GERMLINE TRANSMISSION OF CHICKEN PRIMORDIAL GERM CELLS (PGCS)

Abstract

The present invention is long-term cultures of avian PGCs and techniques to produce germline chimeric and transgenic birds derived from prolonged PGC cultures. In some embodiments, these PGCs can be transfected with genetic constructs to modify the DNA of the PGC, specifically to introduce a transgene encoding an exogenous protein. When combined with a host avian embryo by known procedures, those modified PGCs are transmitted through the germline to yield transgenic offspring. These germline chimeric birds do not have substantial contributions of PGC-derived phenotypes in somatic cells or tissues. This invention includes compositions comprising long-term cultures of PGCs that can be genetically modified by gene targeting, that can accept large amounts of foreign DNA and that contribute to the germline of recipient embryos.

Claims

1. A culture of genetically modified chicken primordial germ cells (PGCs), comprising at least 110.sup.5 clonal PGCs whose genomes stably comprise and express an exogenous DNA sequence encoding a pharmaceutical protein flanked by at least one insulator, wherein said culture of genetically modified clonal PGCs maintains the PGC phenotype and is derived from a single transfected PGC; and wherein the single transfected PGC is derived by directly culturing whole blood obtained from a stage 12-17 chicken embryo with passaging for at least 40 days in vitro.

2. The culture of claim 1, wherein the genetically modified PGCs are cultured in medium condition with buffalo rat liver (BRL) cells.

3. The culture of claim 1, wherein the genetically modified PGCs are cultured in medium comprising a fibroblast growth factor (FGF).

4. The culture of claim 1, wherein the genetically modified PGCs are cultured in medium comprising a stem cell factor.

5. The culture of claim 1, wherein the genetically modified PGCs are cultured in medium comprising a chicken serum.

6. (canceled)

7. (canceled)

8. A transgenic chicken comprising germline tissues colonized by genetically modified primordial germ cells (PGCs), wherein the genomes of the genetically modified PGCs stably comprise and express an exogenous DNA sequence encoding a pharmaceutical protein flanked by at least one insulator, wherein the genetically modified PGCs are derived from a clonal culture comprising at least 110.sup.5 of the genetically modified PGCs which maintain the PGC phenotype, wherein said clonal culture of PGCs are derived from a single transfected PGC; and wherein said single transfected PGC is derived from PGCs obtained by culturing whole blood obtained from a stage 12-17 chicken embryo for at least 40 days in vitro.

9.-14. (canceled)

15. The culture of claim 1, wherein the pharmaceutical protein is a human protein.

16. The culture of claim 15, wherein the pharmaceutical protein is an antibody.

17. The culture of claim 1, wherein the insulator is a chicken fl-globin 5HS4 insulator.

18. The culture of claim 1, wherein the culture is cryopreserved.

18. The transgenic chicken of claim 8, wherein the pharmaceutical protein is a human protein.

19. The transgenic chicken of claim 18, wherein the pharmaceutical protein is an antibody.

20. The transgenic chicken of claim 8, wherein the insulator is a chicken -globin 5HS4 insulator.

Description

DESCRIPTION OF THE FIGURES

[0033] FIG. 1A: PGCs maintained in culture for 54 days. Note that the cells are not attached and maintain a round morphology. Arrows indicate several dividing cells visible in this culture.

[0034] FIG. 1B: PGCs maintained in culture for 234 days. These cells are cultured on a feeder layer of irradiated STO cells.

[0035] FIG. 2: Gene expression as determined by RT-PCR of the germ cell markers CVH and Dazl. Cells were in culture for 32 days. Lane1 shows expression of both CVH and Dazl in an aliquot of PGCs. A second sample, in lane 2, did not have sufficient mRNA as determined by the absence of actin. CES cells were also analyzed; actin was expressed but the cES cells did not express CVH and Dazl was expressed only weakly.

[0036] FIG. 3: Western analysis of PGCs maintained in culture for 166 days. Testis was used as positive control and liver as a negative control. Rabbit anti-chicken CVH IgG was used as the primary antibody.

[0037] FIG. 4: Telomeric Repeat Amplification Protocol (TRAP) Assay. Different dilutions of cell extracts of 2 different PGC cell lines (13&16) maintained in culture for 146 days. The positive control consisted of the transformed human kidney cell line 293 and the negative control was lysis buffer only with no template added. In the PGC and positive control lanes, repeat sequences are visible indicating the presence of telomerase.

[0038] FIG. 5A: cEG cells derived from PGCs maintained in culture.

[0039] FIG. 5B: Chicken embryonic stem cells. Note the small cells, big nucleus (light grey) and pronounced nucleolus in both cell types.

[0040] FIG. 6: Chimeras obtained from cEG cells derived from PGCs. The EG cells were derived from black feathered Barred Rock embryos. As recipients, a white feathered (White Leghorn) embryo was used. Somatic chimerism is evident by the black feathers.

[0041] FIG. 7. Rooster IV7-5 with his offspring. A White Leghorn is homozygous dominant at the dominant, white locus (I/I). When bred to a Barred Rock hen (i/i) all offspring from a White Leghorn will be white (I/i). A black chick demonstrates that the injected PGCs (derived from a Barred Rock embryo (i/i)) have entered the germline of the White Leghorn rooster.

[0042] FIG. 8. Southern analysis of cx-neo transgene in a line of primordial germ cells (PGCs).

[0043] FIG. 9: FACS analysis of cells stained with antibodies against chicken vasa homologue (CVH) and 1B3. The cell lines used were PGC 102; ES 439 and EG 455.

[0044] FIG. 10: Southern analysis of the HS4--actin-neo transgene in 2 lines of primordial germ cell PGCs.

[0045] FIG. 11: Southern analysis of the HS4-actin-eGFP--actin-puro transgene in primordial germ cell (PGC) line TP103.

[0046] FIG. 12: Karyotype of G-09 showing all chromosomes to be diploid. In one copy of GGA 2, the majority of the p arm is either missing or translocated to another chromosome. The other copy of CGA 2 is normal. The cells are ZZ (male).

[0047] FIG. 13: Section of testes, at 18 days of development, stained with DAPI. GFP positive germ cells are clearly visibly within the seminiferous tubules.

[0048] FIG. 14: The DAPI stained panel shows a section through a seminiferous tubule of an E18 testis.

DETAILED DESCRIPTION OF INVENTION

[0049] As used herein, the terms chicken embryonic stem (cES) cells mean cells exhibiting an ES cell morphology and which contribute to somatic tissue in a recipient embryo derived from the area pellucida of Stage X (E-G&K) embryos (the approximate equivalent of the mouse blastocyst). CES cells share several in vitro characteristics of mouse ES cells such as being SSEA-1.sup.+, EMA-1.sup.+ and telomerase.sup.+. ES cells have the capacity to colonize all of the somatic tissues.

[0050] As used herein, the terms primordial germ cells (PGCs) mean cells exhibiting a PGC morphology and which contribute exclusively to the germline in recipient embryos, PGCs may be derived from whole blood taken from Stage 12-17 (H&H) embryos. A PGC phenotype may be established by (1) the germline specific genes CVH and Dazl are strongly transcribed in this cell line, (2) the cells strongly express the CVH protein, (3) the cells do not contribute to somatic tissues when injected into a Stage X nor a Stage 12-17 (H&H) recipient embryo, (4) the cells give rise to EG cells (see below), or (5) the cells transmit the PGC genotype through the germline when injected into Stage 12-17 (H&H) embryos (Tajima et al. (1993) Theriogenology 40, 509-519; Naito et al., (1994) Mol Reprod Dev, 39, 153-161; Naito et al., (1999) J Reprod Fert 117, 291-298).

[0051] As used herein, the term chicken embryonic germ (cEG) cells means cells derived from PGCs and are analogous in function to murine EG cells. The morphology of cEG cells is similar to that of cES cells and cEG cells contribute to somatic tissues when injected into a Stage X (E-G&K) recipient.

[0052] The germline in chickens is initiated as cells from the epiblast of a Stage X (E-G & K) embryo ingress into the nascent hypoblast (Kagami et al., (1997) Mol Reprod Dev 48, 501-510; Petitte, (2002) J Poultry Sci 39, 205-228). As the hypoblast progresses anteriorly, the pre-primordial germ cells are swept forward into the germinal crescent where they can be identified as large glycogen laden cells. The earliest identification of cells in the germline by these morphological criteria is approximately 8 hours after the beginning of incubation (Stage 4 using the staging system established by Hamburger and Hamilton, (1951) J Morph 88, 49-92). The primordial germ cells reside in the germinal crescent from Stage 4 (H&H) until they migrate through the vasculature during Stage 12-17 (H&H). At this time, the primordial germ cells are a small population of about 200 cells. From the vasculature, the primordial germ cells migrate into the genital ridge and are incorporated into the ovary or testes as the gonad differentiates (Swift, (1914) Am J Anat 15, 483-516; Meyer, (1964) Dev Biol 10, 154-190; Fujimoto et al. (1976) Anat Rec 185, 139-154). In all species that have been examined to date, primordial germ cells have not proliferated in culture for long periods without differentiating into EG cells. Long periods in culture are required in order to produce a sufficient number of cells to introduce a genetic modification by conventional electroporation or lipofection protocols. Typically, these protocols require 10.sup.5 to 10.sup.7 cells and therefore, production of these cells from a single precursor requires 17 to 24 doublings assuming that all cell divisions are (1) synchronous and (2) produce two viable daughter cells. The introduction of a genetic modification into the genome of a cell is a rare event, typically occurring in one in 110.sup.4 to 110.sup.6 cells. Following genetic modification, the cells must be able to establish a colony from the single cell that carries and/or expresses the genetic modification. The colony must be able to expand into a population of 10.sup.5 to 10.sup.7 cells that can be analyzed by PCR or Southern analysis to evaluate the fidelity of the transgene and provide a sufficient number of cells that are then injected into recipient Stage 13-15 (H&H) embryos. Therefore another 17 to 24 cell divisions are required to produce the populations of cells and in total 34 to 58 doublings are required to produce the population of genetically modified cells. Assuming that the cell cycle is 24 hours, a minimum of 34 days and in general 58 days in culture are required to produce genetically modified primordial germ cells for injection into Stage 13-15 (H&H) recipient embryos. The injected cells must then be able to colonize the germline, form functional gametes and develop into a new individual post fertilization.

[0053] The following describes the unexpected finding that PGCs can be isolated from the blood of Stage 12-17 (H&H) embryos, that the cells will proliferate rapidly and maintain their PGC phenotype, that the PGCs can be passaged at daily or 2-day or 3-day intervals, that the PGCs will colonize the germline but not somatic tissues after at least 110 days in culture, that viable offspring can be obtained from cells that have been in culture for 110 days, that the PGCs can be genetically modified by transfection with a transgene, and that the genetically modified PGCs can be isolated and propagated into a colony of genetically modified PGCs.

[0054] Pursuant to this invention, chicken PGC cell lines have been derived from blood taken from Stage 14-16 (H&H) embryos that have a large, round morphology (FIG. 1). These cells are confirmed to be chicken PGCs by their morphology after long term culturing and their ability to yield PGC-derived offspring. In addition, the PGC cultures express the germline-specific genes Dazl and CVH (FIG. 2) and the CVH protein is produced by the cells in culture (FIG. 3). PGCs in culture also express telomerase (FIG. 4) indicating that they have an immortal phenotype. Furthermore, PGCs will give rise to embryonic germ (EG) cells in the appropriate culture conditions (FIG. 5). By analogy, mouse and human PGCs will give rise to EG cells when treated in an analogous fashion. Mouse EG cells will contribute to somatic tissues and chicken EG cells also contribute to somatic tissues as indicated by black feather pigmentation in chimeras (FIG. 6). Chicken PGCs have been genetically modified as indicated by Southern analysis (FIG. 7). In a preferred embodiment, the CX promoter is stably integrated into the genome of a PGC and is used to facilitate expression of the gene encoding aminoglycoside phosphotransferase (APH) which is also integrated into the genome of a PGC and is used to confer resistance to neomycin added to culture media in order to select PGCs that have been genetically modified.

Example 1. Derivation of Cultures of Chicken PGCs

[0055] Two to five L of blood taken from the sinus terminals of Stage 14-17 (H&H) embryos were incubated in 96 well plates in a medium containing Stem Cell Factor (SCF; 6 ng/ml or 60 ng/ml), human recombinant Fibroblast Growth Factor (hrFGF; 4 ng/ml or 40 ng/ml), 10% fetal bovine serum, and 80% KO-DMEM conditioned medium. The wells of the 96-well plates was seeded with irradiated STO cells at a concentration of 310.sup.4 cells/cm.sup.2.

[0056] KO-DMEM conditioned media were prepared by growing BRL cells to confluency in DMEM supplemented with 10% fetal bovine serum, 1% pen/strep; 2 mM glutamine, 1 mM pyruvate, 1 nucleosides, 1 non-essential amino acids and 0.1 mM -mercaptoethanol and containing 5% fetal bovine serum for three days. After 24 h, the medium was removed and a new batch of medium was conditioned for three days. This was repeated a third time and the three batches were combined to make the PGC culture medium.

[0057] After approximately 180 days in culture, one line of PGCs was grown in media comprised of 40% KO-DMEM conditioned media, 7.5% fetal bovine serum and 2.5% chicken serum. Under these conditions, the doubling time of the PGCs was approximately 24-36 hours.

[0058] When the culture was initiated, the predominant cell type was fetal red blood cells. Within three weeks, the predominant cell type was that of a PGC. Two PGC cell lines were derived from 18 cultures that were initiated from individual embryos.

[0059] A line of PGCs has been in culture for over 9 months, maintain a round morphology, and remain unattached (FIGS. 1A &B). PGCs have been successfully thawed after cryopreservation in CO.sub.2 independent medium containing 10% serum and 10% DMSO.

Example 2. Cultured PGCs Express CVH and Dazl

[0060] Expression of CVH, which is the chicken homologue of the germline specific gene VASA in Drosophila, is restricted to cells within the germline of chickens and is expressed by approximately 200 cells in the germinal crescent (Tsunekawa et al., 2000). CVH expression is required for proper function of the germline in males; loss of CVH function causes infertility in male mice (Tanaka et al., 2000). The expression of Dazl is restricted to the germline in frogs (Houston and King, 2000) axolotl (Johnson et al., 2001), mice (Schrans-Stassen et al., 2001), rat (Hamra et al., 2002), and human (Lifschitz-Mercer et al., 2000). Deletion of Dazl led to spermatogenic defects in transgenic mice (Reijo et al., 1995).

[0061] After 32 days, PGCs were washed with PBS, pelleted and mRNA was isolated from the tissue samples with the Oligotex Direct mRNA kit (Qiagen). cDNA was then synthesized from 9 l of mRNA using the SuperScript RT-PCR System for First-Strand cDNA synthesis (Invitrogen). Two l of cDNA was used in the subsequent PCR reaction. Primer sequences which were derived from the CVH sequence (accession number AB004836), Dazl sequence (accession number AY211387), or 3-actin sequence (accession number NM_205518) were:

TABLE-US-00001 V-1 (SEQIDNO.1) GCTCGATATGGGTTTTGGAT V-2 (SEQIDNO.2) TTCTCTTGGGTTCCATTCTGC Dazl-1 (SEQIDNO.3) GCTTGCATGCTTTTCCTGCT Dazl-2 (SEQIDNO.4) TGCGTCACAAAGTTAGGCA Act-RT-1 (SEQIDNO.5) AACACCCCAGCCATGTATGTA Act-RT-2 (SEQIDNO.6) TTTCATTGTGCTAGGTGCCA
Primers V-1 and V-2 were used to amplify a 751 bp fragment from the CVH transcript. Primers Dazl-1 and Dazl-2 were used to amplify a 536 bp fragment from the Dazl transcript. Primers Act-RT-1 and Act-RT-R were used to amplify a 597 bp fragment from the endogenous chicken -actin transcript. PCR reactions were performed with AmpliTaq Gold (Applied Biosystems) following the manufacturer's instructions.

Example 3. PGCs Express the CVH Protein

[0062] Protein was extracted from freshly isolated PGCs using the T-Per tissue protein extraction kit (Pierce). Protein from cells was extracted by lysing the cells in 1% NP.sub.4O; 0.4% deoxycholated 66 mM EDTA; 10 mM, Tris, pH7.4. Samples were run on 4-15% Tris-HCL ready gel (Bio-Rad). After transfer onto a membrane, Western blots were performed with Super Signal West Pico Chemiluminescent Substrate kits (Pierce) as instructed. A rabbit anti-CVH antibody was used as a primary antibody (1:300 dilution) and a HRP-conjugated goat anti-rabbit IgG antibody (Pierce, 1:100,000) was used as a secondary antibody (FIG. 3).

Example 4. Cultured PGCs Express Telomerase

[0063] Primordial germ cells were pelleted and washed with PBS before being frozen at 80 C. until analysis. Cell extracts were prepared and analyzed according to the manufacturer's directions using the TRAPeze Telomerase Detection Kit (Serologicals Corporation) which is based upon the Telomeric Repeat Amplification Protocol (TRAP) (Kim et al., 1994). FIG. 4.

Example 5. Embryonic Germ (EG) Cells can be Derived from Cultures of PGCs

[0064] Chicken EG cells have been derived from PGCs by allowing the cells to attach to the plate and subsequently removing FGF, SCF and chicken serum; these conditions are the same as those for ES cell culture. The morphology of the cEG cells is very similar to the cES cells (FIG. 5A,B). When cEG cells are injected into Stage X (E-G&K) embryos, they have the ability to colonize somatic tissues and make chimeras that, as juveniles, appear identical to chimeras made with cES cells (FIG. 6).

Example 6. Cultured PGCs Give Rise to Functional Gametes

[0065] PGCs that were cultured for 40 days or 110 days were injected into Stage 13-16 (H&H) White Leghorn embryos and 23 chicks have hatched. All of these chicks are phenotypically White Leghorns. The males were reared to sexual maturity and have been mated to Barred Rock hens (Table 1). The rate of germline transmission of the roosters varied from <1% to 87% (Table 1 and FIG. 7).

TABLE-US-00002 TABLE 1 The rate of germline transmission of roosters, injected with PGCs that had been cultured for 40 and 110 days. Days in # # Black % Germline Rooster culture Offspring Offspring Transmission IV7-5 40 460 95 17 IV7-6 40 672 1 0.1 IV7-22 40 306 5 2 IV9-1 110 470 410 87 IV 9-2 110 584 19 3 IV 9-13 110 341 2 0.6 IV 9-15 110 482 7 1.5 IV 9-48 110 356 5 1.4

[0066] PGCs may also be injected into the subgerminal cavity of stage X embryos. 1000 or 5000 PGCs were injected after 209 days of culture into irradiated embryos. Hatched male chicks were grown to sexual maturity and bred to test for germline transmission. In 3 out of 4 roosters tested germline transmission observed in varying frequency of 0.15 to 0.45%. This indicates that PGCs can colonize the germline when injected before gastrulation.

Example 7. Sensitivity of PGCs to Neomycin and Puromycin

[0067] The sensitivity of PGCs to puromycin and neomycin was determined to establish the concentration of puromycin and neomycin required to allow the growth of cells that express antibiotic resistance under the control of the CX-promoter which is strongly expressed in all tissues (Origen Therapeutics, unpublished). These experiments demonstrated that a concentration of 300 g/ml neomycin for 10 days is necessary to eliminate all non-transfected cells. A concentration of 0.5 g/ml puromycin was sufficient to eliminate PGCs within 7-10 days.

Example 8. Genetic Modification of PGCs

[0068] Twenty microgram (20 l) of a NotI linearized cx-neo transgene (see FIG. 8) was added to a population of 5.810.sup.6 PGCs that had been in culture for 167 days. The cells and DNA were resuspended in 800 l of electroporation buffer and 8 square wave pulses of 672 volts and 100 sec duration were applied. After ten minutes, the cells were resuspended in culture medium and aliquoted into 24-well plates. Two days after electroporation, 300 g of neomycin were added per ml of medium to select cells that were expressing the cx-neo transgene. The cells were kept under selection for 19 days. After 19 days, the cells were taken off selection and expanded for analysis. A proportion of the PGCs was kept under 300 g/ml for another 31 days demonstrating that the PGCs were functionally resistant to the antibiotic.

[0069] Referring to FIG. 8, for the plasmid control, the cx-neo plasmid DNA was linearized with NotI and then digested with EcoRI or BamHI to produce a fragment that is slightly smaller (5 kb) than the intact plasmid which is shown by the HindIII digestion. Internal fragments of approximately 2 kb of the cx-neo plasmid were released by digestion with StyI or NcoI. A larger internal fragment of approximately 2.6 kb was released by digestion with EcoRI and KpnI. Digestion of genomic DNA from the line of PGCs with EcoRI, BamHI and HindIII revealed bands that are larger than 6 kb illustrating that the cx-neo transgene was incorporated into the PGC genome. The internal fragments revealed in plasmid DNA following digestion with StyI, NcoI and EcoRI with KpnI were also present in genomic DNA from the PGCs indicating that the cx-neo transgene was integrated into the PGC genome without alteration. Using conventional transgene construction techniques, additional elements can be incorporated such as regulatory elements, tissue specific promoters and exogenous DNA encoding proteins are examples. Monoclonal antibodies are preferred example of a protein encoded by exogenouse DNA and human monoclonals are preferred species thereof.

[0070] As noted above, the performance of genetic modifications in PGCs to produce transgenic animals has been demonstrated in only a very few species. Analogous genetic manipulations can be achieved in chicken PGCs by referring to those achieved using ES cells in mice. In mice, the separate use of homologous recombination followed by chromosome transfer to embryonic stem (mES) cells for the production of chimeric and transgenic offspring is well known. Powerful techniques of site-specific homologous recombination or gene targeting have been developed (see Thomas, K. R. and M. R. Capecchi, Cell 51: 503-512, 1987; review by Waldman, A. S., Crit. Rev. Oncol. Hematol. 12: 49-64, 1992). Insertion of cloned DNA (Jakobovits, A., Curr. Biol. 4: 761-763, 1994) and manipulation and selection of chromosome fragments by the Cre-loxP system techniques (see Smith, A. J. et al., Nat. Genet. 9:376-385, 1995; Ramirez-Solis, R. et al., Nature 378:720-724, 1995; U.S. Pat. Nos. 4,959,317; 6,130,364; 6,130,364; 6,091,001; 5,985,614) are available for the manipulation and transfer of genes into mES cells to produce stable genetic chimeras. Many such techniques that have proved useful in mammalian systems would be available to be applied to chicken PGCs if the necessary cultures were available.

[0071] The genome of primordial germ cells is generally believed to be in a quiescent state and therefore the chromatin may be in a highly condensed state. Extensive testing of conventional electroporation protocols suggest that special methods are needed to introduce genetic modifications into the genome of PGCs. As described below, the transgenes may be surrounded with insulator elements derived from the chicken -globin locus to enhance expression. The inclusion of the -globin insulator elements routinely produces clones that can be grown, analyzed and injected into recipient embryos.

[0072] The conventional promoters that are used to drive expression of antibiotic (e.g. neomycin, puromycin, hygromycin, his-D, blasticidin, zeocin, and gpt) resistance genes are expressed ubiquitously. Typically, the promoters are derived from housekeeping genes such as -actin, CMV, or ubiquitin. While constitutive promoters are useful because they are typically expressed at high levels in all cells, they continue to be expressed in most if not all tissues throughout the life of the chicken. In general, expression should be limited to only the tissue and stage of development during which expression is required. For selection of primordial germ cells, the period during which expression is required is their residence in vitro when the antibiotic is present in the media. Once the cells have been inserted into the embryo, it is preferable to terminate expression of the selectable marker (i.e. the antibiotic resistance gene). To restrict expression of the antibiotic resistance genes, the early response to neural induction (ERNI) promoter is used. An ERNI is a gene that is selectively expressed during the early stages of development (e.g. Stage X (E-G&K)) and in culture, and therefore, this promoter is used to drive expression of antibiotic resistance genes to select PGCs carrying a genetic modification. Since ERNI is only expressed during the early stages of development, the genes that confer antibiotic resistance are not expressed in the mature animals.

Example 9. Homogeneity of Long Term PGC Cell Cultures

[0073] To determine the homogeneity of PGC cultures after long-term culture, ES, EG, DT40 (chicken B cell line) and PGCs were stained with anti-CVH, an antibody against the chicken vasa homologue and the 1B3 antibody (Halfter, W., Schurer, B., Hasselhorn, H. M., Christ, B., Gimpel, E., and Epperlein, H. H., An ovomucin-like protein on the surface of migrating primordial germ cells of the chick and rat. Development 122, 915-23. 1996)). Expression of the CVH antibody is restricted to germ cells and therefore, the anti-CVH antibody is a reliable marker for them. The 1B3 antigen recognizes an ovomucin-like protein present on the surface of chicken PGCs during their migration and colonization of the gonad.

[0074] Cells were washed in CMF/2% FBS, fixed in 4% paraformaldehyde for 5 minutes and washed again. The cell aliquots to be stained for vasa were permeabilized with 0.1% TritonX-100 for 1-2 minutes. Primary antibody was added for 20 minutes, cells were washed twice and incubated with a secondary antibody (Alexa 488 anti-rabbit IgG for CVH and control and Alexa 488 anti-rabbit IgM for 1B3) for 15 minutes. As controls, aliquots of cells were stained only with second antibody. After an additional 2 washes the cells were prepared for FACS analysis.

[0075] Referring to FIG. 9, DT40, ES and EG cells all show background when stained with CVH and the 1B3 Ab. PGCs, however, stain much stronger with both the CVH and the 1B3 antibody. There is a small population of PGCs, which do not stain for either CVH or 1B3 indicating that a small proportion of the cells do not display the PGC phenotype. Two parental PGC lines and 4 transfected cell lines (G-09, P84, P97/6 and P97/33) derived from the PGC13 parental cell line, were tested with the vasa and 1B3 antibody (PGC13 and 102). All show the same pattern indicating that the various PGC cultures contain the same high proportion of cells expressing the PGC phenotype.

Example 10: Germline Transmission of Cultured PGCs

[0076] Primordial germ cell lines were derived from individual Barred Rock embryos. After establishment of the line, the cells were injected into Stage 13-15 (H&H) embryos. The embryos were grown to sexual maturity and the roosters were mated to Barred rock hens. Black offspring were indicative of germline transmission of the injected PGCs. All of the 21 males from the 4 different cell lines that have been tested for germline transmission to date have contributed to the germline. The minimum and maximum durations in culture were 35 days and 47 days, respectively (Table 2).

TABLE-US-00003 TABLE 2 Germline transmission of chimeric roosters Days % germline Rooster Cell line cultured # cells injected transmission IV14-32 PGC21 44 1500 21 IV14-41 PGC21 44 1500 10 IV14-47 PGC21 44 1500 16 IV15-03 PGC35 35 3000 23 IV15-04 PGC35 35 3000 80 IV15-12 PGC35 35 3000 61 IV15-18 PGC35 35 3000 47 IV15-21 PGC35 35 3000 15 IV15-27 PGC35 35 3000 85 IV15-33 PGC35 35 3000 86 IV16-02 PGC34 47 3000 74 IV16-03 PGC34 47 3000 42 IV16-13 PGC34 47 3000 80
Of the PGC derived offspring a male and female were mated and their offspring incubated and hatched. A total of 7 eggs were set and all 7 hatched indicating that offspring derived from cultured PGCs can have normal reproductive function.

Example 11: Genetic Modification of Primordial Germ Cells

[0077] Electroporation with a circular CX-GFP plasmid revealed that the rate of transient transfection in PGCs varied between 1-30%. Using 8 Square wave pulses of 100 sec and 800V we obtained a PGC cell line carrying a CX-neo construct, that was designated G-09. See FIG. 8. The integration of the construct was evaluated using Southern blot analysis. The isolation of this stably transfected line, however, was a spurious event that did not recur in subsequent experiments. With the exception of G-09, stable transfection of PGCs was not achieved after electroporating 1710.sup.7 PGCs with linearized constructs in 37 transfection experiments using both square wave and exponential decay pulses. In each of these experiments, the number of PGCs varied from 110.sup.6 to 1010.sup.6. The following promoters, used widely in ES cell research in mouse, chicken and human were tested: the CX promoter, also called CAG (Niwa, H., Yamamura, K., and Miyazaki, J., Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193-9.1991)), which contains the chicken -actin promoter with a CMV enhancer, the PGK promoter, the MC1 promoter and the Ubc promoter. None of these promoters increased transfection efficiency. To allow expression of selectable markers and clonal derivation of genetically modified cell lines, insulators have been used with integrated constructs.

[0078] Insulators are DNA sequences that separate active from inactive chromatin domains and insulate genes from the activating effects of nearby enhancers, or the silencing effects of nearby condensed chromatin. In chickens, the 5HS4 insulator located 5 of the -globin locus has been well characterized by Felsenfeld and colleagues (Burgess-Beusse, B., Farrell, C., Gaszner, M., Litt, M., Mutskov, V., Recillas-Targa, F., Simpson, M., West, A., and Felsenfeld, G. (2002)). The insulation of genes from external enhancers and silencing chromatin. Proc Natl Acad Sci USA 99 Suppl 4, 16433-7. This insulator protects the -globin locus from an upstream region of constitutively condensed chromatin. We assembled a transgene with the chicken -actin promoter driving neomycin resistance using the chicken -globin 5HS4 sequence as insulators both 5 and 3 of the chicken -actin-neo cassette.

[0079] The 250 bp core sequence of hypersensitive site 4 from the chicken -globin locus was PCR amplified with the following primer set:

TABLE-US-00004 HS4-Bam-F: (SEQID.NO.7) AGGATCCGAAGCAGGCTTTCCTGGAAGG HS4-Bgl-R: (SEQID.NO.8) AAGATCTTCAGCCTAAAGCTTTTTCCCCGT

[0080] The PCR product was cloned into pGEM-T and sequenced. A tandem duplication of the HS4 site was made by digesting the HS4 in the pGEM clone with BamHI and BglII to release the insert, and BglII to linearize the vector. The HS4 fragment was ligated to the vector containing a copy of the HS4 insulator, so that two copies were present. Clones were screened and one was selected in which the two copies of HS4 are in the same orientation. This is called 2 HS4.

Example 12: Bulk Selection Using HS4 -Acton-Neo

[0081] -actin neo was obtained from Buerstedde (clone 574) and transferred into pBluescript. 2 HS4 was then cloned at both the 5 and 3 ends of -actin neo to produce HS4--actin neo. Eight transfections were performed using this construct. For each transfection 510.sup.6 PGCs were resuspended in 400 l electroporation buffer (Specialty Media) and 20 g of linearized DNA was added. A Exponential Decay (ED) pulse (200V, with 900-1100 F) or a Square Wave (SW) pulses (250-350V, 8 pulses, 100 sec) were given. After transfection the cells were grown for several days before neomycin selection (300 g/ml) was added. Each transfection was grown as a pool. Resistant cells were isolated from 5 of 8 transfections

[0082] Southern analysis was performed on 2 pools of transfected cells (FIG. 10). Two pig genomic DNA from PGC lines P84 and P85 and 20 pg of plasmid (HS4--actin neo) were digested. Digests were run on a 0.7% gel, transferred by capillary transfer in 10SSC to nylon membrane overnight, and probed with radiolabeled neo gene sequences for 2 hours in Rapid Hyb (Amersham). After washing, the blot was exposed to film overnight at 80 C. Referring to FIG. 10, Lane1 is P84, Lane 2 is P85 and Lane 3 is the plasmid. For the plasmid control the HS4--actin-neo plasmid DNA was linearized with Not1. To obtain a 2.3 Kb internal fragment the PGC DNA and the linearized plasmid were digested with BamH1. Both P84 and P85 show an internal fragment of 2.3 Kb in size. A larger internal fragment of approximately 2.6 Kb was released by digestion with HindIII. Again this internal fragment is present in both the P84 and P85 digests. Digestion of genomic DNA of P84 and P85 with EcoR1 and BglII should reveal bands larger than 2.9 Kb if the transgenes are integrated into the genome. In P84 no junction fragments are seen, indicating that P84 is a composite of several different clones. In P85, junction fragments of 4.5-5 kb are present in the EcoR1 digestion and a junction fragment of 5 Kb is present in the BglII digestion indicating that P85 is integrated into the genome and that the culture is comprised substantially from one clone. This example shows the utility of insulators as a preferred element of a construct for reliable expression of selectable markers in primordial germ cells.

Example 13: Clonal Derivation of Genetically Modified PGCs

[0083] The following examples show that genetically modified lines of primordial germ cells can be clonally derived.

[0084] First, -actin-eGFP was made. The eGFP gene was released from CX-eGFP-CX-puro with XmnI and KpnI, -actin was released from HS4--actin puro with EcoRI and XmnI, and the two were cloned as a 3-way ligation into pBluescript digested with EcoRI and KpnI to produce -actin EGFP. Then, -actin eGFP was released with BamHI and KpnI (blunted with T4 DNA polymerase) and cloned into HS4--actin puro digested with BglII and EcoRV.

[0085] Five transfections were performed using this construct. For each transfection 510.sup.6 PGCs were resuspended in 400 l electroporation buffer (Specialty Media) and 20 g of linearized DNA was added. An ED pulse (150-200V; 900 F) or SW (350V, 8 pulses, 100 sec) pulses were given. After transfection the cells were plated into individual 48 wells and grown for several days before selection (0.5 g/ml) was added. A total of 5 clones were observed in 4 of the 5 transfections. One clone TP103 was analyzed by Southern (FIG. 11). Referring to FIG. 11, the plasmid control DNA was linearized with NotI. An internal fragment was released by digesting the DNA with KpnI. In both TP103 and the plasmid a fragment of the same size was released. Digestion of genomic DNA of TP103 with NcoI, MfeI, and SphI should reveal bands that are larger than the corresponding lanes of digested plasmid DNA. No band is seen in the lane of MfeI digested TP103 genomic DNA, which may be due to the band being too large. In the lanes representing the NcoI and SphI digestions, fragments have been released in the TP103 genomic DNA that are substantially larger than the fragments released in the plasmid DNA, indicating that the transgene is incorporated into the genome of the TP103 cell line.

Clonal Derivation of HS4--Actin-Puro.

[0086] First, -actin puro was made by a 3-way ligation of puro from CX-EGFP-CX-puro (XmnI-EcoRI), -actin from -actin neo in pBS (see above)(Sal-XmnI), and pBluescript (SalI-EcoRI). Next, -actin puro was cloned into pBS containing two copies of 2 HS4 by ligating BamHI digested -actin puro into BamHI/SAP treated 2 HS4 vector.

[0087] Three transfections were performed using this construct. For each transfection 4-510.sup.6 PGCs were resuspended in 400 l electroporation buffer (Specialty Media) and 20 g of linearized DNA was added. An ED pulse was given of 200V, 900 F. After transfection the cells were plated into individual 48 wells and grown for several days before selection (0.5 g/ml) was added. No colonies were seen in 2 transfections. Two colonies were isolated from the third transfection.

Clonal Derivation of HS4-Cx-eGFP-Cx-Puro.

[0088] Three transfections were performed with HS4-cx-eGFP-cx-Puro. 510.sup.6 PGCs were resuspended in 400 l electroporation buffer (Specialty Media) and 20 s of linearized DNA was added. Eight SW pulses of 350V for 100 sec was given to each transfection. After transfection the cells were plated in individual 48 wells, grown for several days before puromycin selection (0.5 g/ml) was added. A total of 16 clones were isolated from 2 transfections.

Clonal Derivation of Cx-Neo.

[0089] The PGC 13 cell line was electroporated with a plasmid carrying a cx-neo selectable marker. After exposure to neomycin a cell line was derived that was resistant to neomycin (G-09). The karyotype of this cell line was determined and all cells exhibited a deletion in the p-arm of chromosome 2 (Table 3 and FIG. 12). These data demonstrate that G-09 was clonally derived from a PGC carrying a signature deletion in the p-arm of chromosome 2.

TABLE-US-00005 TABLE 3 Chromosomal analysis of G-09 cell line. Chromosomes Cell 1 2 2p- 3 4 Z Micros 1 2 1 1 2 2 2 69 2 2 1 1 2 2 2 44 3 2 1 1 2 2 2 56 4 2 1 1 2 2 2 56 5 2 1 1 2 2 2 65 6 2 1 1 2 2 2 67 7 2 1 1 2 2 2 59 8 1 0 1 1 2 1 38 9 2 1 1 2 2 2 65 10 2 0 1 2 2 2 55 11 2 1 1 2 2 2 43 12 2 1 1 2 2 2 59 13 2 0 1 2 2 2 55 14 2 0 1 2 2 2 33 15 1 1 1 2 2 2 56 16 2 1 1 2 2 2 62

Example 14: Tissue Specific Expression of Selectable Markers in PGCs

[0090] The gene ERNI is expressed from the pre-primitive streak stage in the chicken embryo and is an early response gene to signals from Hensen's node Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A., and Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature 406, 74-8. Furthermore ERNI is expressed in chicken ES cells Acloque, H., Risson, V., Birot, A., Kunita, R., Pain, B., and Samarut, J. (2001). Identification of a new gene family specifically expressed in chicken embryonic stem cells and early embryo. Mech Dev 103, 79-91. The ERNI gene (also called cENS-1) has an unusual structure in which a single long open reading frame is flanked by a 486 bp direct repeat, in addition to unique 5 and 3 UTR sequences. Based on the idea that this structure is reminiscent of a retroviral LTR-like structure, Acloque et al. 2001 assayed different portions of the cDNA sequence for promoter/enhancer activity and found that a region of the unique sequence in the 3 UTR acts as a promoter. PCR primers were designed essentially as described (Acloque et al., 2001) to amplify an 822 bp fragment of the 3 UTR of the ERNI gene. After amplification of the ERNI sequences, they were cloned upstream of the neomycin-resistance gene, with an SV40 polyA site, to generate ERNI-neo (1.8 kb). The 2 HS4 insulator was then cloned on either side of the ERNI-neo selectable marker cassette.

[0091] Two transfections were performed with HS4-Erni-neo. 510.sup.6 PGCs were resuspended in 400 l electroporation buffer (Specialty Media) and 20 g of linearized DNA was added. In the first transfection a single ED pulse of 175V, 900 F was given and in the second transfecton, 8 SW pulses of 100 sec and 350V were given. After transfection the cells were plated in individual 48 wells, grown for several days before neomycin selection (300 g/ml) was added. In the first transfection (ED pulse) 5 colonies were isolated, and in the second transfection (SW pulses) 11 colonies were isolated.

[0092] The isolation of stably transfected clones indicates that ERNI is expressed in PGCs and can be used as a tissue specific promoter.

Example 15: Contribution of Transfected PGCs to the Germline

[0093] PGCs were transfected with HS4-actin-GFP and injected into the vasculature of Stage 13-15 (H&H) embryos. At D18, gonads were retrieved, fixed, sectioned and stained with the CVH antibody to identify the germ cells. The stained sections were then analyzed for the presence of GFP positive cells in the gonads. GFP positive germ cells were found in both male (FIG. 13) and female gonads. Examination of histological preparations of brain, heart muscle and liver of these embryos showed only four green cells in one slide. These data demonstrate that a few cultured PGCs are found in ectopic locations but that the vast majority of cultured PGCs preferentially colonize the germline.

[0094] To determine that the GFP positive cells were germ cells the sections were stained with the anti-CVH antibody. As can be seen in FIG. 14, the GFP positive cells also stain for the CVH protein, indicating that the GFP positive cells are germ cells.

[0095] Referring to FIG. 14, GFP positive cells are present in this section and the DAPI/GFP panel shows that these GFP positive cells are located within the seminiferous tubule. When germ cells are stained with the anti-CVH antibody they exhibit a intense red stained ring that delineates the cytoplasm of the germ cells. The DAPI/CVH panel shows that these cells are located within the seminiferous tubule. The last panel shows that the GFP positive cells also stain for CVH and that the seminiferous tubules contains CVH positive germ cells that are GFP negative.

[0096] Although the examples herein are described for chickens, other gallinaceous species such as quails, turkey, pheasant, and others can be substituted for chickens under experimentation and with a reasonable expectation for successful implementation of the methods disclosed here.