Methods for inhibiting starvation of a cell
09610363 ยท 2017-04-04
Assignee
Inventors
Cpc classification
C12Y401/01032
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N2830/008
CHEMISTRY; METALLURGY
C12N2799/025
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
Abstract
The present invention is directed to methods for the treatment or prevention of starvation in a cell, e.g., a neuronal cell, and methods for the treatment and prevention of disorders associated therewith by the administration of an agent, e.g., a nucleic acid molecule, which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH.
Claims
1. A method for inhibiting starvation of a photoreceptor cell compromised by retinitis pigmentosa, comprising contacting said cell with at least one isolated nucleic acid molecule which enhances the intracellular generation and/or uptake of glucose in said photoreceptor cell, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of glucose-6-phosphatase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase, phosphogluconate dehydrogenase, ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase, transaldolase, GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, GLUT13, and GLUT14, thereby inhibiting starvation of said photoreceptor cell.
2. A method for treating or preventing retinitis pigmentosa in a subject comprising administering to said subject at least one isolated nucleic acid molecule which enhances the intracellular generation and/or uptake of glucose such that starvation of a photoreceptor cell in the subject is inhibited, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of glucose-6-phosphatase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase, phosphogluconate dehydrogenase, ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase, transaldolase, GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, GLUT13, and GLUT14, thereby treating or preventing retinitis pigmentosa in said subject.
3. A method for prolonging the viability of a cone cell compromised by retinitis pigmentosa, comprising contacting said cell with at least one isolated nucleic acid molecule which enhances the intracellular generation and/or uptake of glucose such that starvation of the cone cell is inhibited, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of glucose-6-phosphatase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase, phosphogluconate dehydrogenase, ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase, transaldolase, GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, GLUT13, and GLUT14, thereby prolonging the viability of said cone cell.
4. A method for prolonging the viability of a rod cell compromised by retinitis pigmentosa, comprising contacting said cell with at least one isolated nucleic acid molecules which enhances the intracellular generation and/or uptake of glucose such that starvation of the rod cell is inhibited, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of glucose-6-phosphatase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase, phosphogluconate dehydrogenase, ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase, transaldolase, GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, GLUT13, and GLUT14, thereby prolonging the viability of said rod cell.
5. The method of any one of claims 1 and 2-4, wherein the at least one isolated nucleic acid molecule enhances an activity selected from the group consisting of the intracellular generation of glucose, the uptake of glucose into a cell, the intracellular generation of NADPH, metabolic flux through gluconeogenesis, metabolic flux through the pentose phosphate pathway, the ability of a cell to generate phospholipids, and the ability of a cell to detoxify free oxygen radicals.
6. The method of any one of claims 1 and 2-4, wherein the at least one isolated nucleic acid molecule reduces metabolic flux through glycolysis.
7. The method of any one of claims 1 and 2-4, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of glucose-6-phosphatase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and fructose 1,6-bisphosphatase.
8. The method of any one of claims 1 and 2-4, wherein the at least one isolated nucleic acid molecule encodes an enzyme involved in the pentose phosphate pathway.
9. The method of claim 5, wherein the at least one isolated nucleic acid molecule encodes an enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxykinase and fructose 1,6-bisphosphatase.
10. The method of any one of claims 1 and 2-4, wherein the at least one nucleic acid molecule is contained within a vector.
11. The method of claim 10, wherein the vector is a retrovirus, an adenovirus, an adenoviral/retroviral chimera, an adeno-associated virus (AAV), a herpes simplex virus I or II, a parvovirus, a reticuloendotheliosis virus, a poliovirus, a papillomavirus, a vaccinia virus and a lentivirus.
12. The method of claim 2, wherein the administration is intraocular administration.
13. The method of claim 12, wherein the intraocular administration is selected from the group consisting of intravitreal, subconjuctival, sub-tenon, periocular, retrobulbar, suprachoroidal, and intrascleral administration.
14. The method of any one of claim 1, 3, or 4, wherein the cell is contacted with at least two isolated nucleic acid molecules which enhance the intracellular generation and/or uptake of glucose such that starvation of the rod cell is inhibited.
15. The method of claim 2, wherein the subject is administered at least two isolated nucleic acid molecules which enhance the intracellular generation and/or uptake of glucose such that starvation of the rod cell is inhibited.
16. The method of claim 14, wherein the nucleic acid molecules are contained in a single vector.
17. The method of claim 14, wherein the nucleic acid molecules are contained in different vectors.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DETAILED DESCRIPTION OF THE INVENTION
(35) The present invention is based, at least in part, on the discovery that the upregulation of certain genes in a cell, e.g., a neuronal cell, undergoing cellular starvation, can serve to enhance intracellular levels of glucose, pyruvate, lactate, and/or NADPH. In addition, it has been discovered that cone cells in a mouse model of RP undergo self-digestion, or autophagy, a sign of insufficient nutrition. Accordingly, the upregulation of genes encoding enzymes involved in glucose transport, glucose production, gluconeogenesis, lactate transport and NADPH production can serve to inhibit cellular starvation, thus, increasing cellular viability. Additionally, increased levels of glucose, pyruvate, lactate, and/or NADPH can enhance production of phospholipids, the components of cell membranes, thereby increasing cellular viability under conditions when nutrition is limited.
(36) Without wishing to be bound by any particular theory, it is believed that by upregulating the level of intracellular glucose, pyruvate, lactate, and/or NADPH, the cells are provided with additional nutrition to sustain themselves and, are further provided the building blocks for cellular structure, for example, the building blocks for the production of phospholipids, the primary component of cellular membranes. Accordingly, the enhancement of intracellular glucose, pyruvate, lactate, and/or NADPH serves to promote or enhance cellular viability, e.g., when cells are compromised by genetic and environmental factors and to treat or prevent a disorder associated with starvation of cells, e.g., a disorder that would otherwise lead to malfunction and death of the cells.
(37) Accordingly, the present invention provides methods for inhibiting starvation of a cell, as well as methods for the treatment and/or prevention of disorders associated with cellular starvation, for example, retinitis pigmentosa, by enhancing the intracellular levels of glucose, pyruvate, lactate and/or NADPH.
(38) In one embodiment of the invention, cells suitable for use in the instant methods are neuronal cells. As used herein, the terms neuron or neuronal cell refer to a nerve cell capable of receiving and conducting electrical impulses from the nervous system. A nerve cell or neuron typically comprises a cell body, an axon, axon terminals, and dendrites and is readily identifiable by one of ordinary skill in the art.
(39) As used herein, the terms neural or neural cell also include glial cells, also referred to as neuroglia or glia, which are cells that provide support and nutrition (e.g., glucose or lactate), maintain homeostasis, form myelin, and participate in signal transmission in the nervous system.
(40) The types of glial cells are: astrocytes, oligodendrocytes, Schwann cells), and microglia. Astrocytes have numerous projections that anchor neurons to their blood supply and regulate nutrition of neuronal cells. They also regulate the external chemical environment of neurons by removing excess ions, notably potassium, and recycling neurotransmitters released during synaptic transmission. Oligodendrocytes and Schwann cells coat axons in the central or peripheral nervous system, respectively, to form a myelin sheath which provides insulation to the axon that allows electrical signals to propagate more efficiently. Microglia are specialized macrophages capable of phagocytosis.
(41) In one embodiment, a neuron is a photoreceptor cell, i.e., a specialized neuron found in the retina. The retina is a thin, transparent tissue containing about 120 million separate rod cells (night vision) and 7 million cone cells (day and color vision) as well as millions of other structural supporting and interconnecting cells. Photoreceptor cells consist of rods and cones, which are the photosensitive cells of the retina. The rods contain rhodopsin, the rod photopigment, and the cones contain other distinct photopigments, which respond to light and ultimately trigger a neural discharge in the output cells of the retina, the ganglion cells. Ultimately, this signal is registered as a visual stimulus in the visual cortex and other target locations in the brain. The retinal pigment epithelial (RPE) cells produce, store and transport a variety of factors that are responsible for the normal function and survival of photoreceptors. Retinal neurons that can also sense light consist of photosensitive ganglion cells. These cells, known as the melanopsin ganglion cells are found in the inner retina, have dendrites and long axons projecting to the protectum (midbrain), the suprachiasmatic nucleas in the hypothalamus, and the lateral geniculate (thalamus). In one embodiment, a photoreceptor cell is a rod. In one embodiment, a photoreceptor cell is a cone. In one embodiment, a photosensitive cell is a cell is a melanopsin ganglion cell.
(42) As used herein, the term starvation of a cell, cellular starvation, cellular ischemia refers to the insufficient supply of nutrients to a cell to allow for proper functioning and maintenance. In particular embodiments, cellular starvation includes insufficient supply of glucose, pyruvate, lactate, NADPH, and/or oxygen and/or insufficient ability to generate phospholipids, cellular membranes, cellular proteins, nucleic acid, carbohydrates, vitamins, or intermediates thereof, and slower than normal cellular processes, e.g., DNA replication, translation, generation of glucose, pyruvate, lactate, NADPH, oxygen, phospholipids, cellular membranes, cellular proteins, nucleic acid, carbohydrates, vitamins, or intermediates thereof. Methods for identifying a cell undergoing starvation are routine to one of ordinary skill in the art and include, for example, determination of the rate of cell division, protein synthesis, glucose uptake, intracellular oxygen levels, organelle digestion (macroautophagy), and protein degradation through, e.g., chaperone-mediated autophagy or the ubiquitin-proteasome system.
(43) As used herein, the term disorders associated with starvation of a cell includes disorders in which there is insufficient supply of nutrients to the cell to allow for proper functioning and maintenance. Exemplary disorders include disorders, diseases, conditions or injuries in which upregulation of intracellular glucose, pyruvate, lactate, NADPH would be beneficial, e.g., to increase cell viability, such as ischemic disorders, neurodegenerative disorders, ocular disorders, retinal disorders, stroke, heart attack, or wound healing.
(44) As used herein, the term neurodegenerative disorder refers to disorders in which neuronal integrity is threatened, for example, where neuronal cells display decreased survival or exhibit an inability or reduced ability to propagate a signal. Neurodegenerative disorders are well known in the art and include, for example, stroke or Alzheimer's Disease.
(45) As used herein, the term ocular disorder refers to a disorder of the eye. In a particular embodiment of the invention, the ocular disorder is characterized and/or associated with cellular starvation. For example, ocular disorders include, but are not limited to, retinal disorders, retinitis pigmentosa, age related macular degeneration, cone rod dystrophy, rod cone dystrophy and glaucoma.
(46) As used herein, the term retinal disorder refers generally to a disorder of the retina. In one embodiment, the retinal disorder is associated with decreased viability, for example, death, of cone cells, and/or rod cells. Moreover, in a particular embodiment, a retinal disorder is not associated with blood vessel leakage and/or growth, for example, as is the case with diabetic retinopathy, but, instead is characterized primarily by reduced viability of cone cells and/or rod cells. In certain embodiments, the retinal disorder is a genetic disorder. In a particular embodiment, the retinal disorder is retinitis pigmentosa.
(47) As used herein, the term retinitis pigmentosa or RP is known in the art and encompasses a disparate group of genetic disorders of rods and cones. Retinitis pigmentosa generally refers to retinal degeneration often characterized by the following manifestations: night blindness, progressive loss of peripheral vision, eventually leading to total blindness; ophthalmoscopic changes consist in dark mosaic-like retinal pigmentation, attenuation of the retinal vessels, waxy pallor of the optic disc, and in the advanced forms, macular degeneration. In some cases there can be a lack of pigmentation. Retinitis pigmentosa can be associated to degenerative opacity of the vitreous body, and cataract. Family history is prominent in retinitis pigmentosa; the pattern of inheritance may be autosomal recessive, autosomal dominant, or X-linked; the autosomal recessive form is the most common and can occur sporadically.
(48) As used herein, the terms Cone-Rod Dystrophy or CRD and Rod-Cone Dystrophy or RCD refer to art recognized inherited progressive diseases that cause deterioration of the cone and rod photoreceptor cells and often result in blindness. CRD is characterized by reduced viability or death of cone cells followed by reduced viability or death of rod cells. By contrast, RCD is characterized by reduced viability or death of rod cells followed by reduced viability or death of cone cells.
(49) As used herein, the term age-related macular degeneration also referred to as macular degeneration or AMD, refers to the art recognized pathological condition which causes blindness amongst elderly individuals. Age related macular degeneration includes both wet and dry forms of ARMD. The dry form of ARMD, which accounts for about 90 percent of all cases, is also known as atrophic, nonexudative, or drusenoid (age-related) macular degeneration. With the dry form of ARMD, drusen typically accumulate in the retinal pigment epithelium (RPE) tissue beneath/within the Bruch's membrane. Vision loss can then occur when drusen interfere with the function of photoreceptors in the macula, which may include reduction of the flow of nutrients from the choroidal vasculature through the RPE to the photoreceptors. The dry form of ARMD results in the gradual loss of vision over many years. The dry form of ARMD can lead to the wet form of ARMD. The wet form of ARMD, also known as exudative or neovascular (age-related) macular degeneration, can progress rapidly and cause severe damage to central vision. The macular dystrophies include Stargardt Disease, also known as Stargardt Macular Dystrophy or Fundus Flavimaculatus, which is the most frequently encountered juvenile onset form of macular dystrophy.
(50) As used herein, the term glaucoma has its art recognized meaning, and refers to a group of eye diseases characterized by degeneration of the optic nerve head and visual field loss, often caused by increased intraocular pressure due to blockage of the channel through which aqueous humor drains (chronic or open-angle glaucoma) or by pressure of the iris against the lens (acute or angle-closure glaucoma). The term glaucoma, as used herein, includes primary glaucomas, secondary glaucomas, and familial (i.e., inherited glaucomas). The increase in intraocular pressure may result in a reduction of blood flow through the retinal vasculature, thus leading to a reduction in nutrients delivered to retinal neurons.
(51) As used herein, the term stroke refers to the art recognized pathological condition in which impairment of consciousness and neurological symptom(s) are acutely induced by a cerebrovascular disorder, which includes intracerebral hemorrhages (hypertensive intracerebral hemorrhage and the like), cerebral infarction, transient ischemic attack, subarachnoid hemorrhage, cerebral thrombosis (atherothrombotic cerebral infarction and the like), cerebral embolism (cardiogenic cerebral embolism and the like) and lacunar infarction.
(52) As used herein, the terms Alzheimer's Disease or AD encompass both non-hereditary and hereditary forms of the disease. Specifically, the terms, as used herein, include the non-hereditary form which is a progressive degenerative disease of the brain primarily associated with aging. The terms further include the hereditary form called familial Alzheimer's disease (FAD). Clinical presentation of AD is characterized by loss of memory, cognition, reasoning, judgment, and orientation. As the disease progresses, motor, sensory, and linguistic abilities are also affected until there is global impairment of multiple cognitive functions. These cognitive losses occur gradually, but typically lead to severe impairment and death in the range of four to twelve years.
(53) The term glucose transporter as used herein refers to a protein that catalyzes the transport of glucose across a cell membrane. More specifically the glucose transporter facilitates the uptake of glucose into the cytoplasm across the plasma membrane.
(54) The term lactate transporter as used herein refers to a protein that catalyzes the transport of lactate across a cell membrane. More specifically the lactate transporter facilitates the uptake of lactate into the cytoplasm across the plasma membrane.
(55) As used herein, the term nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA. A nucleic acid molecule used in the methods of the present invention can be isolated using standard molecular biology techniques. Using all or portion of a nucleic acid sequence of interest as a hybridization probe, nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning. A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
(56) An isolated nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. For example, with regards to genomic DNA, the term isolated includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated. Preferably, an isolated nucleic acid molecule is free of sequences which naturally flank the nucleic acid molecule (i.e., sequences located at the 5 and 3 ends of the nucleic acid molecule) in the genomic DNA of the organism from which the nucleic acid molecule is derived.
(57) A nucleic acid molecule for use in the methods of the invention can also be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of a nucleic acid molecule of interest. A nucleic acid molecule used in the methods of the invention can be amplified using cDNA, mRNA or, alternatively, genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. Furthermore, oligonucleotides corresponding to nucleotide sequences of interest can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
(58) The nucleic acids for use in the methods of the invention can also be prepared, e.g., by standard recombinant DNA techniques. A nucleic acid of the invention can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which has been automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Pat. No. 4,598,049; Caruthers et al. U.S. Pat. No. 4,458,066; and Itakura U.S. Pat. Nos. 4,401,796 and 4,373,071, incorporated by reference herein).
(59) As used herein, an antisense nucleic acid comprises a nucleotide sequence which is complementary to a sense nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence or complementary to the coding strand of a gene. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
(60) In one embodiment, a nucleic acid molecule of the invention is an siRNA molecule. In another embodiment, a nucleic acid molecule of the invention is an shRNA molecule. In one embodiment, a nucleic acid molecule of the invention mediates RNAi.
(61) In another embodiment, a nucleic acid molecule of the invention mediates translational inhibition. RNA interference (RNAi) is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287. 2431-2432 (2000); Zamore, P. D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev. 13, 3191-3197 (1999); Cottrell T R, and Doering T L. 2003. Trends Microbiol. 11:37-43; Bushman F. 2003. Mol. Therapy. 7:9-10; McManus M T and Sharp P A. 2002. Nat Rev Genet. 3:737-47). The process occurs when an endogenous ribonuclease cleaves the longer dsRNA into shorter, e.g., 21- or 22-nucleotide-long RNAs, termed small interfering RNAs or siRNAs. The smaller RNA segments then mediate the degradation of the target mRNA. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabs or Ambion. In one embodiment one or more of the chemistries described herein for use in antisense RNA can be employed in molecules that mediate RNAi.
(62) As used herein, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes or nucleic acid molecules to which they are operatively linked and are referred to as expression vectors or recombinant expression vectors or simply expression vectors. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. In some embodiments, expression vectors are used in order to permit pseudotyping of the viral envelope proteins.
(63) Expression vectors are often in the form of plasmids. In the present specification, plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, adeno-associated viruses, lentiviruses), which serve equivalent functions.
(64) As used herein, the term retrovirus is used in reference to RNA viruses that utilize reverse transcriptase during their replication cycle. The retroviral genomic RNA is converted into double-stranded DNA by reverse transcriptase. This double-stranded DNA form of the virus is capable of being integrated into the chromosome of the infected cell; once integrated, it is referred to as a provirus. The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles. At each end of the provirus are structures called long terminal repeats or LTRs. LTRs contain numerous regulatory signals, including transcriptional control elements, polyadenylation signals, and sequences needed for replication and integration of the viral genome. LTRs may be several hundred base pairs in length.
(65) The term AAV vector refers to a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, or AAVX7. rAAV vector refers to a vector that includes AAV nucleotide sequences as well as heterologous nucleotide sequences. rAAV vectors require only the 145 base terminal repeats in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka (1992) Curr. Topics Microbiol. Immunol. 158:97). Typically, the rAAV vector genome will only retain the inverted terminal repeat (ITR) sequences so as to maximize the size of the transgene that can be efficiently packaged by the vector. The ITRs need not be the wild-type nucleotide sequences, and may be altered, e.g., by the insertion, deletion or substitution of nucleotides, as long as the sequences provide for functional rescue, replication and packaging. In particular embodiments, the AAV vector is an AAV2/5 or AAV2/8 vector. Suitable AAV vectors are described in, for example, U.S. Pat. No. 7,056,502 and Yan et al. (2002) J. Virology 76(5):2043-2053, the entire contents of which are incorporated herein by reference.
(66) As used herein, the term lentivirus refers to a group (or genus) of retroviruses that give rise to slowly developing disease. Viruses included within this group include HW (human immunodeficiency virus; including but not limited to HW type 1 and HW type 2), the etiologic agent of the human acquired immunodeficiency syndrome (AIDS); visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep; the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus (EIAV), which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SW), which cause immune deficiency and encephalopathy in sub-human primates. Diseases caused by these viruses are characterized by a long incubation period and protracted course. Usually, the viruses latently infect monocytes and macrophages, from which they spread to other cells. HW, FW, and SW also readily infect T lymphocytes (i.e., T-cells). In one embodiment of the invention, the lentivirus is not HW.
(67) The term promoter as used herein refers to a recognition site of a DNA strand to which the RNA polymerase binds. The promoter forms an initiation complex with RNA polymerase to initiate and drive transcriptional activity. The complex can be modified by activating sequences termed enhancers or inhibitory sequences termed silencers.
(68) The terms transformation, transfection, and transduction refer to introduction of a nucleic acid, e.g., a viral vector, into a recipient cell.
(69) As used herein, the term subject includes warm-blooded animals, preferably mammals, including humans. In a preferred embodiment, the subject is a primate. In an even more preferred embodiment, the primate is a human.
(70) As used herein, the various forms of the term modulate are intended to include stimulation (e.g., increasing or upregulating a particular response or activity) and inhibition (e.g., decreasing or downregulating a particular response or activity).
(71) As used herein, the term 417 contacting (i.e., contacting a cell with an agent) is intended to include incubating the agent and the cell together in vitro (e.g., adding the agent to cells in culture) or administering the agent to a subject such that the agent and cells of the subject are contacted in vivo. The term contacting is not intended to include exposure of cells to an agent that may occur naturally in a subject (i.e., exposure that may occur as a result of a natural physiological process).
(72) As used herein, the term administering to a subject includes dispensing, delivering or applying a composition capable of enhancing the intracellular generation and/or uptake of glucose, NADPH, pyruvate, and/or lactate to a subject by any suitable route for delivery of the composition to the desired location in the subject, including delivery by intraocular administration or intravenous administration. Alternatively or in combination, delivery is by the topical, parenteral or oral route, intracerebral injection, intramuscular injection, subcutaneous/intradermal injection, intravenous injection, buccal administration, transdermal delivery and administration by the rectal, colonic, vaginal, intranasal or respiratory tract route.
(73) Various additional aspects of the methods of the invention are described in further detail in the following subsections.
(74) Methods Of The Invention
(75) The present invention provides methods for inhibiting starvation of a cell, e.g., a neuronal cell, which generally comprise contacting a cell with an agent which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH in the cell.
(76) The present invention also provides methods for treating or preventing a disorder associated with starvation of a cell in a subject. The methods generally comprise administering to the subject an agent which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH.
(77) In another aspect, the present invention provides methods for treating or preventing retinitis pigmentosa in a subject. Such methods generally comprise administering to the subject an agent which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH.
(78) The present invention further provides methods for prolonging the viability of a cone cell. The methods generally comprise contacting the cell with an agent which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH.
(79) In one embodiment, the methods described herein can be performed in vitro. For example, intracellular levels of glucose, pyruvate, lactate, and/or NADPH can be modulated in a cell in vitro and then the treated cells can be administered or re-administered to a subject. In one embodiment, the cell is a mammalian cell, e.g., a human cell. For practicing the methods in vitro, cells can be obtained from a subject by standard methods and incubated (e.g., cultured) in vitro with an agent which stimulates intracellular levels of glucose, pyruvate, lactate, and/or NADPH. Methods for isolating cells are well known in the art. The cells can be readministered to the same subject, or another subject which is compatible with the donor of the cells.
(80) For administration of cells to a subject, it may be preferable to first remove residual agents in the culture from the cells before administering them to the subject. This can be done, for example, by gradient centrifugation of the cells or by washing of the tissue. Methods for the ex vivo genetic modification of cells followed by re-administration to a subject are well known in the art and described in, for example, U.S. Pat. No. 5,399,346 the entire contents of which are incorporated herein by reference.
(81) In one embodiment, the invention allows for modulation of intracellular levels of glucose, pyruvate, lactate, and/or NADPH in vivo, by administering to a subject a therapeutically effective amount of an agent as described herein. For example, intracellular levels of glucose, pyruvate, lactate, and/or NADPH can be modulated to treat or prevent a disorder associated with cellular starvation.
(82) The claimed methods of modulation are not meant to include naturally occurring events. For example, the term agent or modulator is not meant to embrace endogenous mediators produced by the cells of a subject.
(83) Application of the methods of the invention for the treatment and/or prevention of a disorder can result in curing the disorder, decreasing at least one symptom associated with the disorder, either in the long term or short term or simply a transient beneficial effect to the subject. Accordingly, as used herein, the terms treat, treatment and treating include the application or administration of agents, as described herein, to a subject who is suffering from a disorder associated with starvation of a cell, or who is susceptible to such conditions with the purpose of curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving or affecting such conditions or at least one symptom of such conditions. As used herein, the condition is also treated if recurrence of the condition is reduced, slowed, delayed or prevented.
(84) Subjects suitable for treatment using the regimens of the present invention should have or are susceptible to developing disorders associated with cellular starvation, e.g., neuronal cellular starvation, for example, retinal disorders. For example, subjects may be genetically predisposed to development of the disorders. Alternatively, abnormal progression of the following factors including, but not limited to visual acuity, the rate of death of cone and/or rod cells, night vision, peripheral vision, attenuation of the retinal vessels, and other ophthalmoscopic factors associated with retinal disorders such as retinitis pigmentosa may indicate the existence of or a predisposition to a retinal disorders. Other art recognized symptoms or risk factors, as associated with the development of or predisposition to the particular disorder, for example, Alzheimer's Disease or a stroke, heart attack, diabetes, Parkinson's, may be monitored as well known in the art.
(85) The agents, as described herein, may be administered as necessary to achieve the desired effect and depend on a variety of factors including, but not limited to, the severity of the condition, age and history of the subject and the nature of the composition, for example, the identity of the genes or the affected biochemical pathway. In various embodiments, the compositions may be administered at least two, three, four, five or six times a day. Additionally, the therapeutic or preventative regimens may cover a period of at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 weeks.
(86) The ability of an agent to upregulate intracellular levels of glucose, pyruvate, lactate, and/or NADPH can be determined as described herein, e.g., by determining the ability of the agent to modulate: cell viability (e.g., modulation of apoptosis), cleavage of LaminA or Caspase 3; expression of Opn1sw, Opn1mw, LAMP-2A, LAMP-2B, or LAMP-2C; protein production of LAMP-2A, LAMP-2B, LAMP-2C, HIF1-, or GLUT1; phosphorylation of mTOR, S6K1, AMPK, PTEN, or Akt; phospholipid production; production of reactive oxygen species; and/or the expression and protein synthesis of photoreceptor specific opsins.
(87) In various embodiments, the methods of the present invention further comprise monitoring the effectiveness of treatment. For example, visual acuity, the rate of death of cone and/or rod cells, night vision, peripheral vision, attenuation of the retinal vessels, and other ophthalmoscopic changes associated with retinal disorders such as retinitis pigmentosa may be monitored to assess the effectiveness of treatment. Additionally, the rate of death of cells associated with the particular disorder that is the subject of treatment and/or prevention, may be monitored. Alternatively, the viability of such cells may be monitored, for example, as measured by phospholipid production. The assays described in the Examples section below may also be used to monitor the effectiveness of treatment.
(88) In one embodiment, the agent is a nucleic acid molecule. In a particular embodiment, the nucleic acid molecule is a glucose transporter. For example, glucose transporters for use in the present invention may belong to the GLUT family of transporters (including at least one of GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, GLUT13, and GLUT14), encoded by the SLC2 family of genes (including at least one of SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A6, SLC2A7, SLC2A8, SLC2A9, SLC2A10, SLC2A11, SLC2A12, SLC2A13, and SLC2A14), which upregulate the cellular uptake of glucose by facilitated diffusion. In a particular embodiment, the nucleic acid molecule is SLC2A1 encoding the GLUT1 transporter.
(89) The amino acid sequences of the GLUT family of transporters are known and can be found in, for example, GenBank Accession Nos. GI:166795299 (GLUT1; GI:4557851 (GLUT2; GI:5902090 (GLUT3; GI:4507011 (GLUT4); GI:4507013 (GLUT5, isoform 1); GI:207447703 (GLUT5, isoform 2); GI:223029432 (GLUT6, isoform 1); GI:223029430 (GLUT6, isoform 2); GI:134053883 (GLUT7); GI:21361449 (GLUT8); GI:47933387 (GLUT9, isoform 1); GI:47933389 (GLUT9, isoform 2); GI:13540547 (GLUT10); GI:190684655 (GLUT11, isoform a); GI:68226418 (GLUT11, isoform b); GI:68226420 (GLUT11, isoform c); GI:21553331 (GLUT12); GI:203098995 (GLUT13); and GI:23592238 (GLUT14).
(90) The nucleotide sequences of the SLC2 family of transporters are known and can be found in, for example, GenBank Accession Nos. GI:166795298 (SLC2A1); GI:4557850 (SLC2A2); GI:221136810 (SLC2A3); GI:83722278 (SLC2A4); GI:207446701 (SLC2A5, variant 1); GI:207447702 (SLC2A5, variant 2); GI:223029431 (SLC2A6, variant 1); GI:223029429 (SLC2A6, variant 2); GI:134053882 (SLC2A7); GI:51870928 (SLC2A8); GI:47933386 (SLC2A9, variant 1); GI:47933388 (SLC2A9, variant 2); GI:39777591 (SLC2A1); GI:190684654 (SLC2A11, variant 1); GI:190684652 (SLC2A11, variant 2); GI:190684653 (SLC2A11, variant 3); GI:93277101 (SLC2A12); GI:203098994 (SLC2A13); and GI:24475843 (SLC2A14).
(91) In another embodiment, the stimulatory agent is a nucleic acid molecule involved in promoting gluconeogenesis, thereby increasing metabolic flux through gluconeogenesis, and/or reducing metabolic flux through glycolysis. As is well known in the art, gluconeogenesis promotes the generation of glucose, whereas glycolysis promotes the degradation of glucose. Accordingly, the nucleic acid molecule may be a gluconeogenic gene including, but not limited to, pyruvate carboxylase, phosphoenolpyruvate carboxykinase and fructose 1,6-bisphosphatase. In a particular embodiment, one or more gluconeogenic genes may be utilized.
(92) The nucleotide and amino acid sequences of pyruvate carboxylase are known and can be found in, for example, GenBank Accession Nos. GI:106049294 (variant 1), GI:106049291 (variant 2), and GI:106049527 (variant 3). The nucleotide and amino acid sequences of phosphoenolpyruvate carboxykinase are known and can be found in, for example, GenBank Accession Nos. GI:66346720 (variant 1) and GI:66346722 (variant 2). The nucleotide and amino acid sequences of fructose 1,6-bisphosphatase are known and can be found in, for example, GenBank Accession Nos. GI:160298191 (FBP1, variant 1), GI:189083691 (FBP1, variant 2), and GI:22907027 (FBP2).
(93) The present invention further provides methods for increasing intracellular levels of lactate, which, in turn, can serve as an important precursor for gluconeogenesis and the production of glucose. As is well known in the art, lactate is converted to pyruvate, which, in turn, is converted to oxaloacetate for entry into gluconeogenesis and the production of glucose. Accordingly, in one embodiment, the agent may be involved in increasing the uptake of lactate. For example, the agent may be a stimulatory agent, e.g., a nucleic acid molecule that, for example, encodes a lactate transporter (a monocarboxylic acid transporter). In another embodiment, the agent may be an inhibitory agent that downregulates a negative regulator of, for example, a lactate transporter. In yet another embodiment, the agent may be a stimulatory agent, e.g., glutamate, that, for example, increases extracellular lactate concentrations my causing its release from neighboring cells, e.g., Muller glia and/or astrocytes.
(94) The nucleotide and amino acid sequences of members of the monocarboxylic acid transporter family are known and can be found in, for example, GenBank Accession Nos. GI:115583684 (SLC16A1, variant 1) and GI:262073006 (SLC16A1, variant 2); GI:164663748 (SLC16A2); GI:109288011 (SLC16A3, variant 1), GI:109288008 (SLC16A3, variant 2), and GI:109288009 (SLC16A3, variant 3); GI:4759113 (SLC16A4); GI:20127461 (SLC16A5); GI:141802120 (SLC16A6); GI:34222196 (SLC16A7); GI:114796625 (SLC16A8); GI:197383642 (SLC16A9); GI:221139821 (SLC16A10); GI:23503292 (SLC16A11); GI:157041232 (SLC16A12); GI:222537717 (SLC16A13); and GI:42415495 (SLC16A14).
(95) The present invention further provides methods for increasing intracellular levels of NADPH, which, as described above, is important for the generation of phospholipids, the primary component of cellular membranes. Moreover, NADPH serves to detoxify free oxygen radicals which can be damaging to cells, e.g., neuronal cells. For example, after rod cells die, excess oxygen, which is subsequently converted to free oxygen radicals in the presence of light or by phototransduction, accumulates around cone cells. The presence of free oxygen radicals diverts available NADPH from, for example, the generation of phospholipids, thereby reducing the viability of cells. By enhancing the levels of NADPH, in accordance with the methods of the present invention, one can serve to increase phospholipid production and, in turn, cellular membrane generation and, further, to detoxify otherwise damaging free oxygen radicals.
(96) Accordingly, in a particular embodiment, the methods of the present invention are directed to enhancing the ability of a cell to generate NADPH. For example, increasing cellular levels of glucose by the methods described herein serves to increase metabolic flux through the pentose phosphate pathway, thereby generating increased levels of NADPH. Alternatively or in combination, cells suffering from starvation or subject suffering from disorders associated with such starvation can be contacted with agents, e.g., stimulatory agents, which directly enhance intracellular levels of NADPH. For example, the stimulatory agent may be a nucleic acid molecule, e.g., a nucleic acid molecule encoding malic enzyme, which serves to convert malate to pyruvate and generate NADPH as a byproduct. In another embodiment, the stimulatory agent may be, e.g., insulin or triiodothyronine (T3) that e.g., stimulates the expression of malic enzyme. In yet another embodiment, the stimulatory agent may be glutamate that, e.g., stimulates lactate release from neighboring cells.
(97) The nucleotide and amino acid sequences of members of the malic enzyme family are known and can be found in, for example, GenBank Accession Nos. GI:112382261 (ME1), GI:270265877 (ME2, variant 1), GI:270265878 (ME2, variant 2), GI:62420879 (ME3, variant 1), GI:62420881 (ME3, variant 2), and GI:239049446 (ME3, variant 3).
(98) In another embodiment, the agent is an inhibitory agent which downregulates a negative regulator of the synthesis of, for example, malate. In one aspect, the present invention is directed to the use of an agent, e.g., a nucleic acid molecule, vectors and compositions comprising such nucleic acid molecules, to prolong the viability of cone cells. In one embodiment, the viability or survival of cones cells is short term viability, e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 3 years, about 4 years, about 5 years, about 10 years, about 15, years, about 20 years, about 25 years, about 30 years, about 40 years, about 50 years, about 60 years, about 70 years, and about 80 years.
(99) The methods of the invention described above, thus, may be used to treat or prevent starvation of cells and disorders associated with such starvation. In one embodiment, the disorder is a neurodegenerative disorder, such as a stroke or Alzheimer's Disease. In other embodiments, the disorder is an ocular disorder including, but not limited to, retinitis pigmentosa, age related macular degeneration, cone rod dystrophy, rod cone dystrophy and glaucoma. In further embodiments, the disorder is an ocular disorder associated with decreased viability of cone and/or rod cells. In yet another embodiment, the disorder is a genetic disorder.
(100) In one embodiment, the invention is directed to a method of treating or preventing a disorder associated with starvation of a neuronal cell, for example, retinitis pigmentosa, in a subject by selecting a subject who is susceptible to the development of the disorder and administering to the subject an effective amount of the nucleic acid molecules, vectors and/or compositions of the present invention, thereby treating or preventing the disorder in the subject.
(101) The overall strategy to save neurons from degeneration is to supply them with the genes that will allow them to make up for deficits in the building materials that are required to maintain function and survival. Genes encoding gluconeogenic enzymes, glucose transporter(s), and/or NADPH synthetic enzymes are those targeted for delivery. Vectors derived from AAV, adenoviruses, lentiviruses and/or other types of retroviruses, as well as electroporation can be used.
(102) Age related macular degeneration is another disease in which cones die. The early signs of this disease are drusen, which are accumulations of lipids and proteins in the region between the choroidal vasculature, the retinal pigmented epithelium, and photoreceptors. The drusen likely impedes the flow of nutrients through the RPE to the photoreceptors. Treatments with the gluoconeogenic enzymes would prevent the rapid death of nutritionally deprived cones. In addition to cone photoreceptor survival, the survival of several other types of neurons has been proposed to result form lack of glucose and/or oxygen, or other nutrients.
(103) Glaucoma is another disease that can be treated using the methods of the present invention. Glaucoma is a disease in which ganglion cells die, and high intraocular pressure often accompanies ganglion cell death. Compromised blood flow due to increased pressure might cause the ganglion cells to die. Gluconeogenic enzymes are expected to prolong their survival by allowing lactate made by Muller glial cells to be utilized for glucose synthesis.
(104) Stroke is yet another disease that can be treated using the methods of the present invention. Stroke is caused by a compromised blood supply. Given that neurons expend energy rapidly, a depletion in glucose and oxygen can lead to rapid death. Supplying the genes for gluconeogenesis quickly after a stroke will prevent neuronal death.
(105) Similarly, heart attack is caused, at least in part, by compromised blood supply and, thus, depletion in glucose and oxygen often leading to heart muscle death. Accordingly, supplying the genes for gluconeogenesis quickly after a heart attack will prevent heart cell death
(106) Alzheimer's Disease may be caused, at least in part, by a reduction in energy supply. Physical and mental activity later in life is believed to supply good blood flow to the areas being used, thereby helping those cells maintain sufficient nutrition to prevent neuronal death. Providing cells with gluconeogenic genes is expected to also prevent this type of degeneration.
(107) Injuries, such as burns and other wounds will also be benefited by the methods of the invention in that increases in glucose, pyruvate, lactate, and/or NADPH will allow the production of all cellular intermediates for cellular repair necessary for wound healing.
(108) Agents for Use in the Methods of the Invention
(109) Stimulatory Agents
(110) The methods of the invention may use stimulatory agents which upregulate or enhance the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH in a cell. Examples of such stimulatory agents include proteins, nucleic acid molecules, e.g., expression vectors comprising nucleic acid molecules, and chemical agents that stimulate expression and/or activity of a protein which enhances the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH in a cell.
(111) A preferred stimulatory agent is a nucleic acid molecule encoding a protein of interest. For example, a cDNA (full length or partial cDNA sequence) is cloned into a recombinant expression vector and the vector is transfected into cells using standard molecular biology techniques. The cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library.
(112) Following isolation or amplification of a cDNA, the DNA fragment is introduced into a suitable expression vector. For example, nucleic acid molecules encoding a protein of interest in the form suitable for expression of the protein in a host cell, can be prepared using nucleotide sequences based on the nucleic acid sequence of a nucleic acid molecule encoding the protein of interest.
(113) In one embodiment, a stimulatory agent can be present in an inducible construct. In another embodiment, a stimulatory agent can be present in a construct which leads to constitutive expression.
(114) In one embodiment, the nucleic acid molecules of the invention may be delivered to cells, e.g., neuronal cells, or to subjects using a viral vector, preferably one whose use for gene therapy is well known in the art. Techniques for the formation of vectors or virions are generally described in Working Toward Human Gene Therapy, Chapter 28 in Recombinant DNA, 2nd Ed., Watson, J. D. et al., eds., New York: Scientific American Books, pp. 567-581 (1992). An overview of suitable viral vectors or virions is provided in Wilson, J. M., Clin. Exp. Immunol. 107(Suppl. 1):31-32 (1997), as well as Nakanishi, M., Crit. Rev. Therapeu. Drug Carrier Systems 12:263-310 (1995); Robbins, P. D., et al., Trends Biotechnol. 16:35-40 (1998); Zhang, J., et al., Cancer Metastasis Rev. 15:385-401 (1996); and Kramm, C. M., et al., Brain Pathology 5:345-381 (1995). Such vectors may be derived from viruses that contain RNA (Vile, R. G., et al., Br. Med. Bull. 51:12-30 (1995)) or DNA (Ali M., et al., Gene Ther. 1:367-384 (1994)).
(115) Examples of viral vector systems utilized in the gene therapy art and, thus, suitable for use in the present invention, include the following: retroviruses (Vile, R. G., supra; U.S. Pat. Nos. 5,741,486 and 5,763,242); adenoviruses (Brody, S. L., et al., Ann. N.Y. Acad. Sci. 716: 90-101 (1994); Heise, C. et al., Nat. Med. 3:639-645 (1997)); adenoviral/retroviral chimeras (Bilbao, G., et al., FASEB J. 11:624-634 (1997); Feng, M., et al., Nat. Biotechnol. 15:866-870 (1997)); adeno-associated viruses (Flotte, T. R. and Carter, B. J., Gene Ther. 2:357-362 (1995); U.S. Pat. No. 5,756,283); herpes simplex virus I or II (Latchman, D. S., Mol. Biotechnol. 2:179-195 (1994); U.S. Pat. No. 5,763,217; Chase, M., et al., Nature Biotechnol. 16:444-448 (1998)); parvovirus (Shaughnessy, E., et al., Semin Oncol. 23:159-171 (1996)); reticuloendotheliosis virus (Donburg, R., Gene Therap. 2:301-310 (1995)). Extrachromosomal replicating vectors may also be used in the gene therapy methods of the present invention. Such vectors are described in, for example, Calos, M. P. (1996) Trends Genet. 12:463-466, the entire contents of which are incorporated herein by reference. Other viruses that can be used as vectors for gene delivery include poliovirus, papillomavirus, vaccinia virus, lentivirus, as well as hybrid or chimeric vectors incorporating favorable aspects of two or more viruses (Nakanishi, M. (1995) Crit. Rev. Therapeu. Drug Carrier Systems 12:263-310; Zhang, J., et al. (1996) Cancer Metastasis Rev. 15:385-401; Jacoby, D. R., et al. (1997) Gene Therapy 4:1281-1283).
(116) In a particular embodiment, the viral vector for use in the methods of the present invention is an AAV vector. In particular embodiments, the viral vector is an AAV2/5 or AAV2/8 vector. Such vectors are described in, for example, U.S. Pat. No. 7,056,502, the entire contents of which are incorporated herein by reference.
(117) The vector will include one or more promoters or enhancers, the selection of which will be known to those skilled in the art. Suitable promoters include, but are not limited to, the retroviral long terminal repeat (LTR), the SV40 promoter, the human cytomegalovirus (CMV) promoter, and other viral and eukaryotic cellular promoters known to the skilled artisan.
(118) Guidance in the construction of gene therapy vectors and the introduction thereof into affected animals for therapeutic purposes may be obtained in the above-referenced publications, as well as in U.S. Pat. Nos. 5,631,236, 5,688,773, 5,691,177, 5,670,488, 5,529,774, 5,601,818, and PCT Publication No. WO 95/06486, the entire contents of which are incorporated herein by reference.
(119) Generally, methods are known in the art for viral infection of the cells of interest. The virus can be placed in contact with the neuronal cell of interest or alternatively, can be injected into a subject suffering from a disorder associated with neuronal cellular starvation.
(120) In one aspect of the invention, the therapeutic nucleic acid molecule or the vector containing the same will be in the form of a pharmaceutical composition containing a pharmaceutically acceptable carrier. As used herein pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. In one embodiment, the carrier is suitable for intraocular, parenteral, intravenous, intraperitoneal, topical, or intramuscular administration. In another embodiment, the carrier is suitable for oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the gene therapy vector, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
(121) In a particular embodiment, the pharmaceutical compositions of the present invention would be administered in the form of injectable compositions. The vector can be prepared as an injectable, either as liquid solutions or suspensions. The preparation may also be emulsified. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the preparation may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH-buffering agents, adjuvants or immunopotentiators.
(122) In a particular embodiment, the nucleic acid molecules and/or vectors are incorporated in a composition suitable for intraocular administration. For example, the compositions may be designed for intravitreal, subconjuctival, sub-tenon, periocular, retrobulbar, suprachoroidal, and/or intrascleral administration, for example, by injection, to effectively treat the retinal disorder. Additionally, a sutured or refillable dome can be placed over the administration site to prevent or to reduce wash out, leaching and/or diffusion of the active agent in a non-preferred direction.
(123) Relatively high viscosity compositions, as described herein, may be used to provide effective, and preferably substantially long-lasting delivery of the nucleic acid molecules and/or vectors, for example, by injection to the posterior segment of the eye. A viscosity inducing agent can serve to maintain the nucleic acid molecules and/or vectors in a desirable suspension form, thereby preventing deposition of the composition in the bottom surface of the eye. Such compositions can be prepared as described in U.S. Pat. No. 5,292,724, the entire contents of which are hereby incorporated herein by reference.
(124) In general, the nucleic acid molecule is provided in a therapeutically effective amount to elicit the desired effect, e.g., enhancing intracellular levels of glucose, pyruvate, lactate, and/or NADPH. The quantity of the vector to be administered, both according to number of treatments and amount, will also depend on factors such as the clinical status, age, and weight of the subject to be treated, and the severity of the disorder. Precise amounts of active ingredient required to be administered depend on the judgment of the gene therapist and will be particular to each individual patient. Generally, the viral vector is administered in titers ranging from about 110.sup.5, about 1.510.sup.5, about 210.sup.5, about 2.510.sup.5, about 310.sup.5, about 3.510.sup.5, about 410.sup.5, about 4.510.sup.5, about 510.sup.5, about 5.510.sup.5, about 610.sup.5, about 6.510.sup.5, about 710.sup.5, about 7.510.sup.5, about 810.sup.5, about 8.510.sup.5, about 910.sup.5, about 9.510.sup.5, about 110.sup.6, about 1.510.sup.6, about 210.sup.6, about 2.510.sup.6, about 310.sup.6, about 3.510.sup.6, about 410.sup.6, about 4.510.sup.6, about 510.sup.6, about 5.510.sup.6, about 610.sup.6, about 6.510.sup.6, about 710.sup.6, about 7.510.sup.6, about 810.sup.6, about 8.510, about 910.sup.6, about 9.510.sup.6, about 110.sup.7, about 1.510.sup.7, about 210.sup.7, about 2.510.sup.7, about 310.sup.7, about 3.510.sup.7, about 410.sup.7, about 4.510.sup.7, about 510.sup.7, about 5.510.sup.7, about 610.sup.7, about 6.510.sup.7, about 710.sup.7, about 7.510.sup.7, about 810.sup.7, about 8.510.sup.7, about 910.sup.7, about 9.510.sup.7, about 110.sup.8, about 1.510.sup.8, about 210.sup.8, about 2.510.sup.8, about 310.sup.8, about 3.510.sup.8, about 410.sup.8, about 4.510.sup.8, about 510.sup.8, about 5.510.sup.8, about 610.sup.8, about 6.510.sup.8, about 710.sup.8, about 7.510.sup.8, about 810.sup.8, about 8.510.sup.8, about 910.sup.8, about 9.510.sup.8, and about 110.sup.9 colony forming units (cfu) per ml, although ranges may vary. Preferred titers will range from about 110.sup.6 to about 110.sup.8 cfu/ml.
(125) In one embodiment, a packaging cell line is transduced with a retroviral vector carrying the desired nucleic acid molecule to form a producer cell line. The packaging cells may be transduced by any means known in the art, including, e.g., electroporation, CaPO.sub.4 precipitation, or the use of liposomes. Examples of packaging cells that may be transfected include, but are not limited to, BOSC23, Bing, PE501, PA317, .PSI.-2, .PSI.-AM, PA12, T19-14X, VT-19-17-H2, .PSI.-CRE, .PSI.-CRIP, GP+E86, GP+envAm12, and DAN cell lines. Guidance on retroviral producing packaging cells and how to construct them can be found in Short et al., J. Neurosci. Res. 27:427-433 (1990); Miller, A. D., Human Gene Ther. 1:5-14 (1990); Danos, 0, Construction of Retroviral Packaging Cell Lines, in Methods in Molecular Biology (M. Collins, ed.), Vol. 8, The Humana Press Inc., Clifton, N.J., 17-26 (1991); Murdoch, B., et al., Gene Therapy 4:744-749 (1997); and U.S. Pat. Nos. 5,529,774 and 5,591,624, the entire contents of which are incorporated herein by reference.
(126) Retroviral vectors have also been successfully packaged with a vesicular stomatitis virus (VSV) envelope glycoprotein G (pseudotyping). These vectors are more stable and can be concentrated to 10.sup.9 cfu/ml, allowing them to be injected directly (Burns, J. C. et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037).
(127) The producer cells can then be grafted near or into the desired location, for example, intraocularly. Direct injection of high titer retroviral producer cells (Murdoch, B., et al., Gene Ther. 4:744-749 (1997); Onodera, M., et al., Hum Gene Ther. 8:1189-1194 (1997)) should allow for efficient in situ infection with the retroviral sequences (Rainov, N. G., et al., Cancer Gene Ther. 3:99-106 (1996); Ram, Z., et al., Cancer Res. 53:83-88 (1993)). Producer cells injected intraocularly do not generally migrate from the site of injection. Moreover, although they may be rejected by the host, this does not occur for 5-10 days, by which time retroviral infection of nearby cells will have occurred (Ram, Z., et al., J. Neurosurg. 79:400-407 (1993)). In general, vector producer cell (VPC) dosages range from about 2.510.sup.8, about 110.sup.8, about 1.510.sup.8, about 210.sup.8, about 2.510.sup.8, about 310.sup.8, about 3.510.sup.8, about 410.sup.8, about 4.510.sup.8, about 510.sup.8, about 5.510.sup.8, about 610.sup.8, about 6.510.sup.8, about 710.sup.8, about 7.510.sup.8, about 810.sup.8, about 8.510.sup.8, about 910.sup.8, about 9.510.sup.8, and about 110.sup.9 VPCs. The exact amount of producer cells will ultimately be determined by the skilled artisan based on numerous factors, including, but not limited to, the available injectable volume, clinical status of the patient, and the severity of the disorder.
(128) Preferably, the viral genomes of the viral vectors used in the invention should be modified to remove or limit their ability to replicate, however, replication conditional viruses will also be useful in the present invention, as will replicating vectors that are capable of targeting certain cells. (See, e.g., Zhang, J. et al. (1996) Cancer Metastasis Rev. 15:385-401).
(129) In one embodiment, a single viral vector is used to carry multiple nucleic acid molecules, for example, genes encoding pyruvate carboxylase and phosphoenolpyruvate carboxykinase. In another embodiment, two viral vectors are used each carrying one or more genes of interest. If two viral vectors are used, they can be derived from the same or a different type of virus, and can be administered simultaneously or sequentially (i.e., without regard for a specific order).
(130) The nucleic acid molecules can also be delivered using non-viral methods for gene transfer, preferably those whose use in gene therapy is known in the art (Nakanishi, M., Crit. Rev. Therapeu. Drug Carrier Systems 12:263-310 (1995); Abdallah, B., et al., Biol Cell 85:1-7 (1995); Zhang, J., et al., Cancer Metastasis Rev. 15:385-401 (1996); Philips, S. C., Biologicals 23:13-16 (1995); Lee, R. J. and Huang, L., Crit. Rev. Ther. Drug Carrier Syst. 14:173-206 (1997)). Examples of such non-viral vectors for gene delivery include prokaryotic vectors, cationic liposomes, DNA-protein complexes, non-viral T7 autogene vectors (Chen, X., et al., Hum. Gene Ther. 9:729-736 (1998)), fusogenic liposomes, direct injection of nucleic acid (naked DNA), particle or receptor-mediated gene transfer, hybrid vectors such as DNA-adenovirus conjugates or other molecular conjugates involving a non-viral and viral component, starburstpolyamidoamine dendrimers (Kukowska-Latallo, J. F., et al., Proc Natl Acad Sci USA 93:4897-4902 (1996); Tang, M. X., et al., Bioconjug. Chem. 7:703-714 (1996)), cationic peptides (Wyman, T. B., et al., Biochemistry 36:3008-3017 (1997)), mammalian artificial chromosomes (Ascenzioni, F., et al., Cancer Lett. 118:135-142 (1997)), and nanoparticles (Parker Read et al. J. Gene Med. 12:86-96 (2010); Frajo et al. PlosOne 1:E38 (2006).
(131) In addition, the present invention provides an embodiment of the foregoing methods wherein the nucleic acid molecules are delivered using any cellular vector, preferably one whose use for gene therapy is well-established for those skilled in the art. Examples of such cellular vectors for gene therapy include endothelial cells (Rancourt, C., et al., Clin. Cancer Res. 4:265-270 (1998); Qjeifo, J. O., et al., Cytokines Mol. Ther. 2:89-101 (1996)) and macrophages including tumor-infiltrating macrophages (Zufferey, R., et al., Nat. Biotechnol. 15:871-875 (1997); Naldini, L., et al., Science 272:263-267 (1996)), each of which may be modified using viral or non-viral vectors to carry the desired nucleic acid molecules, and thus express the desired gene products. Other suitable non-viral vectors will be readily apparent to the skilled artisan.
(132) Gene delivery can be enhanced by including an internal ribosome entry site (IRES) sequence to achieve coordinate expression of multiple genes on a bicistronic message. IRESs are sequences containing 500-600 bp that are typical of the 5 nontransduced regions of picornaviruses, including the polio- and encephalomyocarditis viruses (EMCV). See, e.g., Ghattas, I. R., et al., Molecular and Cellular Biology 11:5848-5859 (1991); Morgan, R. A., et al., Nucleic Acids Research 20:1293-1299 (1992). This approach has been used for efficient retroviral coexpression of the two subunits of interleukin-12 (Tahara, H., et al., J. Immunol. 154:6466-6474 (1995)). Similarly, a viral sequence, the picornavirus 2A sequence, can be used to create mRNAs encoding more than one protein. The viral 2A peptide is 16-20 amino acids and can be employed as a cleavage peptide located between two proteins of interest, where it promotes their cleavage into two separate proteins (Furler et al. Gene Ther. 8:864-873 (2001). Another alternative is for the vector to contain multiple genes under the control of distinct promoters.
(133) Other examples of stimulatory agents for enhancing the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH in a cell is a small molecule compound, an antibody, or other protein as described below.
(134) Inhibitory Agents
(135) The methods of the invention may also use agents which inhibit a negative regulator of the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH. Such agents can be, for example, intracellular binding molecules that act to specifically inhibit the expression, processing, post-translational modification, or activity of a negative regulator of the intracellular generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH. As used herein, the term intracellular binding molecule is intended to include molecules that act intracellularly to, for example, inhibit the processing expression or activity of a protein by binding to the protein or to a nucleic acid (e.g. an mRNA molecule) that encodes the protein.
(136) Examples of intracellular binding molecules, described in further detail below, include antisense nucleic acids, intracellular antibodies, peptidic compounds, and chemical agents that specifically inhibit the activity of a negative regulator of intracellular levels of glucose, pyruvate, lactate, and/or NADPH.
(137) In one embodiment, such an agent is an antisense nucleic acid molecule that is complementary to a gene encoding a negative regulator of intracellular levels of glucose, pyruvate, lactate, and/or NADPH, or to a portion of said gene, or a recombinant expression vector encoding the antisense nucleic acid molecule. The use of antisense nucleic acids to downregulate the expression of a particular protein in a cell is well known in the art (see e.g. Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, ReviewsTrends in Genetics, Vol. 1(1) 1986; Askari, F. K. and McDonnell, W. M. (1996) N. Eng J. Med. 334:316-318; Bennett, M. R. and Schwartz, S. M. (1995) Circulation 92:1981-1993; Mercola, D. and Cohen, J. S. (1995) Cancer Gene Ther._:47-59; Rossi, J. J. (1995) Br. Med. Bull. 51:217-225; Wagner, R. W. (1994) Nature 372:333-335; each of which is incorporated herein by reference). An antisense nucleic acid molecule comprises a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRNA sequence) and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule.
(138) Antisense sequences complementary to a sequence of an mRNA can be complementary to a sequence found in the coding region of the mRNA, the 5 or 3 untranslated region of the mRNA or a region bridging the coding region and an untranslated region (e.g. at the junction of the 5 untranslated region and the coding region). Furthermore, an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element. Preferably, an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3 untranslated region of an mRNA.
(139) Antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of an mRNA, but more preferably is antisense to only a portion of the coding or noncoding region of an mRNA.
(140) An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g. an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. To inhibit expression in cells, one or more antisense oligonucleotides can be used.
(141) Alternatively, an antisense nucleic acid can be produced biologically using an expression vector into which all or a portion of a cDNA has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest, for instance promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of antisense RNA. The antisense expression vector is prepared according to standard recombinant DNA methods for constructing recombinant expression vectors, except that the cDNA (or portion thereof) is cloned into the vector in the antisense orientation. The antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus. The antisense expression vector can be introduced into cells using a standard transfection technique.
(142) Antisense nucleic acid molecules are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a protein to thereby inhibit expression of the protein, e.g. by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarily to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection at a tissue site. Alternatively, an antisense nucleic acid molecule can be modified to target selected cells and then administered systemically. For example, for systemic administration, an antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g. by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
(143) In yet another embodiment, an antisense nucleic acid molecule that may be used in the methods of the invention is an -anomeric nucleic acid molecule. An -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, 8-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641; incorporated herein by reference). The antisense nucleic acid molecule can also comprise a 2-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148; incorporated herein by reference) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330; incorporated herein by reference).
(144) In still another embodiment, an antisense nucleic acid molecule that may be used in the methods of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g. hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591; incorporated herein by reference)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation mRNAs. A ribozyme having specificity for an encoding nucleic acid molecule of interest can be designed based upon the nucleotide sequence of the cDNA. For example, a derivative of a Tetrahynena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in, an encoding mRNA of interest. See, e.g. Cech et al. U.S. Pat. No. 4,987,071; Cech et al. U.S. Pat. No. 5,116,742; each of which is incorporated herein by reference. Alternatively, a mRNA of interest can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J. W. (1993) Science 261:1411-1418; incorporated herein by reference.
(145) In another embodiment, a agent that promotes RNAi can be used to inhibit expression of a negative regulator of intracellular levels of glucose, pyruvate, lactate, and/or NADPH. RNA interference (RNAi is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287. 2431-2432 (2000); Zamore et al. Cell 101, 25-33 (2000). Tuschl et al. Genes Dev. 13. 3191-3197 (1999); Cottrell T R, and Doering T L. 2003. Trends Microbiol. 11:37-43; Bushman F. 2003. Mol. Therapy. 7:9-10; McManus M T and Sharp P A. 2002. Nat. Rev. Genet. 3:737-47; each of which is incorporated herein by reference). The process occurs when an endogenous ribonuclease cleaves the longer dsRNA into shorter, e.g. 21- or 22-nucleotide-long RNAs, termed small interfering RNAs or siRNAs. The smaller RNA segments then mediate the degradation of the target mRNA. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabsor Ambion. In one embodiment one or more of the chemistries described above for use in antisense RNA can be employed in molecules that mediate RNAi.
(146) Antibodies can also be used as agents in the methods of the invention. In one embodiment, an antibody is an intracellular antibody that inhibits protein activity. Such an intracellular antibody is prepared using methods well known in the art which generally involve preparing a recombinant expression vector which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell.
(147) For inhibition of transcription factor activity according to the inhibitory methods of the invention, an intracellular antibody that specifically binds the protein is expressed within the nucleus of the cell. Nuclear expression of an intracellular antibody can be accomplished by removing from the antibody light and heavy chain genes those nucleotide sequences that encode the N-terminal hydrophobic leader sequences and adding nucleotide sequences encoding a nuclear localization signal at either the N- or C-terminus of the light and heavy chain genes (see e.g. Biocca et al. (1990) EMBO J. 9:101-108; Mhashilkar et al. (1995) EMBO J. 14:1542-1551; each of which is incorporated herein by reference). A preferred nuclear localization signal to be used for nuclear targeting of the intracellular antibody chains is the nuclear localization signal of SV40 Large T antigen (see Biocca et al. (1990) EMBO J. 9:101-108; Mhashilkar et al. (1995) EMBO J. 14:1542-1551; each of which is incorporated herein by reference).
(148) To prepare an intracellular antibody expression vector, antibody light and heavy chain cDNAs encoding antibody chains specific for the target protein of interest, is isolated, typically from a hybridoma that secretes a monoclonal antibody specific for the protein. Antibodies can be prepared by immunizing a suitable subject, (e.g. rabbit, goat, mouse or other mammal), e.g., with a protein immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed protein or a chemically synthesized peptide. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory compound. Antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497; incorporated herein by reference) (see also, Brown et al. (1981) J. Immunol. 127:539-46; Brown et al. (1980) J Biol Chem 255:4980-83; Yeh et al. (1976) PNAS76:2927-31; Yeh et al. (1982) Int. J. Cancer 29:269-75; each of which is incorporated herein by reference). The technology for producing monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, N.Y. (1980); E. A. Lerner (1981) Yale J. Biol. Med., 54:387-402; M. L. Gefter et al. (1977) Somatic Cell Genet., 3:231-36; each of which is incorporated herein by reference). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a protein immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds specifcally, a protein of interest. Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating a monoclonal antibody (see, e.g. G. Galfre et al. (1977) Nature 266:550-52; Gefter et al. Somatic Cell Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra; each of which is incorporated herein by reference). Moreover, the ordinary skilled artisan will appreciate that there are many variations of such methods which also would be useful.
(149) Typically, the immortal cell line (e.g. a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine (HAT medium). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g. the P3-NS1/1-Ag4-1, P3-x63-Ag8.653 or Sp2/O Ag14 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (PEG). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody that specifically binds the protein are identified by screening the hybridoma culture supernatants for such antibodies, e.g. using a standard ELISA assay.
(150) Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody that binds to a protein can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g. an antibody phage display library) with the protein, or a peptide thereof, to thereby isolate immunoglobulin library members that bind specifically to the protein. Kits for generating and screening phage display libraries are commercially available (e.g. the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurJZAP Phage Display Kit, Catalog No. 240612; each of which is incorporated herein by reference).
(151) Examples of methods and compounds particularly amenable for use in generating and screening antibody display libraries can also be found in, for example, Ladner et al U.S. Pat. No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. International Publication WO 92/20791; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Grifeths et al. (1993) EMBO J. 12:725-734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clarkson et al. (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) NucAcid Res 19:4133-4137; Barbas et al. (1991) PNAS 88:7978-7982; McCafferty et al. Nature (1990) 348:552-554; each of which is incorporated herein by reference.
(152) In another embodiment, ribosomal display can be used to replace bacteriophage as the display platform fro identifying antibodies for use in the methods of the invention (see, e.g. Hanes et al. 2000. Nat. Biotechnol. 18:1287; Wilson et al. 2001. Proc. Natl. Acad. Sci. USA 98:3750; Irving et al. 2001 J. Immunol. Methods 248:31; each of which is incorporated herein by reference). In yet another embodiment, cell surface libraries can be screened for antibodies (Boder et al. 2000. Proc. Natl. Acad. Sci. USA 97: 10701; Daugherty et al. 2000 J. Immunol. Methods 243:211; each of which is incorporated herein by reference). Such procedures provide alternatives to traditional hybridoma techniques for the isolation and subsequent cloning of monoclonal antibodies.
(153) In another embodiment, an antibody that may be used in the methods of the invention is a substantially human antibody generated in transgenic animals (e.g., mice) that are incapable of endogenous immunoglobulin production (see e.g. U.S. Pat. Nos. 6,075,181, 5,939,598, 5,591,669 and 5,589,369 each of which is incorporated herein by reference).
(154) For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of a human immunoglobulin gene array to such germ line mutant mice will result in the production of human antibodies upon antigen challenge. Another preferred means of generating human antibodies using SCID mice is disclosed in U.S. Pat. No. 5,811,524 which is incorporated herein by reference. It will be appreciated that the genetic material associated with these human antibodies can also be isolated and manipulated as described herein.
(155) Yet another highly efficient means for generating recombinant antibodies for use in the methods of the invention is disclosed by Newman, Biotechnology, 10:1455-1460 (1992); incorporated herein by reference. Specifically, this technique results in the generation of primatized antibodies that contain monkey variable domains and human constant sequences. This reference is incorporated by reference in its entirety herein. Moreover, this technique is also described in U.S. Pat. Nos. 5,658,570, 5,693,780 and 5,756,096; each of which is incorporated herein by reference.
(156) Once a monoclonal antibody has been identified (e.g. either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library, including monoclonal antibodies that are already known in the art), DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques. For hybridoma derived antibodies, light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For recombinant antibodies, such as from a phage display library, cDNA encoding the light and heavy chains can be recovered from the display package (e.g. phage) isolated during the library screening process. Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 and in the Vbase human germline sequence database.
(157) Once obtained, the antibody light and heavy chain sequences are cloned into a recombinant expression vector using standard methods. As discussed above, the sequences encoding the hydrophobic leaders of the light and heavy chains are removed and sequences encoding a nuclear localization signal (e.g. from SV40 Large T antigen) are linked in-frame to sequences encoding either the amino- or carboxy terminus of both the light and heavy chains. The expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full-length antibody light and heavy chains such that a full-length antibody is expressed intracellularly. In another embodiment, the vector encodes a full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab fragment is expressed intracellularly.
(158) In another embodiment, an inhibitory agent for use in the methods of the invention is a peptidic compound derived from the amino acid sequence of a negative regulator of intracellular levels of glucose, pyruvate, lactate, and/or NADPH.
(159) Peptidic compounds useful in the method of the invention can be made intracellularly in cells by introducing into the cells an expression vector encoding the peptide. Such expression vectors can be made by standard techniques using oligonucleotides that encode the amino acid sequence of the peptidic compound. The peptide can be expressed in intracellularly as a fusion with another protein or peptide (e.g. a GST fusion). Alternative to recombinant synthesis of the peptides in the cells, the peptides can be made by chemical synthesis using standard peptide synthesis techniques.
(160) Synthesized peptides can then be introduced into cells by a variety of means known in the art for introducing peptides into cells (e.g. liposome and the like).
(161) Another form of an inhibitory agent which inhibits a negative regulator of the generation and/or uptake of glucose, pyruvate, lactate, and/or NADPH in a cell is a chemical small molecule compound.
(162) This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as the Figures, are hereby incorporated by reference.
EXAMPLES
Example 1
Assessing Stimulation of the Insulin/mTOR Pathway and Resulting Effects on Cone Cell Death in a Mouse Model of Retinitis Pigmentosa
(163) Material and Methods
(164) Animals: Wild type (wt) mice (C57B1/6N) and PDE-/ mice (referred as rd1 or FVB/N) were purchased from Taconic Farms. The PDE-/ mice have a mutation in the -subunit of cGMP phosphodiesterase (Bowes, C. et al. (1990) Nature 347, 677-80) (PDE). The PDE-knock-out (PDE--KO) lacks the -subunit of PDE (Tsang, S. H. et al. (1996) Science 272, 1026-9). The rhodopsin knock-out (Rho-KO) lacks the rod-specific opsin gene (Tsang, S. H. et al. (1996) Science 272, 1026-9; Lem, J. et al. (1999) Proc Natl Acad Sci USA 96, 736-41). The P23H mouse has a proline-23 to histidine mutation in the rhodopsin gene (Naash, M. I., et al. (1993) Proc Natl Acad Sci USA 90, 5499-503). As this mouse carries a transgene the strain was always crossed back to C57B1/6N to ensure that none of the progeny would carry two alleles of the transgene. The transgene is specifically expressed in rods (Gouras, P., et al. (1994) Vis Neurosci 11, 1227-31; Woodford, B. J., et al. (1994) Exp Eye Res 58, 631-5; al-Ubaidi, M. R. et al. (1990) J Biol Chem 265, 20563-9) and carries 3 mutations in the rhodopsin gene (Val-20 to Gly, Pro-23 to H is, Pro-27 to Leu). In this study it is referred as the P23H mutant. The cone-lacZ strain has been previously described (Wang, Y. et al. (1992) Neuron 9, 429-40). All procedures involving animals were in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
(165) Affymetrix array analysis: RNA was extracted as described previously (Punzo, C. & Cepko, C. (2007) Ophthalmol Vis Sci 48, 849-57). Three to 4 retinae were used per extraction. A minimum of two arrays were analyzed per time point. The statistical significance of each gene expression profile was determined by a Jonckheere-Terpstra test of the hypothesized cone-death patterned alternative, using exact p-values calculated by the Harding algorithm (Harding, E. F. (1984) Applied Statistics 33, 1-6).
(166) qRT-PCR was performed as described previously with the same primers and conditions for Opn1sw and gapdh (Punzo, C. & Cepko, C. (2007) Ophthalmol Vis Sci 48, 849-57). The following primers and conditions were used for the three LAMP-2 splice forms: LAMP-2 forw. ctgaaggaagtgaatgtctacatg (SEQ ID NO:1); LAMP-2A rev. gctcatatccagtatgatggc (SEQ ID NO:2); LAMP-2B rev. cagagtctgatatccagcatag (SEQ ID NO:3); LAMP-2C rev. gacagactgataaccagtacg (SEQ ID NO:4). Conditions for all three PCRs: 95 for 3 sec, 52 for 15 sec, 72 for 25 sec. The data in
(167) Retinal explant cultures: The retina was dissected free from other ocular tissues in DMEM, and then incubated in conditions according to the chart in
(168) TUNEL, X-gal histochemistry and In Situ Hybridizations were performed as described previously (Punzo, C. & Cepko, C. (2007) Ophthalmol Vis Sci 48, 849-57). For the double labeling of cones (see
(169) Viral injections were performed as described previously (Punzo, C. & Cepko, C. L. (2008) Dev Dyn 237, 1034-42). Mice were injected at embryonic day 10 and harvested at postnatal week 10. The fusion protein was generated with a NotI site at the 5' end followed by GFP, then LC3, and then an XhoI site at the 3' end and cloned into pQCXIX (Clonetech: cat. #631515). The following primers were used for the fusion protein: 5'NotI-GFP atgcgggccgccaccatggtgagcaagggcgaggagc (SEQ ID NO:7), 3'GFP-LC3 aggtcttctcggacggcatcttgtacagctcgtccatgc-cgag (SEQ ID NO:8), 5'LC3 atgccgtccgagaagaccttcaagc (SEQ ID NO:9), 3'LC3-XhoI atctcgagttacacagccattgctgtcccgaatg (SEQ ID NO:10).
(170) Rapamycin, Streptozotocin and Insulin treatments were performed as follows. Rapamycin was diluted to 10 mg/ml in ethanol. The stock was diluted to 0.015 mg/ml in drinking water over a period of 2 weeks. A single intraperitoneal injection of 150 l (12 mg/ml in 0.1M citric acid, ph4.5) of Streptozotocin was injected at postnatal day (P) 21. Insulin was injected intraperitoneally daily starting at P21. The concentration was increased weekly such that the first week, 10 U/kg body weight, the second 15 U/kg, the third 20 U/kg and fourth 30 U/kg body weight, were injected. In the treatment that lasted 7 weeks 30 U/kg body weight were injected for the remaining 3 weeks. Blood glucose levels were measured by collecting a drop of blood from the tail directly onto a test strip from TrueTrack smart system (CVS pharmacy). Eye bleeds were avoided due to the fact that cell survival in the retina was being assayed.
(171) Quantification of cone survival was performed as follows. The colors of the bright light image were inverted and processed with Imaris software (Bitplane Inc) to calculate the percentage of blue surface area versus the total retinal surface area (see also
(172) Whole mount and section antibody staining were performed as previously (Punzo, C. & Cepko, C. L. (2008) Dev Dyn 237, 1034-42) described with the following modifications. Antibody staining for LAMP-2: Triton was replaced with 0.01% Saponin. Antibody staining for p*-mTOR and p*-S6: PBS was replaced by TBS in every step of the procedure. Primary antibody dilutions: mouse -rhodopsin Rho4D21:20051; goat --Galactosidase (Serotec) 1:400; rabbit -blue opsin (Jeremy Nathans) 1:1000; rabbit -Gnat1 1:200 (Santa Cruz); rabbit -Cleaved Caspase-3 (Cell Signaling) 1:100; rabbit -Cleaved Lamin A (Cell Signaling) 1:100; rabbit -GLUT-1 (Alpha Diagnostics) 1:100; rabbit -p*-mTOR (Ser2448) (Cell Signaling) 1:300; rabbit -p*-S6 (Ser235/236) (Cell Signaling) 1:100; rabbit -HIF-1 (R&D Systems) 1:300; rat -LAMP-2 (clone: GL2A7, from DSHB) 1:200. Time points analyzed for the rod and cone death kinetics (P: postnatal day; PW: postnatal week): PDE-/: P10-P20 daily, PW3-10 weekly, PW 12, PW15, PW18, PW45; PDE--KO: P10-P20 daily, PW3-PW10 weekly, PW15, PW25, PW45; Rho-KO: PW4-PW8 weekly, PW10, PW11, PW17, PW20, PW25, PW27, PW31, PW34, PW37, PW45, PW55, PW80; P23H: PW5, PW10, PW16, PW25, PW30, PW35, PW40, PW65, PW70, PW75, PW80, PW85.
(173) Results
(174) Rod and Cone Death Kinetics
(175) To establish a framework for comparing gene expression in 4 different models of RP, the equivalent stages of disease pathology were established through examination of the kinetics of rod (
(176) Two methods were used to determine the onset and progression of cone death. First, the overall time frame of cone demise was determined by quantitative real-time polymerase chain reaction (qRT-PCR) (
(177) In summary, the kinetics and histological changes that accompanied rod and cone death shared several features across the 4 models. First, cone degeneration always started after the major rod death phase (
(178) Microarray Analysis
(179) To determine common gene expression changes, RNA samples from all 4 models were collected halfway through the major phase of rod death, at the onset of cone death, and from two time points during the cone death phase (
(180) mTOR in Wild Type and Degenerating Retinae
(181) Based on the findings of the microarray analysis, the insulin/mTOR signaling pathway was examined during the period of cone death. The kinase, mTOR, is a key regulator of protein synthesis and ribosome biogenesis (Reiling, J. H. & Sabatini, D. M. (2006) Oncogene 25, 6373-83). When cellular energy levels are high, mTOR allows energy consuming processes, such as translation, and prevents autophagy, while nutrient poor conditions have the reverse effect. Therefore, glucose, which increases cellular ATP levels, and amino acid availability, especially that of leucine, positively affect mTOR activity. To understand if cellular energy levels or amino acid availability might be compromised in cones during degeneration, levels of phosphorylated mTOR (p*-mTOR) were examined by immunofluorescence. Phosphorylation of mTOR increases kinase activity, and therefore levels of p*-mTOR can serve as an indicator of its activity level. Since every eukaryotic cell expresses mTOR, a certain level of p*-mTOR is likely to be found in every cell. Surprisingly, high levels of p*-mTOR were detected only in dorsal cones of wild type retinae (
(182) Responses of Cones to Nutritional Imbalance
(183) The data on mTOR evidenced a nutritional imbalance in cones during cone degeneration, possibly caused by reduced glucose levels in cones. To test this idea, the level of the heterodimeric transcription factor, Hypoxia inducible factor 1 (HIF-1/), which improves glycolysis under stress conditions such as low oxygen, was examined. HIF-1 and mTOR are tightly linked as low oxygen results in low energy due to reduced oxidative phosphorylation, and therefore in reduced mTOR activity (Reiling, J. H. & Sabatini, D. M. (2006) Oncogene 25, 6373-83; Dekanty, A., et al. (2005) J Cell Sci 118, 5431-41; Hudson, C. C. et al. (2002) Mol Cell Biol 22, 7004-14; Treins, C., et al. (2002) J Biol Chem 277, 27975-81; Zhong, H. et al. (2000) Cancer Res 60, 1541-5; Thomas, G. V. et al. (2006) Nat Med 12, 122-7). An upregulation of the regulated subunit HIF-1 would likely reflect low glucose levels in cones, and not hypoxic conditions, as oxygen levels are increased due to the loss of rods (Yu, D. Y. & Cringle, S. J. (2005) Exp Eye Res 80, 745-51). Immunofluorescence analysis of HIF-1 during cone degeneration revealed an upregulation of the protein in cones in all 4 mouse models (
(184) To ascertain if cones are nutritionally deprived, autophagy within cones was assessed. Two types of autophagy are inducible by various degrees of nutrient deprivation: macroautophagy and chaperone mediated autophagy (CMA) (Massey, A., et al. (2004) Int J Biochem Cell Biol 36, 2420-34; Finn, P. F. & Dice, J. F. (2006) Nutrition 22, 830-44; Codogno, P. & Meijer, A. J. (2005) Cell Death Differ 12 Suppl 2, 1509-18; Dice, J. F. (2007) Autophagy 3, 295-9). Macroautophagy is non-selective, targets proteins or entire organelles, and is marked by de novo formation of membranes that form intermediate vesicles (autophagosomes) that fuse with the lysosomes. The machinery required for macroautophagy has been shown to be present in PRs (Kunchithapautham, K. & Rohrer, B. (2007) Autophagy 3, 433-41). In contrast, CMA is selective and targets individual proteins for transport to the lysosomes. The presence of macroautophagy was assessed by infection with a viral vector encoding a fusion protein of green fluorescent protein (GFP) and light chain 3 (LC3), an autophagosomal membrane marker (Kabeya, Y. et al. (2000) Embo J 19, 5720-8; Mizushima, N., et al. (2004) Mol Biol Cell 15, 1101-11; Punzo, C. & Cepko, C. L. (2008) Dev Dyn 237, 1034-42). No difference was observed in GFP distribution in cones of wild type and mutant mice, indicating that formation of autophagosomes was absent during cone death (see
(185) CMA is normally activated over extended periods of starvation and results in increased levels of lysosomal-associated membrane protein (LAMP) type 2A at the lysosomal membrane (Massey, A., et al. (2004) Int J Biochem Cell Biol 36, 2420-34; Finn, P. F. & Dice, J. F. (2006) Nutrition 22, 830-44; Cuervo, A. M. & Dice, J. F. (200) Traffic 1, 570-83). Both starvation and oxidative stress can induce CMA (Massey, A., et al. (2004) Int J Biochem Cell Biol 36, 2420-34). Starvation increases LAMP-2A by preventing its degradation while oxidative stress results in de novo synthesis of LAMP-2A (Kiffin, R., et al. (2004) Mol Biol Cell 15, 4829-40). A LAMP-2 antibody that recognizes the proteins resulting from all 3 splice isoforms (Cuervo, A. M. & Dice, J. F. (2000) J Cell Sci 113 Pt 24, 4441-50) (A, B, C) showed high levels of LAMP-2 at the lysosomal membrane in all 4 mutants during cone degeneration (
(186) Stimulation of the Insulin Receptor Pathway Prolongs Cone Survival
(187) The data on mTOR, HIF-1, GLUT1 and the induction of CMA demonstrated that a shortage of glucose in cones resulting in starvation and further demonstrated that the insulin/mTOR pathway plays an important role during cone death. To determine if the insulin/mTOR pathway can influence cone survival, we stimulated the pathway by systemic treatment of PDE-/ mice with insulin. The PDE- mutant was chosen over the other three mutants due to its faster cone death kinetics, allowing for a better read-out of cone survival. Mice were treated with daily intraperitoneal injections of insulin over a 4 week period, starting at the onset of cone death. To reduce insulin, a single injection of streptozotocin, a drug that kills the insulin-producing beta cells of the pancreas, also was examined. Systemic administration of insulin results in a desensitized insulin receptor due to a feedback loop in the pathway, which causes an increase in blood glucose levels. Injection of streptozotocin, which also results in increased blood glucose levels, served as a control for the effect of elevated blood glucose, and also provided animals with reduced levels of insulin. PDE-/ mice injected with insulin showed improved cone survival compared to uninjected control mice. PDE-/ mice injected with Streptozotocin showed a decrease in cone survival (
(188) Discussion
(189) The results presented herein show that cones exhibit signs of nutritional imbalance during the period of cone degeneration in RP mice. The microarray analysis demonstrates that there are changes in cellular metabolism involving the insulin/mTOR pathway at the onset of cone death. It was demonstrated that inhibition of mTOR in wild type mice resulted in the same pattern of loss of red/green opsin as seen during degeneration. In accord with changes in p*-mTOR, and its sensitivity to glucose, an upregulation of HIF-1 and GLUT1 was observed, demonstrating that glucose uptake, and/or the intracellular levels of glucose, may be compromised in cones of RP mice. Additionally, systemic administration of insulin prolonged cone survival, whereas depletion of endogenous insulin had the reverse effect. The systemic treatment with insulin prevented the upregulation of HIF-1 in cones seen normally during cone degeneration, demonstrating that insulin was directly acting on cones. Interestingly, a prolonged treatment of insulin during a time span of 7 weeks instead of 4 weeks did not show any significant improvement of cone survival (see
(190) These studies described herein were designed to determine why the loss of rods result in cone death in RP. The previous hypotheses attributing cone death either to a toxin released by rod cells or to the lack of a trophic factor produced by rod cells and necessary for cone survival each fail to explain the pathology found in humans. The rod and cone death kinetics shown here clearly argue against a toxin produced by dying rods as a cause for cone death since the onset of cone death always occurred after the major rod death period. If a rod toxin caused cone death, then the onset of cone death should have either coincided with the onset of rod death or should have started shortly thereafter, since this would be the period of peak toxin production. Interestingly, the lack of a trophic factor produced by healthy rods and required for cone survival would agree with the onset of cone death seen in all four models as one would expect the onset of cone death during the end stages of rod death. However, the progression of cone death and the end phase of rod death make this unlikely hypothesis as the sole reason for cone death. In the two PDE mutants and in the Rho-KO mutant, cones were dying for many weeks after the end phase of rod death, indicating that they could survive quite awhile in the absence of rods. In addition, in the P23H model, rods died so slowly during the end phase of rod death, that during the entire period of cone death, rods were still present. The hypothesis that a lack of a rod trophic factor being the main cause for cone death seems unlikely given these discrepancies.
(191) Our observations of nutritionally deprived cones demonstrate the dependence of cones on rods. The OS-RPE interactions are vital since the RPE shuttles nutrition and oxygen from the choroidal vasculature to PRs. Roughly 95% of all PRs in mouse and human are rods and approximately 20-30 OSs contact one RPE cell (Snodderly, D. M., et al. (2002) Invest Ophthalmol Vis Sci 43, 2815-8; Young, R. W. (1971) Journal of Cell Biology 49, 303-318). Thus, only 1-2 of those RPE-OS contacts are via cones. During the collapse of the ONL, the remaining cone:RPE interactions are likely perturbed. If these interactions drop below a threshold required for the proper flow of nutrients, the loss of rods results in a reduced flow of nutrients to cones. In all 4 mouse models, the onset of cone death occurred when the ONL reached one row of cells. This cell density therefore represents the critical threshold. Then, while the remaining rods die due to a mutation in a rod-specific gene, cone death begins due to nutrient deprivation. In accord with this notion, cone death progressed more slowly when the remaining rods died slowly. This mechanism would also explain why the loss of cones does not lead to rod death (Biel, M. et al. (1999) Proc Natl Acad Sci USA 96, 7553-7; Yang, R. B. et al. (1999) J Neurosci 19, 5889-970. Since in humans and mouse, cones are less than 5% of all PRs, the critical threshold that perturbs OS-RPE interactions would not be reached. Further support for this idea is provided by studies in zebrafish where the overall ratio of rods to cones is reversed (1:8). Additionally, the distribution of rods and cones in zebrafish is uneven such that certain regions are cone-rich whereas other regions are rod-rich. A recently isolated mutation in a cone-specific gene resulted in rod death, but only in regions of high cone density (Stearns, G., et al. (2007) J Neurosci 27, 13866-74), leading Stearns and co-workers to conclude that cell density is the crucial determinant. We determined that once a critical threshold of cell density is breached, improper OS-RPE interactions result in reduced flow of nutrients (e.g., glucose). This results in reduced OS membrane synthesis, which in turn further contributes to a reduced uptake of nutrients from the RPE. Ultimately, prolonged starvation, as indicated by the activation of CMA, leads to cell death. Since starvation can occur slowly over extended periods of time, and because the rate may fluctuate due to fluctuations in nutrient uptake, the slow and irregular demise of cones observed in humans results therefrom. Therefore, the results presented herein not only provide a new mechanism of cone death in RP that should direct future therapeutic approaches, but also consolidate the data from the literature with respect to the death kinetics of rods and cones seen in mice and patients with different RP mutations.
Example 2
Transfection of Cone Cells with Gluconeogenic Genes to Increase Cone Viability
(192) Neurons can be compromised by genetic and environmental factors that lead to their malfunction and death. In the retina, specialized sensory neurons, the photoreceptors (rods and cones), as well as ganglion cells, the output neurons of the retina, are the neuronal cell types that malfunction and die, leading to partial or complete loss of vision. The reasons that retinal neurons die in a disease, Retinitis Pigmentosa, that leads to loss of vision have been investigated. In Retinitis Pigmentosa, mutation of a gene that is only expressed in rods leads to the death of the rods. Subsequently, cones also die. It has been discovered that cones suffer from a lack of activity in the mTOR pathway, and appear to be starving. Starvation in cones was indicated by the activation of the chaperone mediated autophagy pathway, whereby a cell digests selected proteins when under starvation conditions. Prior to autophagy, it was noted that the cone outer segments were shrinking, and that the synthesis and/or turnover of red/green opsin protein led to reduction of this protein in cones. These observations led to the determination that cones were starving due to a lack of glucose. It was reasoned that membrane biosynthesis was slowed, leading to a reduction in the size of the outer segments, which are very membrane rich. Membrane biosynthesis requires acetylCoA, which is derived from glucose (as well as other molecules). In addition, membrane biosynthesis, as well as many other anabolic reactions, require NADPH, which can be generated by the pentose phosphate pathway, which originates with glucose. The reduction in red/green opsin protein levels also was consistent with lack of a nutrient(s) as it could be due to lack of robust translation, and/or rapid turnover of this protein. In keeping with the rationale of insufficient glucose was a lack of detectable phosphorylation of mTOR in cones. It was shown that mTOR phosphorylation in cones was dependent upon glucose. Lack of mTOR phosphorylation leads to a reduction in translation and, thus, reduction in red/green opsin, as well as other proteins. Finally, the autophagy was also consistent with a reduction in nutrients, and glucose is a key nutrient. Therefore methods to supply cones with more glucose, and/or more NADPH were investigated.
(193) Two ways were used to supply cells with more glucose. One was to increase intracellular glucose levels by providing cones with the means to synthesize their own glucose. Glucose synthesis, called gluconeogenesis, is carried out primarily in the liver, and to a limited extent in kidney and muscle. One might consider that the enzymes required for glucose synthesis could be those that break down glucose, during the process of glycolysis. However, some of the steps in glycolysis are energy producing and thus to reverse them requires a different process. Three enzymes must be supplied to allow the glucose to be synthesized, utilizing pyruvate or lactate as a starting point, and utilizing ATP and GTP to go uphill energetically in the synthesis. The first energy requiring step is catalyzed by Pcx (Pcx: Pyruvate Carboxylase) and utilizes ATP. A subsequent energy requiring step is catalyzed by Pck1: Phosphoenolpyruvate carboxykinase) and requires GTP. The third gene that is required to carry out gluconeogenesis is Fbp1 (Fructose 1,6 biphosphatase). Both Pck1 and Fbp1 have two isoforms, known as Pck2 and Fbp2. Pck1 and Fbp1 are expressed in the liver and are located in the cytoplasm whereas Pck2 and Fbp2 are located in the mitochondria and are expressed normally in muscle cells. To allow cone cells to synthesize their own glucose, cones were infected with an AAV virus (AAV 2/5; genome from serotype 2, with rep and cap genes from serotype 5) that carries these 3 genes. The AAV2/5 has the advantage that it infects or expresses in cones. The vector design is as follows: CMV promotor-Pcx-IRES-Fbp1-IRES-Pck1 (see
(194) This vector was tested in vivo in the rd1 mutant mouse, which has shown additional cone survival relative to controls. This result confirms that cones are starving due to limiting glucose. The morphology of the cone outer segments is remarkably similar to that of normal cones, with robust inner and outer segments, with red/green opsin properly localized to the outer segment. This observation also confirms that outer segment shortening was due to insufficient glucose. The animals were also tested in two behavioral assays, with infected animals demonstrating functional vision (see
(195) An additional strategy to supply cones with more glucose is to provide them with a gene encoding a glucose transporter, such as glut1. The gene encoding glut1 is delivered using an AAV2/5 vector. There is likely excess extracellular glucose in the region around the cones. Rods constitute 97% of the cells in the area occupied by cones and, thus, the glucose that would have been taken up by the rods should still be available after the rods die. Cones with additional glut1 are able to take up more of this additional glucose. Another way to supply more nutrition to cones is to boost the uptake of nutrients from the retinal glial cell type that is in intimate contact with photoreceptors (the Muller glial cells). Muller glial cells also take up glucose and can use the glucose to produce, and then release, lactate, and perhaps pyruvate. The lactate can then be taken up by photoreceptors through a transporter, such as MCT1 or MCT2. In order to boost this process, the glut 1 gene can be delivered to Muller glia and/or the MCT1 or MCT2 gene can be delivered to photoreceptors. Finally, NADPH may be the limiting molecule that causes cones to die. NADPH is used for anabolic processes, as well as for detoxifying free oxygen radicals. After the rods die, the oxygen that would have been consumed by them is in excess in the vicinity of the cones. Excess free oxygen and light, as well as the phototransduction process, can lead to more oxygen free radicals, which are damaging to cellular macromolecules. NADPH may be utilized primarily for this purpose, reducing the supply of NADPH for anabolic processes, such as membrane biosynthesis. To supply more NADPH, the gene encoding malic enzyme is supplied in an AAV2/5 vector. This enzyme catalyzes NADPH synthesis in the cytoplasm, using malate that originates from citrate that exits from the mitochondria.
Example 3
Transfection of Cone Cells with Gluconeogenic Genes to Increase Cone Viability
(196) As described in Example 2, AAV vectors (2/5) were created to transmit the three gluconeogenesis genes, Pcx, Pck, and Fbp-1 (as a single vector comprising the three genes operably linked to the CMV promoter), and were used to produce glucose in transfected cells.
(197) As described below, the three genes (Pcx, Pck, and Fbp-1) were separated into different AAV vectors operably linked to the cone-specific promoter, CAR, from the cone arrestin gene. In some cases, a gluconeogenesis gene was also operably linked to the marker gene, H2BGFP, a nuclear form of GFP, or mGFP, a membrane-bound form of GFP, to allow the tracking of infected cells.
(198) Alternatively, an AAV-GFP vector was co-injected with the three AAV vectors comprising a gluconeogeneis gene to allow detection of successful targeting of the viral inoculum. These vectors were used to infect the retina of wild type, CD1, mice to determine if protein encoded by the three gluconeogeneis gene was produced. Retinas were injected as described and subsequently used to make protein extracts for analysis by Western blot or for immunohistochemistry.
(199) In one series of experiments, CD1 mice were injected at postnatal day 0 (P0) with three different viral vectors, each comprising a single gluconeogeneis gene operably linked to a CAR promoter (see, e.g.,
(200) In another series of experiments, CD1 mice were injected at postnatal day 0 (P0) with three different viral vectors each comprising a single gluconeogeneis gene operably linked to a CAR promoter (see, e.g.,
(201) In addition, one AAV vector comprising a gluconeogeneis gene, Pcx, operably linked to the CMV promoter and mGFP (pAAV-CMVpq-Pcx-1-mGFP) and a seond AAV vector comprising the gluconeogeneis genes, Fbp1 and Pck1, operably linked to the CMV promoter and H2BGFP (pAAV-CMVpq-H2BGFP-1-Fbp1-Pck1) were injected into CD1 mice at P0 and retinas were harvested at P18.
EQUIVALENTS
(202) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.