostate cancer, and H460 lung cancer cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS). HepG2 liver cancer and MCF-7 human cancer cells were maintained in MEM containing 10% FBS. HEK293T human embryonic kidney cells, CV-1 green monkey kidney cells, MEF cells, A549 human lung cancer cells, HaCat human keratinocyte cells, BHK baby hamster kidney cells, Caco2 human colon cancer carcinoma cells, SW480 human colon adenocarcinoma cells, and HCT116 human colon cells were maintained in DMEM supplemented with 10% FBS. The F9 murine embryonal carcinoma cell line had both alleles of RXR disrupted (Clifford, J. et al., Embo J 15 (16), 4142-4155 (1996)). The cell cultures were maintained at 37 C. in a 5% CO.sub.2 humidified atmosphere.
(200) Antibodies and Reagents
(201) Anti-phospho-Akt (Ser 473, D9E, #4060) was from Cell Signaling Technology (Danvers, Mass.). Anti--actin (A1978) and anti-Flag (M2, F3165) antibodies were obtained from Sigma-Aldrich (St. Louis, Mo.). Anti-p85 (#06-195) antibody was purchased from Millipore (Billerica, Mass.). Antibodies for Akt1(C-20) sc-1618, GFP (B-2) sc-9996, HSP60 (N-20) sc-1052, c-Myc (9E10) sc-40PI3, RAR (C-19) sc-550, RXR (D20) sc-553, RXR (N197) sc-774, PARP (H-250) sc-7150 were from Santa Cruz Biotechnology (Santa Cruz, Calif.). ECL, Anti-rabbit and anti-mouse IgG, Horseradish Peroxidase-Linked Species-Specific antibodies were from GE Healthcare (Little Chalfont, Buckinghamshire, UK). ALEXA FLUOR 594 goat anti-rabbit IgG (A-11012) and ALEXA FLUOR 488 goat anti-mouse IgG (A-10667) were purchased from Invitrogen (Carlsbad, Calif.). Protein A/G Plus-Agarose (sc-2003) was from Santa Cruz Biotechnology (Santa Cruz, Calif.). Recombinant Human TNF (210-TA) was from R&D Systems (Minneapolis, Minn.). Protease Inhibitor Cocktail Tablets were from Roche (Basel, Switzerland). 9-cis-retinoic acid (9-cis-RA) (R4643). Sulindac sulfide and its analogues were dissolved in dimethyl sulfoxides (DMSO) in stock solutions of 100 mM. All-trans-retinoic acid (ATRA) (R2625) and chymotrypsin were from Sigma-Aldrich (St. Louis, Mo.). SR11237 was kindly provided by Dr. Marcia I. Dawson (Burnham Institute).
(202) Ligand-Binding Assay
(203) Bacterially expressed His-tagged RXR ligand-binding domain (LBD) (aa 223-462) was incubated with [.sup.3H]-9-cis-RA (Amersham Biosciences, Amersham, UK) in ligand binding assay buffer in the presence or absence of various concentrations of unlabeled 9-cis-RA or sulindac sulfide. The RXR LBD protein was captured by nickel-coated beads. Bound radiolabeled 9-cis-RA was determined in a scintillation counter as described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005)).
(204) HPLC Analysis of Sulindac Sulfide Binding to RXR Protein in Cells
(205) Expression vector containing receptor fused to C-terminal TAP fusion (Stratagene, La Jolla, Calif.) was transfected into HEK293 cells using FuGene 6 transfection reagent (Roche, Basel, Switzerland). The cells were maintained in exponential growth in complete medium, DMEM (Mediatech Inc., Herndon, Va.) supplemented with 10% calf serum (SCS, Hyclone Logan, Utah), 2 mM glutamine, penicillin (100 U/ml) and streptomycin (100 g/ml). At two days post-transfection cells were switched into medium containing 400 mg/ml G418 until 20 days post-transfection, when dishes were scored for drug-resistant colonies. Expression of RXR fusion protein was determined by immunoblotting. Cells were grown to confluency in four 150 mm plates and subsequently treated with or without 100 mM sulindac sulfide for 3 hr. After treatment, cells were twice washed in 50 ml cold PBS and streptavidin based purification carried out as described in INTERPLAY Mammalian TAP System (Stratagene, La Jolla, Calif.) manual up through initial wash of streptavidin beads with provided streptavidin binding buffer. A 0.1 ml portion of dilute sulfuric acid solution (pH 2) was then added followed by 1.0 ml of acetonitrile. The samples were then vortexed for 30 sec on a vortex mixer and subsequently centrifuged (1000 g5 min). The liquid sample was then transferred to a second tube and evaporated to dryness under a stream of nitrogen. The residue was redissolved in 0.12 ml of chromatographic mobile phase, and a 0.1 ml portion was injected into the HPLC. HPLC analysis was performed using microsorb-mv 100-3 C18 1004.6 column (Varian, Palo Alto, Calif.). The mobile phase consisted of 4% v/v aqueous acetic acid and acetonitrile (30:70) pumped at flow rate of 1.0 ml/min. Detection of sulindac sulfide was performed using a photoarray detector (Waters model 2996, Waters Corporation, Milford, Mass.), which collected spectra between 200 and 450 nM. A standard solution of sulindac sulfide was used to obtain the calibration curve. Characteristic peak spectrum and retention time was used for identification, and peak areas at 4max used for quantification were calculated by using MILLENNIUM CHROMATOGRAPHY MANAGER software (Waters Corporation, Milford, Mass.). One of three similar experiments was shown.
(206) Proteolytic Protection Assay
(207) RXR LBD was synthesized by in vitro transcription-translation using rabbit reticulocyte lysates (Promega, Fitchburg, Wis.) as described previously (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Zhang, X. K. et al., Nature 355 (6359), 441-446 (1992); Zhang, X.-K. et al., Nature. 358 (6387), 587-591 (1992)). In vitro translated .sup.35[S]methionine labeled RXR-LBD was preincubated with solvent (1% DMSO), Sulindac (100 M) or 9-cis-RA (10.sup.7 M) for 30 min. and then digested with indicated concentration of chymotrypsin. Digested fragments were separated by PAGE.
(208) Transient Transfection Assays
(209) Cells (110.sup.5 cells/well) seeded in 24-well plates were transiently transfected using a modified calcium phosphate precipitation procedure as described (Kolluri, S. K. et al., Proc Natl Acad Sci USA 102 (7), 2525-2530 (2005); Cao, X., et al., Mol Cell Biol 24(22), 9705-9725 (2004)).
(210) Apoptosis Assays
(211) For nuclear morphological change analysis, cells were trypsinized, washed with PBS, fixed with 3.7% paraformaldehyde, and stained with DAPI (4,6-diamidino-2-phenylindole) (1 mg/ml) to visualize the nuclei by fluorescent microscopy (Masia, S. et al., Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol Endocrinol 21 (10), 2391-2402 (2007); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009); Balkwill, F., Nat Rev Cancer 9 (5), 361-371 (2009)). The percentages of apoptotic cells were determined by counting at least 300 GFP-positive cells having nuclear fragmentation and/or chromatin condensation. For the determination of DNA fragmentation, the Cell Death Detection ELISA.sup.PLUS (Roche Applied Science, Penzberg, Bavaria, Germany) was used. One of three similar experiments was shown.
(212) RXR and RAR siRNA
(213) RXR siRNA siGENOME SMARpool (M-003443-02), RAR siRNA siGENOME SMARpool (M-003439-01), and siRNA Non-specific Control IX (D-001206-09-05) were purchased from DHARMACON (Lafayette, Colo.). A 2.5 l aliquot of 20 mM siRNA/per well was transfected into cells grown in 12-well plates by using oligofectamine reagent (Invitrogen, Carlsbad, Calif.) according to manufacturer's recommendations. Two days after transfection the cells were harvested for Western blotting.
(214) Immunoblotting
(215) For immunoblotting, cell lysates were boiled in SDS sample buffer, resolved by SDS-polyacrylamide gel electrophoresis, and transferred to nitrocellulose. After transfer, the membranes were blocked in 5% milk in TBST (10 mM Tris-HCl, pH. 8.0, 150 mM NaCl, 0.05% Tween 20) containing antibody. The membranes were then washed three times with TBST, then incubated for 1 hr at room temperature in 5% milk in TBST containing horseradish peroxide-linked anti-immunoglobulin.
(216) Coimmunoprecipitation (CoIP) Assays
(217) For the CoIP assay, cells or cells transfected with indicated expression vectors were suspended in lysis buffer (50 mM Tris-HCl, pH 7.4; 150 mM NaCl; 20 mM EDTA; 1% NP-40; 1 mM PMSF; 50 mg/ml Leupeptin; 20 mg/ml Aprotinin; 0.1 mM Na.sub.3VO.sub.4; and 1 mM DTT). Cell extracts were cleared by incubation with the Protein A/G plus Agarose beads (Santa Cruz Biotechnology, Santa Cruz, Calif.) and then incubated with appropriate antibody and 30 ml of Protein A or G plus Agarose beads overnight at 4 C. Beads were then washed and boiled in Laemmli gel-loading solution before performing SDS-PAGE/immunoblotting using polyclonal or monoclonal antibodies. Immunoreactive products were detected by chemiluminescence with an enhanced chemiluminescence system (ECL) (Amersham Biosciences, Amersham, UK).
(218) HeLa-RXR/1-134 Stable Clone and Soft Agar Assay
(219) RXR N-terminal fragment, 1-134, was cloned into pNTAP vector (Stratagene, La Jolla, Calif.). The resulting pNTAP-RXR/1-134 was transfected into HeLa cells. 48 hr after transfection, cells were selected with 400 mg/ml G418 for 2 weeks. Single clones were picked up and examined by immunoblotting. HeLa RXR/1-134 stable clone and HeLa cells transfected with control pNTAP vector were seeded at 510.sup.3 cells/well (6 well plate) in DMEM supplemented with 10% FBS and 0.35% agarose with 0.5% bed agar. After 12 days incubation at 37 C., colonies were stained with 0.005% crystal violet for 1 h and counted.
(220) Colony Formation Assay
(221) HeLa RXR/1-134 stable clone and control HeLa cells were seeded in 6-well plate, 350 cells/well. Five days later, cells were treated with Sulindac (50 M) and K-80003 (25 M) in 0.5% serum medium for 3 days. After washed with PBS, cells were fixed with 4% paraformaldehyde in PBS for 20 min. Colonies were stained with 0.1% crystal violet for 30 min, and pictures were taken and colonies were counted.
(222) Human Tissues and Evaluation
(223) Breast and liver tumor tissues and their surrounding tissues were obtained by surgical resection from cancer patients. Histological normal specimens, which were about at least 35 cm distant from the tumor nodule, were obtained from the corresponding patients. The study was approved by Xiamen University Institute for Biomedical Research Ethics Committee, and all of the patients gave informed consent.
(224) Tissues from patients with primary hepatocellular carcinoma (HCC, n=6) or breast cancer (n=6) were collected for detecting the expression of RXR. For the immunoblotting assay, tumor and its surrounding tissues were separately prepared and lysed in a modified RIPA buffer. The lysates were electrophoresed on an 8% SDS-PAGE gel and transferred onto PVDF membranes. The membranes were sequentially incubated with N197 anti-RXR antibody (1:1000) overnight at 4 C. and horseradish peroxidase conjugated anti-rabbit IgG antibody (1:5000) at room temperature for 1 hr, and detected by enhanced chemiluminescence (ECL) (Amersham Biosciences, Amersham, UK). The stripped blots were reprobed with monoclonal anti-GAPDH antibody (1:2000) for loading control. For immunohistochemistry analysis, tissue sections were incubated with the N197 anti-RXR antibody (1:500) overnight at 4 C. and detected with goat antirabbit-specific immunoglobulins (1:100) at room temperature for 30 minutes. The slides were counterstained with hematoxylin.
(225) Confocal Microscopy
(226) Cells transfected with Myc-tagged RXR/80 and Flag-tagged p85 were seeded on chamber slides overnight. Cells were fixed in PBS containing 3.7% paraformaldehyde for 10 min and washed twice with PBS. Cells were then permeabilized with 0.1% triton X-100 in PBS for 5 min. Fixed cells were pre-incubated for 30 min in PBS containing 5% BSA at room temperature. Cells were stained with polyclonal anti-Myc antibody (1:500 dilution) and anti-Flag antibody (1:500 dilution) followed by Cy3-conjugated antirabbit IgG (1:1000, Sigma-Aldrich, St. Louis, Mo.) or FITC-labeled anti-mouse IgG (1:500, Sigma-Aldrich, St. Louis, Mo.). Confocal microscopy data shown in the manuscript are representative of at least three similar experiments.
(227) Subcellular Fractionation
(228) Subcellular fractionation was performed as described with minor modifications (Cao, X., et al., Mol Cell Biol 24(22), 9705-9725 (2004); Ohashi, E. et al., Cancer Res 69 (8), 3443-3450 (2009)).
(229) Briefly, cells (110.sup.7 cells) suspended in 0.5 ml hypotonic buffer (250 mM sucrose, 20 mM HEPES-KOH, pH 7.4, 10 mM KCl, 10 mM MgCl.sub.2, 0.5 mM EGTA, 1.5 mM EDTA, pH 8.0, and 1 mM DTT) with proteinase inhibitors were homogenized and cell extracts were centrifuged at 800g for 10 min. The pellet containing nuclei was resuspended in 200 l 1.6 M sucrose in hypotonic buffer plus protease inhibitors and laid over 1 ml 2.0 M sucrose in the same buffer, then centrifuged at 150,000g for 90 min at 4 C. to obtain the nuclear fraction. The supernatant was centrifuged at 10,000g for 30 min at 4 C. to obtain cytoplasmic fractions. Nuclear and cytoplasmic fractions were resuspended in 100 l lysis buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 5 mM EDTA, pH 8.0) with a cocktail of proteinase inhibitors for immunoblotting analysis.
(230) COX Assays
(231) COX Fluorescent Activity Assay Kit (700200), COX Fluorescent Inhibitor Screening Assay Kit (700100) and Prostaglandin E2 Enzyme Immunoassay (EIA) Kit (514010) were obtained from Cayman Chemical (Ann Arbor, Mich.). COX-1 and COX-2 activity assay were performed according to the manufacturer's protocol.
(232) Chemical Synthesis
(233) The .sup.1H NMR and .sup.13C NMR spectra were recorded on a Bruker AV 400 spectrometer (Bremen, Germany). .sup.1H NMR spectra were registered in the indicated solvent, and chemical shifts are expressed in parts per million () relative to internal Me.sub.4Si. IR spectra were recorded on a Nicolet Avatar 360 FT-IR spectrophotometer (Thermo Fisher Scientific, Waltham, Mass.). Mass spectra were recorded with a Bruker Dalton Esquire 3000 plus (ESI direct injection) (Bremen, Germany). Elemental analyses were performed using a Vario RL analyzer. Melting points were determined on an X-4 Micromelting point apparatus and are uncorrected. The 6-fluoro-1-indanone 4b used in this study is commercially available. Tetrahydrofuran was distilled prior to use from sodium benzophenone ketyl. Dichloromethane was distilled from phosphorus pentoxide. Methanol was distilled from magnesium turnings and iodine. Silica gel (zhifu, 300-400 mesh) from Yantai Silica Gel Factory (China) was used for column chromatography, eluting (unless otherwise stated) with ethyl acetate/petroleum ether (PE) (60-90 C.) mixture or dichloromethane/methanol.
* * * * *
(234) While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, patents, patent applications and publications referred to herein are hereby incorporated by reference in their entireties.