cDNA construct of Salmonidae alphavirus

Abstract

The invention concerns recombinant DNA's comprising cDNA of genomic RNA of a Salmonidae alphavirus preceded by a spacer sequence, under the control of a suitable promoter. Said recombinant DNAs are useful for obtaining expression vectors, producing recombinant Salmonidae alphavirus, and for obtaining vaccines.

Claims

1. A recombinant Salmonidae alphavirus RNA replicon obtained by a method comprising introducing a recombinant DNA in to a host cell and culturing said host cell, wherein the recombinant Salmonidae alphavirus DNA or RNA replicon is derived from a genome of a Salmonidae alphavirus and comprises: a transcription promoter and, downstream of said promoter and under transcriptional control thereof; a spacer sequence and a cDNA of a genomic RNA of a Salmonidae alphavirus, wherein the spacer sequence defined by the general formula (I) below:
5 X.sub.1CTGANGARX.sub.2B.sub.2X.sub.2YGAAAX.sub.3B.sub.3X.sub.3TH 3(I) (SEQ ID NO: 29) in which A, T, G, and C have their usual meaning; H represents C, T or A; R represents A or G; Y represents C or T; N represents A, T, G or C; X.sub.1 represents an oligonucleotide of at least 3 nucleotides of sequence complementary to that of the 5 end of the genome of said alphavirus; X.sub.2 represents an oligonucleotide of at least 3 nucleotides of any sequence; B.sub.2 represents an oligonucleotide of 4 or 5 nucleotides, of any sequence; X.sub.2 represents an oligonucleotide complementary to X.sub.2; X.sub.3 represents an oligonucleotide of at least 2 nucleotides of any sequence; B.sub.3 represents an oligonucleotide of 4 to 5 nucleotides, of any sequence; X.sub.3 represents an oligonucleotide complementary to X.sub.3.

2. A recombinant Salmonidae alphavirus, obtained by a method comprising introducing a recombinant DNA or an RNA replicon into a host cell in which all structural proteins of said alphavirus that are required for encapsidation are expressed, and culturing said host cell wherein the recombinant Salmonidae alphavirus DNA or RNA replicon is derived from a genome of a Salmonidae alphavirus and comprises: a transcription promoter and, downstream of said promoter and under transcriptional control thereof; a spacer sequence and a cDNA of a genomic RNA of a Salmonidae alphavirus, wherein the spacer sequence is defined by general formula (I):
5 X.sub.1CTGANGARX.sub.2B.sub.2X.sub.2YGAAAX.sub.3B.sub.3X.sub.3TH 3(I) (SEQ ID NO: 29) in which A, T, G, and C have their usual meaning; H represents C, T or A; R represents A or G; Y represents C or T; N represents A, T, G or C; X.sub.1 represents an oligonucleotide of at least 3 nucleotides of sequence complementary to that of the 5 end of the genome of said alphavirus; X.sub.2 represents an oligonucleotide of at least 3 nucleotides of any sequence; B.sub.2 represents an oligonucleotide of 4 or 5 nucleotides, of any sequence; X.sub.2 represents an oligonucleotide complementary to X.sub.2; X.sub.3 represents an oligonucleotide of at least 2 nucleotides of any sequence; B.sub.3 represents an oligonucleotide of 4 to 5 nucleotides, of any sequence; X.sub.3 represents an oligonucleotide complementary to X.sub.3, or introducing the RNA replicon according to claim 1, into a host cell in which all of the structural proteins of said alphavirus that are required for its encapsidation are expressed, and the culturing of said host cell.

3. The recombinant Salmonidae alphavirus of claim 2, wherein part of the genetic information for the expression of said structural proteins is provided in trans by the host cell.

4. The recombinant Salmonidae alphavirus RNA replicon of claim 1, wherein all of the genetic information for the expression of said structural proteins is provided in trans by the host cell.

5. A vaccine comprising the recombinant Salmonidae alphavirus RNA replicon of claim 4.

6. A vaccine comprising the recombinant Salmonidae alphavirus RNA replicon of claim 1.

7. A vaccine comprising the recombinant Salmonidae alphavirus of claim 2.

8. A vaccine comprising the recombinant Salmonidae alphavirus of claim 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 depicts a schematic drawing of the pBS-VMS plasmid as described in Example 1 below. The sequences in FIG. 1 are disclosed as SEQ ID NO: 26 and SEQ ID NO: 30, respectively, in order of appearance.

(2) FIG. 2A depicts a schematic drawing of the construction of p-nsP from pSDV.

(3) FIG. 2B depicts a schematic drawing of the construction of p-nsP-LUC-GFP.

(4) FIG. 3A depicts the nucleotide sequence of a hammerhead ribozyme that was fused to the first nucleotide of the 5 end of the SDV cDNA genome as described in Example 2 below. The nucleotide sequence in FIG. 3A is SEQ ID NO: 27 and the amino acid sequence in FIG. 3A is SEQ ID NO: 28.

(5) FIG. 3B depicts a schematic drawing of the construction of pHH-nsP-LUC-GFP and pHH-nsP-XbaI-LUC-GFP as described in Example 2 below.

(6) FIG. 4A is a bar graph representing the luciferase activity (as units of luminescence) detected for the p-nsP-LUC plasmid from day 2 to day 11 as described in Example 2 below.

(7) FIG. 4B shows the fluorescence due to the GFP of the p-nsP-GFP plasmid on day 5, day 7, and day 10 as described in Example 2 below.

(8) FIG. 5 depicts a schematic drawing of the construction of pHH-SDV-T7t.

(9) FIG. 6A shows the immunofluorescence detected from BF-2 cells fixed with a 1/1 alcohol/acetone mixture at 20 C. for 15 minutes. The fixed BF-2 cells had been incubated with an assortment of monoclonal antibodies directed against structural and nonstructural proteins of SDV and then after washing, had been incubated with a commercial anti-mouse immunoglobulin antibody. Prior to fixing, the BF-2 cells had been transfected with pHH-SDV-T7t and infected with vTF7-3, then incubated at 37 C. for 7 days, as described in Example 3 below.

(10) FIG. 6B shows the amplification products from recombinant SDV that had been digested with BlpI. The amplification products were obtained by RT-PCR using RNA extracted from cells in which the recombinant SDV had been grown, along with NsP4-F and CapR as primers [see, Example 3 below].

(11) FIG. 6C depicts a schematic drawing of the position of primers NsP4-F and CapR relative to the BlpI restriction site of the recombinant SDV.

(12) FIG. 7A depicts schematic drawings of pHH-SDV-GFP.sub.first and pHH-SDV-GFP.sub.second.

(13) FIG. 7B shows the fluorescence due to the GFP of pHH-SDV-GFP.sub.first and pHH-SDV-GFP.sub.second on days 5 and 7 following the transfection with these plasmids of BF-2 cells infected with vTF7 as described in Example 5 below.

(14) FIG. 8A depicts a schematic drawing of pHH-SDV-GFP.sub.3.

(15) FIG. 8B shows the results of RT-PCR using nsP4-F and GFP-R primers confirming that effectively 3 GFP cassettes were present in pHH-SDV-GFP.sub.3.

EXAMPLES

Viruses and Cells

(16) The viruses used in the examples which follow are derived from the S49P strain of SDV, previously described (CASTRIC et al., Bulletin of the European Association of Fish Pathologists, 17, 27-30, 1997).

(17) These viruses are propagated on monolayer cultures of BF-2 cells, cultured at 10 C. in Eagle's minimum essential medium (EMEM, Sigma FRANCE) buffered at pH 7.4 with Tris-HCl and supplemented with 10% fetal calf serum. In order to obtain a better yield during the transfections, the BF-2 cells used are derived from subclones selected on the basis of their ability to be efficiently transfected.

(18) This selection was carried out as follows:

(19) BF-2 cells were cultured in a 96-well plate, at a rate of one cell per well. After one month, 24 of the clones thus obtained were selected randomly, and amplified in two 12-well plates. Each of these clones was transfected with a test plasmid (pcDNA3-G), obtained by insertion of the sequence encoding the glycoprotein G of the VHSV virus (Viral Haemorrhagic Septicaemia Virus) into the vector pcDNA3 (InVitrogen), downstream of the CMV promoter and of the T7 promoter. The efficiency of the transfection was determined by evaluating the level of expression of the glycoprotein G under the control of the CMV promoter, by immuno-fluorescence, using an antibody directed against this protein.

(20) The eleven clones in which the fluorescence was the strongest were selected and amplified. Each of these clones was again tested, as indicated above, for its ability to be transfected with pcDNA3-G, but, this time, after prior infection with vTF7-3 (FUERST et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126, 1986), and by evaluating the level of expression of the glycoprotein G under the control of the T7 promoter. Finally, 5 clones were selected for their ability to be infected with vTF7-3, combined with their ability to be transfected efficiently.

(21) Amplification Primers:

(22) The sequences of the primers used in the examples which follow are indicated in Table 1 hereinafter.

(23) TABLE-US-00001 TABLE1 SEQ ID Primer Sequence(5-3)* Restriction NO: P1 CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC EcoRI 1 P2 CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG SmaI 2 P3 CCCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG SmaI 3 P4 GGTCTAGAGTATGATGCAGAAAATATTAAGG XbaI 4 P5 CCTCTAGACCAACCATGTTTCCCATGCAATTCACC XbaI 5 P6 CCGCGGCCGCATTGAAAATTTTAAAAACCAATAGATGACTCA NotI 6 5RIBO GGATCCTGGATTTATCCTGATGAGTCCGTGAGGACGAAACT BamHI 7 ATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC 3RIBO GCCGGCGGAAGGGTTAGCTGTGAGATTTTGCATCATTGATA NaeI 8 TATGTATGCTTTTGGATTTATCGACTATAGGAATTCCTT 5SanDI CCTCGTCAGCGGGACCCATAATGCC SanDI 9 3?XbaIBlpI CCGCTGAGCGGTTGGTTGAGAGTATGATGC BlpII 10 5GFP CCAACCGCTGAGCATGGTGAGCAAGGGCGAGG BlpI 11 3GFP GTGGCTAACGGCAGGTGATTCACGCTTAAGCTCGAGATCTG 12 AGTCCG 5nsp4 GCGTGAATCACCTGCCGTTAGCCACAATGGCGATGGCCACG 13 CTCG 3Jun CCATGCTGAGCGGTTGGTTGAGAGTATGATGC BlpI 14 nsP4-F GGCGGCTTCCTGTTACTCGACACGG 15 5ProGFP ATCGATGAACGATATCGGCCGCCGCTACACGCTATGGCG BlpI 16 3ProGFP CCGGAATGCTAGCTTAAGCTCGAGATCTGAGTCCG 17 3UTR CGAGCTTAAGCTAGCATTCCGGTATACAAATCGC EcoV 18 T7t GGCTAGGTCGGCGGCCGCAAAAAACCCCTCAAGACCCG NheI 19 GSP1 CCGCCGAGTCGCTCCAGTTGGCG NheI 20 GSP2 CGGGTTCTCCAGGACGTCCTTCAAG NotI 21 5RACEseq GGCGGCGGCATGGTCGTTGGACGACCGG 22 Cap-R CCTTCAGCATAGTCATGGCCTTCTTTGG 23 GFP-R TTAAGCTCGAGATCTGAGTCCGGAC 24

(24) The restriction sites are underlined. The sequences in italics are part of the nsP4 sequence and the sequences indicated in bold are part of the GFP sequence.

Example 1

Cloning of the Complete SDV Genome

(25) A whole SDV cDNA construct, pBS-VMS, was obtained from cDNA fragments (numbered 1 to 3) covering the complete SDV genome, obtained from the previously published sequence (VILLOING et al., 2000; WESTON et al., 2002, mentioned above; GENBANK accession number: NC.sub.003433.1/GI:19352423). Each fragment was amplified by reverse transcription followed by PCR (RT-PCR) using the SDV genomic RNA as template. The RNA was extracted using the QIAamp viral RNA purification kit (Qiagen), from the PEG-concentrated supernatants of SDV-infected cells. The primers (P1 to P6) used for the reverse transcription and the PCR amplification are given in Table 1.

(26) The cDNA fragments obtained were ligated to one another and assembled at the multiple cloning site of the pBlueScript plasmid using the EcoRI, SmaI, XbaI and NotI restriction sites. The plasmid obtained is represented in FIG. 1.

(27) As indicated in FIG. 1, an XbaI restriction site was introduced artificially so as to facilitate subsequent cloning steps. The sequencing of the pBS-VMS construct demonstrated 42 variations compared with the published sequence. These variations are listed in table II hereinafter, and indicated by the letters (a to x) on the pBS-VMS construct represented in FIG. 1.

(28) Among them, 8 chance mutations were corrected as follows: various portions of the SDV RNA genome corresponding to the regions of the cDNA genome containing the mutations were re-amplified by RT-PCR. Each PCR product was sequenced and, if its sequence was correct, was inserted in place of its homolog into the pBS-VMS construct using the appropriate restriction sites and standard technology (SAMBROOK et al., Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., 1989). With the exception of the XbaI restriction site, the final pBS-VMS construct contains an exact cDNA copy of the SDV RNA genome.

(29) TABLE-US-00002 TABLE II Position (nt) Nucleotide* Amino Acid* 5UTR 2 a T? A nsP1 35 b T? A L? Q 1123 c G? A D? N 1519 d G? A G? R 1531 d C? A L? I nsP2 1958 C? A A? D 2345 G? A G? E 2477 A? G E? G 2669 T? C L? P 3728 e G? C R? P 3934 f CG? GT R? V 3938 f G? T R? L 3941 f C? T S? F nsP3 5084 C? T P? L 5095 A? G I? V nsP4 6107g T? C L?P 6392 T? A F? Y 6471 h A? C E? D 6505 i A? G K? E 7467 j A? C E? D jun 7836 CA? AG 8337 k T? A F? I Capsid 8383l T? A V? D 8415 m T? A C? S 8469 n G? T G? W 8482 o A? C N? T 8486 o T? Frameshift 8490 o G? 8504 p T? G 8506 p T? C 8510 p T? A 8539 q G? 8553-55 r CcA? GcC P? A 8556 r T? A F? I E2 9310 s C? T T? M 9937 t T? G L: W 6K 10422 u GCG? AGC A? S E1 10858 A? G E? G 11709 v A? G R? G 11722 w A? Frameshift 11739 w T? 11751 x G? *The first position corresponds to the published sequence; the second position corresponds to the cDNA sequence determined in the present study. The accidental mutations that were corrected are indicated in bold. The letters (a-x) refer to FIG. 1.

Example 2

Construction of a Genomic RNA Allowing the Synthesis of the Nonstructural SDV Proteins in Fish Cells, and Of an SDV Replicon Expressing GFP and Luciferase

(30) The SDV CDNA insert was transferred from pBS-VMS into a vector pcDNA3 (Stratagene) between the EcoRI and NotI restriction sites, downstream of the cytomegalovirus (CMV) immediate early (IE) promoter and of a T7 RNA polymerase promoter. The resulting construct was called pSDV.

(31) The region of the cDNA encoding the structural proteins was removed by digestion with XbaI, one site of which is in the junction region and the other of which is in the multiple cloning site of pDNA3, downstream of the cDNA. The construct was autoligated to give the plasmid p-nsP, represented in FIG. 2A).

(32) The plasmid p-nsP was then linearized with XbaI in order to insert, downstream of the region encoding the nonstructural proteins, a sequence encoding GFP or luciferase (LUC) preceded by the end of the junction region and.sup.2 followed by the 3 untranslated end of SDV fused to a poly (A) tail. The artificial XbaI site of the junction region was removed by interchanging a SanDI/BlpI fragment. The reading frame of GFP or that of luciferase is bordered by two unique restriction sites: an EcoRV site and a BlPI site. In these final constructs, called p-nsp-GFP and p-nsp-LUC, the CMV/T7 promoter combination is separated from the 5 end of the SDV genome by 61 nucleotides belonging to the multiple cloning site of pcDNA3. These constructs are represented in FIG. 2B.

(33) In order to evaluate the functionality of these constructs for the expression of the GFP and LUC reporter genes, each of them was used to transfect BF-2 cells, which were incubated at 10 C., in culture plate wells (610.sup.5 cells/well), and the luciferase activity and GFP activity were measured daily.

(34) To measure the luciferase activity, the transfected cells were harvested before measurement, washed with PBS, and lysed with 75 l of 1 lysis buffer (25 mM Tris-phosphate (pH 7.8), 2 mM DTT, 2 mM 1,2-diaminocyclohexane-N,N,N,N-tetraacetic acid, 10% glycerol, 1% Triton X-100). The lysates are clarified by low-speed centrifugation, and the proteins are quantified by the Bradford method, in order to normalize the samples.

(35) 50 l of luciferase reagent (Promega) are added to aliquots of the clarified lysates.

(36) In the case of GFP, the expression in the transfected cells is directly monitored by observation under a microscope in UV light.

(37) The expression of the nonstructural proteins is detected by immunofluorescence from the day after transfection onward. On the other hand, respective of the time-after transfection, neither luciferase activity nor GFP fluorescence is detected.

(38) The results are given in table III below.

(39) TABLE-US-00003 TABLE III Expression of Plasmid nonstructural GFP Luciferase Construct Proteins Expression expression p-nsP-GFP +++ p-nsP-LUC +++

(40) These results indicate that the viral RNA was transcribed, but that no expression of the GFP or luciferase reporter genes, which are placed under the control of the SDV 26 Subgenomic promoter, is observed.

(41) This makes it possible to suppose that the replicative viral complex is not functional due to the fact that the 5 end is not strictly identical to that of the SDV genome.

(42) Use of a Ribozyme as Spacer:

(43) A hammerhead ribozyme sequence (HH sequence) was fused to the first nucleotide of the 5 end of the SDV cDNA genome, in the following way: a HindIII fragment of p-nsP, containing the first two Kb of SDV cDNA was removed and subcloned into a plasmid pUC19, to give the construct pUC-SDV HindIII. A BamHI/NaeI fragment containing the 5 end of the SDV genome was removed from this construct, and was replaced with a synthetic DNA fragment generated by hybridization of two partially complementary oligonucleotides of 79 and 80 nucleotides comprising the sequence of the hammerhead ribozyme fused to the 5 end of the SDV genome, and filling using the T4 DNA polymerase Klenow fragment. The sequence of these oligonucleotides (5RIBO and 3RIBO) is given in table I.

(44) The sequence of the hammerhead ribozyme is represented in FIG. 3A; the BamHI and Neal sites and the T7 promoter are underlined. The ribozyme cleavage site and the start of the SDV genome are indicated by arrows.

(45) After digestion with the appropriate restriction enzymes, the synthetic DNA fragment was inserted into the plasmid pUC-SDV HindIII, to give the construct pUC-HH-SDV HindIII The modified HindIII fragment was recovered from this construct and reinserted into the plasmid p-nsP, to give the construct pHH-nsP.

(46) The resulting construct pHH-nsP was then linearized with XbaI and modified in the same way as in the case of p-nsP: insertion, downstream of the region encoding the nonstructural proteins, of a sequence encoding GFP or luciferase (LUC) bordered by the BlpI and EcoRV sites, preceded by the end of the junction region and followed by the 3 untranslated end of SDV fused to a poly (A) tail, correction of the artificial XbaI site. The final constructs are called pHH-nsP-GFP and pHH-nsP-LUC. The steps for obtaining these constructs are given in FIG. 3B.

(47) The functionality of these constructs was evaluated in the same way as for the constructs p-nsP-GFP and p-nsP-LUC.

(48) The results are illustrated in FIG. 4.

(49) A significant luciferase activity is detected from 2 days after infection onward, and increases up to 9 days after transfection (FIG. 4A). GFP expression is demonstrated 4 days after transfection, and is optimal, as for luciferase, after 9 days (FIG. 4B).

(50) These results indicate that the SDV replicase complex (nsP1, nsP2, nsP3 and nsP4) expressed from the pHH-nsP-LUC or -GFP vectors is biologically active and is capable of replicating and of transcribing a subgenomic RNA containing the reporter genes. These data also show that the cleavage of the 5 end of the SDV genome was effectively carried out by the hammerhead ribozyme.

Example 3

Construction of an Infectious Recombinant cDNA of SDV

(51) An infectious SDV cDNA clone was constructed in the following way:

(52) The region encoding the structural proteins of SDV was inserted between the BlpI and EcoRV sites of pHH-nsP-LUC, as a replacement for the sequence encoding luciferase, to give the construct pHH-SDV.

(53) This construct was also modified by insertion of a T7 terminator (T7t): the pHH-SDV vector was linearized by digestion with the NotI restriction enzyme, and blunt-end ligated with a BlpI/NheI fragment of the vector pET-14b (Novagen) containing a T7 terminator (prior to the ligation, the ends of the two fragments were filled using the T4 DNA polymerase Klenow fragment). The resulting construct is called pHH-SDV-T7t. The steps for obtaining this construct are shown schematically in FIG. 5.

(54) This construct was used to transfect BF-2 cells infected with the recombinant vaccinia virus vTF7-3, which expresses the T7 RNA polymerase (FUERST et al., 1986, mentioned above), The BF-2 cells (approximately 1.210.sup.6 cells/well) are cultured in 12-well plates and infected with vTF7-3 (multiplicity of infection=5). After 1 hour of adsorption at 37 C., the cells are washed twice, and transfected with 1.6 g of PSDV, using the Lipofectamine 2000 reagent, according to the manufacturer's instructions (Invitrogen). The cells are incubated for 7 hours at 37 C. and washed with MEM medium before being transferred to 10 C. and incubated at this temperature for 7 or 10 days. In certain experiments, transfections were carried out according to the same protocol, but without prior infection of the cells with vTF7-3.

(55) 7 days and 10 days after transfection, the cells are fixed with a 1/1 alcohol/acetone mixture at 20 C. for 15 minutes, and incubated with an assortment of monoclonal antibodies directed against structural or nonstructural proteins of SDV, said antibodies being diluted to 1/1000 in PBS-Tween. After incubation for 45 minutes at ambient temperature, the cells are washed and incubated with an anti-mouse immunoglobulin antibody (Biosys, France). After washing, the cells are examined with a m microscope under UV light.

(56) In parallel, the supernatants are recovered, clarified by centrifugation at 10 000g in a microcentrifuge, and used to infect fresh BF-2 cells, cultured at 10 C. as a monolayer in 24-well plates. The cells thus infected are analyzed by immunofluorescence as described above.

(57) The results observed 7 days after transfection are shown in FIG. 6A: some small loci appear; they are greater in size 10 days after infection, which probably reflects a cell-to-cell infection by the recombinant SDV.

(58) The recombinant SDV has a BlpI restriction site, which is absent from the wild-type virus. In order to verify that the virus produced by the infected cells is indeed the recombinant SDV, the RNA is extracted from the cells infected with the recombinant SDV, after the first passage, and used as a template to carry out an RT-PCR using the primers NsP4-F and CapR, bordering the BlpI site. The position of these primers is indicated in FIG. 6C. An RT-PCR is also carried out, with the same primers, using RNA extracted from cells infected with the wild-type virus.

(59) The amplification products are digested with BlpI, and their restriction profiles are compared. The results are shown in FIG. 6B. In the absence of BlpI (BlpI), a fragment of 1326 nucleotides is observed with the recombinant SDV, as with the wild-type virus. After digestion with BlpI (+BlpI), this fragment remains intact in the case of the wild-type virus, and gives a fragment of 990 nucleotides and a fragment of 336 nucleotides in the case of the recombinant SDV.

Example 4

In Vivo Infection with the Recombinant SDV

(60) In order to verify the infectious capacity of the recombinant SDV, 50 healthy young rainbow trout (Oncorhynchus mykiss) were infected by immersion for 2 hours in an aquarium filled with water at 10 C., containing 510.sup.4 PFU/ml of wild-type SDV or of recombinant SDV, obtained from infected BF-2 cells. The aquarium is then made up to 30 liters with fresh water. Fish used as control are treated under the same conditions, with culture medium in place of the viral suspension.

(61) 3 weeks after infection, some fish were sacrificed and homogenates of organs of each fish were used to infect BF-2 cells. Analysis of these cells by immuno-fluorescence, as described in example 3 above, shows the presence of virus in the cells infected with the organ homogenates from fish infected with the wild-type SDV or with the recombinant SDV (results not shown).

(62) All the fish sacrificed were positive for SDV, the viral titer being approximately 10.sup.7 PFU/ml for the wild-type SDV as for the recombinant SDV.

Example 5

Construction of an Infectious Recombinant SDV Expressing a Heterologous Gene

(63) In order to produce an infectious recombinant virus expressing GFP, the infectious cDNA pHH-SDV-T7t is modified in two different ways, in order to insert an additional expression cassette expressing GFP.

(64) 1) Construction of the Infectious cDNA pHH-SDV-GFPfirst

(65) The pHH-nsP-GFP construct is used as template to generate two separate PCR amplification products: the GFP PCR product is obtained using the 5GFP and 3GFP primers (table 1); the subgenomic SDV PCR is obtained using the 5nsP4(77-6-7750) and 3Jun primers (table 1). Since the exact location and the minimum size of the SDV subgenomic promoter have not yet been determined, a fragment of approximately 100 nucleotides, containing the end of the sequence of nsP4 and the junction region, was used. The SDV subgenomic promoter is then ligated, by PCR, in a position 3 of the sequence encoding GFP, by mixing the two products derived from the first amplification and using the 5GFP and 3Jun primers.

(66) The resulting amplification product (GFP-SDVPro) is digested with BlpI and inserted into the pHH-SDV-T7t construct, digested beforehand with BlpI, so as to obtain the infectious cDNA pHH-SDV-GFPfirst.

(67) 2) Construction of the Infectious cDNA pHH-SDV-GFPsecond

(68) In this construct, the GFP expression cassette is inserted downstream of the structural genes.

(69) Two PCR amplification products are generated: the SDV subgenomic promoter fused to GFP (product PCR1), using as primers 5ProGFP and 3ProGFP (table 1), and as matrix the pHH-nsP-GFP construct; the 3untranslated region of SDV fused to a poly(A) tail and to the T7 promoter (product PCR2), using as primers 3UTR and T7t (table 1), and as template the pHHSDV-T7t construct.

(70) The PCR1 and PCR2 products are assembled by PCR using the 5ProGFP and T7t primers. The PCR amplification product is digested with EcoRV and NotI, and inserted into the PHH-SDV construct digested with the same enzymes, so as to obtain the infectious cDNA pHH-SDV-GFPsecond.

(71) These two constructs are shown schematically in FIG. 7A.

(72) These constructs are used to transfect BF-2 cells infected with vTF7, and the GFP expression is monitored daily. The results are shown in FIG. 7B.

(73) The GFP expression is detectable starting from 7 days after transfection for the two pHH-SDV-GFP constructs. However, a more intense expression of GFP is observed when the GFP gene is located downstream of the structural protein genes in the genome.

(74) During the cloning of the GFP gene into pSDV in order to obtain the pHH-SDV-GFPfirst construct, a plasmid (pHH-SDV-GFP.sub.3) suspected of containing 3 GFP cassettes was selected.

(75) This plasmid is shown schematically in FIG. 8A.

(76) An RT-PCR using the nsP4-F and GFP-R primers (table 1) made it possible to confirm that effectively 3 GFP cassettes were present in the pHHSDV-GFP.sub.3 plasmid.

(77) The results of this RT-PCR are represented in FIG. 8B. Together, these three GFP cassettes represent a DNA fragment of 2.7 Kb.

(78) This construct was transfected into BF-2 cells infected with vTF7-3, and the appearance of loci of infected cells after 9 days confirmed the functionality of this construct.

(79) These results show that SDV can contain a heterologous nucleic acid which is more than 20% longer than the wild-type virus genome.