Bioproduction of phenethyl alcohol, aldehyde, acid, amine, and related compounds
11597954 · 2023-03-07
Assignee
Inventors
- Zhi Li (Singapore, SG)
- Shuke Wu (Singapore, SG)
- Yi Zhou (Singapore, SG)
- Benedict Ryan Lukito (Singapore, SG)
Cpc classification
C12Y205/01054
CHEMISTRY; METALLURGY
C12N9/1205
CHEMISTRY; METALLURGY
C12N9/0071
CHEMISTRY; METALLURGY
C12Y206/01057
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12Y101/01282
CHEMISTRY; METALLURGY
C12P13/22
CHEMISTRY; METALLURGY
C12N9/1085
CHEMISTRY; METALLURGY
International classification
C12P13/00
CHEMISTRY; METALLURGY
Abstract
This invention relates to the bioproduction of substituted or unsubstituted phenylacetaldehyde, 2-phenylethanol, phenylacetic acid or phenylethylamine by subjecting a starting material comprising glucose, L-phenylalanine, substituted L-phenylalanine, styrene or substituted styrene to a plurality of enzyme catalyzed chemical transformations in a one-pot reaction system, using recombinant microbial cells overexpressing the enzymes. To produce phenylacetaldehyde from styrene, the cells are modified to overexpress styrene monooxygenase (SMO) and styrene oxide isomerase (SOI). To produce phenylacetic acid from styrene, SMO, SOI and aldehyde dehydrogenase are overexpressed. Alternatively, to produce 2-phenylethanol, SMO, SOI and aldehyde reductase or alcohol dehydrogenase are overexpressed, while to produce phenylethylamine, SMO, SOI and transaminase are overexpressed.
Claims
1. A method for bioproduction of substituted or unsubstituted phenylacetaldehyde, 2-phenylethanol, phenylacetic acid or phenylethylamine by one or more recombinant bacterial or fungal cells genetically engineered to overexpress, relative to a wild type cell, at least one enzyme, which method comprises subjecting a starting material to a plurality of enzyme-catalyzed chemical transformations in an one-pot reaction system, wherein the starting material is selected from the group consisting of glucose, L-phenylalanine, substituted L-phenylalanine, styrene and substituted styrene, wherein the genetically engineered cells: i) overexpress styrene monooxygenase and styrene oxide isomerase for generating substituted or unsubstituted phenylacetaldehyde from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; and the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; or ii) overexpress styrene monooxygenase, styrene oxide isomerase and an aldehyde dehydrogenase for generating substituted or unsubstituted phenylacetic acid from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; and the aldehyde dehydrogenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 4; or iii) overexpress styrene monooxygenase, styrene oxide isomerase, an aldehyde reductase and/or an alcohol dehydrogenase for generating substituted or unsubstituted 2-phenylethanol from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; and the alcohol dehydrogenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 5; or iv) overexpress styrene monooxygenase, styrene oxide isomerase and a transaminase for generating substituted or unsubstituted phenylethylamine from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; and the transaminase is ω-transaminase comprising an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 6.
2. The method of claim 1, wherein the styrene monooxygenase is encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO: 7 and 8; the styrene oxide isomerase is encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO: 9; the aldehyde dehydrogenase is encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO: 10; the alcohol dehydrogenase is encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO: 11 and the transaminase is w-transaminase encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ NO: 12.
3. The method of claim 1, wherein the genetically engineered cells produce styrene or substituted styrene from L-phenylalanine or substituted L-phenylalanine by a deamination reaction catalyzed by overexpression of an ammonia lyase and a decarboxylation reaction catalyzed by overexpression of a decarboxylase.
4. The method of claim 3, wherein the ammonia lyase comprises the amino acid sequence set forth in SEQ ID NO: 13 and the decarboxylase comprises the amino acid sequence set forth in SEQ ID NO: 14.
5. The method of claim 1, wherein the genetically engineered cells produce L-phenylalanine from glucose by a reaction catalyzed by overexpression of at least one enzyme selected from a group comprising DAHP synthase (AroG), shikimate kinase (AroK), shikimate dehydrogenase (YdiB), chorismate mutase/prephenate dehydratase (PheA) and tyrosine aminotransferase (TyrB), wherein the genetically engineered cells are engineered to produce L-phenylalanine from glucose.
6. The method of claim 5, wherein AroG comprises the amino acid sequence set forth in SEQ ID NO: 17; AroK comprises the amino acid sequence set forth in SEQ ID NO: 18; YdiB comprises the amino acid sequence set forth in SEQ ID NO: 19; PheA comprises the amino acid sequence set forth in SEQ ID NO: 20, and TyrB comprises the amino acid sequence set forth in SEQ ID NO: 21.
7. The method of claim 5, wherein AroG is replaced by a feedback inhibition resistant mutant AroG* encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 27 and/or PheA is replaced by a feedback inhibition resistant mutant PheA* encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 28.
8. The method of claim 5, further comprising deletion or inactivation of crr and/or prephenate dehydrogenase (tyrA) genes.
9. The method of claim 1, wherein the one-pot reaction system comprises the use of a tri-phasic medium comprising: (a) an aqueous: organic solvent: solid resin medium; or (b) an aqueous: organic solvent: functionalized nanoparticles medium.
10. A method for bioproduction of substituted or unsubstituted 2-phenylethanol or phenylethylamine by one or more recombinant bacterial or fungal cells genetically engineered to overexpress, relative to a wild type cell, at least one enzyme, which method comprises subjecting a starting material to a plurality of enzyme-catalyzed chemical transformations in an one-pot reaction system, wherein the starting material is styrene or substituted styrene, wherein the genetically engineered cells: iii) overexpress styrene monooxygenase, styrene oxide isomerase, an aldehyde reductase and/or an alcohol dehydrogenase for generating substituted or unsubstituted 2-phenylethanol from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; and the alcohol dehydrogenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 5; or iv) overexpress styrene monooxygenase, styrene oxide isomerase and a transaminase for generating substituted or unsubstituted phenylethylamine from the styrene or the substituted styrene, wherein the styrene monooxygenase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NOs: 1 and 2; the styrene oxide isomerase comprises an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 3; and the transaminase is ω-transaminase comprising an amino acid sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 6.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
DESCRIPTION
(27) Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference.
Definitions
(28) Certain terms employed in the specification, examples and appended claims are collected here for convenience.
(29) The terms “amino acid” or “amino acid sequence,” as used herein, refer to an oligopeptide, peptide, polypeptide, or protein sequence, or a fragment of any of these, and to naturally occurring or synthetic molecules. Where “amino acid sequence” is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.
(30) As used herein, the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. However, in context with the present disclosure, the term “comprising” or “including” also includes “consisting of”. The variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
(31) The term “isolated” is herein defined as a biological component (such as a nucleic acid, peptide or protein) that has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been isolated thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
(32) The phrases “nucleic acid” or “nucleic acid sequence,” as used herein, refer to an oligonucleotide, nucleotide, polynucleotide, or any fragment thereof, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent the sense or the antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material. In the context of the invention, “fragments” refers to those nucleic acid sequences which are greater than about 60 nucleotides in length, and most preferably are at least about 100 nucleotides, at least about 1000 nucleotides, or at least about 10,000 nucleotides in length which are not full-length native sequence but retain catalytic enzyme activity.
(33) The term “oligonucleotide,” as used herein, refers to a nucleic acid sequence of at least about 6 nucleotides to 60 nucleotides, preferably about 15 to 30 nucleotides, and most preferably about 20 to 25 nucleotides, which can be used in PCR amplification or in a hybridization assay or microarray. As used herein, the term “oligonucleotide” is substantially equivalent to the terms “amplimers,” “primers,” “oligomers,” and “probes,” as these terms are commonly defined in the art.
(34) The terms ‘variant’ and ‘mutant’ are used interchangeably herein. The at least one nucleic acids encoding at least one catalytic enzyme may encode a variant or mutant of the exemplified catalytic enzyme which retains activity. A “variant” of a catalytic enzyme, as used herein, refers to an amino acid sequence that is altered by one or more amino acids. The variant may have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have “nonconservative” changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing catalytic activity may be found using computer programs well known in the art, for example, DNASTAR software. In some embodiments, variant enzymes are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, preferably at least 90%, homologous or identical at the amino acid level to an exemplary amino acid sequence described herein (e.g., alcohol dehydrogenase, ω-transaminase) or a functional fragment thereof—e.g., over a length of about: 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, preferably at least 90%, of the length of the mature reference sequence, yet retain catalytic activity. Preferably said variant enzymes have at least 90% identity at the amino acid level and retain catalytic activity. An exemplary alcohol dehydrogenase is represented by SEQ ID NO: 5, and an exemplary ω-transaminase is represented by SEQ ID NO: 6.
(35) The terms ‘phenylacetaldehyde reductase’ (PAR) and ‘alcohol dehydrogenase’ (ADH), as referred to herein, are used interchangeably.
(36) A vector can include one or more catalytic enzyme nucleic acid(s) in a form suitable for expression of the nucleic acid(s) in a host cell. Preferably the recombinant expression vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence(s) to be expressed. The term “regulatory sequence” includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences such as the T7 IPTG-inducible promoters disclosed in the Examples herein. The design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or polypeptides, including fusion proteins or polypeptides, encoded by nucleic acids as described herein (e.g., catalytic enzyme proteins, fusion proteins, and the like).
(37) The recombinant expression vectors of the invention can be designed for expression of catalytic enzyme proteins in prokaryotic or eukaryotic cells. For example, polypeptides of the invention can be expressed in bacteria (e.g., E. coli), insect cells (e.g., using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. Alternatively, the recombinant expression vector(s) can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
(38) Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
(39) To maximize recombinant protein expression in E. coli is to express the protein in a host bacterium with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al., (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by known DNA synthesis techniques and is described in the Examples.
(40) The catalytic enzyme expression vector can be a yeast expression vector, a vector for expression in insect cells, e.g., a baculovirus expression vector, a vector for expression in bacterial cells, e.g. a plasmid vector, or a vector suitable for expression in mammalian cells.
(41) When used in mammalian cells, the expression vector's control functions can be provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
(42) The methods described hereinbefore make use of enzymes to catalyse a sequence of reactions. While these reactions may be performed individually or, more particularly, two or more of them in combination, it is particularly preferred that all of the reactions are combined into a cascade reaction sequence that provides the product from the initial starting material in one pot, thereby eliminating the need for isolation of the intermediates and, potentially, increasing the overall yield of the reaction sequence. These cascade reactions may involve the use of one or more reactive components selected from the group consisting of cells, immobilized cells, cell extracts, isolated enzymes and immobilized enzymes in said reaction vessel.
(43) In this invention, we proposed a novel biocatalytic route (pathway) to produce “natural” 2-PE, PA, PAA, and PEA from the easy available biobased L-phenylalanine and glucose (
(44) The whole route was divided into three parts: 1) upstream shikimate pathway to produce L-Phe from glucose (
(45) In an embodiment of the invention, all the enzymes responsible for the reactions are co-expressed in one recombinant E. coli strain. In this case, all the chemical reactions are taken place inside a single cell. To construct the recombinant biocatalyst, the enzymes are cloned as several artificial operons or separately on one plasmid or several compatible plasmids. After transforming the plasmids into the E. coli strain, the multiple enzymes are co-expressed and the whole recombinant cells are served as a biocatalyst for the cascade reactions. The expression level of multiple enzymes could be adjusted and optimized for efficient cascade transformation without significant accumulation of intermediates. There are many methods to achieve tuning the expression level of multiple enzymes: using different plasmids, inducer, promoters or ribosome binding sites with different strength.
(46) In a preferred embodiment, the cascade transformations are better performed in aqueous phase. For low concentration biotransformation, aqueous one phase system fulfills the requirement and can achieve the final product easily. However, the intermediate Sty and SO are generally hydrophobic (limited solubility in aqueous phase) and toxic for the cell and enzyme (may have substrate inhibition). Thus, an organic: aqueous two-phase reaction system is a better choice for high-concentration biotransformation. The Sty and SO are better soluble in organic phase, while the diols, amino alcohols, amino acids, cells, and enzymes are mostly in the aqueous phase. By applying the two-phase reaction system, the problems of low solubility and inhibition of Sty and SO are solved.
(47) Other forms of biocatalyst could also be applied to synthesize 2-PE, PA, PAA, and PEA. They include isolated enzyme, enzymes immobilized on nano or micro size support (such as magnetic nano particles) to increase their stability and re-usability, wild type microbial cells, and recombinant cells immobilized on some carriers. By utilizing isolated enzymes, immobilized enzymes or immobilized cells, the cascade biocatalysis can be performed to produce 2-PE, PA, PAA, and PEA from biobased L-Phe or glucose. A mixture of different forms of biocatalyst is also a suitable system to carry out the cascade biocatalysis.
EXAMPLES
(48) Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2012).
(49) Strain, Biochemicals, and Culture Medium
(50) Escherichia coli T7 expression cells were purchased from New England Biolabs. Primers (DNA oligos) were synthesized from IDT. Phusion DNA polymerase, fast digest restriction enzymes, and T4 DNA ligase were bought from Thermo Scientific. LB medium, tryptone, yeast extract, and agar were obtained from Biomed Diagnostics. Chloramphenicol, streptomycin, ampicillin, kanamycin, and glucose were purchased from Sigma-Aldrich. IPTG (Isopropyl β-D-1-thiogalactopyranoside) was obtained from Gold Biotechnology.
(51) The culture medium used in this study is standard M9 medium supplemented with glucose (20 g/L), yeast extract (6 g/L). The M9 medium contains 6 g/L Na.sub.2HPO.sub.4, 3.0 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 1.0 g/L NH.sub.4Cl, 1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2, and 1 mL/L l.sup.−1 trace metal solution. The trace metal solution contains 8.3 g/L FeCl.sub.3.6H.sub.2O, 0.84 g/L ZnCl.sub.2, 0.13 g/L CuCl.sub.2.2H.sub.2O, 0.1 g/L CoCl.sub.2.2H.sub.2O, 0.1 g/L H.sub.3BO.sub.3, 0.016 g/L MnCl.sub.2.4H.sub.2O, and 0.1 g/L Na.sub.2MoO.sub.4.2H.sub.2O in 1 M HCl.
(52) SDS-PAGE Analysis and Quantification
(53) Freshly prepared E. coli whole cells were centrifuged and resuspended in DI water to a density of 8 g cdw/L (OD.sub.600=20). The cell suspension (60 μL) was mixed with 20 μl of SDS sample buffer (4× Laemmli Sample Buffer with DTT, Bio-Rad) and heated to 98° C. for 15 min. 60 μl of 0.2 g/L, 0.1 g/L, and 0.05 g/L of BSA standards were also mixed with 20 μL of SDS sample buffer and heated to 98° C. for 15 min. Then the mixture was centrifuged (13000 g) for 10 min. 10 μL of the supernatant was used to load into the sample well of 12% SDS-PAGE gel (hand cast). The electrophoresis was run in a setup of Mini-Protean tetra cell at 100 V for 15 min and 150 V for 75 min. After running, the PAGE gel was washed with water and then stained with Bio-Safe Coomassie Stain (Bio-Rad) according to the instruction. The figure was obtained with GS-900 calibrated densitometer (Bio-Rad), and quantification analysis was done with the volume tools in the Image Lab software (Bio-Rad).
(54) General Procedures for Culturing E. coli Cells for Biotransformation
(55) E. coli strain was initially inoculated in LB medium (1 mL) containing appropriate antibiotics (50 mg/L kanamycin, 50 mg/L chloramphenicol, 50 mg/L streptomycin, 50 mg/L ampicillin) for 8-10 h (280 rpm) at 37° C. and then were transferred to a 250 mL tribaffled flask with 50 mL of M9 medium supplemented with glucose (20 g L.sup.−1), yeast extract (6 g L.sup.−1), and appropriate antibiotics. The cells continued to grow at 37° C. and 250 rpm for about 2 h to reach an OD.sub.600 of 0.6, and then IPTG (0.5 mM final concentration) was added to induce the enzyme expression. The cells were further grown at 22° C. overnight (12-13 h), and harvested by centrifugation (4000 g, 10 min).
(56) Chemical and Materials
(57) The following chemicals were purchased from Sigma-Aldrich: Sty-m-OMe-Sty, α-Me-Sty, p-Me-α-Me-Sty, Sty oxide, PA, PAA-p-OMe-PAA, rac-2-Phenylpropanoic acid-α, 4-Dimethylphenylacetic acid, (S)-2-Phenylpropanoic acid, acetic acid, ethyl oleate, n-hexadecane, kanamycin, glucose, NaCl, Na.sub.2SO.sub.4, Na.sub.2HPO.sub.4, NH.sub.4Cl, KH.sub.2PO.sub.4, K.sub.2HPO.sub.4, TFA, phenethylamine, and benzyl alcohol. p-OMe-Sty was from Alfa Asear. Oleic acid, p-F-α-Me-Sty and p-Cl-α-Me-Sty were from TCI chemical. Acetonitrile, ethyl acetate, 2-propanol and n-hexane were purchased from Tedia. n-Heptane, silica gel 60 and TLC plates were purchased from Merck. LB medium, yeast extract, and agar were purchased from Biomed Diagnostics. DNA polymerase, ligase, and restriction enzymes were purchased from Thermo Fisher.
(58) Analytical Methods
(59) Cell growth was monitored by spectrophotometry (NanoDrop™, Thermo Fisher Scientific Inc., Massachusetts, USA) measurement of the optical density (OD.sub.600) at 600 nm. Metabolites such as L-Phe and 2-PE were measured by high-performance liquid chromatography (Prominence, Shimadzu Corporation) equipped with photodiode array (DAD) detectors. The media samples were centrifuged and filtered, and eluted through Agilent Poroshell 120 SB-C18 column (150×4.6 mm, 2.7 μm) under reversed phase condition with 30% acetonitrile and 70% ultrapure water containing 0.1% TFA. Flowrate: 0.4 ml/min, temperature: 25° C. Detector: photodiode array detector. Wavelength: 210 nm. 2-PE extracted in the oleic acid was eluted through Agilent ZORBAX RX-SIL column (150×4.6 mm, 5 μm) with 2% acetonitrile and hexane. Glucose levels during fed-batch fermentation was monitored by HPLC equipped with refractive index detector. The samples were eluted using Aminex-HPX87P column (Biorad, USA) with ultrapure water as mobile phase.
(60) 2-PE (organic phase) and styrene were analyzed using Agilent 7890A Gas Chromatography (GC). Column: Agilent HP-5 (30 m×0.32 mm×0.25 mm). Temperature programme: initial temperature at 70° C., increase 25° C./min until it reached 200° C.; subsequently increase to 250° C. at 50° C./min, then hold for 1 minute; Lastly, increase to 270° C. at 20° C./min.
(61) Size and morphology of synthesized-MNPs were determined using JEOL JEM 2010 Transmission Electron Microscope (TEM-JEOL, USA). Hydrodynamic diameter and size distribution were characterized using zetasizer (Molvern).
(62) HPLC analysis of Sty-p-OMe-Sty was performed on a Shimadzu prominence HPLC system with a photodiode array detector and a reverse-phase Agilent Poroshell 120 SB-C18 column (150×4.6 mm, 2.7 mm) at 25° C. Mobile phase: 50% water with 0.1% TFA: 50% acetonitrile. Flow rate: 0.5 mLmin.sup.−1. The concentration was determined by comparison of peak areas at 210 nm to those on the calibration curve of the authentic compound. Retention times: phenethylamine (internal standard) 3.2 min, PAA 4.8 min, o-F-PAA 5.0 min, m-F-PAA 5.1 min, p-F-PAA 5.0 min, m-CI-PAA 6.0 min, p-CI-PAA 6.1 min, m-Br-PAA 6.4 min, p-Br-PAA 6.5 min, m-Me-PAA 5.7 min, p-Me-PAA 5.7 min, m-OMe-PAA 4.8 min, p-OMe-PAA 4.7 min.
(63) GC-FID analysis of Sty-p-OMe-Sty, Sty oxide and PA was performed on an Agilent 7890A gas chromatograph system with an FID detector. Column: Agilent HP-5 (30 m×0.32 mm×0.25 mm). Temperature program: start at 70° C., increase to 200° C. at 25° C. min.sup.−1, increase to 250° C. at 50° C. min.sup.−1, hold for 1 min, and then increase to 270° C. at 20° C. min.sup.−1. The concentration was determined by comparison of peak areas to those on the calibration curve of the authentic compound. Retention times: benzyl alcohol (internal standard) 2.8 min, Sty 2.2 min, o-F-Sty 2.2 min, m-F-Sty 2.2 min, p-F-Sty 2.2 min, m-CI-Sty 3.1 min, p-Cl-Sty 3.1 min, m-Br-Sty 3.5 min, p-Br-Sty 3.5 min, m-Me-Sty 2.6 min, p-Me-Sty 2.6 min, m-OMe-Sty 3.4 min, p-OMe-Sty 3.4 min.
(64) Chiral HPLC analysis of α-Me-Sty-p-Me-α-Me-Sty (concentration) was performed on the same HPLC system with a reverse-phase Daicel Chiralpak AD-3R column (150×4.6 mm, 3 mm) at 15° C. The concentration was determined by comparison of peak areas at 210 nm to those on the calibration curve of authentic compound.
(65) Method A: mobile phase consisting of 80% water with 0.1% TFA: 20% acetonitrile was delivered at 1.0 mLmin.sup.−1. Retention times: benzyl alcohol (internal standard) 5.8 min, (R)-2-Phenylpropanoic acid 13.9 min, (S)-2-Phenylpropanoic acid 14.6 min, (R)-p-F-α-Me-PAA 19.2 min, (S)-p-F-α-Me-PAA 19.9 min, (R)-p-Me-α-Me-PAA 32.3 min, (S)-p-Me-α-Me-PAA 33.4 min.
Method B: mobile phase consisting of 70% water with 0.1% TFA: 30% acetonitrile was delivered at 1.0 mLmin.sup.−1. Retention times: benzyl alcohol (internal standard) 3.8 min, (R)-p-Me-α-Me-PAA 12.2 min, (S)-p-Me-α-Me-PAA 13.0 min.
(66) The ee values of (S)-2-Phenylpropanoic acid-(S)-p-Me-α-Me-PAA were measured with another chiral HPLC analysis method using a Daicel Chiralpak ADH column (250×4.6 mm, 5 mm) at 25° C. Mobile phase consisting of 90% n-hexane with 0.1% TFA: 10% 2-propanol was delivered at 1.0 mLmin.sup.−1. Retention times: (R)-2-Phenylpropanoic acid 5.7 min, (S)-2-Phenylpropanoic acid 6.3 min, (R)-p-F-α-Me-PAA 5.7 min, (S)-p-F-α-Me-PAA 6.3 min, (R)-p-CI-α-Me-PAA 6.0 min, (S)-p-CI-α-Me-PAA 6.6 min, (R)-p-Me-α-Me-PAA 5.7 min, (S)-p-Me-α-Me-PAA 6.4 min.
(67) Conversion of Styrene and Substituted Styrene to 2-Phenylethanols (2-PEs), Phenylacetaldehydes (PAs), Phenylacetic Acids (PAAs), and Phenylethylamines (PEAs)
(68) A representative example was demonstration of converting (substituted) styrene to (substituted) 2-PE. Previously, we had engineered E. coli co-expressing SMO from styrene degradation Pseudomonas sp. VLB120 [Wu, S., Chen, Y., et al., ACS Catal. 4: 409-420 (2014)]. The gene of SOI was amplified and constructed together with SMO to give an artificial operon as module 2-1 on plasmid pRSFduet-1 (
(69) To achieve conversion of (substituted) Sty to (substituted) PEA (
(70) Another representative example was demonstration of converting (substituted) styrene to (substituted) PAA. The gene of phenylacetaldehyde dehydrogenase (EcALDH) from E. coli [Ferrandez, A., Prieto, M. A., et al., FEBS Lett. 406: 23 (1997)] was engineered together with SMO-SOI to give an artificial operon as module 2-4 (
(71) To produce (S)-PAA in very high ee, alcohol dehydrogenase ADH9v1, as reported in [P. Könst, H. Merkens, et al., Angew. Chem. Int. Ed. 51: 9914-9917 (2012)] with S-selectivity for the enantioselective oxidation of racemic PA was cloned. The gene of ADH9v1 was synthesized and constructed together with styC and pRSF-StyAB to form a recombinant plasmid pRSF-StyABC-ADH9v1 (
(72) Further description of exemplary embodiments are provided below.
Example 1. Genetic Engineering of E. coli Containing Module 2-1 and Expressing SMO and SOI
(73) The styC gene coding SOI (SEQ ID NO: 9) from Pseudomonas sp. VLB120 was first synthesized and codon optimized for E. coli according the published sequence. Then it was amplified using primers StyC-Kpnl-RBS-F (CGGGTACCTAAGGAGATATATAATGTTACACGCGTTTGAACGTA AAATG; SEQ ID NO: 29) and StyC-HindIII-Xhol-R (ACTGCTCGAGAAGCTTACTCGGCTGCCGCG TGTGGAACGGCTTTACG; SEQ ID NO: 30) and Phusion DNA polymerase (available from Thermo). The PCR products were double-digested with Kpnl and Xhol, and then ligated to same digested pRSF-SMO plasmid [Wu, S., Chen, Y., et al., ACS Catal. 4: 409-420 (2014)] with T4 DNA ligase. The ligation product was transformed (heat shock) into E. coli T7 Expression competent cells (available from New England Biolabs) to give pRSF-SMO-SOI. This module 2-1 was sub-cloned to other three vectors by the following procedures. Module 2-1 operon was amplified with primers StyA-BspHI-F (ACTGTC ATGAAAAAGCGTATCGGTATTGTTGG; SEQ ID NO: 31) and StyC-HindIII-Xhol-R (ACTGCTCGAG AAGCTTACTCGGCTGCCGCGTGTGGAACGGCTTTACG; SEQ ID NO: 30), digested with BspHI and Xhol, and then ligated to double digested pACYCduet, pCDFduet, and pETduet (available from Novagen). The transformation of these products gave pACYC-SMO-SOI, pCDF-SMO-SOI, and pET-SMO-SOI respectively.
Example 2. Genetic Engineering of E. coli Containing Module 2-2 and Expressing SMO, SOI, and PAR
(74) The pad gene coding ADH (alcohol dehydrogenase; SEQ ID NO: 11) from tomato Saccharomyces cerevisiae was first synthesized and codon optimized for E. coli according the published sequence. Then it was amplified using primers PAR-HindIII-RBS-F (ACTGAAGCTTTAAGGAGATATATAATGAGCGTGAC CGCGAAAACCGTG; SEQ ID NO: 32) and PAR-Xhol-R (ACTGCTCGAGTCACATGCTTGAACTCCCG CCGAAA; SEQ ID NO: 33) and Phusion DNA polymerase (available from Thermo). The PCR products were double digested with HindIII and Xhol, and then ligated to same digested pRSF-SMO-SOI plasmid (see example 1) with T4 DNA ligase. The ligation product was transformed (heat shock) into E. coli T7 Expression competent cells (available from New England Biolabs) to give pRSF-SMO-SOI-PAR. This module 2-2 was sub-cloned to other three vectors by the following procedures. Module 2-2 operon was amplified with primers StyA-BspHI-F (ACTGTC ATGAAAAAGCGTATCGGTATTGTTGG; SEQ ID NO: 31) and PAR-Xhol-R (ACTGCTCGAGTCACAT GCTTGAACTCCCG CCGAAA; SEQ ID NO: 33), digested with BspHI and Xhol, and then ligated to double digested pACYCduet, pCDFduet, and pETduet (available from Novagen). The transformation of these products gave pACYC-SMO-SOI-PAR, pCDF-SMO-SOI-PAR, and pET-SMO-SOI-PAR respectively.
Example 3. Production of 2-PE From Sty via Cascade Biocatalysis by Using E. coli Containing Module 2-2 and Expressing SMO, SOI, and PAR
(75) The recombinant E. coli (StyABC-PAR) containing the plasmid pRSF-SMO-SOI-PAR was grown in 1 mL LB medium containing 50 mg/L kanamycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 hours at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM KPB buffer (pH=8.0) to 10 g cdw/L with 2% glucose (for cofactor regeneration). To a 2 mL of aqueous system, a 2 mL n-hexadecane containing 60 mM Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 100-mL flask for 8 hours. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent poroshell 120 EC-C18 column, acetonitrile:water=50:50, and flow rate 0.5 mL/min) to quantify the production of 2-PE in aqueous phase. 100 μL of organic phase samples were taken during the reaction and analyzed by GC-FID (Agilent HP-5 column, 70° C. increase to 200° C. at 25° C./min, increase to 250° C. at 50° C./min, hold for 1 min, and then increase to 270° C. at 20° C./min) to quantify Sty, SO, PA, 2-PE in the organic phase. 2-PE was produced from Sty, with a best result of about 56 mM (93% yield) obtained in 8 h (
Example 4. Efficient Production of Substituted 2-PE From Substituted Sty via Cascade Biocatalysis by Using E. coli (StyABC-PAR)
(76) ##STR00001##
(77) E. coli (StyABC-PAR) was grown in 1 mL LB medium containing 50 mg/L kanamycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 h at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM KPB buffer (pH=8.0) to 10 g cdw/L with 2% glucose (for cofactor regeneration). To a 2 mL of aqueous system, a 2-mL n-hexadecane containing 20 mM of substituted Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 100-mL flask for 8 hours. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent poroshell 120 EC-C18 column, acetonitrile:water=50:50, and flow rate 0.5 mL/min) to quantify the production of substituted 2-PE in aqueous phase. 100 μL of organic phase samples were taken during the reaction and analyzed by GC-FID (Agilent HP-5 column, 70° C. increase to 200° C. at 25° C./min, increase to 250° C. at 50° C./min, hold for 1 min, and then increase to 270° C. at 20° C./min) to quantify substituted Sty, SO, PA, 2-PE in organic phase. As shown in Table 1, all the 12 substituted 2-PEs were produced in good to excellent yield 62-99% in 8 h. This prove the relative broad scope of the cascade biotransformation system.
(78) TABLE-US-00001 TABLE 1 Conversion of substituted styrene to substituted 2-PEs with E. coli (StyABC-PAR). Conv. to Regioselectivity Entry Substrate Product 2-PE [%].sup.[b] 2-OH:1-OH .sup.[c] 1 Sty H >99 >99:1 2 o-F-Sty o-F-2-PE 90 >99:1 3 m-F-Sty m-F-2-PE 94 >99:1 4 p-F-Sty p-F-2-PE 98 >99:1 5 m-Cl-Sty m-Cl-2-PE 89 >99:1 6 p-Cl-Sty p-Cl-2-PE 80 98:2 7 m-Br-Sty m-Br-2-PE 83 99:1 8 p-Br-Sty p-Br-2-PE 62 98:2 9 m-Me-Sty m-Me-2-PE 99 >99:1 10 p-Me-Sty p-Me-2-PE 96 >99:1 11 m-OMe-Sty m-OMe-2-PE >99 >99:1 12 p-OMe-Sty p-OMe-2-PE 96 98:2 [a] Sty (20 mM in organic phase) was transformed with resting cells (10 g cdw L.sup.−1) in KP buffer (200 mM, pH 8, 2% glucose) and n-hexadecane (1:1) at 30° C. and 250 rpm for 8 h. .sup.[b]Determined by HPLC analysis of aqueous phase and GC-FID analysis of organic phase. .sup.[c] Measured by GC-FID analysis.
Example 5. Preparation of (Substituted) 2-PE From (Substituted) Sty by Using E. coli (StyABC-PAR) in a 100 mL System
(79) E. coli (StyABC-PAR) was grown in 1 mL LB medium containing 50 mg/L kanamycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin. After 5 h growth at 37° C., the 50 mL culture was expanded into 2 L M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin and continue culture at 37° C. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 hours at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM KPB buffer (pH=8.0) containing 2% glucose to 10 g cdw/L. To a 50 mL of aqueous system, a 50-mL n-hexadecane containing 50 mM of Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 1-L flask for 24 hours. After reaction, the two phase was separated by centrifugation (4000 g, 15 mins). The aqueous phase was extracted with 50 mL ethyl acetate for three times, and the hexadecane phase was wash with 50 mL water for three times. The wash water was combined and extracted with 100 mL ethyl acetate for two times. All the ethyl acetate was combined, dried over Na.sub.2SO.sub.4 and evaporated. The residue was further purified by flash chromatography with n-hexane: ethyl acetate=5:1. The fractions were combined and evaporated to get 253 mg of pure 2-PE with 83% isolated yield. Using the similar process, p-fluoro-2-PE, p-methyl-2-PE, and m-methyoxyl-2-PE were also isolated in 74%, 66%, and 78% yield, respectively.
Example 6. Genetic Engineering of E. coli Containing Module 2-3 and Expressing SMO, SOI, CvTA, and AlaDH
(80) The cvTA gene (coding CvTA; SEQ ID NO: 12) and aid gene (coding for AlaDH; SEQ ID NO: 34) was amplified together from the previous template pRSF-AlkJ-CvTA-AlaDH [Wu, S., Zhou, Y., et al., Nat. Commun. 7: 11917 (2016)] using primers CvTA-BamHI-BspHI-F (ACTGGGATCCGATCATGATGCAAAAACAACGCACCACCTCAC; SEQ ID NO: 35) and AlaDH-Xhol-R (ACTGCTCGAGTTAAGCACCCGCCACAGATGATTCA; SEQ ID NO: 36). The PCR product was double digested with BspHI and Xhol, and then ligated to pCDF (digested with Ncol and Xhol) with T4 DNA ligase. The ligation product was transformed (heat shock) into E. coli T7 Expression competent cells to give pCDF-CvTA-AlaDH. The pCDF-CvTA-AlaDH and pACYC-SMO-SOI plasmids were co-transformed into competent cells of E. coli RARE strain [Kunjapur, A. M., Tarasova, Y., Prather, K. L. J. Am. Chem. Soc. 136: 11644-11654 (2014)] to give E. coli (StyABC-CvTA-AlaDH) co-expressing SMO, SOI, CvTA, and AlaDH. The competent cells of E. coli RARE strain were made according to the following protocol: it was grown in 1 mL LB media at 37° C. for overnight; then 100 μL culture was inoculated into 5 mL fresh LB media containing appropriate antibiotic at 37° C. until OD.sub.600 reached 0.5 (about 2 h); then the cells were harvested by centrifugation (2500 g, 10 min, 4° C.) and resuspended in 1 mL cold CaCl.sub.2 solution (0.1 M) on ice. The cell suspension was kept on ice and shaken at 90 rpm for 2 h, and then harvested by centrifugation (2500 g, 8 min, 4° C.) and resuspended in 0.2-0.5 mL cold CaCl.sub.2 solution (0.1 M) to obtain the competent cells.
Example 7. Production of PEA From Sty via Cascade Biocatalysis by Using E. coli Containing Module 2-3 and Expressing SMO, SOI, CvTA and AlaDH
(81) The recombinant E. coli (StyABC-CvTA-AlaDH) was grown in 1 mL LB medium containing 50 mg/L chloramphenicol and 50 mg/L streptomycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), 50 mg/L chloramphenicol and 50 mg/L streptomycin. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 h at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM NaPB buffer (pH=8.0) to 10 g cdw/L with 2% glucose (for cofactor regeneration) and 200 mM NH.sub.3—NH.sub.4Cl (pH 8.25). To a 2 mL of aqueous system, a 2-mL n-hexadecane containing 80 mM Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 100-mL flask for 10 h. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent Poroshell 120 EC-C18 column, acetonitrile:water: TFA=30:70:0.1, and flow rate 0.5 mL/min) to quantify the production of PEA in aqueous phase. 100 μL of organic phase samples were taken during the reaction and analyzed by GC-FID (Agilent HP-5 column, 70° C. increase to 200° C. at 25° C./min, increase to 250° C. at 50° C./min, hold for 1 min, and then increase to 270° C. at 20° C./min) to quantify Sty, SO, PA, 2-PE in organic phase. PEA was produced from Sty, and the best result is about 74 mM (93% yield) obtained in 10 h (
Example 8. Efficient Production of Substituted PEA From Substituted Sty via Cascade Biocatalysis by Using E. coli (StyABC-CvTA-AlaDH)
(82) ##STR00002##
(83) E. coli (StyABC-CvTA-AlaDH) was grown in 1 mL LB medium containing 50 mg/L chloramphenicol and 50 mg/L streptomycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L chloramphenicol and 50 mg/L streptomycin. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 h at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM NaPB buffer (pH=8.0) to 10 g cdw/L with 2% glucose (for cofactor regeneration) and 200 mM NH.sub.3—NH.sub.4Cl (pH 8.25). To a 2 mL of aqueous system, a 2-mL n-hexadecane containing 20 mM of substituted Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 100-mL flask for 10-24 hours. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent poroshell 120 EC-C18 column, acetonitrile:water: TFA=30:70:0.1, and flow rate 0.5 mL/min) to quantify the production of substituted PEA in aqueous phase. 100 μL of organic phase samples were taken during the reaction and analyzed by GC-FID (Agilent HP-5 column, 70° C. increase to 200° C. at 25° C./min, increase to 250° C. at 50° C./min, hold for 1 min, and then increase to 270° C. at 20° C./min) to quantify substituted Sty, SO, and PA in organic phase. As shown in Table 2, all the 12 substituted PEAs were produced in good to excellent yield 45-99% in 10-24 h. This prove the relative broad scope of the cascade biotransformation.
(84) TABLE-US-00002 TABLE 2 Conversion of substituted styrene to substituted PEAs with E. coli (StyABC- CvTA-AlaDH). Conv. to Chemoselectivity Regioselectivity Entry Substrate Product PEA [%].sup.[b] NH.sub.2:OH.sup.[b] 2-NH.sub.2:1-NH.sub.2.sup.[c] 1 Sty H 98 96:4 >99:1 2 o-F-Sty o-F-PEA 94 99:1 >99:1 3 m-F-Sty m-F-PEA >99 99:1 >99:1 4 p-F-Sty p-F-PEA 96 98:2 >99:1 5 m-Cl-Sty m-Cl-PEA 86 98:2 >99:1 6 p-Cl-Sty p-Cl-PEA 76 98:2 >99:1 7 m-Br-Sty m-Br-PEA 45 97:3 >99:1 8 p-Br-Sty p-Br-PEA 60 98:2 >99:1 9 m-Me-Sty m-Me-PEA 93 97:3 >99:1 10 p-Me-Sty p-Me-PEA 99 98:2 >99:1 11 m-OMe-Sty m-OMe-PEA >99 99:1 >99:1 12 p-OMe-Sty p-OMe-PEA 94 96:4 >99:1 [a] Sty (20 mM in organic phase) was transformed with resting cells (10 g cdw/L) in NaP buffer (200 mM, pH 8, 2% glucose) and n-hexadecane (1:1) at 30° C. and 250 rpm for 10 h. .sup.[b]Determined by HPLC analysis of aqueous phase and GC-FID analysis of organic phase. .sup.[c]1-phenylethylamines were not detected. [d] 24 h reaction time.
Example 9. Preparation of (Substituted) PEA From (Substituted) Sty by Using E. coli (StyABC-CvTA-AlaDH) in a 60 mL System
(85) E. coli (StyABC-CvTA-AlaDH) was grown in 1 mL LB medium containing 50 mg/L chloramphenicol and 50 mg/L streptomycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L chloramphenicol and 50 mg/L streptomycin. After 5 h growth at 37° C., the 50-mL culture was expanded into 2 L M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L chloramphenicol and 50 mg/L streptomycin and continue culture at 37° C. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 h at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 200 mM NaPB buffer (pH=8.0) to 10 g cdw/L with 2% glucose (for cofactor regeneration) and 200 mM NH.sub.3—NH.sub.4Cl (pH 8.25). To a 50 mL of aqueous system, a 10-mL n-hexadecane containing 50 mM Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 1-L flask for 24 h. After reaction, the two phase was separated by centrifugation (4000 g, 15 mins). The aqueous phase was adjusted to pH=13 with NaOH and extracted with 50 mL ethyl acetate for three times. All the ethyl acetate was combined, dried over Na.sub.2SO.sub.4 and evaporated. The residue was further purified by flash chromatography with dichloromethane: methanol: triethylamine=100:5:1. The fractions were combined and evaporated to get 236 mg of pure PEA with 78% isolated yield. Using the similar process, p-fluoro-PEA, p-methyl-PEA, and m-methyoxyl-PEA were also isolated in 68%, 71%, and 82% yield, respectively.
Example 10. Genetic Engineering of E. coli Containing Module 2-4 and Expressing SMO, SOI, and EcALDH
(86) The padA gene coding EcALDH (phenylacetaldehyde reductase; SEQ ID NO: 10) from E. coli was amplified using primers EcALDH-Notl-RBS-F (ACTGCGGCCGCTAAGGAGATATATAATGAC AGAGCCGCATGTAGCAGTAT; SEQ ID NO: 37) and EcALDH-Xhol-R (ACTG CTCGAG TTAATACCGT ACACACACCGACTTAG; SEQ ID NO: 38) and Phusion DNA polymerase (available from Thermo). The PCR product were double digested with Notl and Xhol, and then ligated to same digested pRSF-SMO-SOI plasmid (see example 1) with T4 DNA ligase. The ligation product was transformed (heat shock) into E. coli T7 Expression competent cells (available from New England Biolabs) to give pRSF-SMO-SOI-EcALDH. This module 2-4 was sub-cloned to other three vectors by the following procedures. Module 2-4 operon was amplified with primers StyA-BspHI-F (ACTGTC ATGAAAAAGCGTATCGGTATTGTTGG; SEQ ID NO: 31) and EcALDH-Xhol-R (ACTGCTCGAGTTAATACCGTACACACACCGACTTAG; SEQ ID NO: 38), digested with BspHI and Xhol, and then ligated to double digested pACYCduet, pCDFduet, and pETduet (available from Novagen). The transformation of these products gave pACYC-SMO-SOI-EcALDH, pCDF-SMO-SOI-EcALDH, and pET-SMO-SOI-EcALDH respectively.
Example 11. Production of PAA From Sty via Cascade Biocatalysis by Using E. coli Containing Module 2-4 and Expressing SMO, SOI, and EcALDH
(87) The recombinant E. coli (StyABC-EcALDH) containing the plasmid pRSF-SMO-SOI-EcALDH was grown in 1 mL LB medium containing 50 mg/L kanamycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 hr at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 400 mM KPB buffer (pH=8.0) to 15 g cdw/L with 0.5% glucose (for cofactor regeneration). To a 2 mL of aqueous system, a 2 mL ethyl oleate containing 130 mM Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 100-mL flask for 6 h. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent poroshell 120 EC-C18 column, acetonitrile: water=50:50, and flow rate 0.5 mL/min) to quantify the production of PAA in aqueous phase. 100 μL of organic phase samples were taken during the reaction and analyzed by GC-FID (Agilent HP-5 column, 70° C. increase to 200° C. at 25° C./min, increase to 250° C. at 50° C./min, hold for 1 min, and then increase to 270° C. at 20° C./min) to quantify Sty, SO, PA in organic phase. PAA was produced from Sty, and the best result is about 122 mM (94% yield) obtained in 6 h (
Example 12. Preparation of (Substituted) PAA From (Substituted) Sty by Using E. coli (StyABC-EcALDH) in a 48 mL System
(88) ##STR00003##
(89) E. coli (StyABC-EcALDH) was grown in 1 mL LB medium containing 50 mg/L kanamycin at 37° C. and then inoculated into 50 mL M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin. After 5 h growth at 37° C., the 50-mL culture was expanded into 2 L M9 medium containing glucose (20 g/L), yeast extract (6 g/L), and 50 mg/L kanamycin and continue culture at 37° C. When OD.sub.600 reached 0.6, 0.5 mM IPTG was added to induce the expressing of enzymes. The cells continued to grow and expressed protein for 12 hours at 22° C. before they were harvested by centrifuge (4000 g, 10 mins). The cells were resuspended in 400 mM KPB buffer (pH=8.0) to 15 g cdw/L with 0.5% glucose (for cofactor regeneration). To a 40-mL of aqueous system, an 8-mL ethyl oleate containing 25-100 mM of substituted Sty was added to the reaction system to form a second phase. The reaction was conducted at 30° C. and 300 rpm in a 250-mL tri-baffled flask for 10 hours. 100 μL of aqueous phase samples were taken during the reaction and analyzed by reverse phase HPLC (Agilent poroshell 120 EC-C18 column, acetonitrile:water=50:50, and flow rate 0.5 mL/min) to quantify the production of substituted PAA in aqueous phase. As shown in Table 3, all the 12 substituted 2-PEs were produced in good to excellent yield 85-99% in 10 h. This proved the relative broad scope of the cascade biotransformation. After reaction, the two phases were separated by centrifugation (4000 g, 15 mins). The aqueous phase was adjusted to pH=2 with HCl and extracted with 100 mL ethyl acetate for two times. The ethyl acetate fractions were combined, dried over Na.sub.2SO.sub.4 and evaporated. The PAAs were purified by flash chromatography. Pure PAA was obtained at 82% isolated yield (Table 3).
(90) TABLE-US-00003 TABLE 3 Conversion of substituted styrene to substituted PAAs with E. coli (StyABC-EcALDH). Scale Substrate Conv. to Isolated Entry Substrate KPB + EO [mL] Conc. [mM] Product PAA [%] yield [%] 1 Sty 100 + 20 100 PAA 96 82 2 o-F-Sty 40 + 8 50 o-F-PAA 98 71 3 m-F-Sty 40 + 8 50 m-F-PAA >99 73 4 p-F-Sty 40 + 8 50 p-F-PAA 98 76 5 m-Cl-Sty 40 + 8 50 m-Cl-PAA 94 81 6 p-Cl-Sty 40 + 8 50 p-Cl-PAA 85 75 7 m-Br-Sty 40 + 8 25 m-Br-PAA 91 77 8 p-Br-Sty 40 + 8 25 p-Br-PAA 87 71 9 m-Me-Sty 40 + 8 50 m-Me-PAA 99 67 10 p-Me-Sty 40 + 8 50 p-Me-PAA 98 56 11 m-OMe-Sty 40 + 8 50 m-OMe-PAA >99 66 12 p-OMe-Sty 40 + 8 50 p-OMe-PAA >99 52
Example 13. Genetic Engineering of E. coli Expressing SMO, SOI and ADH9v1 (StyABC-ADH9v1)
(91) Gene coding ADH9v1 (SEQ ID NO: 39), as reported in [P. Könst, H. Merkens, et al., Angew. Chem. Int. Ed. 51: 9914-9917 (2012)], was amplified using the primers ADH9v1-Hindll-RBS-F: ACTGAAGCTTTAAGGAGATATATCATGAAAAATCGTGTTGC CTTTGTTAC (SEQ ID NO: 40) and ADH9v1-Xhol-R: ACTGCTCGAGTTAGTTAAACACCATACCACCAT (SEQ ID NO: 41) and Phusion DNA polymerase (available from Thermo). The PCR product were double digested with HindIII and Xhol, and then ligated to same digested pRSF-SMO-SOI plasmid (see Example 1) with T4 DNA ligase. The ligation product was transformed (heat shock) into E. coli T7 Expression competent cells (available from New England Biolabs) to give E. coli (StyABC-ADH9v1) or (pRSF-SMO-SOI-ADH9v1).
Example 14. Preparation of (S)-2-Arylpropionic Acids From α-Methylstyrene Derivatives With E. coli (StyABC-ADH9v1)
(92) Freshly prepared E. coli (StyABC-ADH9v1) cells were resuspended to 20 g cdw/L in KP buffer (200 mM, pH 8.0). 100 mL of the cell suspension were mixed with 10 mL of n-hexadecane in a tri-baffled flask (500 mL). α-Me-Sty (2 mmol), or p-F-α-Me-STy-p-Me-α-Me-Sty (0.5 mmol) was added to start the reaction at 300 rpm and 30 8° C. for 24 h. Aqueous phase samples (100 mL) were separated by centrifugation (13000 g, 3 min), diluted with 400 mL TFA solution (0.5%) and 500 mL acetonitrile (with 2 mM benzyl alcohol), and analyzed by chiral HPLC to quantify the concentration and ee of 2-Phenylpropanoic acid-p-Me-α-Me-paa. At the end of the reaction, the mixture was subjected to centrifugation (4000 g, 15 min) to collect the aqueous phase. The reaction flask, the cells and n-hexadecane were washed with water (20 mL). The aqueous phase and washed water were combined, adjusted to pH≤2 with HCl, saturated with NaCl, and then extracted with ethyl acetate (3×100 mL). The ethyl acetate was collected, dried over Na.sub.2SO.sub.4, and subjected to evaporation by using a rotary evaporator. The crude product was purified by flash chromatography on a silica gel column with an eluent consisting of n-hexane: ethyl acetate of 5:1 and acetic acid (0.5% as additive) (R.sub.f=0.2-0.3). The collected fractions were subjected to GC-FID analysis to confirm the purity. The desired fractions were combined, subjected to evaporation (n-heptane was added to remove acetic acid by forming azeotrope), and dried overnight under vacuum.
Example 15. One-Pot Synthesis of (S)-Arylpropionic Acids From α-Methylstyrene Derivatives With E. coli (StyABC-ADH9v1)
(93) ##STR00004##
(94) Asymmetric cascade oxidation of α-methylstyrene (20 mM) was examined with resting cells of E. coli (StyABC-ADH9v1) under different conditions on a small scale (
(95) To demonstrate the cascade oxidation for asymmetric synthesis of 2-arylpropionic acid, E. coli (StyABC-ADH9v1) resting cells (20 g cdw/L) were employed to transform α-Methylstyrene (20 mM) in a larger system consisting of 100 mL KP buffer and 10 mL n-hexadecane. After reacting for 24 hours, (S)-2-Phenylpropanoic acid was produced in 82% conversion (Table 4). Work-up, extraction with ethyl acetate, and purification by flash chromatography gave 195 mg of pure (S)-2-Phenylpropanoic acid in 65% isolated yield. The ee of (S)-2-Phenylpropanoic acid is excellent (98%). The cascade biooxidation was further applied to transform ring-substituted α-methylstyrenes (S)-p-F-α-Me-PAA-(S)-p-Me-α-Me-PAA (5 mM) in the same system of 100 mL KP buffer and 10 mL n-hexadecane. (S)-p-F-α-Me-PAA-(S)-α, 4-Dimethylphenylacetic acid were successfully produced in 67-75% conversion, and similar work-up, extraction, and purification afforded pure (S)-p-F-α-Me-PAA-(S)-p-Me-α-Me-PAA in 46-52% isolated yield. The ees of (S)-4-F-α-Me-PAA and (S)-p-Me-α-Me-PAA were also excellent (97-98%), while the ee of (S)-p-CI-α-Me-PAA is slightly lower (92%). These results clearly demonstrated that the epoxidation-isomerization-oxidation cascade is highly regio- and stereo-selective for the conversion of 2-arylpropenes to give (S)-2-arylpropionic acids. This unique one-pot asymmetric oxidation has no chemical counterpart thus far.
(96) TABLE-US-00004 TABLE 4 One-Pot Synthesis of (S)-Arylpropionic Acids from α-Methylstyrene Derivatives with E. coli (StyABC-ADH9v1) Conversion Conc. to Product ee Isolated Entry Substrate [mM] Product [%] [%] yield [%] 1 α-Me-Sty 20 (S)-2-Phenylpropanoic acid 82 98 65 2 p-F-α-Me-Sty 5 (S)-p-F-α-Me-PAA 75 97 49 3 p-Cl-α-Me-Sty 5 (S)-p-Cl-α-Me-PAA 67 92 46 4 p-Me-α-Me-Sty 5 (S)-p-Me-α-Me-PAA 73 98 52 Conversion to 4 [%] and ee [%] are determined by chiral HPLC analysis.
One-Pot Production of Natural 2-PE From L-Phe
Example 16. Genetic Engineering of E. coli Containing Module 1 and Module 2-2 and Expressing PAL, PAD, SMO, SOI, and PAR
(97) AtPAL2 from Arabidopsis thaliana was chosen for the deamination of L-phenylalanine, while AnPAD (fdc1 and pad1) from Aspergillus niger was selected for decarboxylation of cinnamic acid. Both genes were subsequently cloned together in compatible plasmids to provide the first cascade containing Module 1.
(98) The synthesized gene of AnFDC (fdc1) with nucleic acid sequence (SEQ ID NO: 42) encoding AnPAD protein sequence (SEQ ID NO: 43) was amplified using primers “AnFDC-BspHI-F: ACTGTCATGAGCGCGCAACCTGCGCACCTG” (SEQ ID NO: 44) and “AnFDC-EcoRI-R: ACTGGAATTCTTAGTTACTGAAGCCCATTTTGGTC” (SEQ ID NO: 45) with Phusion DNA polymerase. The PCR product was double-digested with BspHI and EcoRI, and then ligated to the Ncol and EcoRI digested pRSFDuet-1 with T4 DNA ligase. The ligation product was transformed into E. coli T7 Expression competent cells to give pRSF-AnFDC. On the other hand, the synthesized gene of AnPAD (pad1) with nucleic acid sequence (SEQ ID NO: 16) encoding AnPAD protein sequence (SEQ ID NO: 14) was amplified using primers “AnPAD-EcoRI—RBS-F: ACTGGAATTCTAAGGAGATATATCATGTTCAACTCACTTCTGTCCGGC” (SEQ ID NO: 46) and “AnPAD-Pstl-R: ACTGCTGCAGTTATTTTTCCCAACCATTCCAACG” (SEQ ID NO: 47). The PCR product was double digested with EcoRI and Pstl, and then ligated to the same digested pRSF-AnFDC with T4 DNA ligase. The ligation product was transformed into E. coli T7 Expression competent cells to give pRSF-PAD plasmid. Then, the gene of AtPAL2 with nucleic acid sequence (SEQ ID NO: 15) encoding PAL protein sequence (SEQ ID NO: 13) was amplified from the cDNA library of Arabidopsis thaliana (purchased from ATCC 77500) using primers “AtPAL-Ndel-F: ACTGCATATGGATCAAATCGAAGCAATGTTGTG” (SEQ ID NO: 48) and “AtPAL-Xhol-R: ACTGCTCGAGTTATTTTTCCCAACCATTCCAACG” (SEQ ID NO: 49). The PCR product was double digested with Ndel and Xhol, and then ligated to the same digested pRSF-PAD with T4 DNA ligase. The ligation product was transformed into E. coli T7 Expression competent cells to give pRSF-PAD-PAL plasmid. PAD-PAL was also sub-cloned to the other three vectors by the following procedure. PAD-PAL was amplified with primers “AnFDC-BspHI-F: ACTGTCATGAGCGCGCAACCTGCGCACCTG” (SEQ ID NO: 44) and “AtPAL-Xhol-R: ACTGCTCGAGTTATTTTTCCCAACCATTCCAACG” (SEQ ID NO: 49), digested with BspHI and Xhol, and then ligated to Ncol and Xhol digested pACYCDuet-1, pCDFDuet-1, and pETDuet-1. The transformation of these products gave pACYC-PAD-PAL, pCDF-PAD-PAL, and pET-PAD-PAL, respectively.
(99) For the second cascade containing Module 2-2, pRSF-SMO-SOI-PAR, pACYC-SMO-SOI-PAR, pCDF-SMO-SOI-PAR, and pET-SMO-SOI-PAR were produced according to Example 2.
(100) In order to achieve an equal enzyme expression in the E. coli strain, all 5 main enzymes were divided into 2 different modules, PAL-PAD and SMO-SOI-PAR using 4 different plasmids each, pACYC, pCDF, pET, and pRSF, respectively. The twelve recombinant plasmids were then transformed to E. coli T7 competent cells to provide 12 E. coli strains, each co-expressing PAL, PAD, SMO, SOI, and PAR. Plasmids for Module 1 and Module 2-2 combined plasmids for Module 1 and Module 2-2 are shown in Table 5.
(101) TABLE-US-00005 TABLE 5 Engineering of recombinant E. coli expressing PAL, PAD, SMO, SOI, and PAR using two modules (PAL_PAD and SMO_SOI_PAR) with different plasmids Plasmid for Plasmid for PAL_PAD SMO_SOI_PAR Combined plasmids for Module 1 (M1) (M2-2) and Module 2-2 pACYC (M1) pACYC (M2-2) pACYC (M1)_pCDF (M2-2) (AC) pCDF (M1) pCDF (M2-2) pACYC (M1)_pET (M2-2) (AE) pET (M1) pET (M2-2) pACYC (M1)_pRSF (M2-2) (AR) pRSF (M1) pRSF (M2-2) pCDF (M1)_pACYC (M2-2) (CA) pCDF (M1)_pET (M2-2) (CE) pCDF (M1)_pRSF(M2-2) (CR) pET (M1)_pACYC (M2-2) (EA) pET (M1)_pCDF (M2-2) (EC) pET (M1)_pRSF (M2-2) (ER) pRSF (M1)_pACYC (M2-2) (RA) pRSF (M1)_pCDF (M2-2) (RC) pRSF (M1)_pET (M2-2) (RE)
Example 17. Screening of Recombinant E. coli Strains for 2-PE Production
(102) One-pot synthesis of 2-PE production via resting cells biotransformation was conducted in furtherance to test the activity of all those 12 strains (Table 5). KP buffer (potassium phosphate, 100 mM, pH 8) in 10 g cdw/L cell density containing 50 mM of L-phenylalanine was used as initial substrate, together with n-hexadecane as the organic phase, in a total volume of 4 ml (1:1). Glucose (0.5%) was added to the reaction mixture for the purpose of NADH regeneration via cellular metabolism. As shown in
Example 18. 2-PE Product Inhibition
(103) Apart from the achievements that have been reported so far, most of the 2-PE production is hindered by the product toxicity. Concentrations of 2-PE higher than 2-3 gr/L will inhibit the cells, causing a low conversion of the product in the end of the biotransformation. [Etschmann, M., Bluemke, W., et al., J. Appl. Microbiol. Biotechnol. 59: 1-8; (2002); Hua, D., Xu, P. Biotechnol. Adv. 29: 654-660 (2011); Hua, D. L, Liang, X. H., et al., Asian J. Chem. 25(11): 5951-5954 (2013); Stark, D., Zala, D., et al., Enzyme Microb Technol. 32: 212-223 (2003)] 2-PE will aim the cell membrane once it is formed during the biotransformation, hence enlarging the membrane fluidity and deflating both glucose and substrate uptake [Seward, R., Willets, J. C., Dinsdale, M. G., and Lloyd, D. J Inst Brew. 102: 439-443 (1996)]. Protein and RNA inhibitions towards E. coli were also reported before due to the exceeding concentration of 2-PE [Luchini, J. J., Corre, J., and Cremieux, A. Res. Microbiol. 141: 499-510 (1990)].
(104) The product inhibition was investigated by adding different concentration of 2-PE to the cell suspension (10 g cdw/L) of E. coli (pRSF-PAL-PAD_pET-SMO-SOI-PAR) in KP buffer (100 mM, pH 8.0) containing 0.5% glucose in aqueous phase with n-hexadecane as the organic phase, followed by the incubation at 30° C. and 250 rpm for 3 h.
(105) Referring to
(106) To further investigate the product inhibition, the apparent kinetics of the whole-cells was measured and determined using Lineweaver-Burk plot. 2-PE concentration of 3 mM was used for 15 minutes in order to determine the kinetic, thus the product toxicity towards the cells could be neglected. Competitive inhibition was shown (
Example 19. Screening and Selection of Organic Solvent for Partitioning 2-PE
(107) In-situ product removal technique via extraction have been conducted to remove the obtained 2-PE from the aqueous phase and make its concentration below the inhibitory level. We investigated different type of organic solvents and ionic liquids to perform the extractive biotransformation for 2-PE production via styrene-derived pathway from L-phenylalanine, starting from the analysis of their partition coefficients in the biphasic system. Product and substrate coefficient partitions in organic and aqueous phase were determined by adding different concentration of 2-PE and L-phenylalanine, respectively, into KP buffer (100 mM, pH 8.0) together with the respective organic solvents. Reaction mixtures were incubated for 1 h (280 rpm, 30° C.).
(108) Results in
(109) Further investigation was conducted in order to determine the biocompatibility of the organic solvents towards the biocatalyst. The E. coli cell pellets (pRSF-PAL-PAD_pET-SMO—SOI-PAR, 10 g cdw/L) in KP buffer (100 mM, pH 8.0) containing 0.5% glucose and 50 mM L-Phe were used to perform the biotransformation by utilizing the respective organic solvents for 24 h (280 rpm, 30° C.). From
Example 20. Preparation and Characterization of Nano-Solid Adsorbent
(110) The use of a magnetic adsorbent consisting of iron oxide core and benzene ring functional groups on the surface was investigated. Polystyrene was employed to coat the OA-MNP in order to protect the iron oxide cores.
(111) The synthesis of the OA-MNP-PS is shown in
Example 21. Adsorbent Screening
(112) In-situ product adsorption (ISPA) can be applied as an in-situ product removal (ISPR) alternative technique, where resins or other adsorption media are implemented to minimize the 2-PE product inhibition. Product concentration increased up to 6.2 g/l when macroporous resin D101 was applied during the biotransformation. However, ISPA also suffers from limitation, such as a low specificity and adsorption capacity for 2-PE [Mei, J., Min, H., and Lu, Z. Process Biochemistry. 44: 886-890 (2009)].
(113) Seven different adsorbents were used, including OA-MNP-PS. As shown in
Example 22. Tri-Phasic Cascade Biotransformation of L-Phenylalanine to 2-PE With In-Situ Product Removal (ISPR) via Extraction and Adsorption in 1 Pot
(114) XAD4 resin (0.36 g) or OA-MNP-PS (5 mg/ml) was selected as the adsorbent, together with oleic acid, which was proven to give the best extractive biotransformation in the biphasic system (Example 18). Tri-phasic biotransformation was carried out with resting cells E. coli (pRSF-PAL-PAD_pET-SMO-SOI-PAR, 10 g cdw/L) resuspended in KP buffer (100 mM, pH 8.0) containing 0.5% glucose and 50 mM L-phenylalanine with aqueous to organic ratio of 1:1 in a total volume of 4 ml. As shown in
(115) In order to perform the repeated batch biotransformation, cells were resuspended in fresh buffer containing 0.5% glucose and same initial substrate concentration, and mixed with a new organic solvent and adsorbent to carry on the biotransformation. As shown in
(116) Microbial Production of 2-PE From Glucose
Example 23. Engineering of Native Biosynthetic Pathway for L-Phe Overproduction
(117) A scheme for the production of 2-PE from glucose is shown in
(118) AroG* (SEQ ID NO: 27), aroK, ydiB, pheA* (SEQ ID NO: 28), and tyrB were cloned and overexpressed using strong promoter in T7 strain (T7-Phe).
(119) The genes for overexpression and deletion for overproduction of L-Phe were amplified by PCR from E. coli MG1655 genomic DNA. pCDFDuet was used for overexpression of aroG*, aroK, ydiB, pheA* and tyrB genes. The genes aroG*, aroK, ydiB were cloned in multiple cloning site-1 and pheA* and tyrB were cloned in multiple cloning site-2. Two overexpression plasmids were used for the styrene-mediated pathway genes. pRSFDuet was used for the overexpression of PAL, FDC and PAD and pETDuet was used for the overexpression of styABC and PAR, as described in Example 15.
(120) Gene Deletion Methodology:
(121) The crr and tyrA chromosomal deletions were performed using homologous recombination and the pKOV vector invented by Link et al. [Link, A. J., Phillips, D., & Church, G. M. Journal of bacteriology, 179(20): 6228-6237 (1997)]. The pKOV plasmid was obtained as a gift from George Church (Addgene plasmid #25769). Briefly, ˜600 bp of upstream and downstream DNA base pairs of the target gene were used to provide sufficient homology for gene replacement. The target genes were replaced by random 10-20 bp length double stranded DNA. The crr gene and tyrA gene deletion sequences, comprising the short double stranded DNA flanked by the 600 bp upstream and downstream gene nucleotide sequences are shown in SEQ ID NO: 52 and SEQ ID NO: 53, respectively. The replacement ‘10-20 bp’ length double stranded DNA inserts are at nucleotide positions 619-635 and 598-610, respectively of SEQ ID NO: 52 and 53.
(122) The integration of the recombinant pKOV plasmid into chromosome was performed by growing the E. coli T7 strain containing recombinant pKOV plasmid at 42° C. using chloramphenicol as selection marker. After successful replacement of target DNA with insertion fragment, the deletion was confirmed using PCR. Further, the plasmid sequence was removed from the chromosome using sucrose as selection pressure and the deletion was confirmed by PCR and DNA sequencing. Similar approach was performed in single mutants to delete additional gene and create double mutants.
(123) TABLE-US-00006 TABLE 6 List of strains and plasmids constructed in Example 23 to Example 26 Strain/plasmid Description Strain T7 Escherichia coli T7 express T7ΔC T7Δcrr T7ΔT T7ΔtyrA T7ΔΔ T7ΔcrrΔtyrA Plasmid Phe pCDFDuet-aroG*-aroK-ydiB-pheA*-tyrB Sty pRSFDuet-PAL-FDC-PAD, pETDuet-styABC-AR pKOV-crr pKOV plasmid for crr deletion pKOV-tyrA pKOV plasmid for tyrA deletion
(124) Overexpression of the key enzymes resulted in increased L-Phe production by T7-Phe strain (
(125) To further improve L-Phe production, efforts to improve precursor availability was attempted. One approach was limiting the usage of PEP in PTS system by the deletion of crr. As shown in
(126) The second target to improve precursor availability was prephenate dehydrogenase (TyrA). TyrA converts prephenate the precursor of L-Phe to tyrosine. Therefore, tyrA was deleted (T7ΔT) and L-Phe production was studied in T7ΔT-Phe. As shown in
(127) Surprisingly, the double mutant T7ΔΔ-Phe could produce ˜13 mM L-Phe which is ˜6-fold higher than T7-Phe (
(128) As T7ΔΔ-Phe cell growth was relatively low, a brief experiment was performed by growing T7-Phe and T7ΔΔ-Phe in rich media (LB broth) for 6 h to increase the cell density and shifted to M9 media with a start OD.sub.600 of ˜5 (
Example 24. Overexpression of Styrene-Mediated 2-PE Production Pathway in L-Phe Producer
(129) After the successful overproduction of L-Phe from glucose, the conversion of L-Phe to 2-PE was attempted using the styrene-mediated pathway enzymes (
(130) 2-PE production from glucose by T7ΔΔ-Phe-Sty was conducted in a shake flask for 24 h. T7ΔΔ-Phe-Sty could produce 1.3 mM 2-PE directly from glucose and 2.5 mM of unconverted L-Phe was also present at the end of fermentation (
Example 25. Improvement of 2-PE Production Using In-Situ Product Removal
(131) The low production of 2-PE and L-Phe and accumulation of L-Phe could be also due to the toxicity of 2-PE seen in Example 23. Therefore, 2-PE production from glucose by T7ΔΔ-Phe-Sty in biphasic media with different ratios of M9 media and oleic acid (v:v) such as 1:0.25, 1:0.5 and 1:1 were tested for in-situ 2-PE removal.
(132) As shown in
(133) As shown in
Example 26. Evaluation of Engineered Strains for 2-PE Production in Bioreactor Scale
(134) To understand the potential of T7ΔΔ-Phe-Sty for 2-PE production from glucose, a bioreactor-scale fermentation with biphasic media was performed. The bioreactor could facilitate a high cell density necessary for reaching higher titers.
(135) A bioreactor-scale fermentation was performed with 1 L of 2×M9 media in a 3 L bioreactor. Glucose was maintained between 50-200 mM by intermittent feeding of 500 g L.sup.−1 glucose solution. 0.1 mM IPTG was added at 6 h and 100 mL oleic acid was added every 8 h starting from 10 h of fermentation. The growth temperature was shifted to 22° C. from 30° C. after induction.
(136) As shown in
REFERENCES
(137) Any listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that such document is part of the state of the art or is common general knowledge. 1. Etschmann, M., Bluemke, W., Sell, D., Schrader, J. Appl. Microbiol. Biotechnol. 2002, 59: 1-8. 2. Ferrandez, A., Prieto, M. A., Garcia, J. L., Diaz, E. FEBS Lett. 1997, 406: 23. 3. Hua, D., Xu, P. Biotechnol. Adv. 2011, 29: 654-660. 4. Kaulmann, U., Smithies, K., Smith, M. E. B., Hailes, H. C., Ward, J. M. Enzyme Microb. Technol. 2007, 41: 628-637. 5. Kim, B., Cho, B. R., Hahn, J. S. Biotechnol. Bioeng. 2014, 111: 115-124. 6. P. Könst, H. Merkens, S. Kara, S. Kochius, A. Vogel, R. Zuhse, D. Holtmann, I. W. Arends, F. Hollmann, Angew. Chem. Int. Ed. 2012, 51: 9914-9917. 7. Hua, D. L, Liang, X. H., Che, C. C., Zhang, X. D., Zhang, J., Li, Y., and Xu, P. Asian J. Chem. 2013, 25(11): 5951-5954. 8. Kunjapur, A. M., Tarasova, Y., Prather, K. L. J. Am. Chem. Soc. 2014, 136: 11644-11654. 9. Link, A. J., Phillips, D., & Church, G. M. Journal of bacteriology. 1997, 179(20): 6228-6237. 10. Liu, S.-P., et al. Process Biochemistry. 2013, 48(3): 413-419. 11. Luchini, J. J., Corre, J., and Cremieux, A. Res. Microbiol. 1990, 141: 499-510. 12. Mei, J., Min, H., and Lu, Z. Process Biochemistry. 2009, 44: 886-890. 13. Seward, R., Willets, J. C., Dinsdale, M. G., and Lloyd, D. J Inst Brew. 1996, 102: 439-443. 14. Stark, D., Zala, D., Munch, T., Sonnleitner, B., Marison, I. W., and Stockar, U. V. Enzyme Microb Technol. 2003, 32: 212-223. 15. Tieman, D. M., Loucas, H. M., Kim, J. Y., Clark, D. G., Klee, H. J. Phytochemistry 2007, 68: 2660 16. Wu, S., Chen, Y., Xu, Y., Li, A., Xu, Q., Glieder, A., Li, Z. ACS Catal. 2014, 4: 409-420. 17. Wu, S., Zhou, Y., Wang, T., Too, H. P., Wang, D. I., Li, Z. Nat. Commun. 2016, 7: 11917. 18. Zhou, Y., Wu, S., Li, Z. Angew. Chem. Int. Ed. 2016, 55: 11647-11650.