Binary vectors and uses of same

Abstract

The invention relates to binary vectors based on compatible and autonomous origins, specifically based on the pBBR1 and RK2 replication origins. These binary vectors are useful for having a wide range of hosts, for their maintenance in Agrobacterium sp. and Escherichia coli, and as a new tool for plant synthetic biology as well as a flexible framework for assembly, transfer and characterization of multiple DNA elements. The binary vectors disclosed are small, preferably less than 3.8 kb in size, stable, include an origin compatible with the most commonly used binary T-DNA vectors, comply with current standards for plant synthetic biology, and allow the administration of multiple T-DNA cassettes by means of the multiplexing of the vectors. The present invention also relates to methods for transferring and expressing nucleic acid sequences using said binary vectors, and to the uses of the same.

Claims

1. A binary vector comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 5, SEQ ID N0:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:28.

2. A binary vector system comprising: (a) a first binary vector according to claim 1; and (b) one or more additional binary vector(s).

3. A host cell comprising one or more binary vector(s) according to claim 1.

4. A host cell according to claim 3, wherein the host cell is a cell of a species of the phylum Proteobacteria.

5. A method for delivering at least one nucleotide sequence of interest in at least one host cell, or one eukaryotic cell or organism comprising: (a) introducing at least one nucleotide sequence of interest in at least one binary vector according to claim 1; and (b) contacting with or introducing into at least one host cell, or one eukaryotic cell or organism a linear or circular version of the binary vector(s) of step (a).

6. A host cell, eukaryotic cell or organism, regenerated cell, regenerated organism, progeny or seed obtainable by the method according to claim 5.

7. A method for delivering at least one nucleotide sequence of interest in at least one eukaryotic cell or organism comprising: (a) introducing at least one nucleotide sequence of interest in at least one binary vector according to claim 1; and (b) introducing the binary vector(s) of step (a) into a host cell; and (c) contacting with or introducing into at least one eukaryotic cell or organism the host cell of step (b).

8. A eukaryotic cell or organism, regenerated cell, regenerated organism, progeny or seed obtainable by the method according to claim 7.

9. A method according to claim 7, wherein the host cell is a cell of a species of the phylum Proteobacteria.

10. A method according to claim 9, wherein the eukaryotic cell or organism is a plant cell or plant.

11. A plant cell or plant, regenerated plant cell, regenerated plant, progeny or seed obtainable by the method according to claim 10.

12. A kit comprising: (a) the binary vector according to claim 1; and (b) instructions for using the kit.

13. A kit comprising: (a) the host cell according to claim 3; and (b) instructions for using the kit.

14. A method for obtaining a binary vector comprising at least one nucleotide sequence of interest, said method comprising assembling at least one nucleotide sequence of interest into at least one binary vector according to claim 1.

15. A binary vector obtained from the method according to claim 14.

16. A host cell comprising one or more binary vector(s) according to claim 15.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Construction of T-DNA binary vectors by assembly of modular parts

(2) Module 1, 2, and 3 refer to the T-DNA cassette, the pBBR1 origin, and the selectable marker, respectively. Each module includes one or several DNA parts, which are flanked by two diverse assembly linkers (diamonds): Linker_1 (SEQ ID NO: 112), Linker_2 (SEQ ID NO: 113), Linker_3 (SEQ ID NO: 114). Parts from the three modules were obtained by PCR or chemical synthesis, and were joined by one-step isothermal DNA assembly to generate the pLX-B2 (SEQ ID NO: 3), pLX-B3 (SEQ ID NO: 4), pLX-B4 (SEQ ID NO: 5) binary vectors.

(3) FIG. 2. Novel T-DNA binary vectors of the pLX series and their features

(4) (A) Organization of the pBBR1-based pLX plasmids. The binary vectors are composed of three modules, (i) a T-DNA cassette that includes a right border, an Escherichia coli reporter gene, two left borders, and is flanked by bacterial transcription terminators (T1 and T2); (ii) the broad host-range pBBR1 origin suitable for plasmid replication in E. coli and Agrobacterium tumefaciens (oriV+rep); and (iii) a selectable marker such as antibiotic resistance genes. The plasmid vectors are indicated by a letter that reflects their origin module (B, pBBR1-derived origin) and a digit according the R gene: 2, npfI, gene that confers resistance to kanamycin; 3, aadA, gene that confers resistance to spectinomycin/streptomycin; 4, aacC1, gene that confers resistance to gentamicin. (B) Cloning features of a T-DNA cassette of the pLX vectors. The lacZα reporter is flanked by two divergent BsaI recognition sites (solid triangles); the nonpalindromic overhangs generated by BsaI digestion allow assembly of transcription units by one-step digestion-ligation cloning (Golden Gate). Convergent BsmBI sites (open triangles) are included to build multiple transcription unit constructs by Golden Braid assembly. Alternatively, pLX vectors can be linearized by inverse PCR using divergent primers (arrows), DpnI treated, and used to join one or several overlapping inserts by one-step isothermal DNA assembly (Gibson assembly). (C) Diagrams of pLX vector cloning features. Parts or transcription units can be assembled into pLX vectors using the BsaI-based Golden Gate and GoldenBraid standards. Overlapping DNA fragments can be joined into the linearized pLX vectors by Gibson assembly. The pLX vectors can be used for multiple T-DNA delivery by vector multiplexing into Agrobacterium cells.

(5) FIG. 3. Transient transgene expression in plants using the pLX vector series

(6) (A) Construct scheme of the transgene for transient transformation of Nicotiana benthamiana plants. The TagRFP-T gene (RFP) driven by the cauliflower mosaic virus (CaMV) 35S promoter was inserted into different pLX-derived backbones, which were delivered to plants by agro-infiltration. Data were collected at 6 days post-agro-infiltration (dpa); CTRL, an empty control; B2-RFP indicates pLX-B2-TagRFP-T (SEQ ID NO: 13); B3-RFP, pLX-B3-TagRFP-T (SEQ ID NO: 14); B4-RFP, pLX-B4-TagRFP-T (SEQ ID NO: 15). (B) RFP fluorescence of infiltrated leaves was imaged under a fluorescence stereoscope. (C) Cell RFP fluorescence was imaged by confocal microscopy; bars, 100 μm. (D) RFP accumulation was assessed by immunoblot analysis. Ponceau red-stained blot is shown as a loading control.

(7) FIG. 4. Stable transgene expression in plants using the pLX vector series

(8) (A) A transgene construct for stable transformation of Arabidopsis thaliana plants was assembled in pLX-B2-P.sub.CRC:mTFP1 (SEQ ID NO: 23), and included a cyan fluorescent protein gene (mTFP1) driven by the A. thaliana cruciferin C promoter, which is active in seeds (P.sub.CRC). (B) To confirm stable integration of the transgene, PCR assays of genomic DNA were performed using transgene-specific (mTFP1; 765 bp) or control primers (P.sub.CRC; 1081 bp). Each lane represents a single plant sample; C, untransformed plant sample; T.sub.1, independent lines selected by cyan fluorescence of seed collected from the Agrobacterium-treated plants. Fluorescence images of untransformed seeds (Col-0) and those collected from a single T.sub.1 plant (T2).

(9) FIG. 5. Stability of the pLX vector series in Escherichia coli cells

(10) (A) The expression cassette of a GFP-tagged plum pox virus (PPV) cDNA clone was subcloned from a pBIN19-derived vector (pSN-PPV) to a pLX plasmid, to generate the pLX-PPV vector (SEQ ID NO: 21). Schemes are not to scale. (B) Clones # A and # B of the new pLX-PPV vector were transformed in E. coli cells to evaluate the plasmid stability, inputs (In). For each transformation, eight individual colonies were picked and subjected to six growth cycles (24 h, 37° C.). The purified plasmids (Out, outputs) were EcoRI-digested and resolved by agarose gel electrophoresis. Fragments derived from the cDNA copy cassette of the PPV genome are indicated (left); upper bands are backbone-specific fragments. (C) To generate the pLX-TuMV vector (SEQ ID NO: 28), the expression cassette of a GFP-tagged turnip mosaic virus (TuMV) cDNA clone was subcloned from a pUC-based vector (p35Tunos-vec01-NAT1) to a pLX-B2-derived plasmid. (D) pLX-TuMV (SEQ ID NO: 28) was transformed into E. coli cells to evaluate plasmid stability, input (In). Ten individual colonies were picked and subjected to six growth cycles (24 h, 37° C.). The purified plasmids (Out, outputs) were EcoRI-digested and resolved by agarose gel electrophoresis.

(11) FIG. 6. Viral vector delivery and recombinant protein production in plants using the pLX vector series

(12) The pLX-PPV (pLX) (SEQ ID NO: 21) and pSN-PPV (pSN) viral vectors were delivered to N. benthamiana plants by agro-infiltration (panels A-D); the pLX-TuMV viral vector was delivered to A. thaliana plants by agro-inoculation (panels E-G). (A) Recombinant GFP was expressed in plants using a chimeric PPV clone. (B) Viral accumulation was assessed by anti-PPV coat protein (CP) immunoblot analysis of samples from the agro-infiltrated and upper uninoculated leaves, at 6 and 14 dpa, respectively. Ponceau red-stained blots are shown as loading controls. (C) At 6 dpa, GFP fluorescence intensity (FI) of the agro-infiltrated leaf patches was quantified in a 96-well plate reader. Bar indicates mean±standard deviation (SD, n=4); * p<0.001, Student's t-test. (D) At 14 dpa, the upper uninoculated leaves were imaged on a blue light transilluminator; GFP fluorescence is shown in light gray; scale bar, 2 cm. (E) Recombinant GFP was expressed in plants using a chimeric TuMV clone. (F) The pLX-TuMV (SEQ ID NO: 28) vector was delivered to A. thaliana plants by agro-inoculation, and data were collected at 11 days post agro-inoculation. Viral accumulation was assessed by anti-TuMV CP immunoblot analysis of upper uninoculated leaves; the Ponceau red-stained blot is shown as a loading control. (G) Upper uninoculated leaves were imaged; GFP fluorescence is shown in light gray; scale bar, 1 cm.

(13) FIG. 7. Assembly of DNA parts into the pLX vectors by using synthetic biology standards

(14) (A) Standardized units for delivery to plants of the kanamycin resistance (NptII) and red fluorescent protein (DsRED) genes were assembled into the pLX-B2 vector (SEQ ID NO: 3) to generate the pLX-B2-NptII-DsRED vector (SEQ ID NO: 20). (B) The pLX-B2-XT1-XT2-hCas9 vector (SEQ ID NO: 19) was assembled for delivery of standardized units: a kanamycin resistance gene (NptII), human codon-optimized Streptococcus pyogenes Cas9 gene (hCas9), and sgRNA targeting the N. benthamiana Niben101Scf04205Ctg025 (XT1) and Niben101Scf04551Ctg021 (XT2) endogenous genes. (C) Scheme of the pLX vectors that incorporate cloning cassettes compatible with the Golden Braid binary assembly. The alpha level kanamycin-resistant plasmids have divergent BsaI and convergent BsmBI sites; the omega level spectinomycin-resistant plasmids have divergent BsmBI and convergent BsaI sites. All plasmids include the pBBR1 origin and the lacZα reporter.

(15) FIG. 8. Assembly of large transcription units by overlap-based cloning methods, and virus agro-inoculation using the pLX vector series

(16) (A) Use of a pLX vector to generate an infectious cDNA clone of an RNA virus. Three RT-PCR fragments (gray boxes) spanning the entire Ugandan cassava brown streak virus (UCBSV) genome were cloned in a linearized pLX-B2-based vector by Gibson assembly. The pLX-UCBSV vector (SEQ ID NO: 22) obtained was delivered to N. benthamiana plants by agro-infiltration, and data were collected at 12 dpa. (B) Photographs of mock- and pLX-UCBSV-infiltrated plants (left and right, respectively). The plant relative height is plotted, mean±SD (n=4); * p=0.0059, Student's t-test. (C) Transmission electron micrograph shows particles observed in the infected plant sample; scale bar, 100 nm. (D) Viral accumulation was assessed by anti-UCBSV coat protein (CP) immunoblot analysis of samples from upper uninoculated leaves. The Ponceau red-stained blot is shown as a loading control.

(17) FIG. 9. Relative size comparison of the pLX-B2 backbone and selected T-DNA binary vectors

(18) Relative size comparison of the pLX-B2 backbone and selected binary vectors (T-DNA cassette sequences were not considered). Graph bars are filled according to the plasmid replication origins shown at right; the pVS1- and pSa-based binary vectors include a narrow-host-range origin for maintenance in E. coli; *, as the pSa origin in the pGreen-based vectors is not autonomous, the size of the RK2-based pSoup plasmid required for pGreenII maintenance in A. tumefaciens is also included in the graph. Glyphs according to the Synthetic Biology Open Language visual format.

(19) FIG. 10. Comparison in plant expression assays of the pBBR1-based pLX vectors, and T-DNA binary vectors based on the RK2 and pVS1 origins

(20) (A) The pBBR1 replication module of pLX vectors was replaced with an RK2 minimal origin to build pLX-R2 (SEQ ID NO: 6), pLX-R3 (SE ID NO: 7) and pLX-R4 (SEQ ID NO: 8) vectors. These were engineered to obtain the pLX-R2-TagRFP-T (SEQ ID NO: 16), pLX-R3-TagRFP-T (SEQ ID NO: 17) and pLX-R4-TagRFP-T (SEQ ID NO: 18) vectors for expression of the TagRFP-T gene (RFP). (B) In transient expression assays, the RFP vectors from FIG. 3 (B2-RFP indicates pLX-B2-TagRFP-T (SEQ ID NO: 13); B3-RFP, pLX-B3-TagRFP-T (SEQ ID NO: 14); B4-RFP, pLX-B4-TagRFP-T (SEQ ID NO: 15)) were compared to RK2-based pLX vectors (R2-RFP indicates pLX-R2-TagRFP-T (SEQ ID NO: 16); R3-RFP, pLX-R3-TagRFP-T (SEQ ID NO: 17); R4-RFP, pLX-R4-TagRFP-T (SEQ ID NO: 18)); CTRL, an empty control. RFP fluorescence intensity (FI) of bacterial suspensions and infiltrated plant samples (at 4 or 6 dpa) was measured in a plate reader. Bar graphs show the FI values for plant samples, mean±SD (n 0.3); letters indicate p<0.05, one-way Anova and Tukey's HSD test; * p=0.00047, Student's t-test. Scatter plot shows linear regression analysis of FI values for plant and bacterial samples; the B3-RFP, R3-RFP, and empty control samples are shown in black, gray and white, respectively. (C) Expression of a DsRED standard cassette was compared in transient and stable expression assays. A pCAMBIA-derived vector (GB1686, SEQ ID NO: 27) and pLX-B2-NptII-DsRED (pLX, SEQ ID NO: 20) were transformed into N. benthamiana plants; CTRL, control. In agro-infiltrated leaf samples, cell DsRED fluorescence was imaged by confocal microscopy (bars, 100 μm) and quantified in a plate reader. FI values were plotted, mean±SD (n=4); letters indicate p<0.05, one-way Anova and Tukey's HSD test. In stable transformation assays, leaf samples were co-cultured with the indicated A. tumefaciens strains and transferred to kanamycin-containing medium. Images show plantlets imaged under an epifluorescence microscope at 40 days post inoculation. The plot shows transformation efficiencies defined as the number of kanamycin-resistant plantlets that showed DsRED fluorescence, mean±SD (n=7); n.s., p=0.91. Vector origins are indicated: pBBR1, solid circle/bars; pVS1, open circle/bars.

(21) FIG. 11. Delivery of CRISPR/Cas system components, and targeted genome mutagenesis comparison of pBBR1-based pLX vectors and T-DNA binary vectors based on the pVS1 origin

(22) Targeted mutagenesis in transient expression assays by using a Golden Braid-based CRISPR/Cas9 system. (A) Nicotiana benthamiana plants were infiltrated with a pCAMBIA-derived vector (GB1108) and the pLX-B2-XT1-XT2-hCas9 (pLX; SEQ ID NO: 19); the vectors bear transcription units for the human codon-optimized Cas9 (hCas9), and sgRNA targeting the Niben101Scf04205Ctg025 (XT1) and Niben101Scf04551Ctg021 (XT2) endogenous genes. (B) Gels show PCR/digestion assays; asterisks mark cleavage-resistant DNA bands; CTRL, hCas9 delivered with no sgRNA sequences. The plot shows mutagenesis efficiencies, which were estimated by quantifying the ratio of uncleaved/cleaved bands; mean±SD (n=4); * p<0.001. Vector origins are indicated: pBBR1, solid circle/bars; pVS1, open circle/bars.

(23) FIG. 12. Sequence similarity of the pLX vectors and reference T-DNA binary vectors

(24) (A) Representation of the new pLX binary vector compatible with the pBBR1 origin. pLX-Z4 (SEQ ID NO: 9) shares the pLX modular organization and cloning cassette shown in FIG. 2; it includes T-DNA border sequences from the succinamopine-type pTiBo542 plasmid, a second left border sequence, lambda phage terminators, a gentamicin resistance gene (aacC1), and a 2.2-kb minimal replicon from the broad host-range plasmid RK2. (B) Percent identity plots show significant DNA local alignments between the pBBR1-based pLX-B2 and RK2-based pLX-Z4 (SEQ ID NO: 9), or pLX-R4 (SEQ ID NO: 8) vectors. Cloning cassette sequences were omitted in the comparisons; plots were generated using PipMaker (Schwartz S., et al, Genome Res. 2000, 10, 577-586). (C) Sequence similarity of the new pLX and reference T-DNA binary vectors. The matrix shows outputs obtained by pairwise sequence analysis of the vector backbones. Sequence similarity was classified according to BLASTN total score values: high, >4100; partial, 800-4100; low, <800. Matrix entries of the pBBR1-based pLX vectors are boxed, and crossed entries mark vector pairs that show low sequence similarity but share selection antibiotics.

(25) FIG. 13. Characterization of an octopine-type, disarmed strain of A. tumefaciens that shows sensitivity to several antibiotics, and strain usage for vector multiplexing

(26) (A) Antibiotic sensitivity of C58C1-313, an A. tumefaciens disarmed strain. Bacteria were inoculated into Luria-Bertani medium supplemented with rifampicin plus indicated antibiotics: AMP (ampicillin), CL (chloramphenicol), GENT (gentamicin), TC (tetracycline), KAN (kanamycin), SP (spectinomycin) and ST (streptomycin). To monitor growth curves, absorbance (OD600) was measured in a plate reader. Plot shows mean±SD (n=6); h, hours. (B) C58C1-313 harbors a pTi of the octopine type. A fragment of pTi repB gene was PCR-amplified from C58C1-313 and sequenced. A phylogenetic tree was built from an alignment of the 607-nt repB sequence from the C58C1-313 strain and deposited Ti plasmid sequences (NCBI: DQ058764.1; AB016260.1; AE007871.2; M24529.1; CP011249.1; AF242881.1). C58C1-313 clusters with the octopine-type pTi accessions. (C) Stability of pTi maintenance in the A. tumefaciens strain C58C1-313. C58C1-313 was plated, and the presence of pTi in individual colonies was confirmed by PCR using pTi-specific primers (repB; 724 bp); N, negative control. (D) Diagram of an A. tumefaciens strain (dashed hexagon) that simultaneously hosts pLX-B2- and pLX-Z4-derived vectors conferring kanamycin and gentamicin resistance, respectively. Growth curves of A. tumefaciens C58C1-313 that harbors no vectors (CTRL, gray), or the pLX-B2− plus pLX-Z4-derived vectors (black). Kanamycin- and gentamicin-supplemented medium was inoculated with the indicated strains, and absorbance measured in a plate reader. The plot shows mean±SD (n=6); h, hours.

(27) FIG. 14. Usage of the pLX vector series for multiple T-DNA delivery to plants

(28) (A) Diagram of an A. tumefaciens strain (dashed hexagon) that simultaneously hosts pLX-B2-derived and pCAMBIA-derived vectors conferring kanamycin and spectinomycin resistance, respectively; vector origins are indicated: pBBR1, solid circle; pVS1, open circle. Components of pLX-B2-P.sub.CRC:mTFP1 are described in FIG. 4; in pSN.5-P.sub.PAP85:RFP, the TagRFP-T gene (RFP) is driven by the A. thaliana PAP85 promoter (P.sub.PAP85). The P.sub.CRC and P.sub.PAP85 promoters used are active in seeds. (B) Arabidopsis thaliana plants were treated with the A. tumefaciens pLX-B2-P.sub.CRC:mTFP1 plus pSN.5-P.sub.PAP85:RFP strain by floral dipping. The T.sub.1 seeds were collected and visualized under a fluorescence stereoscope. Pictures show seeds that express mTFP1 only (Single T-DNA), or mTFP1 plus RFP (Double T-DNA); for each condition, number and percentage of obtained seeds are indicated.

(29) FIG. 15. Experimental design for delivery of synthetic circuit components to plants by multiplexing the pLX vectors

(30) (A) Sequence of the P.sub.EtOH synthetic promoter (SEQ ID NO: 35). The cauliflower mosaic virus (Ca MV) 35S terminator was included to insulate against promoters that might flank the T-DNA integration sites; AlcR DNA-binding sites (triangles) derived from the Aspergillus nidulans alcR, aldA, alcA promoters are placed upstream of a figwort mosaic virus 34S minimal promoter (arrow); open box, starting codon of the coding sequence. (B) Buffer gate truth table. Symbol of a buffer gate that uses ethanol (EtOH) as the input, and mNeonGreen (NEON) fluorescence as the output. (C) Genetic circuit that implements the gate of the previous panel. The dashed hexagon represents a single A. tumefaciens strain (R-AlcR+P.sub.EtOH:NEON) that hosts two compatible T-DNA binary vectors, pLX-Z4-P.sub.mas:RFP-AlcR (SEQ ID NO: 24) and pLX-B2-P.sub.EtOH:NEON (SEQ ID NO: 25), which confer gentamicin and kanamycin resistance, respectively. Once delivered to plants, the constitutive mannopine synthase promoter (P.sub.mas) drives expression of the RFP and AlcR proteins. In the presence of EtOH (star), AlcR binds to and activates an otherwise silent synthetic promoter (P.sub.EtOH). NEON accumulation results from the activation of the gate.

(31) FIG. 16. Gene expression control and delivery of synthetic circuit components to plants by the pLX vectors

(32) Evaluation of a buffer gate in plants. (A) Nicotiana benthamiana plants were infiltrated with an Agrobacterium strain that harbors both pLX-Z4-P.sub.mas:RFP-AlcR (SEQ ID NO: 24) and pLX-B2-P.sub.EtOH:NEON (SEQ ID NO: 25) binary vectors (R-AlcR+P.sub.EtOH:NEON). Plants were treated twice with water or EtOH. At 4 dpa, RFP and NEON fluorescence was imaged by laser scanning of leaves. Scale bar, 3 cm. (B) Nicotiana benthamiana leaves were untreated (N), or infiltrated with the A. tumefaciens R-AlcR+P.sub.EtOH:NEON strain. Leaf disks were collected, placed in a 96-well plate and incubated in the presence or absence of EtOH. Cell RFP and NEON fluorescence was imaged by confocal microscopy at 24 h post-treatment (hpt). (C) Leaf disks from agro-infiltrated patches were placed in a 96-well plate and different amounts of inducer were added. Fluorescence intensities (FI) were measured in a plate reader at 22 hpt, and the NEON/RFP FI relative value of the non-inducer condition (None) was set to 1. Bar graph shows mean±SD (n=18). Letters indicate p<0.01, one-way Anova and Tukey's HSD test. (D) Kinetics of the EtOH-responsive buffer gate. Leaf disks from agro-infiltrated patches were treated with water (gray, minus) or 0.1% EtOH (black, plus), and fluorescence intensity was measured in a plate reader. NEON/RFP FI relative value of the water condition was set to 1. The plot shows mean±SD (n=5).

DETAILED DESCRIPTION OF THE INVENTION

(33) In a first aspect, the present invention relates to a binary vector (pBBR1-based pLX vector) comprising at least three modules: (a) a T-DNA cassette module comprising at least sequences of a T-DNA right border and a T-DNA left border; (b) a replication origin module comprising a pBBR1 origin or a variant functionally equivalent thereof; and (c) at least a selectable marker module.

(34) The terms “plasmid” and “vector”, as used herein, are interchangeable and refer to an extra-chromosomal element that may carry one or more genes. Plasmids and vectors typically are circular double-stranded DNA molecules. However, plasmids and vectors may be linear or circular nucleic acids, of single- or double-stranded DNA or RNA, and may be derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construct that is capable of introducing a promoter fragment and a coding polynucleotide sequence along with any appropriate 3′ untranslated sequence into a cell. In the examples, plasmids and vectors may comprise autonomously replicating sequences, genome integrating sequences, and/or phage or nucleotide sequences.

(35) The term “viral vector” refers to a vector that comprises viral genome sequences that can launch viral infections, and are useful for rapid, high-level delivery of exogenous sequences to eukaryotic cells.

(36) The terms “Ti plasmid”, “Ri plasmid”, “pTi” and “pRi”, as used herein, are interchangeable, and refer to a large plasmid contained in the wild-type Agrobacteriumsp.; pTi comprises a T-DNA (transfer DNA) that is introduced into plants, a virulence region (vir region), etc. T-DNA is a DNA fragment inserted into the genome of a plant cell, and in wild-type Agrobacterium sp. comprises genes for the synthesis of opines and plant growth regulators. The vir region is a region that encodes virulence proteins, a protein group required for integration of the T-DNA into plants, and it comprises genes such as virA, virB, virC, virD2, virD3, virG or virJ.

(37) The term “disarmed Ti plasmid” refers to a plasmid produced by removing the T-DNA region from a wild-type Ti plasmid and that encodes virulence proteins, or to a functionally equivalent artificial or natural plasmid, such as and without limitation, the p42a plasmid of Rhizobium etli (Lacroix B. & Citovsky V., PLoS Pathog. 2016, 12, 3, e1005502). Thus, a disarmed Ti plasmid lacks the T-DNA region, and is able to mediate the DNA transfer to eukaryotic cells and their subsequent genetic modification.

(38) The term “border sequence”, e.g., right border (RB) or left border (LB), refers to a directly repeated nucleic acid sequence defining an end of the T-DNA region. Border sequences may be from a Ti plasmid, or may be other bacterial, plant-derived, or synthetic sequences that function similarly. In a preferred embodiment of the pBBR1-based pLX vector of the invention, the LB and RB are independently selected from the group consisting of a T-DNA border from a nopaline-, an octopine-, a succinamopine-type Ti plasmid, or any combination thereof. In a preferred embodiment, the T-DNA borders are selected from octopine- or succinamopine-type Ti plasmids from A. tumefaciens, and include a second left border of the nopaline type.

(39) The terms “binary vector” and “T-DNA binary vector”, as used herein, are interchangeable. They refer to a plasmid that has an origin of replication (ori) that permits maintenance of the vector in a wide range of bacteria including E. coli and Agrobacterium sp., and that comprises a T-DNA cassette, and a marker for selection and maintenance in bacteria. In some embodiments, the binary vector may include a selectable marker for selection in eukaryotic organisms, preferably for selection in plants.

(40) The terms “T-DNA cassette” and “T-DNA cloning cassette”, as used herein, are interchangeable and refer to a T-DNA region that comprises at least the RB and LB sequences, and features that allow insertion of a sequence of interest between the RB and LB sequences in a way that the sequence of interest can be transferred to eukaryotic cells.

(41) In a more preferred embodiment, the pBBR1-based pLX binary vector of the present invention is characterized in that the T-DNA cassette comprises one T-DNA right border and two T-DNA left border sequences. In a more preferred embodiment, the right border comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 102 or SEQ ID NO: 115. In a more preferred embodiment, the left border comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%, identical to SEQ ID NO: 103, SEQ ID NO: 104 or SEQ ID NO: 116. In a more preferred embodiment, the right border comprises the SEQ ID NO: 102 and the left borders comprise the SEQ ID NO: 103 and SEQ ID NO: 104. In a more preferred embodiment, the right border consists of SEQ ID NO: 102 and the left borders consist of SEQ ID NO: 103 and SEQ ID NO: 104.

(42) In a further preferred embodiment, the pBBR1-based pLX binary vector is characterized in that the T-DNA region also comprises at least two transcription terminators. Transcription terminators useful in the present invention are known in the art (i.e., in Chen Y. J., et al, Nat Methods. 2013, 10, 7, 659-664). In a more preferred embodiment, the transcription terminators comprise a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to any of the sequences selected from the list consisting of: SEQ ID NO: 108, 109, 110, 111, or any combinations thereof, more preferably, SEQ ID NO: 108 and 109. In a more preferred embodiment, the transcription terminators are selected from sequences comprising the SEQ ID NO: 108, 109, 110, 111 or any combinations thereof, more preferably, SEQ ID NO: 108 and 109. In a more preferred embodiment, the transcription terminators consist of any of the sequences selected from SEQ ID NO: 108, 109, 110, 111, or any combinations thereof, more preferably, SEQ ID NO: 108 and 109.

(43) “Homology”, “identity” or “similarity” refer to the sequence similarity between two nucleic acid or amino acid sequences. Homology can be determined by comparing a position in each sequence, which may be aligned for comparison purposes. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of homology or similarity or identity between nucleic acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. A degree of identity of amino acid sequences is a function of the number of identical amino acids at positions shared by the amino acid sequences. A degree of homology or similarity of amino acid sequences is a function of the number of amino acids, i.e., structurally related, at positions shared by the amino acid sequences. The degree of homology, identity, and/or similarity can be determined by the use of algorithms, programs and methods, such as and without limitations Clustal, Wilbur-Lipman, GAG, GAP, BLAST, BLASTN, BLASTP, EMBOSS Needle, FASTA, Smith Waterman or BLOSUM.

(44) In a more preferred embodiment, the pBBR1-based pLX vector of the invention is characterized in that the T-DNA borders flank a sequence of interest. The nucleic acid sequence(s) of interest is operatively linked to sequences required for DNA transfer to a target eukaryotic cell.

(45) The term “operatively linked” or “operably associated” refer to a functional linkage between a regulatory sequence and a coding sequence, or a functional linkage between two regulatory sequences. The term “construct” refers to units or components so described that are assembled and operatively linked thus in a relationship that permits them to function in their intended manner. By placing a coding sequence under regulatory control of a promoter or another regulatory sequence means positioning the coding sequence such that the expression of the coding sequence is controlled by the regulatory sequence. The term “transcription unit” refers to a construct including promoter, coding and terminator sequences that are operatively linked to permit the expression or delivery of the sequence of interest in the intended manner.

(46) The sequence of interest, although often a gene sequence, can actually be any nucleic acid sequence whether or not it produces a protein, an RNA, an antisense molecule or regulatory sequence or the like.

(47) A “transgene” refers to a sequence of interest independently of whether this sequence has been introduced exogenously or has been manipulated; in both cases, the sequence defined as “transgene” has not been shown to occur naturally. The terms “endogenous gene”, “endogenous sequence”, “wild-type gene” or “wild-type sequence” refer to a native gene in its natural location in the genome of an organism.

(48) Sequences of interest or transgenes may include functional elements that affect developmental processes, fertility, abiotic and biotic stress resistance, or that confer new phenotypes, and the like. Other transgenes include sequences useful to produce edible vaccines for humans or animals (e.g., U.S. Pat. Nos. 6,136,320; 6,395,964), to alter fatty acid content or change amino acid composition of crops (e.g., U.S. Pat. No. 6,664,445), to introduce enzymes in pathways to synthesize metabolites such as vitamin A and vitamin E, to increase iron concentration, to control fruit ripening, to reduce allergenic properties of e.g., wheat and nuts, to absorb and store toxic and hazardous substances and to assist contaminated soil cleanup, to alter fiber content of woods, to enhance resistance to diseases, bacteria, fungi, nematodes, herbicides, viruses and insects, or to increase salt tolerance and drought resistance, amongst others.

(49) In a typical vector, the sequence of interest is operatively linked to a promoter. A “promoter” is a sequence of nucleotides from which transcription of a downstream, operatively linked DNA may be initiated. The product of a sequence of interest may be expressed constitutively, after induction, in specific tissues or at certain development stages. Regulatory elements to effect such expression are well known in the art. Many examples of regulatory elements may be found in the Patent Lens document “Promoters used to regulate gene expression” version 1.0, October 2003 (incorporated in its entirety). Other promoters can be identified through a variety of assays. Enhancer elements or other regulatory elements can be included in addition to a promoter. “Minimal promoter” sequences usually require an enhancer element for activity, such as the so-called 35S minimal promoter from cauliflower mosaic virus (CaMV), or the 34S minimal promoter from figwort mosaic virus.

(50) In a more preferred embodiment, the pBBR1-based vector of the invention is characterized in that the T-DNA cassette module also comprises a cloning cassette. More preferably, the T-DNA cloning cassette comprises restriction endonuclease and primer annealing sites; and in a more preferred embodiment, these sites are compatible with high-throughput, Type IIS restriction endonuclease- and/or overlap-based DNA assembly methods, such as and without limitations, Golden Gate, Golden Braid, Modular Cloning (MoClo), one- or two-step Gibson assembly (Gibson D. G., et al, Nat. Methods 2009, 6, 343-345), Sequence and Ligation Independent Cloning (SLIC), GeneArt seamless cloning and assembly (Thermo Fisher Scientific), NEBuilder HiFi DNA assembly (New England BioLabs), Cold Fusion cloning (System Biosciences), or In-fusion cloning (Clontech).

(51) In another preferred embodiment, a T-DNA cloning cassette also comprises a selectable, screenable marker or reporter elements for identifying insertion of the sequence of interest. The marker or reporter element is a gene or an operon that confers a visual phenotype or negative selection, such as, and without limitations, the lacZα, ccdB, sacB, a luciferase or a fluorescent protein gene, or a canthaxanthin biosynthesis operon. Additionally, the screenable marker or reporter element included in the T-DNA cassette can be selected from the list mentioned below for the selectable marker module of the binary vector of the present invention.

(52) In a further preferred embodiment, the replication origin module of the pBBR1-based pLX vector of the invention comprises a pBBR1 origin comprising the pBBR1-oriV and -rep regions, or a variant functionally equivalent thereof. In a further preferred embodiment, the pBBR1 origin comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 105, more preferably the pBBR1 origin comprises the SEQ ID NO: 105, and more preferably the pBBR1 origin consists of SEQ ID NO: 105.

(53) As used herein, the term “functionally equivalent variant” refers to any variant in which the nucleotide sequence encodes an amino acid sequence comprising conservative or non-conservative alterations in the amino acid sequence resulting in silent changes that preserve the functionality of the molecule including, for example, deletions, additions, and substitutions. Such altered molecules may be desirable where they provide certain advantages in their use. As used herein, conservative substitution involves the substitution of one or more amino acids within the sequence of the corresponding peptide with another amino acid having similar polarity and hydrophobicity/hydrophilicity characteristics resulting in a functionally equivalent molecule. Such conservative substitutions include but are not limited to substitutions within the following groups of amino acids: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine; and methionine, norleucine. The skilled person in the art will understand that mutations in the nucleotide sequence encoding a peptide, which give rise to conservative amino acid substitutions in positions that are non-critical for the functionality of the peptide, are evolutionarily neutral mutations that do not affect its global structure or its functionality.

(54) The term “replication origin” (ori) refers to a cis-acting sequence essential for replication. Origin sequences that permit the plasmid replication or maintenance in a wide range of bacteria have been described (U.S. Pat. Nos. 4,940,838; 5,149,645; 6,165,780; 6,265,638, incorporated in its entirety). In a preferred embodiment, the origin of replication is a wide-host-range origin or a broad-host-range origin, terms that are interchangeable in the present invention. As used herein, “wide-host-range” or “broad-host-range” means that the vector replicates in at least two bacterial species, preferably in Agrobacterium sp. and E. coli. The host range is conferred by an origin of replication. When a nucleic acid molecule is integrated into the bacterial chromosome or other self-replicating bacterial DNA molecules, an origin is not necessary. Thus, when suitably modified and engineered, these bacteria may be used for transferring nucleic acid sequences into eukaryotic cells, and especially into plant cells.

(55) In another preferred embodiment, the pBBR1-based pLX vector also comprises a selectable or a screenable marker module for identifying host cell transformants, preferably bacterial transformants. Well-known selectable markers are genes that confer resistance to drugs (such as antibiotics selected from the list consisting of: neomycin, ampicillin, carbenicillin, chloramphenicol, kanamycin, tetracycline, gentamicin, spectinomycin, bleomycin, phleomycin, streptomycin, erythromycin, blasticidin, and hygromycin), herbicide resistance genes, and the like. Other selection systems can alternatively be used, including genes encoding resistance to other toxic compounds, such as potassium tellurite resistance genes, genes encoding products required for growth of the cells in positive selection systems. Examples of these “positive selection” systems are abundant (e.g., U.S. Pat. No. 5,994,629). “Negative selection” systems can also be used. Alternatively, a screenable marker or reporter gene may be employed to allow selection of transformed cells based on a visual phenotype, e.g. a β-glucuronidase, a luciferase or a fluorescent protein gene. The selectable marker is also typically operably linked to regulatory elements necessary for gene transcription, e.g., a constitutive or inducible promoter and a terminator sequence. Elements that enhance efficiency of transcription are optionally included. In a preferred embodiment, the selectable marker module comprises a gene that confers resistance to a drug, and is selected from the group consisting of neomycin, ampicillin, carbenicillin, chloramphenicol, kanamycin, tetracycline, gentamicin, spectinomycin, bleomycin, phleomycin, streptomycin, erythromycin, blasticidin and hygromycin resistance genes.

(56) In a more preferred embodiment, the pBBR1-based pLX vector is selected from the list consisting of: SEQ ID NO: 3 (pLX-B2), SEQ ID NO: 4 (pLX-B3), SEQ ID NO: 5 (pLX-B4), SEQ ID NO: 10 (pLX-B2α2), SEQ ID NO: 11 (pLX-B3Ω1), SEQ ID NO: 12 (pLX-B302), SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 25, and SEQ ID NO: 28.

(57) Furthermore, a pBBR1-based pLX vector of the present invention can be used as a single binary vector, which has autonomous replication, or in a binary vector system, which includes a combination of binary vectors that have replication and bacterial selection mechanisms allowing a mutual and autonomous coexistence with each other.

(58) As used herein, the phrase “binary vector system” refers to binary vectors that are capable of replicating in both E. coli and A. tumefaciens, and host unlinked T-DNA cassettes. In a binary vector system, vectors are multiplexed and employed for delivery of multiple T-DNA cassettes to eukaryotic cells or organisms, preferably to plants.

(59) In a more preferred embodiment, the binary vectors and vectors of the binary vector system of the present invention have a minimal size between 2 to 20 kb, preferably between 2.5 to 3.8 kb, more preferably have a size below 3.8 kb.

(60) Another aspect of the present invention refers to a binary vector system comprising the pBBR1-based pLX plasmid according to the present disclosure and another binary vector (second binary vector) known in the art and compatible with a first binary vector of the present invention. In a more preferred embodiment of the binary vector system of the present invention, the second binary vector is an RK2-based pLX plasmid as described herein.

(61) Another aspect of the present invention, the RK2-based pLX plasmid, according to the present disclosure refers to a binary vector comprising at least three modules: (a) a T-DNA cassette module comprising at least a T-DNA right border and a T-DNA left border; (b) a replication origin module comprising an origin compatible with the pBBR1 origin, preferably selected from the list consisting of origins of the IncQ, IncW, IncU, pRi, pVS1 and IncP-α plasmid incompatibility groups, wherein more preferably is an origin of the IncP-α plasmid incompatibility group, and wherein more preferably, the replication origin is the RK2 origin, or a variant functionally equivalent thereof; and (c) at least a selectable marker module.

(62) In a preferred embodiment, the RK2-based pLX vector of the invention comprises a T-DNA cassette comprising one T-DNA right border and two T-DNA left borders; preferably comprising the T-DNA border sequences mentioned above. In a more preferred embodiment, the right border comprises the SEQ ID NO: 115 and the left borders comprise the SEQ ID NO: 116 and SEQ ID NO: 104. In a more preferred embodiment, the right border consists of SEQ ID NO: 115, and the left borders consist of the SEQ ID NO: 104 and SEQ ID NO: 116.

(63) In a further preferred embodiment, the RK2-based pLX vector is characterized in that the T-DNA cassette is flanked by at least two transcription terminators, preferably the transcription terminators that are disclosed above. In a more preferred embodiment, the transcription terminators comprise the SEQ ID NO: 110 and 111, more preferably the transcription terminators consist of SEQ ID NO: 110 and 111.

(64) In a more preferred embodiment, the RK2-based pLX vector of the invention is characterized in that the T-DNA borders flank a sequence of interest. The nucleic acid sequence(s) of interest is operatively linked to sequences required for the DNA transfer to a target eukaryotic cell. In a more preferred embodiment, the sequences of interest are mentioned above.

(65) In a more preferred embodiment, the RK2-based vector of the invention is characterized in that the T-DNA cassette module also comprises a cloning cassette; more preferably, the T-DNA cloning cassette comprises the selectable, screenable marker or reporter elements mentioned above. In a further preferred embodiment, the T-DNA cassette comprises restriction endonuclease and primer annealing sites; in a more preferred embodiment, these sites are compatible with high-throughput, Type IIS restriction endonuclease- and overlap-based assembly methods as mentioned above.

(66) In a further preferred embodiment, the replication origin of the RK2-based pLX vector of the invention comprises an RK2 replication origin comprising the RK2-oriV and -trfA regions, or a variant functionally equivalent thereof. In a more preferred embodiment the RK2 origin comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 106 or SEQ ID NO: 107, more preferably the RK2 origin comprises the SEQ ID NO: 106 or SEQ ID NO: 107, and more preferably the RK2 origin consists of SEQ ID NO: 106 or SEQ ID NO: 107.

(67) In another preferred embodiment, the selectable marker module of the RK2-based pLX binary vector comprises a selectable or a screenable marker gene mentioned above.

(68) In a more preferred embodiment, the selectable marker gene of the RK2-based pLX binary vector differs from the selectable marker gene of the pBBR1-based pLX vector, so as to facilitate simultaneous selection of both plasmids.

(69) In a more preferred embodiment, the RK2-based pLX vector is selected from the list consisting of: SEQ ID NO: 6 (pLX-R2), SEQ ID NO: 7 (pLX-R3), SEQ ID NO: 8 (pLX-R4), SEQ ID NO: 9 (pLX-Z4), SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 24.

(70) In another preferred embodiment, the backbone of the RK2-based pLX vector has no regions with >28 nucleotide identity to the pBBR1-based pLX vector of the present invention.

(71) Consequently, the binary vector system of the present invention comprises the pBBR1-based pLX plasmid and, preferably, the RK2-based pLX plasmid according to the present disclosure.

(72) Another aspect of the present invention relates to methods to assemble synthetic, genomic, metagenomic, and/or cDNA sequences of interest into the binary vector or the binary vector system disclosed in the present invention.

(73) Another aspect of the present invention is related to a host cell comprising the pBBR1-based pLX vector, the RK2-based pLX vector, or the binary vector system of the present invention.

(74) In accordance with the present invention, the term “host cell” refers to a cell which has been transformed, or is capable of being transformed, by an exogenous DNA sequence, preferably by the binary vector or the binary vector system of the present invention. A host cell can be used, for example, for expression of a nucleic acid of interest, propagation of plasmid vectors and/or delivery of a sequence of interest to eukaryotic cells.

(75) In a preferred embodiment, the host cell of the present invention is a bacterial cell, preferably selected from Agrobacterium sp. and E. coli cells. In a more preferred embodiment, the host cell is preferably of a species of the Rhizobiaceae family, more preferably is an Agrobacterium sp. bacterium, especially preferably an Agrobacterium strain that comprises a disarmed Ti plasmid.

(76) Alternatively, genome sequences of Agrobacterium sp. and other bacterial species can be compared. Genes that are missing in the latter bacteria and are important for delivery and transformation of T-DNA into eukaryotic cells may be individually picked from the Agrobacterium genome and inserted into the desired bacterial genome by any means, or expressed on a plasmid. Similarly, bacteria can be used to transform a eukaryotic organism or cell under a variety of test conditions, such as temperature, pH, nutrient additives and the like. The best conditions can be quickly determined and then tested to transform plant cells or other eukaryotic cells as mentioned above. Furthermore, host bacterial species may naturally interact in specific ways with a number of eukaryotic organisms, such as plants. These bacterial-plant interactions are very different from the way Agrobacterium naturally interacts with plants. Thus, tissues and cells that can be transformed by Agrobacterium sp. or by the use of other bacteria may be different.

(77) In general, plasmids are transferred through a direct transfer method to the bacteria (host cell) of this invention. By transferring either single or multiple binary vectors as described herein, transformation competent bacteria are generated. These bacteria can be used to transform a eukaryotic cell or organism, such as a yeast, a fungus, a plant, an insect or an animal.

(78) The term “eukaryotic cell” refers to either individual cells or cell aggregates (such as tissues or organs, parts of tissues or organs) and to entire organisms, comprising a yeast, a fungus, an alga, a plant, an insect or an animal.

(79) In a more preferred embodiment, the term “plant cell” refers to individual cells or cell aggregates, organized plant tissues, organs, or entire plants, such as and without limitation, protoplasts, calli, cell cultures, meristems and meristematic tissues, leaves, shoots, roots, flowers, ovules, pollen and pollen tubes, seeds, embryos, hypocotyls, cotyledons, seedlings and mature plants.

(80) Eukaryotic cells may be transformed within the context of this invention. Generally, eukaryotic cells to be transformed are cultured before transformation, or cells may be transformed in situ. In some embodiments, cells are cultured in the presence of additives to render them more susceptible to transformation. Transformants can be easily detected by their phenotypic changes, e.g., growth on a medium including drugs/herbicides/toxic compounds or lacking an essential growth component on which the untransformed cells cannot grow. In other embodiments, cells are transformed without prior culturing.

(81) Briefly, in an exemplary transformation protocol to generate transformed plants, plant cells are transformed by their co-cultivation with a culture of bacteria containing the binary vector or the binary vector system described herein. After co-cultivation for a few days, bacteria are removed, for example by washing and treatment with antibiotics, and plant cells are transferred to post-cultivation medium plates generally containing an antibiotic to inhibit or kill bacterial growth and optionally a selective agent, such as that described in U.S. Pat. No. 5,994,629. Plant cells are further incubated for several days. The expression of the transgene may be tested at this time. After further incubation for several weeks in selective medium, plant cells are transferred to regeneration medium and placed in the light. Shoots obtained are transferred to rooting medium and resulting plants are further propagated.

(82) Alternative methods to transform plant cells include dipping whole flowers into a suspension of bacteria, growing the plants further into seed formation, harvesting the seeds and germinating them in the presence of a selection agent that allows the growth of the transformed seedlings only. Alternatively, germinated seeds may be treated with a selection agent that only the transformed plants tolerate. Alternatively, seeds may be visually selected by detection of fluorescent proteins that only the transformed seeds accumulate.

(83) Cell transformation by Agrobacterium is independent of stable transgene integration into host genomes, and the use of transient expression systems or autonomously replicating RNA/DNA units (viral vectors) can bypass the need for gene integration, if desired. In this sense, the terms “infiltration” and “agro-infiltration” refer to a transient transformation method that relies on mechanical introduction of cultures of host cells comprising at least one binary vector, into eukaryotic organisms or their organs, preferably entire plants, seedlings or leaves. Scale-up is achieved, for example, through the use of vacuum infiltration. The term “agro-inoculation” refers to the delivery of viral vectors by Agrobacterium-mediated transient transformation.

(84) Plants that are especially desirable to transform include corn, rice, wheat, soybean, alfalfa and other leguminous plants, potato, tomato, tobacco, Nicotiana benthamiana, and so on.

(85) Another aspect of the present invention refers to a cell culture comprising the host cells of the present invention.

(86) Another aspect of the present invention relates to a method for delivering at least one nucleotide sequence of interest into at least one plant cell, comprising: (a) inserting the nucleotide sequence of interest into the T-DNA cassette of the pBBR1-based pLX vector, the RK2-based pLX vector, or the binary vector system of the present invention; (b) introducing the pBBR1-based pLX vector, the RK2-based pLX vector, or the binary vector system obtained in step (a) into at least one bacterial host cell according to the present invention; and (c) contacting the host cell of step (b) with a plant cell.

(87) In a preferred embodiment, the method for delivering at least one nucleotide sequence of interest into at least one plant cell is characterized in that the bacterial host cell is an Agrobacterium sp. cell, more preferably, the Agrobacterium cell comprises a disarmed Ti plasmid.

(88) In addition to the numerous technologies for transforming plants or plant cells, the type of cell, tissue, organ that is contacted with foreign constructs may vary as well. Almost all plant tissues may be transformed during dedifferentiation using appropriate techniques within the skill of the art. One skilled in the field of plant transformation will understand that multiple methodologies are available for the production of transformed plants, and that they may be modified and specialized to accommodate biological differences between various plant species. Regardless of the transformation technique employed, the nucleotide sequence of interest can be incorporated into the binary vector or the binary vector system of the present invention, and adapted to express the nucleotide sequence of interest in a plant cell by including in the vector a plant promoter. In addition to plant promoters, promoters from a variety of sources can be used to efficiently express foreign genes in plant cells. For example, promoters of bacterial origin, such as the octopine synthase promoter, nopaline synthase promoter, and mannopine synthase promoter; promoters of viral origin, such as the 35S and 19S promoters of CaMV, a promoter from sugarcane bacilliform virus, and the like may be used. Plant-derived promoters include, but are not limited to, the ribulose-1,5-bisphosphate carboxylase (RuBisCO) small subunit promoter, beta-conglycinin promoter, cruciferin promoter, phaseolin promoter, alcohol dehydrogenase promoter, heat-shock promoters, actin depolymerization factor promoter, and tissue-specific promoters. Promoters may also contain certain enhancer sequence elements that may improve the transcription efficiency. Typical enhancers include, but are not limited to, the alcohol dehydrogenase 1 (ADH1)-intron 1 and ADH1-intron 6. Constitutive promoters may be used. Constitutive promoters direct continuous gene expression in nearly all cell types and at nearly all times (e.g., the actin promoter, ubiquitin promoter, CaMV 35S promoter). Tissue-specific promoters are responsible for gene expression in specific cell, tissue, or organ types. Examples of other promoters that may be used include those that are active during a certain stage of the plant's development, or in specific plant tissues and organs. Examples of such promoters include, but are not limited to, promoters that are root-, pollen-, embryo-, corn silk-, cotton fiber-, seed endosperm-, and phloem-specific promoters. In a further embodiment, the promoter is an inducible promoter. An inducible promoter is “switched on” or increases expression of genes in response to a specific signal, such as physical stimuli (e.g., temperature, heat-shock gene promoters; light, the RuBisCO promoter); hormones (e.g., glucocorticoid); antibiotics (e.g., tetracycline); metabolites or chemical compounds (e.g., ethanol); and stresses (e.g., drought). Other desirable transcription and translation elements that function in plants also may be used, such as, for example, 5′ untranslated leader sequences, RNA transcription termination sequences and poly-adenylate addition signal sequences. Any additional element known in the art and functional in plants may be used.

(89) The biological transformation method described herein can be used to introduce one or more sequences of interest (transgene) into eukaryotic cells, wherein the eukaryotic cell is selected from the group consisting of a yeast cell, a fungal cell, a plant cell, an insect cell and an animal cell; preferably, the eukaryotic cell is a plant cell.

(90) Agrobacterium is an extremely advantageous agent for eukaryotic transformation; alternatively, the binary vector or the vector system disclosed in the present invention can be introduced into eukaryotic cells using any physical methods, such as particle or microprojectile bombardment, electroporation, or other forms of direct DNA uptake such as liposome mediated DNA uptake, or the vortexing method. In a preferred embodiment, physical methods for the transformation of plant cells are reviewed in Oard J. H., Biotech. Adv. 1991, 9, 1-11.

(91) The present invention furthermore relates to a transformed plant system, to a regenerated cell or a regenerated plant therefrom, to their progeny or seeds therefrom generated in accordance with the methods described hereinabove.

(92) In a particular embodiment of the present invention, this transformed plant system is characterized by single or multiple modifications of the plant cell genome, epigenome, transcriptome or metabolome, and in that it may or may not comprise any sequence segments of the abovementioned vector, vector system or of their T-DNA cassettes. In this sense, a component of the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) systems from bacteria and archaea can be used to target specific sequences in eukaryotic and in plant genomes (Murovec J., et al., Plant Biotechnol. J. 2017, doi:10.1111/pbi.12736). This document features a method for modifying the genomic material in a eukaryotic cell, preferably in a plant cell, based on the use of the binary vectors of the invention together with components of the CRISPR/Cas systems; the method provides a relatively simple, effective tool for generating modifications in genomic DNA at selected sites, with no need for transgene integration or maintenance in eukaryotic cell genomes. The CRISPR/Cas systems and their derivatives can be used for, without limitation, targeted mutagenesis, gene targeting, gene replacement, targeted deletion, targeted inversion, targeted translocation, and/or targeted insertion at single or multiple genome site(s). CRISPR/Cas system applications also include epigenetic and transcription regulation, cellular imaging and pathogen targeting. This technology can be used to accelerate the rate of functional genetic studies in eukaryotes, preferably in plants, and to engineer plants with improved characteristics, including enhanced nutritional quality, increased resistance to disease and stress, and heightened production of commercially valuable compounds.

(93) In another aspect, the present invention relates to a method for in vitro delivering at least one nucleotide sequence of interest into at least one eukaryotic cell or organism, comprising: (a) inserting at least one nucleotide sequence of interest into the binary vector or into the binary vector system of the invention; and (b) introducing the binary vector or the binary vector system, of step (a) into at least one eukaryotic cell or organism.

(94) In a preferred embodiment of the method for in vitro delivering at least one nucleotide sequence of interest into at least one eukaryotic cell or organism, the eukaryotic organism is selected from the group consisting of yeasts, fungi, insects and animals.

(95) Another aspect of the present invention relates to a method for transforming eukaryotic cells comprising the step of introducing into the eukaryotic cell the pBBR1-based pLX vector, the RK2-based pLX vector, the binary vector system or the host cell disclosed in the present invention.

(96) Another aspect the present invention relates to a method for obtaining a genetically-engineered plant cell or plant comprising the step of introducing into a plant cell the binary vector, preferably the pBBR1-based pLX vector or the RK2-based pLX vector, the binary vector system, or the bacterial host cell of the invention.

(97) In another aspect, the present invention relates to a genetically-engineered plant cell or plant obtainable by the methods disclosed above.

(98) Another aspect the present invention relates to a method for obtaining in vitro a genetically-engineered eukaryotic cell or organism, comprising the step of introducing into a eukaryotic cell or organism the binary vector, preferably the pBBR1-based or the RK2-based binary vectors, or the binary vector system described herein. In a preferred embodiment, the eukaryotic cell or organism is selected from the group consisting of a yeast, a fungal, an insect and an animal.

(99) In another aspect, the present invention relates to a genetically-engineered eukaryotic cell or organism obtainable by the methods disclosed above.

(100) Another aspect of the present invention relates to the use in vitro or ex vivo of the binary vector, preferably the pBBR1-based pLX binary vector, the RK2-based pLX binary vector, the binary vector system, the bacterial host cell, the culture cells, the genetically-engineered plant cell or plant obtainable by the methods disclosed above, or the genetically-engineered eukaryotic cell or organism obtainable by the methods disclosed above: (a) for site-specific gene knockout; (b) for site-specific genome editing; (c) for DNA sequence-specific interference; (d) for site-specific epigenome editing; (e) for site-specific transcription modulation; or (f) for multiplex genomic engineering; and provided that the use does not comprise a process for modifying the germ line genetic identity of human beings.

(101) In another aspect, the disclosure provides a kit comprising one or more of the components described herein. In some embodiments, the kit comprises the binary vector, the binary vector system, the host cell or the culture cell disclosed herein, and instructions for using the kit. The components or elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. By “kit” as used herein, it refers to a product containing the different reagents necessary to carry out the methods of the invention packaged, allowing transport and storage. Suitable materials for packaging kit components include glass, plastic (polyethylene, polypropylene, polycarbonate, and the like), bottles, vials, paper, envelopes, and the like. Additionally, kits invention may contain instructions for simultaneous, sequential or separate use of the different components found in the kit. Such instructions may be in the form of printed material or in the form of an electronic device capable of storing instructions so that they can be read by a subject, such as electronic storage media (magnetic disks, tapes and the like), optical media (CD-ROM, DVD) and the like. Additionally or alternatively, the media can contain Internet addresses that provide such instructions.

(102) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. Throughout the description and claims the word “comprise”, “include” and their variations are not intended to exclude other technical features, additives, components, or steps. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples, drawings and sequence listing are provided by way of illustration and are not intended to be limiting of the present invention.

EXAMPLES

(103) The following examples are offered to illustrate, but not to limit, the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.

(104) Materials and Methods

(105) DNA Constructs

(106) Unless otherwise indicated, standard molecular cloning methods were used (Sambrook J. & Russel D. W., Molecular cloning: a laboratory manual—3rd edition. Cold Spring Harbor Laboratory Press. 2001). DNA constructs were generated using chemically synthesized and available parts (Table 1). The Ugandan cassava brown streak virus isolate Ke_125 was obtained from DSMZ (PV-0912). Nucleic acids were purified using silica column-based purification kits. Alternatively, genomic DNA from plant samples was extracted following the procedure described by Edwards and collaborators (Edwards K., et al, Nucleic Acids Res. 1991, 19, 1349). PCR reactions were performed with Phusion High-Fidelity DNA polymerase (Fermentas or New England BioLabs), and DnpI-treated to remove plasmid templates, if required. The T-DNA synthetic cassettes T-DNA_1 (SEQ ID NO: 1), for the pLX-B-series and pLX-R series, and T-DNA_2 (SEQ ID NO: 2), for pLX-Z4, were obtained from GeneArt. Overlapping DNA fragments were gel purified and joined using homemade one-step isothermal (Gibson D. G., et al, Nat. Methods. 2009, 6, 343-345) or NEBuilder HiFi (New England BioLabs) DNA assembly master mixes. One-step digestion-ligation reactions were done using Type IIS restriction endonucleases (BsaI or BsmBI, New England BioLabs) and T4 DNA ligase (Promega), as described (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631).

(107) Complete details of the plasmids disclosed in the present invention are reported in Table 1.

(108) TABLE-US-00001 TABLE 1 Plasmid name Origin(s) Reference pSEVA431 pBBR1 http://seva.cnb.csic.es/ pSEVA631 pBBR1 http://seva.cnb.csic.es/ pSEVA221 RK2 http://seva.cnb.csic.es/ pSN.5-TagRFP-T pVS1 + ColE1 Pasin F., etal., Plant Methods. 2014, 10, 22 pSN.5-mTFP1 pVS1 + ColE1 Pasin F., etal., Plant Methods. 2014, 10, 22 pSN.5-mNeon pVS1 + ColE1 Pasin F., etal., Plant Methods. 2014, 10, 22 pGGF003 pUC Lannpropoulos A., et al, PLoS One. 2013, 8, e83043 pGGC011 pUC Lannpropoulos A., et al, PLoS One. 2013, 8, e83043 p35Tunos-vec01-NAT1 pUC Tourifio A., et al, Span. J. Agric. Res. 2008, 6, 48-58 pSN-PPV RK2 Pasin F., etal., PLoS Pathog. 2014, 10, e1003985 pSN-PPV-TagRFP-T2A RK2 Pasin F., etal., PLoS Pathog. 2014, 10, e1003985 pSN2-ccdB pVS1 + ColE1 Pasin F., etal., PLoS Pathog. 2014, 10, e1003985 GB0639 pVS1 + ColE1 Vazquez-Vilar M., etal., Plant Methods. 2016, 12, 1-12 GB1108 pVS1 + ColE1 Vazquez-Vilar M., etal., Plant Methods. 2016, 12, 1-12 GB1181 pVS1 + ColE1 Vazquez-Vilar M., etal., Plant Methods. 2016, 12, 1-12 GB0460 pSa + pUC Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631. pDGB3_alpha1 pVS1 + ColE1 Vazquez-Vilar M., et al, Nucleic Acids Res. 2017, 45, 2196-2209 pLX-B2 pBBR1 Present disclosure (SEQ ID NO: 3) pLX-B3 pBBR1 Present disclosure (SEQ ID NO: 4) pLX-B4 pBBR1 Present disclosure (SEQ ID NO: 5) pLX-R2 RK2 Present disclosure (SEQ ID NO: 6) pLX-R3 RK2 Present disclosure (SEQ ID NO: 7) pLX-R4 RK2 Present disclosure (SEQ ID NO: 8) pLX-Z4 RK2 Present disclosure (SEQ ID NO: 9) pLX-B2α2 pBBR1 Present disclosure (SEQ ID NO: 10) pLX-B3Ω1 pBBR1 Present disclosure (SEQ ID NO: 11) pLX-B3Ω2 pBBR1 Present disclosure (SEQ ID NO: 12) pLX-B2-TagRFP-T pBBR1 Present disclosure (SEQ ID NO: 13) pLX-B3-TagRFP-T pBBR1 Present disclosure (SEQ ID NO: 14) pLX-B4-TagRFP-T pBBR1 Present disclosure (SEQ ID NO: 15) pLX-R2-TagRFP-T RK2 Present disclosure (SEQ ID NO: 16) pLX-R3-TagRFP-T RK2 Present disclosure (SEQ ID NO: 17) pLX-R4-TagRFP-T RK2 Present disclosure (SEQ ID NO: 18) pLX-B2-XT1-XT2- pBBR1 Present disclosure hCas9 (SEQ ID NO: 19) pLX-B2-NptII-DsRED pBBR1 Present disclosure (SEQ ID NO: 20) pLX-PPV pBBR1 Present disclosure (SEQ ID NO: 21) pLX-UCBSV pBBR1 Present disclosure (SEQ ID NO: 22) pLX-B2-P.sub.CRC:mTFP1 pBBR1 Present disclosure (SEQ ID NO: 23) pLX-Z4-P.sub.mas:RFP-AlcR RK2 Present disclosure (SEQ ID NO: 24) pLX-B2-P.sub.EIOHNEON pBBR1 Present disclosure (SEQ ID NO: 25) pSN.5-P.sub.PAP85:RFP pVS1 + ColE1 Present disclosure (SEQ ID NO: 26) GB1686 pVS1 + ColE1 Present disclosure (SEQ ID NO: 27) pLX-TuMV pBBR1 Present disclosure (SEQ ID NO: 28)

(109) The details of the plasmid of the present invention are the following: pLX-B2 (SEQ ID NO: 3) is a T-DNA binary vector according to the present invention (pBBR1-based pLX vector) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) pBBR1 origin (SEQ ID NO: 105), amplified from pSEVA631 using the X198_F/X199_R primers (SEQ ID NO: 42/SEQ ID NO: 43); (ii) nptI gene, from pSEVA221 using X192_F/X193_R (SEQ ID NO: 36/SEQ ID NO: 37); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-B3 (SEQ ID NO: 4) is a T-DNA binary vector according to the present invention (pBBR1-based pLX vector) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) pBBR1 origin (SEQ ID NO: 105) amplified from pSEVA631 using the X198_F/X199_R primers (SEQ ID NO: 42/SEQ ID NO: 43); (ii) aadA gene, from pSEVA431 using X194_F/X195_R (SEQ ID NO: 38/SEQ ID NO: 39); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-B4 (SEQ ID NO: 5) is a T-DNA binary vector according to the present invention (pBBR1-based pLX vector) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) pBBR1 origin (SEQ ID NO: 105), amplified from pSEVA631 using the X198_F/X199_R primers (SEQ ID NO: 42/SEQ ID NO: 43); (ii) aacC1 gene, from pSEVA631 using X196_F/X197_R (SEQ ID NO: 40/SEQ ID NO: 41); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-R2 (SEQ ID NO: 6) is a T-DNA binary vector according to the present invention (RK2-based pLX vector) and comprises the replication origin from the RK2 plasmid (SEQ ID NO: 106). The following parts were joined by Gibson assembly: (i) RK2 origin (SEQ ID NO: 106), amplified from pSEVA221 using the X200_F/X201_R primers (SEQ ID NO: 44/SEQ ID NO: 45); (ii) nptI gene, from pSEVA221 using X192_F/X193_R (SEQ ID NO: 36/SEQ ID NO: 37); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-R3 (SEQ ID NO: 7) is a T-DNA binary vector according to the present invention (RK2-based pLX vector) and comprises the replication origin from the RK2 plasmid (SEQ ID NO: 106). The following parts were joined by Gibson assembly: (i) RK2 origin (SEQ ID NO: 106), amplified from pSEVA221 using the X200_F/X201_R primers (SEQ ID NO: 44/SEQ ID NO: 45); (ii) aadA gene, from pSEVA431 using X194_F/X195_R (SEQ ID NO: 38/SEQ ID NO: 39); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-R4 (SEQ ID NO: 8) is a T-DNA binary vector according to the present invention (RK2-based pLX vector) and comprises the replication origin from the RK2 plasmid (SEQ ID NO: 106). The following parts were joined by Gibson assembly: (i) RK2 origin (SEQ ID NO: 106), amplified from pSEVA221 using the X200_F/X201_R primers (SEQ ID NO: 44/SEQ ID NO: 45); (ii) aacC1 gene, from pSEVA631 using X196_F/X197_R (SEQ ID NO: 40/SEQ ID NO: 41); (iii) T-DNA_1 synthetic cassette (SEQ ID NO: 1). pLX-Z4 (SEQ ID NO: 9) is a T-DNA binary vector according to the present invention (pLX-R4 derivative with the T-DNA_2 cassette (SEQ ID NO: 2), and no BsmBI sites in RK2-trfA and aacC1 genes) and that comprises the replication origin from the RK2 plasmid (SEQ ID NO: 107). The following parts were joined by Gibson assembly: (i) aacC1_3′, amplified from pLX-R4 (SEQ ID NO: 8) using the X295_F/X296_R primers (SEQ ID NO: 73/SEQ ID NO: 74); (ii) aacC1_RK2, from pLX-R4 (SEQ ID NO: 8) using X297_F/X298_R (SEQ ID NO: 75/SEQ ID NO: 76); (iii) RK2_5′, from pLX-R4 (SEQ ID NO: 8) using X299_F/X300_R (SEQ ID NO: 77/SEQ ID NO: 78); (iv) T-DNA_2 synthetic cassette (SEQ ID NO: 2). pLX-B2α2 (SEQ ID NO: 10) is a pLX-B2 derivative with the GoldenBraid alpha2 cloning cassette (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B2 (SEQ ID NO: 3) using the X210_R/X321_F primers (SEQ ID NO: 46/SEQ ID NO: 89); (ii) lacZα cloning cassette, amplified using X322_F/X323_R (SEQ ID NO: 90/SEQ ID NO: 91). pLX-B3Ω1 (SEQ ID NO: 11) is a pLX-B3 derivative with the GoldenBraid omega1 cloning cassette (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B3 (SEQ ID NO: 4) using the X324_R/X325_F primers (SEQ ID NO: 92/SEQ ID NO: 93); (ii) lacZα cloning cassette, amplified using X326_F/X327_R (SEQ ID NO: 94/SEQ ID NO: 95). pLX-B302 (SEQ ID NO: 12) is a pLX-B3 derivative with the GoldenBraid omega2 cloning cassette (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631) and comprises the replication origin from the pBBR1 plasmid (SEQ ID NO: 105). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B3 (SEQ ID NO: 4) using the X324_R/X325_F primers (SEQ ID NO: 92/SEQ ID NO: 93); (ii) lacZα cloning cassette, amplified using X328_F/X329_R (SEQ ID NO: 96/SEQ ID NO: 34). pLX-B2-TagRFP-T (SEQ ID NO: 13) is a pLX-B2 derivative with the CaMV 35S promoter, TagRFP-T and nopaline synthase terminator transcription unit (P.sub.35S:RFP:T.sub.nos). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B2 (SEQ ID NO: 3) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-B3-TagRFP-T (SEQ ID NO: 14) is a pLX-B3 derivative with P.sub.35S:RFP:T.sub.nos. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B3 (SEQ ID NO: 4) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-B4-TagRFP-T (SEQ ID NO: 15) is a pLX-B4 derivative with P.sub.35S:RFP:T.sub.nos. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B4 (SEQ ID NO: 5) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-R2-TagRFP-T (SEQ ID NO: 16) is a pLX-R2 derivative with P.sub.35S:RFP:T.sub.nos. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-R2 (SEQ ID NO: 6) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-R3-TagRFP-T (SEQ ID NO: 17) is a pLX-R3 derivative with P.sub.35S:RFP:T.sub.nos. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-R3 (SEQ ID NO: 7) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-R4-TagRFP-T (SEQ ID NO: 18) is a pLX-R4 derivative with P.sub.35S:RFP:T.sub.nos. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-R4 (SEQ ID NO: 8) using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.35S:RFP:T.sub.nos, from pSN.5-TagRFP-T using X218_F/X219_R (SEQ ID NO: 51/SEQ ID NO: 52). pLX-B2-XT1-XT2-hCas9 (SEQ ID NO: 19) is a pLX-B2 derivative with the XT1 sgRNA, XT2 sgRNA, and hCas9 transcription units. Transcription units were transferred from the GB1108 vector to pLX-B2 performing a restriction-ligation reaction that included BsmBI (New England BioLabs) and T4 DNA ligase (Promega). The reaction mixture was subjected to 30 cycles of 7 min each (3 min at 37° C. and 4 min at 16° C.). Clones were selected onto kanamycin medium plates, and by restriction enzyme assays. pLX-B2-NptII-DsRED (SEQ ID NO: 20) is a pLX-B2 derivative with the P.sub.nos: NptII:T.sub.nos and P.sub.35S:DsRED:T.sub.35S transcription units. Transcription units were transferred from the GB0460 and GB1181 vectors to pLX-B2 performing a restriction-ligation reaction that included BsaI (New England BioLabs) and T4 DNA ligase (Promega). The reaction mixture was subjected to 30 cycles of 7 min each (3 min at 37° C. and 4 min at 16° C.). Clones were selected onto kanamycin medium plates, and by restriction enzyme assays. pLX-PPV (SEQ ID NO: 21) is a pLX-B2 derivative with a GFP-tagged plum pox virus cDNA clone cassette (P.sub.35S:PPV:T.sub.nos). ScaI/XbaI-digested pSN-PPV was mixed with ScaI/NheI-digested pLX-B2. The fragments were ligated using T4 DNA ligase (New England BioLabs). pLX-UCBSV (SEQ ID NO: 22) is a pLX-B2 derivative with a cDNA clone cassette of Ugandan cassava brown streak virus (P.sub.35S:UCBSV:T.sub.nos). Total RNA purified from plants infected with the UCBSV isolate Ke_125 (PV-0912, DSMZ) was used in a cDNA synthesis reaction. This included X122_R (SEQ ID NO: 32), X123_R (SEQ ID NO: 33), random primers and commercial kit components (High Capacity cDNA reverse transcription kit, Applied Biosystems). The cDNA sample was used in PCR reactions: (i) 5UTR-P3, using the X240_F/X241_R primers (SEQ ID NO: 59/SEQ ID NO: 60); (ii) P3-NIB, using X242_F/X243_R (SEQ ID NO: 61/SEQ ID NO: 62); (iii) NIB-3UTR, using X244_F/X245_R (SEQ ID NO: 63/SEQ ID NO: 64). The pLX-B2 backbone with P.sub.35S and T.sub.nos was amplified from pLX-PPV using X238_R/X239_F (SEQ ID NO: 57/SEQ ID NO: 58). The RT- and PCR fragments were joined by Gibson assembly. The sequence of the UCBSV cDNA clone was determined by Sanger sequencing using the 1989_F (SEQ ID NO: 29), X241_R (SEQ ID NO: 60), X244_F (SEQ ID NO: 63), X245_R (SEQ ID NO: 64), X253_R (SEQ ID NO: 65), X254_F (SEQ ID NO: 66), X255_R (SEQ ID NO: 67), X256_F (SEQ ID NO: 68), X257_F (SEQ ID NO: 69), X258_F (SEQ ID NO: 70), X259_R (SEQ ID NO: 71), X260_R (SEQ ID NO: 72) primers. pLX-B2-P.sub.CRC:mTFP1 (SEQ ID NO: 23) is a pLX-B2 derivative with a transcription unit (P.sub.CRC:mTFP1:T.sub.CRC) including an A. thaliana seed promoter of the cruciferin C gene (AT4G28520), a cyan fluorescent protein (mTFP1) and AT4G28520 terminator. The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B2 using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.CRC, from A. thaliana Col-0 genomic DNA using X220_F/X221_R (SEQ ID NO: 53/SEQ ID NO: 54); (iii) mTFP1, from pSN.5-mTFP1 using X212_F/X213_R (SEQ ID NO: 48/SEQ ID NO: 49); (iv) T.sub.CRC, from A. thaliana Col-0 genomic DNA using X222_F/X223_R (SEQ ID NO: 55/SEQ ID NO: 56). pLX-Z4-P.sub.mas:RFP-AlcR (SEQ ID NO: 24) is a pLX-Z4 derivative with the TagRFP-T, Thosea asigna virus 2A peptide (Donnelly M. L. L., et al., J. Gen. Virol. 2001, 82, 1027-1041), A. nidulans AlcR coding sequences flanked by the mannopine synthase promoter and terminator (P.sub.mas:RFP-2A-AlcR:T.sub.mas). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-Z4 using X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) P.sub.mas, from pGGF003 using X301_F/X302_R (SEQ ID NO: 79/SEQ ID NO: 80); (iii) RFP-2A, from pSN-PPV-TagRFP-T2A using X216_F/X303_R (SEQ ID NO: 50/SEQ ID NO: 81); (iv) AlcR_5′, from pGGC011 using X304_F/X305_R (SEQ ID NO: 82/SEQ ID NO: 83); (v) AlcR_3′, from pGGC011 using X306_F/X307_R (SEQ ID NO: 84/SEQ ID NO: 85); (vi) T.sub.mas, from pGGF003 using X308_F/X309_R (SEQ ID NO: 86/SEQ ID NO: 87). pLX-B2-P.sub.EtOH:NEON (SEQ ID NO: 25) is a pLX-B2 derivative with the mNeonGreen sequence under an ethanol-responsive synthetic promoter (P.sub.EtOH:NEON:T.sub.nos). The following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-B2 using the X210_R/X211_F primers (SEQ ID NO: 46/SEQ ID NO: 47); (ii) NEON:T.sub.nos, from pSN.5-mNeon using X310_F/X219_R (SEQ ID NO: 88/SEQ ID NO: 52); (iii) P.sub.EtOH synthetic fragment (SEQ ID NO: 35). pSN.5-P.sub.PAP85:RFP (SEQ ID NO: 26) is a pSN2-ccdB derivative with the A. thaliana AT3G22640 seed promoter, RFP and nopaline synthase terminator transcription unit (P.sub.PAP85:RFP:T.sub.nos). To generate the pSN.5-P.sub.PAP85:RFP vector the following parts were joined by Gibson assembly: (i) backbone, XbaI/PmII-digested pSN2-ccdB; (ii) P.sub.PAP85, from A. thaliana Col-0 genomic DNA using X228_F/X229_R (SEQ ID NO: 98/SEQ ID NO: 99); (iii) RFP:T.sub.nos, from pSN.5-TagRFP-T using X216_F/X80_R (SEQ ID NO: 50/SEQ ID NO: 97). GB1686 (SEQ ID NO: 27) is a pDGB3_alpha1 derivative with the P.sub.nos: NptII:T.sub.nos and P.sub.35S:DsRED:T.sub.35S transcription units. Transcription units were transferred from the GB0460 and GB1181 vectors to pDGB3_alpha1 performing a restriction-ligation reaction that included BsaI (New England BioLabs) and T4 DNA ligase (Promega). The reaction mixture was subjected to 30 cycles of 7 min each (3 min at 37° C. and 4 min at 16° C.). Clones were selected onto kanamycin medium plates, and by restriction enzyme assays. pLX-TuMV (SEQ ID NO: 28) is a pLX-B2 derivative with the P.sub.35S:TuMV:T.sub.nos cassette from p35Tunos-vec01-NAT1. To generate the pLX-TuMV vector the following parts were joined by Gibson assembly: (i) backbone, amplified from pLX-PPV using X333_R/X334_F primers (SEQ ID NO: 100/SEQ ID NO: 101); (ii) XmaI/SalI-digested p35Tunos-vec01-NAT1.

(110) The primers were synthesized by Sigma-Aldrich, and their sequences are listed in Table 2.

(111) TABLE-US-00002 TABLE 2 Table 2. List of the primers, and assembly linkers ID Sequence SEQ ID NO: 1989_F GATTGATGTGATTTCTCCACTGACG  29 2050_F GCCATTGTCCGAAATCTCACG  30 2051_R CTGGAAATGCGATTCTCTTAGC  31 X122_R CGTCAATCGTTAGAGC  32 X123_R CGACCTTGCACTTCA  33 X329_R CGCATCCTTGTCCGGTCTCCAGCGAGAGACGTCACTCATTAG  34 X192_F CGACTTGCGACATGCGGTCCTTTGCAATCAACTATTAGAAAAATTCATCC  36 X193_R AACCGCATAACCGCCAATCCGATCTTGTGTCTCAAAATCTCTGATGTTAC  37 X194_F CGACTTGCGACATGCGGTCCTTTGTTATTTGCCGACTACCTTGGTGA  38 X195_R AACCGCATAACCGCCAATCCGATCGAACCTTGACCGAACGCAGC  39 X196_F CGACTTGCGACATGCGGTCCTTTGCAATTTACCCAACAACTCCGC  40 X197_R AACCGCATAACCGCCAATCCGATCTTGACATAAGCCTGTTCGGTTC  41 X198_F GATCGGATTGGCGGTTATGCGGTTCTACCGGCGCGGCAG  42 X199_R GGAAGACCACCGAACTGATGATGGCCCCCTACGGGCTTGCTCTC  43 X200_F GATCGGATTGGCGGTTATGCGGTTGCGATGCAGGTGGCTGCTGA  44 X201_R GGAAGACCACCGAACTGATGATGGGTAGAAAAGATCAAAGGATCTTCTTG  45 X210_R TGAGACGGTTTCGACCAGG  46 X211_F GTCAGGAGACGGGACAAGGA  47 X212_F ATGGTTTCTAAAGGTGAAGAGAC  48 X213_R TTATGCTCCTTTATCGTCGTC  49 X216_F ATGGTTTCAAAGGGAGAAGAG  50 X218_F GTAGCCTGGTCGAAACCGTCTCACCAGTACGCACGATTCAAGG  51 X219_R CGCATCCTTGTCCCGTCTCCTGACGAGATCGAGTAACATAGATGACACC  52 X220_F GTAGCCTGGTCGAAACCGTCTCATAACGAACGCTCATGCTAAG  53 X221_R TTGTAGTCTCTTCACCTTTAGAAACCATTTTCTTTTTGTTTGTTGTGAG  54 X222_F GGATGACGACGATAAAGGAGCATAATGCACTGGAGGTCAAGGAAG  55 X223_R CGCATCCTTGTCCCGTCTCCTGACATAGCTCGATAGAATCATTTGCT  56 X238_R GTCATATTTATTTTTCCTCTCCAAATGAAATGAACTTCC  57 X239_F GAAATACACCTTATAAAAGTACAAAAAAAAAAAAAAAAAAAAAAAAATGC  58 X240_F GTTCATTTCATTTGGAGAGGAAAAATAAATATGACATAAGAATACATAA  59 X241_R CTCTTCCTTTCGACCTTGCACTTCA  60 X242_F TTGAAGTGCAAGGTCGAAAGGAAGAG  61 X243_R AAAGAAGTATCAAACCTACTACCATCACAATC  62 X244_F GATTGTGATGGTAGTAGGTTTGATACTTCTT  63 X245_R TTTTTTTTTTTTTGTACTTTTATAAGGTGTATTTCTACACCAAACAAAAGGATATGG  64 X253_R CTTTCGTAACAGCTTGCTTTCTCA  65 X254_F CTTTGGTTTAGACAAGCAATGTGTG  66 X255_R CCACTATTATTTCCACGATGCTTC  67 X256_F CAGAGGTGAAGTCTATTCTTGGCAT  68 X257_F AGTTTGGTGGAGTTTTGGATAGC  69 X258_F ATACACACGCTTGAGATAATGGATG  70 X259_R ATCGCCACTGATACAATTCAAAAG  71 X260_R AGGACCAAAATTCTCATAAGTCTCTCT  72 X295_F CAATTTACCCAACAACTCCGC  73 X296_R TGAGTTCGGCGATGTAGCCACCT  74 X297_F GGTGGCTACATCGCCGAACTCA  75 X298_R CGTTCGCGTCGGCTAGAACAGGAG  76 X299_F TGTTCTAGCCGACGCGAACGCT  77 X300_R GTAGAAAAGATCAAAGGATCTTCTTG  78 X301_F GTAGCCTGGTCGAAACCGTCTCATTTTTCAAATCAGTGCGCAAGA  79 X302_R CAGCTCTTCTCCCTTTGAAACCATTGTTGTTACCCGATTTGGTG  80 X303_R TGGCCCTGGATTTTCCTCAA  81 X304_F TTGAGGAAAATCCAGGGCCAATGGCAGATACACGCCGAC  82 X305_R TCCAGCACAGATTGCGTGAGAGAA  83 X306_F CTCTCACGCAATCTGTGCTGGATG  84 X307_R AGCTACAAGAAGCTGTCAACTTTCCCA  85 X308_F GGAAAGTTGACAGCTTCTTGTAGCTCTTGGACTCCCATGTTGG  86 X309_R GCATCCTTGTCCCGTCTCCTGACGATAATTTATTTGAAAATTCATAAG  87 X310_F CAACATTACAATTACTATTTACAATTACAATGGTGAGCAAGGGAGAGGAG  88 X321_F GAGACGGGACAAGGATGCG  89 X322_F CCTGGTCGAAACCGTCTCAGTCAGGAGAGAGACCAAAAGCAAAAAC  90 X323_R CGCATCCTTGTCCCGTCTCCAGCGAGAGACCTCACTCATTAG  91 X324_R TGAGACCGTTTCGACCAGG  92 X325_F GAGACCGGACAAGGATGCG  93 X326_F CCTGGTCGAAACGGTCTCAGGAGAGAGACGAAAAGCAAAAAC  94 X327_R CGCATCCTTGTCCGGTCTCCTGACAGCGAGAGACGTCACTCATTAG  95 X328_F CCTGGTCGAAACGGTCTCAGTCAGGAGAGAGACGAAAAGCAAAAAC  96 X80_R CTCAATGCTGCTGCCTTCATCTGGATATGAGCTTCAC  97 X228_F CCTCGAGTACGTAGGATCCATTTAAATTCCTTCAAGAGAGCAAACCATT  98 X229_R ATCAGCTCTTCTCCCTTTGAAACCATTTTTTCTTGTTGTTTTGTTG  99 X333_R CGTGTCGTGCTCCACCATGTTCACGAAGATT 100 X334_F AAAAAAAAAAATCGGTTCCCCCTAGAGCAGATCGTTCAAACATTTGGCA 101 Linker_1 CCATCATCAGTTCGGTGGTCTTCC 112 Linker_2 CGACTTGCGACATGCGGTCCTTTG 113 Linker_3 GATCGGATTGGCGGTTATGCGGTT 114

(112) Bacterial Growth Conditions

(113) The E. coli DH10B strain was used for cloning and plasmid propagation. To increase plasmid miniprep yields, 10 mL cultures were grown in 50 mL tubes at 30 or 37° C. Overnight cultures were pelleted by centrifugation and processed using commercial minicolumn kits (FavorPrep Plasmid Extraction Mini Kit, Favorgen; Wizard Plus SV Minipreps, Promega). Double volumes of resuspension (50 mM Tris-HCl pH 7.5, 10 mM EDTA, 100 μg/mL RNase A), lysis (0.2 M NaOH, 1% SDS) and neutralization (4.09 M guanidine hydrochloride, 0.759 M potassium acetate, 2.12 M glacial acetic acid) kit solutions were used to improve clearing of bacterial lysates and final plasmid yields. Bacteria were grown in Luria-Bertani medium and antibiotics used at final concentrations of 100 mg/L ampicillin, 15 mg/L chloramphenicol, 20 mg/L gentamicin, 50 mg/L kanamycin, 50 mg/L rifampicin, 100 mg/L spectinomycin, 100 mg/L streptomycin, and 10 mg/L tetracycline. Growth curves were measured in 96-well plates, by recording OD600 absorbance values at 10-minute intervals in a plate reader (Infinite M200, Tecan). Maintenance of pTi in the A. tumefaciens C58C1-313 strain was evaluated by PCR amplification of a repB fragment using the 2050_F/2051_R primers (SEQ ID NO: 30/SEQ ID NO: 31).

(114) Plant Transformation and Agro-Inoculation

(115) The T-DNA binary vectors (See Table 1) were transformed into A. tumefaciens cells by the freeze-thawing or electroporation methods. In transient expression and agro-inoculation assays, A. tumefaciens suspensions were mechanically infiltrated into N. benthamiana and A. thaliana leaves as described (Pasin F., et al., Plant Methods. 2014, 10, 22). The floral dip method was used to stably transform germ line cells of A. thaliana (Clough S. J. & Bent A. F., Plant J. 1998, 16, 735-743). Stable transformation of N. benthamiana leaf disks was carried as described (Horsch R. B. & Klee H. J., Proc. Natl. Acad. Sci. USA 1986, 83, 4428-4432).

(116) Protein Detection

(117) Plant samples that express fluorescent proteins were visualized under an epifluorescence stereoscope, confocal microscope, or imaged in a laser scanner (Pasin F., et al., Plant Methods. 2014, 10, 22). Fluorescence was measured by placing leaf discs in 96-well flat-bottom plates; in kinetics studies, plates were sealed with optical adhesive films (4311971, Applied Biosystems). The fluorescence signal was acquired in filter-based (VICTOR X5, PerkinElmer) or monochromator-based plate readers (Infinite M200, Tecan), as reported (Pasin F., et al., Plant Methods. 2014, 10, 22). Total protein extracts were resolved by SDS-PAGE, and immunodetection was done using rabbit anti-tRFP (AB234, Evrogen), anti-UCBSV CP (AS-0912, DSMZ), anti-PPV CP and anti-TuMV CP sera as the primary antibodies. For the electron microscopy, plant extracts were incubated with collodion-coated carbon-stabilized copper grids, which were negative stained with 2% uranyl acetate. Grids were observed in a transmission electron microscope (JEM 1011, Jeol).

(118) Targeted Genome Mutagenesis

(119) The CRISPR/Cas constructs were transiently expressed in N. benthamiana leaves. To estimate the mutagenesis efficiency, PCR/restriction enzyme assays were done as described (Vazquez-Vilar M., et al., Plant Methods. 2016, 12, 1-12). Briefly, genomic DNA was purified from infiltrated leave samples and used in PCR reactions to amplify DNA fragments spanning the sites targeted by the CRISPR/Cas constructs. The resulting PCR products were purified, and used in DNA digestion reactions that included restriction enzymes whose target sequences overlap predicted editing sites. Intensities of cleaved and cleavage-resistant bands were estimated using the ImageJ software (https://imagej.nih.gov/ij/).

Example 1. Construction of T-DNA Binary Vectors by Assembly of Modular Parts, and Cloning Features of a pBBR1-Based pLX Vector

(120) In the design of new T-DNA binary vectors, the inventors chose basic principles: (a) reduced size; (b) stability; (c) a broad-host-range replication origin for maintenance in E. coli and A. tumefaciens; (d) an origin compatible with the most commonly used T-DNA binary vectors; (e) consistency with current standards for plant synthetic biology; and (f) the possibility to adopt overlap-dependent cloning methods for construct assembly.

(121) Therefore, to construct the pLX binary vectors of the present invention, modular parts were assembled by overlap-based cloning methods. Sequences of synthetic orthogonal overlapping junctions known as assembly linker were designed to allow combinatorial assembly of DNA modules (Table 2). Module 1, 2, and 3 refer to the T-DNA cassette, the pBBR1 origin and a selectable marker (resistance (R) genes such as nptI, aadA, and aacC1), respectively (FIG. 1). Each module includes one or several DNA parts, which are flanked by two diverse assembly linkers that are shown as diamonds in FIG. 1. Parts from the three modules were obtained by PCR or chemical synthesis, and were joined by one-step isothermal DNA assembly to generate the pLX-B2 (SEQ ID NO: 3), pLX-B3 (SEQ ID NO: 4) and pLX-B4 (SEQ ID NO: 5) binary vectors (FIG. 1, Table 3). Details for the generation of the pLX-B2, pLX-B3 and pLX-B4 plasmid are disclosed above.

(122) TABLE-US-00003 TABLE 3 Binary T-DNA vectors of the present invention Cloning features.sup.§ Size Bacterial Golden Golden Gibson Vector bp Origin T-DNA* selection Cassette Gate Braid assembly Multiplexing pLX-B2 3287 pBBR1 octopine KAN alpha1 .square-solid. .square-solid. .square-solid. .square-solid. pLX-B3 3349 pBBR1 octopine SP alpha1 .square-solid. — .square-solid. n.t. pLX-B4 3165 pBBR1 octopine GENT alpha1 .square-solid. — .square-solid. n.t. pLX-B2α2 3287 pBBR1 octopine KAN a1pha2 .square-solid. .square-solid. .square-solid. n.t. pLX-B3Ω1 3349 pBBR1 octopine SP omega1 — .square-solid. .square-solid. n.t. pLX-B3Ω2 3349 pBBR1 octopine SP omega2 — .square-solid. .square-solid. n.t. pLX-Z4 3740 RK2 succinamopine GENT alpha1 .square-solid. — .square-solid. .square-solid. *pTi type of right and left border source, all vectors include a second left border of the nopaline type; .sup.§cloning cassette nomenclature according to GoldenBraid standards (Sarrion-Perdigones A., et al.. Plant Physiol. 2013, 162, 1618-1631): solid square, suitable; open square, not suitable; n.t., not tested.

(123) The pLX binary vectors of the present invention facilitate flexible experimental designs since their replication is autonomous in both E. coli and A. tumefaciens. Additional features of the pLX binary vectors include diverse selectable markers, a T-DNA with borders from an octopine-type pTi and a second left border sequence that was shown to reduce the backbone transfer (FIG. 2A). Bacterial synthetic terminators based on different scaffolds (T1, SEQ ID NO: 108; and T2, SEQ ID NO: 109) were included to increase plasmid stability.

(124) For cloning purposes, the T-DNA cassette hosts the E. coli lacZα reporter gene flanked by Type IIS restriction endonuclease sites (FIG. 2B). Sequences of BsaI- or BsmBI-produced overhangs comply with the syntax proposed for plant synthetic biology; the pLX vectors are thus suitable for assembly of single and multiple eukaryotic transcription units from libraries of standard DNA parts. Parts or transcription units can be assembled from plasmid libraries into the pLX vectors using the BsaI-based Golden Gate, and GoldenBraid standards (FIG. 2C). The T-DNA cassette hosts divergent primer annealing regions with no sequence similarity and secondary structures (arrows, FIG. 2B). These allow linearization of the small pLX backbones by inverse PCR, and subsequent use in the cloning of multiple overlapping fragments by Gibson assembly (FIG. 2C). The pLX vectors with compatible replicons can be multiplexed into Agrobacterium cells for multiple T-DNA delivery (Multiplexing; FIG. 2C). Therefore, the binary vectors of the present invention comprise features that make them compatible with Type IIS restriction endonuclease- and overlap-based assembly methods, and with the delivery of multiple T-DNA cassettes by the multiplexing of binary vectors with compatible origins (Table 3).

Example 2. Transgene Expression in Plants Using the pLX Vector Series

(125) To demonstrate that the binary vectors of the present invention can be used to deliver DNA constructs to eukaryotic cells, specifically to plant cells by Agrobacterium tumefaciens-mediated transformation, a transcription unit (P.sub.35S:RFP:T.sub.nos) that comprises sequences of the cauliflower mosaic virus 35S promoter, the red fluorescent protein (RFP, as a reporter; FIG. 3A), and the nopaline synthase terminator was assembled into the pLX vectors of the present invention to obtain pLX-B2-TagRFP-T (SEQ ID NO: 13), pLX-B3-TagRFP-T (SEQ ID NO: 14) and pLX-B4-TagRFP-T (SEQ ID NO: 15)(FIG. 3A). Details for the generation of the vectors are disclosed above. Transient expression of RFP in Nicotiana benthamiana leaves was evaluated by A. tumefaciens-mediated delivery. At 6 dpa, leaves infiltrated with pLX-B2-TagRFP-T (SEQ ID NO: 13), pLX-B3-TagRFP-T (SEQ ID NO: 14) and pLX-B4-TagRFP-T (SEQ ID NO: 15) showed bright RFP fluorescence, which was absent in the control sample (FIG. 3B). Consistent with genuine plant expression, confocal images showed that the RFP fluorescent protein signal distributes in the cytosol and nucleoplasm of plant cells (FIG. 3C). The RFP accumulation in leaf samples was confirmed by immunoblot analysis of total protein extracts (FIG. 3D).

(126) For some applications, stable integration of T-DNA cassettes into eukaryotic cell genomes is desirable. To prove the suitability of the pLX vectors to mediate stable transgene integration into plant genomes, the inventors used Arabidopsis thaliana as a model plant and the pLX-B2-P.sub.CRC:mTFP1 vector (SEQ ID NO: 23) (FIG. 4A). Details for its synthesis are disclosed above.

(127) The construct was inserted in A. tumefaciens and transformed into plants by floral dipping. Consistent with mTFP1 expression, bright cyan fluorescence was detectable in seed collected from the Agrobacterium-treated plants (T.sub.1 seeds). The mTFP1-expressing seeds were selected under an epifluorescence stereoscope, and sown to soil. The stable transgene integration in germ-line cells was confirmed by PCR analysis of the Ti plants: the promoter of the endogenous cruciferin C gene was amplified (P.sub.CRC) from transformed and untransformed plants, whereas the mTFP1 sequence could be amplified only from plants derived from the cyan fluorescent seeds. Diverse fluorescence phenotypes of the T2 seeds were consistent with the transgene integration into the plant genome and its segregation across generations (FIG. 4B).

(128) The present invention shows that T-DNA cassettes from the pLX vectors can be delivered to plants, and the pLX vectors can be used to transiently express or stably integrate transgenes into eukaryotic cell genomes. The inventors generated transgenic plants that are “marker-free”, since they do not include genes that confer resistance to antibiotics, herbicides, or other chemical compounds used in transgenic plant selection.

Example 3. Stable Maintenance of T-DNA Cassettes in the pLX Binary Plasmid Series of the Invention

(129) cDNA copies of RNA virus genomes can be inserted into plasmids to generate viral infectious clones; these often show instability problems and sequence deletions that arise during the clone propagation in bacteria. To test the stability of the pLX binary vectors of the present invention in challenging conditions, the inventors transferred the entire cDNA sequence of potyvirus genomes into a pLX vector. The vectors generated were propagated in Escherichia coli, and the bacteria were subjected to several growth cycles. Vector stability was evaluated by restriction enzyme digestion assays.

(130) The whole cDNA sequence of an RNA virus was obtained from a pBIN19-based vector, pSN-PPV (Pasin F., et al, PLoS Pathog. 2014, 10, e1003985), which contains the cauliflower mosaic virus 35S promoter, a cDNA copy of the plum pox virus (PPV) genome and the nopaline synthase terminator (P.sub.35S:PPV:T.sub.nos) sequences. As disclosed above, the inventors generated pLX-PPV (SEQ ID NO: 21), a pLX-B2 derivative with the P.sub.35S:PPV:T.sub.nos cassette from pSN-PPV (FIG. 5A). The pLX-PPV vector obtained (SEQ ID NO: 21) has the pBBR1 origin (SEQ ID NO: 105), and is 38% and 9.3 kb smaller than pSN-PPV. Purified plasmids from two independent clones of pLX-PPV (In, # A and # B) were EcoRI digested and resolved by agarose gel (FIG. 5B). Compared to the pSN-PPV digestion profile, pLX-PPV clones showed all the bands corresponding to the viral cDNA cassette of pSN-PPV. High molecular weight DNA bands were consistent with differences in the pSN-PPV and pLX-PPV backbones, pBIN19 and pLX-B2, respectively. The new pLX-PPV # A and # B clones (pLX-PPV, In) were transformed in E. coli cells to evaluate the plasmid stability. For each transformation, eight individual colonies were picked and subjected to six growth cycles (24 h, 37° C.). Purified plasmids were digested with EcoRI and resolved by agarose gel electrophoresis (pLX-PPV, Out; FIG. 5B). The pLX-PPV plasmid showed no instability, since digestion profiles of the input and output plasmids were identical.

(131) To further confirm the results, the entire cDNA sequence from a different RNA virus was obtained from a pUC-based vector, p35Tunos-vec01-NAT1, which contains the cauliflower mosaic virus 35S promoter, a cDNA copy of the turnip mosaic virus (TuMV) genome and the nopaline synthase terminator (P.sub.35S:TuMV:T.sub.nos) sequences (Touriño A., et al, Span. J. Agric. Res. 2008, 6, 48-58). The p35Tunos-vec01-NAT1 vector cannot replicate in A. tumefaciens, and does not include T-DNA borders for its transformation to plants. The inventors generated pLX-TuMV (SEQ ID NO: 28), a pLX-B2 derivative with the P.sub.35S:TuMV:T.sub.nos cassette from p35Tunos-vec01-NAT1 (FIG. 5C). The pLX-TuMV vector (SEQ ID NO: 28) obtained as disclosed above, is only slightly larger (3%, and 0.4 kb) than p35Tunos-vec01-NAT1, but includes the pBBR1 origin (SEQ ID NO: 105) and T-DNA borders suitable for its delivery to plants by Agrobacterium-mediated transformation. The new pLX-TuMV vector (SEQ ID NO: 28) (pLX-TuMV, In) was transformed in E. coli cells to evaluate the plasmid stability. For each transformation, ten individual colonies were picked and subjected to six growth cycles (24 h, 37° C.). Purified plasmids were digested with EcoRI and resolved by agarose gel electrophoresis (pLX-TuMV, Out; FIG. 5D). In agreement with the pLX-PPV results, the newly generated pLX-TuMV plasmid showed no instability, since digestion profiles of the input and output plasmids were identical.

(132) The present example shows that pLX vectors of the present invention can host >10 kb T-DNA cassettes, and that they can be used to generate clones that contain viral genome sequences. cDNA copies of RNA virus genomes have been reported to cause plasmid instability and loss of partial or entire insert sequences. In contrast, the pLX vectors that host cDNA genome copies of plant RNA viruses showed no instability when propagated in the bacterium E. coli.

Example 4. Viral Agro-Inoculation and Delivery of Exogenous Sequences to Plants Using pLX-Based Viral Vectors

(133) The pLX-PPV (SEQ ID NO: 21) and pLX-TuMV (SEQ ID NO: 28) binary vectors from Example 3, if properly expressed in plants, would initiate an infection of a chimeric PPV or TuMV, respectively. These chimeric viruses would host in their genome the GFP coding sequence (FIG. 6A, 6E), and GFP fluorescence could be measured and visualized to confirm exogenous sequence expression in plants by viral expression vectors.

(134) An A. tumefaciens strain hosting pLX-PPV (pLX) (SEQ ID NO: 21) was infiltrated to N. benthamiana plants; a pSN-PPV strain (pSN) (Pasin F., et al., PLoS Pathog. 2014, 10, e1003985) was used as a positive control. The PPV infection and viral accumulation were confirmed by coat protein immunoblot analyses of samples from the agro-infiltrated and upper uninoculated leaves (6 dpa and 14 dpa, respectively; FIG. 6B). The accumulation of recombinant GFP in infected plant samples was confirmed by measuring the fluorescence intensity (FIG. 6C), and by imaging of upper uninoculated leaves (FIG. 6D). To further confirm the results, an A. tumefaciens strain hosting pLX-TuMV (SEQ ID NO: 28) was agro-inoculated to A. thaliana plants. In agreement with the pLX-PPV results, the TuMV infection and viral accumulation in upper uninoculated leaf samples were confirmed by immunoblot analysis of the TuMV coat protein (FIG. 6F). Bright green fluorescence signal was detectable in inoculated plants (FIG. 6G), confirming the accumulation of recombinant GFP.

(135) Therefore, the present example shows that the pLX binary vectors of the present invention can be used to engineer viral infectious clones and viral vectors. These can be delivered by agro-inoculation, and used to introduce exogenous sequences and express recombinant proteins into plants.

Example 5. Assembly of Transcription Units into the pLX Vectors of the Invention Using Plant Synthetic Biology Standards

(136) To demonstrate pLX vector compatibility with plant synthetic biology standards, DNA parts from public libraries were assembled into the pLX binary vectors of the present invention.

(137) The GB1181 and GB0460 plasmids that contain standardized units for plant delivery of the kanamycin resistance (NptII) and red fluorescent protein (DsRED) genes, respectively, were obtained from a public repository (https://gbcloning.upv.es/). As disclosed above, the inventors assembled the standardized units into the pLX-B2 vector (SEQ ID NO: 3) to generate pLX-B2-NptII-DsRED (SEQ ID NO: 20) (FIG. 7A). The pLX-B2-NptII-DsRED vector (SEQ ID NO: 20) obtained is a pLX-B2 derivative with the pBBR1 origin (SEQ ID NO: 105) and two transcription units for plant expression of NptII and DsRED.

(138) To further confirm the results, the inventors transferred the GB1108 (https://gbcloning.upv.es/) standardized units into the pLX-B2 vector (SEQ I NO: 3) to generate pLX-B2-XT1-XT2-hCas9 (SEQ ID NO: 19) (FIG. 7B). The pLX-B2-XT1-XT2-hCas9 vector (SEQ ID NO: 19) obtained is a pLX-B2 derivative with the pBBR1 origin (SEQ ID NO: 105) and four transcription units for plant expression of NptII, a human codon-optimized Streptococcus pyogenes Cas9 gene (hCas9), and single-guide RNA targeting the N. benthamiana Niben101Scf04205Ctg025 (XT1) and Niben101Scf04551Ctg021 (XT2) endogenous genes. Details for the generation of pLX-B2-XT1-XT2-hCas9 vector are disclosed above. To improve flexibility of the binary vectors of the present invention and facilitate the reuse of assembled DNA parts, the inventors generated the pLX-B2α2 (SEQ ID NO: 10), pLX-B3Ω1 (SEQ ID NO: 11) and pLX-B302 vectors (SEQ ID NO: 12) including the GoldenBraid cloning cassettes (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631) (FIG. 7C, Table 3). The pLX-B2α2 (SEQ ID NO: 10) vector is a pLX-B2 derivative with the alpha2 cloning cassette; pLX-B3Ω1 (SEQ ID NO: 11) is a pLX-B3 derivative with the omega1 cloning cassette; and pLX-B302 (SEQ ID NO: 12) is a pLX-B3 derivative with the omega2 cloning cassette; details for their generation are disclosed above. The pLX-B2α2, pLX-B3Ω1 and pLX-B302 vectors include the replication origin from the pBBR1 plasmid (SEQ ID NO: 105) and, together with the pLX-B2 plasmid of the present invention, comprise a minimal set of two alpha and two omega level cloning cassettes with convergent and divergent BsaI and BsmBI sites (Table 3). Following the GoldenBraid standards (Sarrion-Perdigones A., et al, Plant Physiol. 2013, 162, 1618-1631), these cloning cassettes allow reuse of assembled parts and building of large multigenic constructs.

(139) Therefore, based on the pLX binary vectors described in the present invention, the inventors generated the pLX-B2α2 (SEQ ID NO: 10), pLX-B3Ω1 (SEQ ID NO: 11) and pLX-B302 (SEQ ID NO: 12) vectors (Table 3) that include cloning cassettes facilitating combinatorial assembly of pre-made DNA elements and transcription units into multigene constructs.

Example 6. Direct Cloning and Assembly of Large T-DNA Constructs into the pLX Vector Series without Intermediate Plasmids

(140) This example demonstrates that the pLX binary vectors of the present invention can be used to assemble large T-DNA constructs with no intermediate subcloning steps.

(141) The inventors sought to use the vectors of the present invention to generate an infectious clone of the Ugandan cassava brown streak virus (UCBSV), a plant virus, since: (a) the UCBSV genome is a large RNA molecule of 9.1 kb; (b) a cDNA copy of UCBSV genome is not available in public parts libraries; (c) the cDNA copy of UCBSV genome would contain several Type IIS restriction endonuclease sites, whose removal is required for parts domestication and Golden Gate/GoldenBraid cloning; (d) mutagenesis of the UCBSV genome sequence (e.g., to remove BsaI/BsmBI sites) is not desirable, as its effects on virus viability are unknown; (e) correct assembly of the UCBSV genome into a pLX vector can be easily evaluated in plants; (f) UCBSV is a major threat to the staple food crop cassava, and an UCBSV infectious clone would have commercial applications as it facilitates screens for plant genetic resistance.

(142) The inventors generated the pLX-UCBSV vector (SEQ ID NO: 22), a pLX-B2 derivative with a Ugandan cassava brown streak virus cDNA clone cassette (P.sub.35S:UCBSV:T.sub.nos), by one-step assembly of three RT-PCR fragments that spanned the entire 9.1-kb UCBSV genome (FIG. 8A). Details for the generation of the pLX-UCBSV vector are disclosed above.

(143) An A. tumefaciens strain that contains pLX-UCBSV (SEQ ID NO: 22) was infiltrated to N. benthamiana plants. At 12 dpa, the agro-inoculated plants showed reduced height (FIG. 8B). In upper uninoculated leaves, the inventors detected filamentous particles typical of potyvirid virions (FIG. 8C), and confirmed accumulation of the UCBSV coat protein by immunoblot analysis (FIG. 8D). These results demonstrated that a cDNA copy of UCBSV was assembled into a pLX vectors to obtain pLX-UCBSV (SEQ ID NO: 22), which is an infectious clone of UCBSV that can be delivered to plants by Agrobacterium-mediated inoculation.

(144) Thus, the inventors assembled large T-DNA constructs into the pLX binary vectors of the present invention and this assembly did not require the use of restriction enzymes, parts domestication, intermediate plasmids and subcloning steps.

Example 7. Comparison of a pBBR1-Based pLX Vector of the Present Invention Versus RK2 and pVS1 Binary Vectors

(145) Briefly, vectors that use the replicon from the RK2 plasmid include pBIN19, and its smaller derivatives pEAQ and pCB301 (FIG. 9). Due to its reduced size, pCB301 is classified as a mini binary vector. The pVS1 origin is used in the pPZP series, and its derivatives of the pCAMBIA and pLSU series. The pCAMBIA vectors are among those most commonly used by plant scientists (http://www.cambia.org/daisy/cambia/585.html). A pSa minimal replicon includes the ori and RepA regions. These were split and used in the pGreen/pSoup dual-plasmid system: pGreen is a T-DNA binary vector that hosts the pSa-ori sequence, and its replication in A. tumefaciens is not autonomous since it lacks the pSa-RepA gene. The pGreen maintenance in A. tumefaciens requires the simultaneous presence of the helper plasmid pSoup, which provides the pSa-RepA gene and allows replication of the pGreen binary vector (FIG. 9). On the one hand, removal of the RepA gene allowed pGreen size to be kept to a minimum, and on the other, it sacrificed plasmid replication autonomy and promoted instability under non-selective conditions.

(146) To demonstrate that the pLX-binary vectors of the present invention can be classified as mini binary vectors and additionally are useful for driving high transient expression in plants, the inventors compared the pLX binary vectors to the binary vectors mentioned above, which are known in the art.

(147) Firstly, backbone sizes of pLX-B2 (SEQ ID NO: 3) and of the mentioned binary vectors known in the art were compared (FIG. 9). The pBBR1-based backbone of the pLX vectors of the present invention is substantially smaller than the widely used pBIN- and pCAMBIA-based vectors (pBIN19, pCAMBIA-2300; FIG. 9). The pLX-B2 (SEQ ID NO: 3) backbone size equals to those of the pGreen-based vectors, which are not autonomous and require pSoup for their replication in A. tumefaciens. In contrast, the pLX vectors facilitate flexible experimental designs since their replication is autonomous in both E. coli and A. tumefaciens.

(148) pLX-B2 (SEQ ID NO: 3) can be classified as a mini binary vector since its size is below the one of pCB301, an RK2-based vector. Although larger than pBBR1, the RK2 replicon is relatively small and has previously been used to generate autonomous, mini binary vectors. To compare the performance of the pBBR1 and RK2 replicons, the inventors replaced the pBBR1 replication module (SEQ ID NO: 105) of the pLX vectors by an RK2 minimal origin (SEQ ID NO: 106) to build pLX-R2 (SEQ ID NO: 6), pLX-R3 (SEQ ID NO: 7) and pLX-R4 (SEQ ID NO: 8). A transcription unit (P.sub.35S:RFP:T.sub.nos) that contains sequences of the cauliflower mosaic virus 35S promoter, RFP, and nopaline synthase terminator was inserted into the pLX-R2, pLX-R3 and pLX-R4 vectors to obtain pLX-R2-TagRFP-T (SEQ ID NO: 16), pLX-R3-TagRFP-T (SEQ ID NO: 17) and pLX-R4-TagRFP-T (SEQ ID NO: 18), respectively (FIG. 10A). Details for the generation of these vectors are disclosed above.

(149) Transient expression of RFP in N. benthamiana leaves was evaluated by A. tumefaciens-mediated delivery of the pLX vectors including the pBBR1 (FIG. 3A) or RK2 origins (FIG. 10A). Compared to RK2, the use of the pBBR1-based pLX vectors led to significantly higher RFP accumulation in plant transient expression assays (FIG. 10B). The result was independent of the resistance genes used for plasmid selection, and did not correlate significantly with the A. tumefaciens fluorescence that might derive from undesired RFP accumulation in bacteria (FIG. 10B).

(150) The pCAMBIA plasmids have the pVS1 origin, and among the most commonly used T-DNA binary vectors. To compare the pLX and pCAMBIA vectors, the inventors assembled standardized units for plant delivery of the kanamycin resistance (NptII) and red fluorescent protein (DsRED) genes into the pLX-B2 (SEQ ID NO: 3) and pCAMBIA-derived vectors to obtain pLX-B2-NptII-DsRED (SEQ ID NO: 20) and GB1686 (SEQ ID NO: 27), respectively (FIG. 7A, 10C). Agrobacterium strains that contain pLX-B2-NptII-DsRED (pLX) (SEQ ID NO: 20) or GB1686 (SEQ ID NO: 27) were used in transient and stable transformation of N. benthamiana plants. Compared to GB1686, the pLX-B2 backbone significantly enhanced the DsRED accumulation in transient expression assays. In stable transformation assays, a similar number of kanamycin-resistant plantlets that showed DsRED fluorescence were obtained (FIG. 10C). The result indicates that the pLX- and pCAMBIA-based vectors tested have equal stable transformation efficiencies (FIG. 10C).

(151) Therefore, whereas stable transformation efficiencies of the present invention and commercially available vectors are similar, transient expression yields obtained by the use of the pBBR1-based binary vectors of the present invention are higher than those obtained by use of the RK2- and pVS1-based binary vectors.

Example 8. CRISPR/Cas Delivery and High Efficiency of Plant Genome Editing Using the pLX Vector Series of the Present Invention

(152) To demonstrate that the binary vectors of the present invention can be used for CRISPR/Cas construct delivery and targeted genome mutagenesis, transient expression of components of a CRISPR/Cas system was evaluated. The pLX-B2-XT1-XT2-hCas9 (pLX) (SEQ ID NO: 19) vector and GB1108, a pCAMBIA-derived vector that has the pVS1 origin and comprises transcription units identical to those of pLX-B2-XT1-XT2-hCas9 (SEQ ID NO: 19) were delivered to N. benthamiana leaves by A. tumefaciens (FIG. 7C, 11A). The hCas9 gene was delivered with no sgRNA sequences as a control (CTRL). In infiltrated samples, BsmBI- and SpeI-site loss was predicted to occur in the XT1 and XT2 edited loci, respectively. The mutagenesis was confirmed by the appearance of cleavage-resistant bands in PCR/digestion assays (FIG. 11B). Compared to pDGB3, and consistent with the DsRED transient expression results, the pLX vector showed greater mutagenesis efficiency (FIG. 11B).

(153) Therefore, genome mutagenesis obtained by the binary vectors of the present invention is higher than that obtained by use of a pVS1-based binary vector.

Example 9. Multiplexing of T-DNA Binary Vectors Using the pLX Vector Series of the Present Invention

(154) To demonstrate that the vectors generated in Example 1 can be multiplexed with compatible T-DNA binary vectors into A. tumefaciens cells and delivered to plants, the inventors designed the pLX-Z4 plasmid (SEQ ID NO: 9). pLX-Z4 is a novel T-DNA vector of low sequence similarity, and compatible with the pLX-B2 (SEQ ID NO: 3) and pLX-B3 (SEQ ID NO: 4) plasmids (FIG. 12, Table 3). pLX-B4 (SEQ ID NO: 5) and pLX-Z4 (SEQ ID NO: 9) are not compatible, since their selection relies on the same antibiotic, gentamicin. Additional features of pLX-Z4 (SEQ ID NO: 9) include small size, autonomous replication, and compatibility with Type IIS endonuclease-based and overlap-dependent cloning. The pLX-Z4 obtained as disclosed above is an improved pLX-R4 derivative with the T-DNA_2 cassette (SEQ ID NO: 2), and no BsmBI sites in the RK2-trfA and aacC1 genes. It incorporates the RK2 replication origin (SEQ ID NO: 107), lambda phage terminators (λ T1, SEQ ID NO: 110; and λ T2, SEQ ID NO: 111), and T-DNA border sequences from a succinamopine-type pTi, pTiBo542, and a second left border sequence (FIG. 12A). For cloning purposes, the pLX-Z4 T-DNA cassette includes the lacZα reporter, divergent BsaI and convergent BsmBI sites, and primer annealing regions with no sequence similarity and secondary structures and that allow the backbone linearization by inverse PCR. pLX-B2 (SEQ ID NO: 3) shows minimal sequence similarity with the pLX-Z4 backbone (SEQ ID NO: 9) (FIG. 12B). More extensive sequence analyses predicted that the pBBR1-based pLX vectors described in Examples 1 and 5 could be multiplexed with pLX-Z4, and a wide array of binary vectors commonly used by plant scientists (FIG. 12C).

(155) To facilitate vector multiplexing, the inventors characterized a disarmed A. tumefaciens strain (C58C1-313) that is sensitive to antibiotics commonly used in the plasmid selection: C58C1-313 growth is inhibited by the presence of ampicillin, chloramphenicol, gentamicin, tetracycline, kanamycin, or spectinomycin (FIG. 13A). A pTi-repB fragment was amplified from the C58C1-313 cells using the 2050_F (SEQ ID NO: 30)/2051_R (SEQ ID NO: 31) primers, and sequenced. Phylogenetic analysis showed that C58C1-313 hosts an octopine-type Ti plasmid, which is stably retained (FIG. 13B, C). Thus, C58C1-313 is a disarmed A. tumefaciens strain of the octopine type that is suitable for the simultaneous use of multiple plasmids, since it shows sensitivity to several antibiotics. To confirm the results, the C58C1-313 strain was sequentially transformed with the pLX-B2 and pLX-Z4 derivatives disclosed in the present invention, which include, respectively, the pBBR1 origin (SEQ ID NO: 105) and the kanamycin resistance gene or the RK2 origin (SEQ ID NO: 107) and the gentamicin resistance gene (FIG. 13D). A C58C1-313 strain that simultaneously hosts the pLX-B2 and pLX-Z4 derivatives showed resistance to kanamycin and gentamicin, and grew in a medium supplemented with these antibiotics (FIG. 13D). In the same conditions, growth of C58C1-313, a strain that harbors no vectors, was inhibited (CTRL; FIG. 130).

(156) In Example 2, the pLX-B2-P.sub.CRC:mTFP1 vector (SEQ ID NO: 23) including the pBBR1 origin (SEQ ID NO: 105), and kanamycin resistance was used to drive seed expression of the cyan fluorescent mTFP1. Under epifluorescence stereoscopes, cyan and red fluorescence can be imaged with no signal overlap. The inventors generated the pSN.5-P.sub.PAP85:RFP vector (SEQ ID NO: 26) (FIG. 14A), a pCAMBIA derivative with the pVS1 origin, spectinomycin resistance and a transcription unit (P.sub.PAP85:RFP:T.sub.nos) that contains an A. thaliana seed-specific promoter from a seed storage protein gene (PAP85; AT3G22640), RFP and nopaline synthase terminator sequences. Details for the generation of the pSN.5-P.sub.PAP85:RFP vector are disclosed above.

(157) To show that vectors of the present invention (Example 1) can be multiplexed with commercially available binary vectors, the inventors used a two-vector/one-strain system to transform A. thaliana. The pLX-B2-P.sub.CRC:mTFP1 (SEQ ID NO: 23) and pSN.5-P.sub.PAP85:RFP (SEQ ID NO: 26) T-DNA binary vectors were inserted in A. tumefaciens C58C1-313 (FIG. 14A), and transformed into plants by floral dipping. Consistent with the Example 2 results and the mTFP1 expression, cyan fluorescence was detectable in seed collected from the Agrobacterium-treated plants (FIG. 14B); 53% of the mTFP1-expressing seeds also showed red fluorescence derived by RFP expression (FIG. 14B).

(158) These results indicate that the binary vectors of the present invention can be multiplexed with compatible vectors, and used in a two-vector/one-strain system to deliver multiple and diverse T-DNA cassettes to plant cells.

Example 10. Gene Expression Control and Delivery of Synthetic Circuit Components to Plants by Multiplexing of Binary Vectors

(159) The inventors used a chemical expression switch to test whether the binary vectors of the present invention and the multiplexing strategy described in Example 9 could be applied to deliver synthetic circuit components to plants and to regulate gene expression. Ethanol was chosen as a chemical inducer of the expression switch because of its potential in fundamental research and commercial biotechnology applications.

(160) P.sub.EtOH (SEQ ID NO: 35), a novel synthetic promoter that is activated by Aspergillus nidulans AlcR in the presence of ethanol, was designed. The P.sub.EtOH promoter (SEQ ID NO: 35) includes multiple AlcR DNA-binding sites derived from the A. nidulans alcM, alcR, aldA, alcA promoters, and a figwort mosaic virus 34S minimal promoter (FIG. 15A). An ethanol-responsive buffer gate was designed to sense ethanol as the input, and to produce a bright green fluorescent protein (NEON, output; FIG. 15B). To evaluate the two-vector/one-bacterial strain system for the delivery of synthetic circuit components, the gate elements were distributed into the gentamicin-selectable pLX-Z4-P.sub.mas:RFP-AlcR (SEQ ID NO: 24) and the kanamycin-selectable pLX-B2-P.sub.EtOH:NEON (SEQ ID NO: 25) vectors, which have the RK2 and pBBR1 origins respectively (FIG. 15C). pLX-Z4-P.sub.mas:RFP-AlcR (SEQ ID NO: 24) codes for RFP (used as an expression control) and the A. nidulans AlcR transcription factor under the mannopine synthase promoter (P.sub.mas), which directs constitutive expression in plants; whereas pLX-B2-P.sub.EtOH:NEON (SEQ ID NO: 25) encodes the NEON sequence under P.sub.EtOH, a synthetic promoter activated by AlcR in the presence of the inducer (FIG. 15C). Details for the vector generation are disclosed above.

(161) The plasmids were introduced sequentially into A. tumefaciens C58C1-313, and selected using a gentamicin plus kanamycin medium to obtain the R-AlcR+P.sub.EtOH:NEON strain. The R-AlcR+P.sub.EtOH:NEON strain was infiltrated into N. benthamiana leaves, and plants were treated with water or ethanol. As anticipated, while the RFP fluorescence was visible in both conditions, the NEON fluorescence was significantly increased in the presence of the gate inducer (FIG. 16A). Circuit modeling requires quantitative characterization of genetic parts. To test whether the two-vector/one-strain expression system is compatible with medium-throughput analyses, leaf disks were collected from the R-AlcR+P.sub.EtOH:NEON-infiltrated leaves, and placed in 96-well plates to evaluated the gate responses. At 24 h post-treatment (hpt), the gate function was maintained in leaf disks, since the NEON fluorescence was detected only in the presence of the gate input (FIG. 16B). Quantification of the output fluorescence intensity in intact leaf disks showed appropriate gate responsiveness and sensitivity, since 0.1% ethanol was sufficient to trigger >200-fold induction (FIG. 16C). NEON detection requires no lysis or substrate addition steps, which allowed measuring the gate kinetics in a continuous-read assay. In the conditions tested and compared to the water control, the ratio of NEON/RFP fluorescence intensity was significantly increased at 1.5 hpt and reached a plateau at 15 hpt (FIG. 16D).

(162) The results show that the pBBR1-based and RK2-based pLX binary vectors of the present invention can be used to control gene expression in plants, and be coupled in a two-plasmid/one-strain system to allow multiple T-DNA delivery from A. tumefaciens. The binary vector system of the present invention is suitable for delivery of genetic circuit components, and their quantitative characterization in a medium-throughput scale.