Assays, Methods and Means
20170088876 ยท 2017-03-30
Assignee
Inventors
- Patrick Henry Maxwell (Oxford, GB)
- Christopher William Pugh (Oxford, GB)
- Peter John Ratcliffe (Oxford, GB)
- Christopher Joseph Schofield (Oxford, GB)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K31/265
HUMAN NECESSITIES
C07C235/80
CHEMISTRY; METALLURGY
A61K31/185
HUMAN NECESSITIES
A61K31/235
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
A61K31/455
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
A61K31/137
HUMAN NECESSITIES
A61K31/4412
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K31/165
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
G01N2500/04
PHYSICS
C07K2317/30
CHEMISTRY; METALLURGY
C07C323/60
CHEMISTRY; METALLURGY
A01K2217/05
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K31/197
HUMAN NECESSITIES
C12N9/0071
CHEMISTRY; METALLURGY
C07C327/32
CHEMISTRY; METALLURGY
A61K31/194
HUMAN NECESSITIES
A61K31/44
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
A61K31/14
HUMAN NECESSITIES
A61K31/327
HUMAN NECESSITIES
A61K31/221
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
A61K31/166
HUMAN NECESSITIES
International classification
A61K31/185
HUMAN NECESSITIES
A61K31/137
HUMAN NECESSITIES
A61K31/194
HUMAN NECESSITIES
A61K31/44
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
A61K31/166
HUMAN NECESSITIES
A61K31/165
HUMAN NECESSITIES
A61K31/235
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
Abstract
A novel class of hydroxylases is described having the amino acid sequence of SEQ ID NO: 2, 4, 6 and 8, and variants and fragments thereof having HIF hydroxylation activity. The polypeptides of the invention have in particular prolyl hydroxylase activity. An assay method monitors the interaction of the HIF hydroxylase with a substrate. Modulators of HIF hydroxylase are provided for use in the treatment of a condition associated with increased or decreased HIF levels or activity or for the treatment of a condition where it is desirable to modulate HIF levels or activity.
Claims
1-55. (canceled)
56. A method of treatment of a hypoxic condition by administering a substance that inhibits the hydroxylation of one or more prolyl residues of a human HIF- protein mediated by a HIF prolyl hydroxylase, wherein that substance has been identified as inhibiting such hydroxylation by means of an assay comprising contacting a HIF prolyl hydroxylase and a substrate of the hydroxylase under a condition in which the hydroxylase interacts with the substrate, in the presence or absence of a test substance; and determining the interaction, or lack of interaction of, the hydroxylase and the substrate by measuring the hydroxylase activity of the hydroxylase; wherein the HIF prolyl hydroxylase is chosen from (1) the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8; and (2) a fragment thereof containing a -barrel jelly roll structure and having HIF hydroxylase activity.
57. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay contains the motif HXD[X].sub.nH, where X is any amino acid and n is any number between 1 and 200, and where the HXD portion of the HXD[X].sub.nH motif is on the second strand of the -barrel jelly roll structure.
58. The method of claim 57, wherein the HIF prolyl hydroxylase used in the assay contains the sequence M(X).sub.13HXD(X).sub.4D(X).sub.7Y(X).sub.14L(X).sub.14P(X).sub.10D(X).sub.4HXV(X).sub.6R where X is any amino acid residue.
59. The method of claim 57, wherein the HIF prolyl hydroxylase used in the assay has the remaining H of the HXD[X].sub.nH motif on the seventh strand thereof.
60. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay hydroxylates the prolyl residue of a motif LXXLXP contained in the substrate, where X is any amino acid.
61. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay has the amino acid sequence of SEQ ID NO: 4.
62. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay is a fragment of SEQ ID NO: 4 containing a -barrel jelly roll structure and having HIF hydroxylase activity.
63. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay has the amino acid sequence SEQ ID NO: 6.
64. The method of claim 56, wherein the HIF prolyl hydroxylase used in the assay is a fragment of SEQ ID NO: 6 containing a -barrel jelly roll structure and having HIF hydroxylase activity.
65. The method of claim 56, wherein the hypoxic condition is anaemic, histotoxic, stagnant or generalized hypoxia.
66. The method of claim 65, wherein the hypoxic condition is ischaemic hypoxia.
67. The method of claim 66, wherein the treatment is applied following tissue damage.
68. The method of claim 66, wherein the treatment is prophylactic.
69. The method of claim 65, wherein the hypoxic condition is anaemic hypoxia.
70. The method of claim 56, wherein the substance is a 2-oxoglutarate analogue.
71. The method of claim 56, wherein the substance has the following formula:
R.sup.1-A*B*C*D(R.sup.2).sub.y where the group R.sup.1 is capable of forming an electrostatic interaction with the side chain of the arginine which together with other residues binds the 5-carboxylate of 2-oxoglutarate during catalysis, A*B is a chain of two atoms which are, independently, carbon, oxygen, nitrogen or sulphur, C*D is a chain of two atoms which are, independently, carbon, oxygen, nitrogen, or sulphur, and y is 0 or 1, with A, B, C and D being linked to one another by single and/or double and/or triple bonds, such that when y is 0 or 1 at least one of the atoms of A, B, C or D is capable of chelating with a metal group, and when y is 1 said chain is attached to R.sup.2 which is capable of chelating with a metal group.
72. The method of claim 71, wherein at least one of A, B, C and D is not carbon in the substance formula.
73. The method of claim 71, wherein the A*B*C*D chain in the substance formular is selected from the group consisting of CNCC, CCCO, and COCC.
74. The method of claim 71, wherein A*B*C*D in the substance formula forms part of a ring.
75. The method of claim 74, wherein the ring is pyrolidine or an unsaturated derivative thereof.
76. The method of claim 71, wherein R.sup.1 in the substance formula is an acid group.
77. The method of 71, wherein R.sup.2 in the substance formula is selected from the group consisting of SH, OH, CO.sub.2H, SO.sub.3H, B(OH).sub.2, PO.sub.3H.sub.2, NHOH, CONHR.sup.3, CONHOR.sup.3, CONHR.sup.3, and CONR.sup.3OR.sup.3 where R3 is a branched or straight chain alkyl group of 1 to 6 carbon atoms which can be functionalized.
78. The method of claim 56, wherein the substance is a N-containing heterocyclic compound having one of the following formulae: ##STR00063## where R.sup.1 to R.sup.5 may be H, a branched or straight C.sub.1 to C.sub.6 alkyl chain such as Me, a 4 to 7 membered heterocyclic ring optionally containing 1 or more N, S, O or P atoms, or a 5 or 6 membered aromatic ring, optionally containing 1 or more N, O or S atoms, which can be fused to another ring, or a said alkyl chain substituted by a said aromatic group, A=substituted alkylene, BCO.sub.2H, NHSO.sub.2CF.sub.3, tetrazolyl, imidazolyl or 3-hydroxyisoxazolyl, and m is 0 or 1, ##STR00064## where R.sup.I to R.sup.iv may independently be H, a branched or straight chain alkyl of from 1 to 6 C atoms, a halogen group (i.e. fluoro-, chloro-, bromo- or iodo-), a carboxylate group, a 4 to 7 membered heterocyclic ring optionally containing 1 or more N, S, O or P atoms, a 5 or 6 membered aromatic ring, optionally containing 1 or more N, O or S atoms which can be fused to another ring or a said alkyl chain substituted by a said aromatic ring, or a C(O)XR group as defined below, X is O, NH, NR, where R is H, OH, a branched or straight chain alkyl of from 1 to 6 C atoms which can be functionalised, alkoxy containing a branched or straight chain alkyl of from 1 to 6 C atoms which can be functionalised, a 4 to 7 membered heterocyclic ring optionally containing 1 or 2 N, S, O or P atoms, a 5 or 6 membered aromatic ring, optionally containing 1 or 2 N, O or S atoms which can be fused to another ring, such that RX is typically straight or branched C.sub.1 to C.sub.6 alkoxy, and m is 0 or 1, ##STR00065## where XO, Y N or CR.sub.3, m=O or 1, A=substituted alkylene, BCO.sub.2H, NHSO.sub.2CF.sub.3, tetrazolyl, imidazolyl or 3-hydroxyisoxazolyl, R.sup.1, R.sup.2 and R.sup.3 may independently be H, OH, halo, cyano, CF.sub.3, NO.sub.2, CO.sub.2H, alkyl, cycloalkyl, cycloalkoxy, aryl, aralkynyl, alkynylcarbonyl, alkylcarbonyloxy, carbamoyl, alkynyloxyalkyl, alkenyloxy, alkoxyalkoxy, alkynyl, retinyloxycarbonyl, alkenyloxycarbonyloxy, where R.sup.1 and R.sup.2 or R.sup.2 and R.sup.3(CH.sub.2)O in which 1-2 CH.sub.2 groups of the saturated or C:C unsaturated chain may be replaced by O, S, SO, SO.sub.2 or imino, o=3-5, R4H, and ##STR00066## where A=(substituted alkylene), B(modified) carboxy, tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, R4H, OH, halo, cyano, CF.sub.3, NO.sub.2, CO.sub.2H, alkyl (e.g. branched or straight chain C.sub.1-C.sub.6 alkyl), cycloalkyl, cycloalkylalkyl, cycloalkylalkoxy, cycloalkoxyalkyl, aryl, aralkyl, aralkoxy, hydroxyalkyl, alkenyl, alkynyl, alkynyloxyalkyl, alkoxycarbonyl, alkylcarbonyloxy, arylcarbonyloxy, cinnamoyl, alkenylcarbonyl, arylcarbamoyl or aralkoxycarbonyloxy.
79. The method of claim 56, wherein the substance has one of the following formulae: ##STR00067## where R.sup.I to R.sup.vi may independently be H, a branched or straight C.sub.1 to C.sub.6 alkyl chain, a 4 to 7 membered heterocyclic ring optionally containing 1 or 2 N, S, O or P atoms, a 5 or 6 membered aromatic ring, optionally containing 1 or 2 N, O or S atoms, which can be fused to another ring, or a said alkyl chain substituted by a said aromatic ring, preferably H or methyl, R.sub.2O is hydrogen or acyl typically aromatic acyl such as benzoyl, X is NH, NR, where R is OH, Me, alkyl, OMe, Oalkyl with a C.sub.1 to C.sub.6 alkyl chain, and Y is O or S.
80. The method of claim 56, wherein the substance has one of the following formulae: ##STR00068## where R.sup.1 is H, a branched or straight C.sub.1 to C.sub.6 alkyl chain which can be functionalised, any natural amino acid side chain for example of glutamic acid, a 4 to 7 membered heterocyclic ring optionally containing 1 or 2 N, S, O or P atoms or a 5 or 6 membered aromatic ring, optionally containing 1 or 2 N, O or S atoms which may be fused to another ring or a said alkyl chain substituted by a said aromatic ring and each of R.sup.2 to R.sup.6, which may be the same or different, is as defined for R1 or is NH2 or OR.sup.7 where R.sup.7 is as defined for R.sup.1 and E represents a monocyclic ring system such as thiophene or pyran and E is absent or forms with E a bicyclic ring system such as naphthalene or indole, E typically being benzene.
81. The method of claim 56, wherein the substrate used in the assay is a HIF- protein or fragment thereof having one or more prolyl residues that is/are hydroxylated in a condition in which the hydroxylase interacts with the substrate and the hydroxylase activity is determined by measuring the hydroxylation of one or more proline residues of the substrate.
82. The method of claim 56, wherein the condition under which the assay is carried out include the presence of 2-oxoglutarate and wherein the hydroxylase activity is determined by measuring the turnover of the 2-oxoglutarate to succinate and carbon dioxide.
83. The method of claim 56, wherein the condition under which the assay is carried out include the presence of dioxygen.
84. The method of claim 56, wherein the condition under which the assay is carried out include the presence of ascorbate and ferrous iron.
85. The method of claim 56, wherein the assay is carried out in the presence of a reducing agent.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0422]
[0423]
[0424]
[0425]
[0426]
[0427]
[0428]
[0429]
[0430]
[0431]
[0432]
[0433]
[0434]
[0435]
[0436]
[0437]
EXAMPLES
Example 1. Oxygen Regulated Modification by Enzymatic Prolyl Hydroxylation Targets HIF- to the Von Hippel-Lindau Ubiquitylation Complex
[0438] In this example it is shown that the interaction between pVHL and a specific domain of the HIF-1 subunit is regulated by enzymatic hydroxylation of a proline residue (HIF-1 P564) in a manner that is dependent on oxygen and iron. An absolute requirement of the enzyme for dioxygen as a co-substrate and iron as a cofactor suggests a direct mechanism of cellular oxygen sensing.
[0439] In previous studies of the HIF-/pVHL interaction we found that treatment of cells with cobaltous ions and iron chelators prevented the HIF-/pVHL association suggesting that the oxygen sensing mechanism might impinge directly on this protein interaction (8). Surprisingly, these studies indicated that the HIF-/pVHL complex could be retrieved intact from hypoxic cells. Given the rapidity of pVHL dependent proteolysis of HIF- in oxygenated cells, we considered that re-oxygenation of cell extracts during cell lysis might have promoted the observed HIF-/pVHL interaction in vitro. To test this we repeated pVHL co-immunoprecipitation experiments in extracts of .sup.35S-methionine/cysteine labelled cells exposed to hypoxia and harvested in a hypoxia work station using deoxygenated buffers, or exposed to hypoxia and harvested conventionally (18).
[0440] Experiments were performed on stably transfected renal carcinoma cells expressing hemagglutinin (HA) tagged VHL (RCC4/VHL.HA)(11). RCC4 cells, which lack pVHL, were used as a control. RCC4/VHL.HA cells were labelled with .sup.35S-amino acids in the presence of the proteasomal inhibitor MG132, either in normoxia or hypoxia for 4 hrs. Cells were lysed on ice, either in the hypoxic workstation or on the bench. RCC4 cells were also similarly labelled and lysed and both labelling and lysis were carried out under normoxic conditions, pVHL and associated proteins were captured with anti-HA antibody. As reported previously (8), anti-HA immunoprecipitates captured HIF- subunits (HIF-1 and HIF-2) efficiently from the proteasomally blocked normoxic cells. However, when hypoxic RCC4/VHL.HA cells were lysed under hypoxic conditions, HIF- subunits were not co-precipitated with pVHL, despite abundance in the lysate as demonstrated by a HIF-1 immunoblot. This contrasted with the result using conventional buffers, which had not been deoxygenated, where HIF- subunits were captured very efficiently. Capture of pVHL and elongins B&C was found to be similar in all RCC4/VHL.HA samples.
[0441] Taken together with previously published data, these results indicate that the classical features of regulation by oxygen and iron availability (and interference by cobaltous ions) are reflected in the HIF-/pVHL interaction in vivo, and that promotion of the interaction mediated by oxygen can occur rapidly during the preparation of a cell extract.
1.1: Oxygen Sensitivity of the HIF-/pVHL Interaction
[0442] .sup.35S-Methionine labelled HIF-1 subunits and pVHL.HA were produced separately by IVTT (in vitro transcription and translation) in reticulocyte lysates. IVTTs were performed under different conditions, mixed, and assayed for interaction by anti-HA co-immunoprecipitation. These in vitro assays allowed analysis of the HIF/pVHL interaction using the recombinant proteins.
[0443] Labelled HIF-1 and pVHL.HA were generated separately in reticulocyte lysates (IVTT), in the presence or absence of Co (II), desferrioxamine, or Fe(II). Lysates were mixed in various combinations, and interactions assayed by anti-HA immunoprecipitation. We found that supplementary Fe(II) (ferrous chloride, 100 M) in the HIF-1 IVTT greatly enhanced capture by pVHL.HA, whereas addition of Co(II) (cobaltous chloride, 100 M) or desferrioxamine, 100 M (DFO) to the HIF-1 IVTT greatly diminished capture. In contrast, pVHL IVTTs performed under these different conditions were all equally effective in supporting the HIF-1 interaction.
[0444] Further experiments were carried out to determine the effect of producing the IVTTs under hypoxic conditions. Labelled HIF-1 was generated in IVTT reactions in the presence or absence of Fe(II) either under ambient conditions or in a hypoxic workstation. Samples were then diluted in buffer in the hypoxic workstation and purified recombinant GST-VHL-elonginC-elonginB was added. VHL and associated proteins were captured using glutathione-agarose. The results showed that when HIF-1 IVTTs were prepared under hypoxic conditions, hypoxia reduced their ability to interact with pVHL, irrespective of whether the latter was produced either as a normoxic or hypoxic IVTT, or as a bacterially expressed complex of pVHL and elongins B and C.
[0445] Next, we used reticulocyte IVTTs of Gal4/VP16 fusion proteins bearing specific HIF subsequences to show that the regulated interaction with pVHL was supported even by a minimal pVHL binding HIF-1 subsequence comprising residues 556-574. Fusions bearing amino acid residues 556-574, 549-574, 556-582 or 549-582 of HIF-1 were expressed in reticulocyte lysates with or without added Fe(II). The fusion proteins included the HIF-1 sequence between a Gal4 DNA binding domain and VP16 transactivation domain. As a control a fusion containing no HIF-1 sequences was also assessed. Aliquots were assessed for co-immunoprecipitation with pVHL.HA by anti-HA immunoprecipitation. All of the fusions bearing HIF-1 subsequences displayed iron-dependent recognition by pVHL including the fusion comprising the shortest region of HIF-1 subsequence tested comprising residues 556-574. The control fusion, lacking HIF-1 sequences, did not recognise pVHL either in the presence or absence of iron.
[0446] To better understand these findings we surveyed the ability of a series of recombinant pVHL and HIF-1 products produced in different prokaryotic and eukaryotic expression systems (20) to interact. All pVHL products could interact with HIF-1 that was derived from mammalian expression systems. In contrast, HIF-1 could interact only if produced in vivo in tissue culture cells, or in reticulocyte IVTT, and not if produced in bacteria, wheat germ lysates, or insect cells. Together, these results indicate that a factor in mammalian cell extracts was necessary to promote the interaction with specific HIF-1 sequences and that this factor operated in an iron and oxygen dependent manner.
1.2: Modifying Activity which Promotes Interaction of HIF and VHL
[0447] To analyse this further we immunopurified a Gal/HIF-1/VP16 fusion protein expressing HIF-1 residues 549-582, from IVTT reactions prepared in the presence of DFO, using anti-Gal antibodies. The unlabelled HIF-1 substrate was immunopurified on beads, washed, and aliquots incubated under different test conditions in buffer or cell extract. After further washing, the beads were assayed for ability to interact with 35-S labelled pVHL IVTT (21) which was then visualised by fluorography. Increased ability to capture pVHL was seen after exposure of the HIF fusion protein to cell extract in the presence of Fe(II) but not after exposure to Fe(II) without cell extract. The increased ability to capture pVHL after exposure to cell extract and Fe(II) was also found to be oxygen dependent. In analogous experiments it was found that the modifying activity was present in extracts prepared from a variety of mammalian cells, (Hela, RCC, CHO-K1 and rabbit reticulocyte lysate), but that insect cell lysates were essentially inactive on the mammalian HIF fusion protein. The Fe(II) dependent activity of the cell extract was reduced by cooling and was abrogated by pre-heating at 60 C. for 10 minutes. The modifying activity did not pass through a 5 kDa ultrafilter. Titration of Fe(II) supplementation indicated full activation at 5 M. Pre-incubation of the cell extract with hexokinase (50 U/ml) and glucose (50 mM) to deplete ATP did not alter activity, though this treatment abrogated the ability of the cell extracts to phosphorylate a control target. Pretreatment of extracts with clotrimazole (10 M), methyl-viologen (1 mM), or NADase (20 mU/ml), did not significantly affect activity.
[0448] Experiments were also performed using PK epitope tagged HIF-1 (PK.HIF) expressed in insect cells as a HIF substrate. Both RCC4 cell extract, and reticulocyte lysate, in the presence of Fe(II) promoted the ability of HIF to capture wild type but not mutant (Pro86His) pVHL. Thus human HIF-1 produced in insect cells required treatment with mammalian extract to promote interaction with wild type but not mutant pVHL (22). Addition of NaCl to the RCC4 cell extract (to 1M final concentration) abrogated the modifying activity, whereas incubation of the PK-HIF in NaCl (1M) after exposure to the cell extract did not alter its subsequent ability to capture pVHL. Likewise treatment of the HIF fusion protein after modification by exposure to extract, with phosphatase or DFO did not prevent pVHL capture. Overall this suggested an enzyme-mediated modification of HIF-1 that was not phosphorylation.
1.3: Study of the HIF-1 Recognition.
[0449]
[0450] Further studies were performed using synthetic polypeptides as inhibitors of the HIF-1/pVHL interaction(23). When added to an interaction mix of pVHL.HA and HIF-1 IVTTs the 34 residue sequence encompassing amino acids 549-582 was unable to block interaction. However, blocking activity was strikingly induced by exposure to cell extract supplemented with Fe(II) (
[0451] In summary, no polypeptide could block the interaction without prior enzymatic modification, blocking activity could not be induced by a variety of direct oxidation systems, phosphorylation of Tyr565 had no effect on the ability of extract to promote blocking activity, and the mutant sequence Pro564Gly did not block the HIF-1/pVHL interaction, even after exposure to extract.
[0452] Mass spectrometric analyses (24) (MALDI-Tof) of extract-treated synthetic polypeptide, and recombinant HIF (expressed in insect cells and subsequently treated with mammalian extracts to promote pVHL binding ability) implied several oxidations as evidenced by +16 Da mass shifts in ions derived from this sequence. Further analyses by MS/MS (ESI-QTof) indicated oxidation affecting Pro564 and the nearby methionine residues. Since the methionine residues are either non-conserved or could be mutated without effect, and direct oxidation methods known to oxidize methionine efficiently could not mimic the enzymatic activity, we postulated that the enzymatic oxidation that promoted interaction of this HIF-1 sequence with pVHL was the oxidation of Pro564.
1.4 Hydroxyproline Incorporation into a Synthetic Polypeptide.
[0453] We synthesized a polypeptide (HIF-1 residues 556-574), containing a trans-4-hydroxy-S-proline residue at position 564 (19:Pro564Hyp), since the trans-4-hydroxylation is the commonest enzymatic proline oxidation (25). A polypeptide blocking assay was carried out using the 19:Pro564Hyp modified polypeptide and, as a control, the unmodified polypeptide without the trans-4-hydroxylation (19:WT). The 19:WT polypeptide was either incubated with cell extract before the binding assay or was untreated. The 19:Pro564Hyp polypeptide was added to a mixture of HIF-1 and pVHL-HA IVTTs at a concentration of 1, 0.25, 0.05 or 0.01 M and the cell extract treated or untreated 19:WT polypeptide at a concentration of 0.5 M. Interaction of HIF-1 with pVHL was then assayed by anti-HA immunoprecipitation. The hydroxyproline substituted polypeptide (19:Pro564Hyp) was highly effective at inhibiting the HIF-1/pVHL interaction without the need for modification by cell extract. The 19:WT control unsubstituted equivalent polypeptide showed the expected requirement for cell extract in order to inhibit interaction., Control reactions carried out with no blocking polypeptide showed the expected binding of HIF-1 to pVHL-HA. A pVHL capture assay was then carried out using biotinylated synthetic polypeptides. The same polypeptides, 19:Pro564Hyp and 19:WT were assessed for the ability to capture wild type or mutant (Pro86His) pVHL. 19:WT control polypeptide captured pVHL only after incubation with cell extract, whereas 19:Pro564Hyp captured wild type pVHL without pre-treatment. In both cases capture was specific for wild type, as opposed to mutant, pVHL.
[0454] In summary, in striking contrast with previously tested polypeptides, 19:Pro564Hyp blocked the HIF-1/pVHL interaction without the need for exposure to cell extract. Moreover, a biotinylated version of 19:Pro564Hyp specifically captured wild type but not mutant pVHL, and its ability to capture pVHL was not increased further by incubation with cell extract (26). In comparison, the equivalent unmodified synthetic polypeptide 19:WT could not interact without prior incubation with cell extract.
[0455] These results reveal that the enzymatic activity promoting interaction of HIF-1 with pVHL is a prolyl-4-hydroxylase, which we term HIF- prolyl-hydroxylase (HIF-PH). All previously described prolyl-4-hydroxylases are members of the superfamily of 2-oxoglutarate-dependent, and related, dioxygenases (27). Consistent with the data presented above none of these enzymes have an absolute requirement for ATP or NAD(P) but they do have an absolute requirement for Fe(II) as a co-factor and dioxygen as a co-substrate (27). Structural studies within the class have defined a non-haem iron centre co-ordinated by an HXD/E . . . H motif (28). Interestingly, and consistent with our findings, the Fe(II) is not firmly bound and can be readily removed by chelating agents, and enzyme inhibition occurs following substitution of Fe(I) with Co(II) or Ni(II)(25).
1.5: Effect of Ascorbate Supplementation and Various Inhibitors on HIF-PH Activity.
[0456] The capture of labelled pVHL by different HIF substrates was monitored after exposure to various test conditions.
[0457] The effect of ascorbate on pVHL capture by a Gal/HIF-1 549-582/VP16 fusion protein substrate was monitored and ascorbate (2 mM) was found to enhance the modifying activity of cell extract, but have no effect in the absence of cell extract. Ascorbate therefore enhances the activity of HIF-PH.
[0458] We went on to test a series of 2-oxoglutarate analogues which act as competitive inhibitors of this class of enzyme (29) for ability to inhibit HIF-PH as assessed by the ability of cell extracts to modify either HIF polypeptide (19:WT) or a HIF fusion protein (Gal/HIF-1 549-582/VP16) so as to promote pVHL capture. Concordant results were obtained with both sources of HIF sequence. In one such experiment the effect of N-oxalylglycine on pVHL capture by a biotinylated HIF polypeptides as substrate was monitored. The WT:19 and 19:Pro564Hyp polypeptides described above were used as substrates. N-Oxalylglycine (0.2-1 mM) was found to completely inhibit the modifying activity of cell extract on 19:WT. Inhibition by N-Oxalylglycine was overcome by addition of 5 mM 2-oxoglutarate. As previously, 19:Pro564Hyp captured pVHL efficiently without modification by cell extract, and this was not influenced by exposure to N-oxalylglycine. Similar inhibition, also competed by 2-oxoglutarate, was observed with N-oxalyl-2S-alanine but not the enantiomer N-oxalyl-2R-alanine, demonstrating that the effect was not due to simple Fe(II) chelation in solution. We also used a 2-oxoglutarate dependent dioxygenase, phytanoyl-CoA -hydroxylase(30), together with a readily available unnatural substrate (isovaleryl CoA) (31) to deplete the cell extract of 2-oxoglutarate produced by the citric acid cycle; as predicted, this prevented the subsequent modification of HIF polypeptide. The effect of dimethyl-oxaloglycine on HIF-1 expression was also studied. HIF-1 immunoblot analysis of extracts of Hep3B and U2OS cells exposed to dimethyl-oxalylgylcine (0, 0.1 or 1.0 mM) for 6 hours was carried out. HIF-1 was seen to be strongly induced under normoxic culture conditions.
[0459] Prolyl-4-hydroxylases have been identified in many organisms. In mammalian cells these form .sub.2.sub.2 tetramers in which the -subunit is identical with the multifunctional protein disulphide isomerase(27). These enzymes function in collagen modification in the endoplasmic reticulum, and are reported to have a strict substrate specificity for prolyl residues in collagen repeat sequences, typically (Pro-Pro-Gly).sub.n(27). When tested as substrate for recombinant [1 or 2] human prolyl-4-hydroxylase, the HIF polypeptide showed no activity(32). Taken together these findings lead us to postulate that HIF-PH is a novel prolyl-4-hydroxylase which marks HIF promoting recognition by the pVHL ubiquitination ligase system. Since such enzymes utilise molecular oxygen as a co-substrate this predicts a mechanism for direct sensing of oxygen. To test this we examined the effect of hypoxia in the presence of supplements of other co-factors, on HIF-PH activity as assessed by ability to modify the Gal/HIF-1 549-582/VP16 fusion protein so as to promote pVHL capture. HIF substrate was incubated with cell extract (supplemented with 2 mM ascorbate and 10 M Fe(II)) for 1, 2, 5 or 10 mins at 30 C. under ambient conditions or in the hypoxic workstation. The reaction was stopped by washing with DFO, and the HIF substrate assayed for ability to interact with pVHL. A time-dependent increase in capture was seen in normoxia and a marked suppression of activity by hypoxia.
1.6: Summary of Example 1.
[0460] Our findings therefore demonstrate a novel method of protein modification that regulates interaction with pVHL ubiquitylation complexes and indicate that enzymatic prolyl hydroxylation may act directly as a sensor of molecular oxygen. The known properties of 2-oxoglutarate dependent oxygenases readily explain the classical features of mimicry of hypoxia by iron chelators or cobaltous ions. Two explanations have been advanced previously for these findings. First, it has been proposed that cobaltous ions might substitute for ferrous ions at an oxygen sensing iron centre (15). Since most iron centres (e.g. haem and the large majority of iron sulphur clusters) do not exchange in this way it was proposed that such a protein must be turning over rapidly. Second, it has been postulated that cobaltous ions and iron chelators might act by interfering with Fenton chemistry and signalling through reactive oxygen species(17, 33). For instance non-enzymatic metal catalysed oxidation systems that oxidatively modify specific amino acids by local Fenton chemistry can also be inhibited by iron chelators and non-iron transition metal ions (34) providing an alternative hypothesis for effects of these substances on the HIF system. Clearly the labile iron centres associated with prolyl-4-hydroxylases can accommodate the original iron centre substitution hypothesis without the need to propose rapid turnover of the sensor. In contrast we were repeatedly unable to promote specific interactions of HIF- sequences with pVHL by a variety of non-enzymatic oxidation systems and our evidence clearly indicates an enzymatic mechanism of proline hydroxylation. Our findings do not exclude direct oxidation processes or other oxygen sensing systems impinging on HIF at other sites, on other molecules involved in HIF signal transduction, or indeed on components of the enzymatic prolyl hydroxylation complex. Though our evidence indicates that HIF-PH is distinct from the [1 and 2] prolyl-4 hydroxylases associated with collagen modification, it is interesting that these enzymes employ protein disulfide isomerase as a subunit, thus providing a potential link to sulfhydryl, redox chemistry. Also of interest, P4HA1 has recently been shown to be HIF responsive(35), suggesting that similar hypoxic induction of HIF-PH activity could down-regulate HIF in prolonged hypoxia, contributing to accommodation of the HIF response.
[0461] The pVHL multi-protein complex belongs to the SCF class of ubiquitin ligases, with pVHL acting as the F-box like substrate recognition component (36, 37). To date, characterised examples of recognition by F-box proteins have been regulated by phosphorylation of the target sequence. Furthermore, HIF-1 is a phosphoprotein, and phosphorylation has been implicated in HIF regulation(38, 39). While our findings do not exclude the possibility that HIF- phosphorylation could influence pVHL recognition, they demonstrate that the key event in recognition of the minimal interaction domain studied here is enzymatic hydroxylation of Pro564. This defines a novel mechanism of regulating substrate recognition for the F-box class of ubiquitin ligases. Furthermore, it is of interest that evolutionarily conserved proline residues are observed at a number of other sites in HIF- subunits, and that other internal regions of HIF-1 can convey oxygen-dependent destruction(6). In other studies we have defined a second subdomain within the N-terminal portion of the HIF-1 oxygen dependent degradation domain that supports pVHL dependent ubiquitylation and contains a functionally critical proline residue. Furthermore, we have established the existence of a functionally conserved pVHL/HIF system in C. elegans (see below) and demonstrated the critical importance of a conserved proline residue in the ceVHL/ceHIF interaction (indicated in
[0462] Overall this suggests that similar marking modifications may occur elsewhere in HIF- molecules and could contribute to the oxygen sensitive properties of other domains. Whether proline hydroxylation occurs in other molecules on residues that form part of so-called PEST domains that are associated with rapid turnover is also clearly now of interest(40). Equally, if the prolyl modification is relatively specific to pVHL-mediated ubiquitylation then the new findings may help define other substrates that are important in pVHL tumor suppressor function.
REFERENCES & NOTES FOR EXAMPLE 1
[0463] 1. G. L. Semenza, Genes Dev 14, 1983-91. (2000). [0464] 2. N. V. Iyer, et al., Genes Dev. 12, 149-162 (1997). [0465] 3. E. Maltepe, J. V. Schmidt, D. Baunoch, C. A. Bradfield, M. C. Simon, Nature 386, 403-407 (1997). [0466] 4. G. L. Wang, B.-H. Jiang, E. A. Rue, G. L. Semenza, Proc. Natl. Acad. Sci. USA 92, 5510-5514 (1995). [0467] 5. S. Salceda, J. Caro, J. Biol. Chem. 272, 22642-22647 (1997). [0468] 6. L. E. Huang, J. Gu, M. Schau, H. F. Bunn, Proc. Natl. Acad. Sci. USA 95, 7987-7992 (1998). [0469] 7. M. S. Wiesener, et al., Blood 92, 2260-2268 (1998). [0470] 8. P. H. Maxwell, et al., Nature 399, 271-275 (1999). [0471] 9. K. Iwai, et al., Proc. Natl. Acad. Sci. USA 96, 12436-12441 (1999). [0472] 10. J. Lisztwan, G. Imbert, C. Wirbelauer, M. Gstaiger, W. Krek, Genes Dev 13, 1822-33 (1999). [0473] 11. M. E. Cockman, et al., J Biol Chem (2000). [0474] 12. M. Ohh, et al., Nat Cell Biol 2, 423-7. (2000). [0475] 13. T. Kamura, et al., Proc Natl Acad Sci USA 97, 10430-5. (2000). [0476] 14. K. Tanimoto, Y. Makino, T. Pereira, L. Poellinger, Embo J 19, 4298-309. (2000). [0477] 15. M. A. Goldberg. S. P. Dunning. H. F. Bunn, Science 242, 1412-1415 (1988). [0478] 16. G. L. Wang. G. L. Semenza, Blood 82, 3610-3615 (1993). [0479] 17. G. L. Semenza, Cell 98, 281-284 (1999). [0480] 18. Hypoxia (<0.1% oxygen) was obtained in a workstation with O.sub.2, CO.sub.2 and temperature control (Ruskinn Technologies, Leeds, UK). For hypoxic harvest, buffers were preincubated in the chamber overnight. RCC4-VHL.HA, labelling conditions and co-immunoprecipitation assays have been described previously (11); in the current study 12.5 M MG132 was used for proteasomal inhibition. For standard harvest, the cells were removed from the chamber after hypoxic exposure, prior to cell lysis. Co-immunoprecipitation assays on all lysates were performed at 4 C. under ambient oxygen conditions. Parallel experiments established that adding desferrioxamine (100 M) to the lysis and immunoprecipitation buffers did not alter the protein species co-precipitated with pVHL. [0481] 19. pcDNA3.VHL.HA and pcDNA3.HIF-1.PK were used to program TNT reticulocyte lysate (Promega). When programming in hypoxia, reaction mix was preincubated in the workstation for 10 minutes before addition of the DNA template. An aliquot was removed from the workstation for transcription/translation under ambient oxygenation. Interaction assays were as described previously (11). [0482] 20. Protein expression systems used were wheatgerm lysate (Promega) programmed with pcDNA3 based vectors, insect cell expression using recombinant baculovirus (pFastBac1, (GibcoBRL) encoding PK.HIF-1(344-698) and PK.HIF-1 (1-826)) bacterial expression as glutathione-S-transferase (GST-VBC complex) and maltose binding protein fusions (pMAL-HIF-1 (344-698)). For insect cell expression, Sf9 cells (GibcoBRL) were infected 60 hours prior to harvest. [0483] 21. pGal/HIF-1549-582/VP16 was used to program reticulocyte lysate in the presence of unlabelled methionine. The fusion protein product was immunopurified with beads pre-coated with anti-Gal4 antibody RK5C1 (Santa Cruz). After washing with NETN buffer, experimental exposures were to hypotonic extraction buffer (HEB: 20 mM Tris pH7.5, 5 mM KCl, 1.5 mM MgCl2, 1 mM DTT) or cell lysate prepared in HEB. Incubations were for 60 minutes at 22 C. unless otherwise stated, following which the beads were washed with NETN containing DFO, and incubated for 2 hours at 4 C. in NETN+DFO with 5 l rabbit reticulocyte lysate programmed with pcDNA3.VHL.HA. [0484] 22. Baculoviral PK.HIF-1 (1-826) or PK.HIF-1 c (344-698) were immunoprecipitated with anti-PK antibody (Serotec). Bead bound immunoprecipitates were washed, then incubated with test cell lysates, following which the immunoprecipitates were washed again with NTEN containing DFO, incubated with pVHL, and assayed for interaction. [0485] 23. For polypeptide inhibition assays, polypeptides were added to NETN buffer containing a mixture of HIF-1 and pVHL.HA. Final concentration of polypeptide was 1 M unless otherwise stated. Pre-incubation of polypeptide in cell extract or other conditions was for 60 minutes at 30 C. [0486] 24. Samples for mass spectroscopic analyses were either biotinylated synthetic polypeptides 19:WT (residues 556-574), or 34:WT (residues 549-582), or PK-tagged HIF-1 retrieved from insect cell lysates. After modification by mammalian cell lysates the material was purified either by streptavidin/biotin capture (synthetic polypeptides) or anti-PK immunoprecipitation and SDS-PAGE. Proteolytic digestion was performed either on the beads or in-gel with trypsin and V8 protease at pH7.8, or V8 protease at pH4.5. Samples were lyophilised, and dissolved in aqueous 0.1% TFA. Polypeptides were concentrated, desalted on a 300 m ID/5 mm length C18 PepMap column (LC Packings, San Francisco, Calif., USA) and eluted with 80% acetonitrile. The HPLC (CapLC, Waters, Milford, Mass., USA) was coupled via a Nano-LC inlet to a Q-Tof mass spectrometer (Micromass, Manchester, UK) equipped with a nanoelectrospray Z-spray source. The eluted polypeptide mixture was analysed by tandem mass spectrometric sequencing with an automated MS-to-MS/MS switching protocol. Online determination of precursor-ion masses was performed over the m/z range from 300 to 1200 atomic mass units in the positive charge detection mode with a cone voltage of 30 V. The collision induced dissociation for polypeptide sequencing by MS/MS was performed with argon gas at 20-40 eV and a 3 Da quadrupole resolution. [0487] 25. K. I. Kivirikko, R. Myllyla, in The Enzymology of Post-translational Modification of Proteins R. B. Freeman, H. C. Hawkins, Eds. (Academic Press, London, 1980) pp. 53-104. [0488] 26. For pVHL capture assays using biotinylated polypeptides, the polypeptide was interacted with VHL.HA for 30 minutes at 4 C., and precipitated with streptavidin beads. Pre-incubation with cell extract or buffer under test conditions was for 30 minutes at 30 C. [0489] 27. K. I. Kivirikko, J. Myllyharju, Matrix Biol 16, 357-68. (1998). [0490] 28. C. J. Schofield, Z. Zhang, Curr Opin Struct Biol 9, 722-31. (1999). [0491] 29. C. J. Cunliffe, T. J. Franklin, N. J. Hales, G. B. Hill, J Med Chem 35, 2652-8. (1992). [0492] 30. G. A. Jansen, et al., J Lipid Res 40, 2244-54. (1999). [0493] 31. M. Mukherji, M. D. Lloyd et al. unpublished observations. [0494] 32. Prolyl 4-hydroxylase activity was assayed by a method based on the hydroxylation-coupled decarboxylation of 2-oxo[1-.sup.14C]glutarate (Kivirikko, K. I., Myllyl, R.: Posttranslational enzymes in the biosynthesis of collagen: intracellular enzymes. Methods Enzymol., 82, 245-304, 1982) using recombinant human type I and II prolyl 4-hydroxylases expressed in insect cells (26). 0.5 or 1.0 mg of polypeptide was used in each reaction. The assay was performed by Dr. Johanna Myllyharju at the Collagen Research Unit, Department of Medical Biochemistry, University of Oulu, Finland. [0495] 33. W. Ehleben, T. Porwol, J. Fandrey, W. Kummer, H. Acker, Kidney Int. 51, 483-491 (1997). [0496] 34. E. R. Stadtman, Annu. Rev. Biochem. 62, 797-821(1993). [0497] 35. Y. Takahashi, S. Takahashi, Y. Shiga, T. Yoshimi, T. Miura, J Biol Chem 275, 14139-46. (2000). [0498] 36. D. Skowyra, K. L. Craig, M. Tyers, S. J. Elledge, J. W. Harper, Cell 91, 209-219 (1997). [0499] 37. E. E. Patton, A. R. Willems, M. Tyers, Trends Genet. 14, 236-243 (1998). [0500] 38. D. E. Richard, E. Berra, E. Gothie, D. Roux, J. Pouyssgur, J Biol. Chem. 274, 32631-32637 (1999). [0501] 39. P. W. Conrad, T. L. Freeman, D. Beitner-Johnson, D. E. Millhorn, J. Biol. Chem. 274, 33709-33713 (1999). [0502] 40. M. Rechsteiner, S. W. Rogers, Trends Biol. Sci. 21, 267-271 (1996).
Example 2. Identification of Hypoxia Inducible Factor and Von Hippel-Lindau Tumour Suppressor Homologues in C. elegans
[0503] In this Example we define a HIF homologue in C. elegans and demonstrate that both the transcriptional response to hypoxia, and an important mode of regulation through interaction with the von Hippel-Lindau tumour suppressor are conserved.
2.1 Identification of a Homologue.
[0504] We sought homologues to HIF- subunits in the C. elegans EST database using an tBLASTn enquiry with the human sequence. Prior to completion of the C. elegans sequencing programme an EST was found with significant homology to HIF- in the basic-helix-loop-helix region, and we assembled a contig of ESTs covering the putative homologue. Complete determination of the C. elegans sequence revealed a further six predicted PAS proteins but no closer matches to mammalian HIF-. The EST contig we had identified corresponds to a predicted open reading frame (ORF) on chromosome V (F38A6.3) that is identical except for a 104 amino acid amino terminal extension in the latter. Extensive searching of the EST database has not revealed any cDNAs that map to this putative 5 extension. No PCR products corresponding to the extension could be identified and RACE-PCR products did contain a putative trans spliced leader sequence. These findings argue against the predicted N-terminal extension and support the presence of a 719 amino acid protein encoded by 9 exons.
2.2: Regulation of HIF in C. elegans.
[0505] To characterize the putative C. elegans HIF homologue (ceHIF), we constructed a riboprobe encompassing nucleotides 1366 to 1496 of the predicted open reading frame, and raised antisera to a bacterially expression recombinant protein containing amino acids 360 to 497 of the putative protein. The antisera recognised a single species of the appropriate mobility in Cos7 cells transfected with an expression vector expressing the full length cDNA. Total RNA and protein extracts were prepared from populations of worms exposed to normobaric hypoxia by incubation in bell jars flushed with premixed gases of specified oxygen content balanced with nitrogen. Immunoblotting of worm extracts showed a striking induction of ceHIF under hypoxia.
[0506] Immunoblots of ceHIF levels in extracts of C. elegans were carried out to monitor regulation by hypoxia and iron chelation. Firstly, the oxygen dependence of protein induction was analysed. Worms were grown on plates in bell jars flushed with air (N), or with oxygen/balance nitrogen having an oxygen concentration of 5%, 1%, 0.5% or 0.1% for 18 hrs. A graded increase in protein level was seen as the oxygen level was reduced below 5% with the highest level of induction at 0.5 and 0.1% oxygen concentration. The time course of protein induction was then studied. Worms were grown in bell jars flushed with a 0.1% oxygen/balance nitrogen mixture for 0, 4, 8, 16 or 24 hrs before preparation of extracts. The results showed strong induction within 4 hours which was sustained over a 24 hour period. The time course of protein decay on re-oxygenation was then assessed. Worms were grown in bell jars flushed with air (N) or a 0.1% oxygen/balance nitrogen mixture. Extracts were made either immediately, or after 4 and 8 minutes of re-oxygenation. Decay of ceHIF protein was very rapid on re-oxygenation. Protein levels were clearly reduced after 4 minutes and undetectable after 8 minutes of re-oxygenation of the culture. A time course RNAse protection assay showing cehif mRNA levels in worms exposed to 0.1% oxygen/balance nitrogen for 0, 4, 8, 16 and 24 hrs was carried out. No induction of ceHIF mRNA by hypoxia was seen. Thus ceHIF expression was strongly induced by hypoxia at the protein level, but not at the mRNA level, in a manner very similar to that described for mammalian HIF- subunits. In mammalian cells HIF- protein is also strongly induced by iron chelating agents as well as hypoxia, a characteristic that has suggested that an interaction of iron and oxygen is central to the underlying mechanism of oxygen sensing. Induction by iron chelation was also studied in C. elegans. Worms were cultured in liquid media in the presence or absence of the penetrant bidentate iron chelator 2, 2 dipyridyl (200 M) for 6 or 16 hrs. A striking Induction of ceHIF by iron chelation was observed at both 6 and 16 hours and the level of induction was equivalent to that observed in severe hypoxia, ceHIF was not induced in the absence of iron chelation.
2.3 Conserved Role for VHL.
[0507] Regulation of mammalian HIF- subunit protein levels occurs though a one or more systems of ubiquitin mediated, oxygen regulated proteolysis. To date the most clearly defined of these involves the von Hippel-Lindau tumour suppressor protein (pVHL), which physically interacts with specific HIF- residues, acting as the recognition component of an E3 ubiquitin ligase. In VHL defective renal carcinoma cells HIF- subunits are constitutively stabilised leading to greatly increased steady-state levels in normoxia. Recently a putative pVHL homologue in C. elegans has been proposed on the basis of database analysis and a sequence alignment showing 23% amino acid identity. The analysis of HIF regulation in C. elegans performed here shows a conserved role for pVHL.
[0508] To determine whether pVHL function in HIF regulation might also be conserved we first tested for interaction. 35-S labelled ceHIF and HA tagged pVHL were synthesised by IVTT in rabbit reticulocyte lysate, the ceHIF and/or tagged pVHL were then added to EBC buffer with or without worm extract, prior to immunoprecipitation with an anti-HA antibody. Co-immunoprecipitation of ceHIF with pVHL was observed, but only when the recombinant ceHIF IVTT was preincubated with worm extract. Interestingly, though mammalian HIF- produced in reticulocyte lystaes will interact with pVHL, we have found that this is dependent on a factor in the reticulocyte lysate that can be substituted by other mammalian cell extracts, but not the C. elegans extract. Though the human and C. elegans systems appear homologous, this suggests the existence of a species specific modifying factor that promotes the HIF/pVHL interaction. Mammalian pVHL recognises HIF- through a subsequence within a transferable oxygen dependent degradation domain (ODDD) that shows short regions of conservation with ceHIF. To test the functional importance of this we mutated a conserved proline residue that is critical for the mammalian interaction and replaced it with glycine. Whilst wild type ceHIF could interact with tagged pVHL, the ceHIF Pro621-Gly mutant form was unable to interact with pVHL mirroring the findings with mammalian HIF.
[0509] To pursue the functional importance of the interaction between ceVHL and ceHIF, we next employed a viable homozygous deletion mutant worm lacking ceVHL, and assayed worm extracts for ceHIF by immunoblotting. In normoxic ceVHL worms ceHIF levels were strikingly upregulated and were essentially unregulated by oxygen, being similar in hyperoxia (80% 02), air, and hypoxia (0.1% O2). Thus a critical function for pVHL in the response to oxygen appears also to be conserved. Surprisingly, ceVHL deficient worms are phenotypically relatively normal, with only slightly slower growth rates and mildly reduced reproductive capacity compared to wild type.
[0510] This tight conservation of the HIF/pVHL system indicates that C. elegans provides a new model for analysis of the oxygen sensing and signalling pathways that regulate HIF, and for the analysis of downstream effects on patterns of gene expression. As a first step in exploring this potential we assessed ceHIF induction by hypoxia in a mutant worms selected to test candidate molecules in the sensing/signalling pathway. A number of studies support the involvement of oxygen radicals though the source and mode of interaction with the HIF/pVHL complex is unclear. Other studies have suggested the involvement of particular growth factor signalling pathways in HIF regulation, but the relation of these findings to the oxygen sensitive signal is uncertain. In one line of investigation it has been found that insulin and insulin-like growth factors can activate HIF in normoxic cells, that the tumour suppressor PTEN acts as a negative regulator of HIF, and that the downstream target of PTEN, Akt shows oxygen dependent phosphorylation, suggesting the involvement of an insulin receptor/PI3-kinase pathway in HIF regulation. This pathway is conserved in C. elegans, and interestingly has been implicated in ROS metabolism. We therefore tested several mutants to determine their effect on the interaction of ceHIF with VHL.
[0511] The level of ceHIF in wild type and a series of mutant worms was determined by immunoblotting. Worms were grown on plates in bell jars flushed with normoxic (21% oxygen) or hypoxic (0.1% oxygen) gas mixtures for 6 hrs. As expected the vhl mutant worms were found to have high levels of ceHIF protein regardless of oxygen tension. The mutants daf-18 (encoding a PTEN homologue), daf-2 (encoding an insulin receptor homologue) and age-1 (encoding a PI3-kinase homologue), in contrast with the vhl mutant worms, all showed regulation of ceHIF by oxygen that was similar to wild type. The other mutants screened for effects on ceHIF were selected on the basis of known effects on ROS metabolism, or altered phenotypic sensitivity to oxidant stress included several mutants affecting mitochondrial proteins (mev-1, clk-1, gas-1), a ctl-1 mutant that affects cytosolic catalase activity and others (mev-2, mev-3) where the product is not yet characterized and again regulation was similar to wild type suggesting that this a distinct oxygen sensing system that in C. elegans is not tightly linked to general systems of oxidant defence.
[0512] In view of the data presented here demonstrating a critical role for enzymatic hydroxylation of prolyl residues within HIF in its normoxic recognition by pVHL and subsequent ubiquitylation and destruction by the proteasome in the mammalian system we also tested worms bearing mutations in known prolyl hydroxylases (dpy-18 and phy-2), and genes containing sequence motifs compatible with a function as a prolyl hydroxylase (egl-9-located at F22E12.4). The effect of prolyl hydroxylase mutants on HIF activity was studied by blotting. Extracts were made from wild type and mutant worms grown in normoxic (21% oxygen) and hypoxic (0.1% oxygen) conditions. Immunoblots for ceHIF were performed after separation on SDS/PAGE. The band representing ceHIF was identified. No detectable ceHIF was seen in an extract from normoxic wild type worms. In contrast in normoxic extracts from egl-9 deficient worms ceHIF is easily detected (allele MT 1201; allele MT 1216 grown at 25 degrees C.), at levels comparable with those seen in extracts from these strains grown in hypoxic conditions. As the egl-9 deficient worms have high normoxic levels of ceHIF, this suggests that this gene product is involved in the normal degradation of ceHIF. The dpy-18 and phy-2 deficient worms showed normal ceHIF levels.
[0513] We also used dimethyloxalylglycine (a cell permeant alpha ketoglutarate analogue known to block this family of dioxygenases) and demonstrated an increased abundance of ceHIF in normoxia in the present of the inhibitor. In these experiments extracts were made from wild type worms grown in normoxic (21% oxygen) conditions in the presence and absence of dimethyloxalylglycine (1 mM). Immunoblots for ceHIF were performed after separation on SDS/PAGE. The band representing ceHIF was identified and it could clearly be seen that inhibitor treatment clearly results in a substantial increase in the amount of immunodetectable ceHIF in normoxia.
2.4: Expression of HIF Target Genes.
[0514] We wished to test directly for effects of the HIF/pVHL system on patterns of gene expression in C. elegans. First we tested for hypoxia inducible expression amongst a set of C. elegans homologues of mammalian genes that are known HIP targets, and compared the upregulation of mRNA upon hypoxic exposure of wild type worms with that observed in the vhl mutant worm. The results obtained are shown in Tables A and B below.
[0515] Table A summarises results for a subset of genes selected for analysis on the basis of putative homology to mammalian HIF target genes and tested for regulation by hypoxia and VHL in C. elegans. Table B summarises results for a subset of genes confirmed as regulated by vhl by RNAse protection after identification in comparative array screening of wild type and vhl mutant worms, and subsequently tested for regulation by hypoxia. The full gene array dataset from which these genes were identified are available at http://genome-www4.stanford.edu/cgi-bin/SMD/login.pl.
TABLE-US-00004 TABLE A Regulated Regulated Sequence by by Name Gene Description Hypoxia VHL F13D12.2 Lactate de hydrogenase + + F54D8.4 Putative carbonic anhydrase T28F2.3 Putative carbonic anhydrase R01E6.3 Putative carbonic anhydrase, strong + + similarity to human CA2 R173.1 Putative carbonic anhydrase K05G3.3 Putative carbonic anhydrase, strong similarity to human CA7 B0412.2 daf-7/member of the TGF superfamily C14F5.1 nip 3/bcl-2 B0432.5 Putative tyrosine hydroxylase
TABLE-US-00005 TABLE B Regulated Regulated Sequence by by Name Gene Description Hypoxia VHL F22B5.4 Protein of unknown function + + F35G2.4 Prolyl 4-hydroxylase alpha subunit + + C55B7.4 Member of the acyl-CoA + + dehydrogenase protein family K09E4.4 Strong similarity to human alpha T- acetylglucosaminidase T05B4.2 Member of the nuclear hormone + + receptor/Zinc ringer protein family H14N18.4 Member of the gamma- glutamyltransferase (tentative) protein family C16C10.3 Piwi related protein + +
[0516] Clear induction by hypoxia was observed for mRNA encoding lactate dehydrogenase-A and an isoform of carbonic anhydrase, and in each case the mRNA was strikingly upregulated in vhl worms.
[0517] Second we tested for induction by hypoxia among a subset of pVHL dependent differentially expressed gene defined by array screening. Of eight genes demonstrated by RNAse to be upregulated in vhl worms five were strongly inducible by hypoxia in wild type worms.
[0518] Oxygen homeostasis is a fundamental physiological problem in all organisms that can live in an aerobic environment, and genetic studies in bacteria and yeast have defined specific sensing systems that regulate gene expression in accordance with oxygen availability. However efforts to link these systems to responses in mammalian cells have so far been unsuccessful, and database analysis has not reveal a HIF homologue in the S. cerevisiae genome or sequenced prokaryotic genomes. The current work therefore provides the clearest analysis to date of homology with a primitive organism that has been developed for genetic analysis. Given recent advances in large scale analysis of gene expression gene function in C. elegans the findings provide important new opportunities to understand cellular responses to oxygen availability.
[0519] In mammalian cells transcriptional activation of HIF is believed to be a multi-step process involving separate regulatory steps in nuclear localization, DNA binding, and co-activator recruitment as well as different systems of ubiquitin mediated proteolysis. Somewhat surprisingly, in VHL defective renal carcinoma cell lines HIF- subunits are constitutively stabilised and hypoxia inducible mRNAs are constitutively upregulated in normoxic cells, indicating that at least in this cell background pVHL has a dominant non-redundant function in the regulation of the HIF transcriptional response. Both ceHIF protein and its transcriptional target mRNAs also showed striking up-regulation in normoxic vhl mutant worms. Importantly this indicates that a critical non-redundant function of VHL in regulation of HIF extends outside the cell background of VHL associated tumours, and most likely operates generally in higher eukaryotes.
[0520] In mammalian systems the HIF/pVHL system has important functions in the regulation of oxygen delivery through effects on angiogenesis, vasomotor control and erythropoiesis. Conservation in C. elegans indicates that the HIF/pVHL system of oxygen regulated gene expression antedates the development of these complex oxygen delivery systems and that the system must have a critical function in other responses to oxygen availability. The effects observed already on the expression of metabolic enzymes may provide clues to such functions. However though the viability of both vhl mutant and hif mutant worms in the laboratory suggests that the critical functions that have directed the evolution of this system are likely to be observed under other, presumably more stressful, conditions.
2.5: Methods
[0521] Identification of C. elegans hif cDNA. C. elegans EST database searches were performed using the tBLASTn programme and the human HIF-1 sequence as a probe. The putative C. elegans hif cDNA was assembled from 4 overlapping cDNA clones, yk510h7, yk4a2, yk383g1, and yk272d11 (kindly provided by Yuji Kohara, National Institute of Genetics, Mishima, Japan), and inserted into the polylinker of pcDNA1AMP (invitrogen) to create pcDNA1cehif using standard methods.
[0522] Antibody Generation and Immunoblotting.
[0523] DNA encoding amino acids 360 to 497 of ceHIF was inserted into pGEX-4t-1 and the corresponding GST/ceHIF fusion protein was expressed in E. coli. The protein was purified using glutathione agarose and used to raise antisera in rabbits. Antisera were tested for reactivity using extracts of Cos7 cells transfected with pcDNA1 cehif, and purified by ammonium sulphate precipitation. Worm extracts used in immunoblotting were prepared from washed worms by homogenisation in 4 volumes extraction buffer (150 mM NaCl, 1 mM EDTA, 50 mM Tris pH 7.5, 1% NP-40 1% sodium deoxycholate) using an Ultraturax T20 homogeniser.
[0524] Riboprobes and RNAse Protection Riboprobe templates were generated from total C. elegans RNA using RT-PCR. Details of the primers, and sequences are provided in supplementary information. RNAse protection assays were performed as described in (ref) using 10-50 mg total RNA prepared from a mixed population of worms using Tri-Reagent (Sigma).
[0525] Protein Expression and Interaction Assays.
[0526] 35S labelled proteins were generated in reticulocyte lysates (Promega) programmed with plamids encoding wild type ceHIF (pcDNA1 cehif), mutant ceHIF (pcDNA1 cehif.P621G) or c-terminal HA tagged ceVHL (pcDNA3ceVHL-HA). pCDNA1cehif.PxxxG was generated from pcDNA1 cehif using a site directed mutagenesis system (Stratagene) and the following forward and reverse primers:
TABLE-US-00006 5GATTTATCGTGCTTGGCAGGATTCGTTGACACTTATG(forward) 5GTGTCAACGAATCCTGCCAAGCACGATAAATCAGGC(reverse).
pcDNA3ceVHL.HA was obtained by RT-PCR amplification of nucleotides 1 to 525 of the predicted ORF of sequence F08G12.4 from C. elegans RNA, and exchange for human VHL sequence in pcDNA3-VHL.HA. For interaction assays 1 l of each programmed lysate was mixed in EBC buffer at 4C for 1 hr before anti-HA immunoprecipitation as described in Cockman et al. Pretreatment of ceHIF with worm extract was for 30 min at 25C with 10 l of extract derived by hypotonic extraction of a worm homogenate in 20 mM Tris pH7.5, 5mMKC1, 1.5MgCl2, 1mMDTT.
[0527] Worm strains and experimental conditions C. elegans strains were cultured as described by Brenner[Brenner, 1974 #1]. Exposure to hypoxia was in bell jars gassed with humidified air or certificated nitrogen/oxygen mixes (British Oxygen Company). Exposure to iron chelators worms was by growth in a liquid medium as described previously [Lewis, 1997 #2] with or without 200 M 2,2 Dipyridyl. Wild type worms were Bristol strain (N2). ok161 was generated by Dr. Robert Barstead, Oklahoma Medical Foundation, using ultraviolet and psoralen mediated utagenesis. PCR using oligonucleotides from the flanking genomic sequence was used to select worms bearing a deletion at the FO8G12.4 (vhl) locus. Confounding mutations in ok161 were removed by backcross selection using visible markers that flank the VHL locus (dpy-6 unc-9).
Example 3: The VHL E3 Ligase Complex Interacts with Two Independent Regions of HIF-1
[0528] In this Example we show that two independent regions of the HIF-1 ODDD are targeted for ubiquitylation by VHL E3 in a manner dependent upon proline hydroxylation. However these two VHL E3 target sites differ in their overall sequence, their ability to bind VHL directly and their requirement for other cellular factors. These data reinforce the critical role for pVHL in HIF- regulation, but implicate a more complex model for pVHL/HIF- interactions.
[0529] Immunoprecipitation and band shift assays show that VHL and HIF- subunits are physically associated in a wide range of cell types, consistent with a general role for VHL in oxygen-dependent regulation of HIF- subunits. At the same time biochemical studies show that VHL exists as a multiprotein complex with elongins B and C, CUL-2 and RBX1. This complex is homologous to the SCF (Skp-1-Cdc53/Cullin-F-box) class of E3 ubiquitin ligases. Like SCF E3, the VHL complex has inherent ubiquitin ligase activity. VHL itself is thought to play a role analagous to the F-box substrate recognition component. HIF- subunits are therefore clear candidate substrates for VHL E3 and have since been shown to be ubiquitylated in a VHL-dependent manner in vitro.
[0530] Example 1 above demonstrates that degradation of HIF-1 mediated by the VHL binding site occurs through oxygen-dependent hydroxylation at proline 564. It is currently unclear whether oxygen-dependent degradation of HIF- subunits is solely VHL-dependent. In renal cell carcinoma lines and in CHO cells VHL appears to be the critical mediator. However only one VHL binding site has been identified in HIF-1 and regions outside this site can confer oxygen-dependent regulation in vivo. To investigate the mechanisms underlying this we have employed in vitro ubiquitylation assays which provide evidence of functional interaction with the VHL E3 ligase. We find that two independent regions of the HIF-1 ODDD are targeted for ubiquitylation by VHL E3 in a manner dependent upon proline hydroxylation. However these two VHL E3 target sites differ in their overall sequence, their ability to bind VHL directly and their requirement for other cellular factors. These data reinforce the critical role for pVHL in HIF- regulation, but implicate a more complex model for pVHL/HIF- interactions.
Materials and Methods
[0531] Plasmid Constructs
[0532] His.sub.6-E1-tagged mouse E1 cDNA in pRSET was a kind gift of T. Hunt. pcDNA3-VHLHA has been previously described Cockman et al. pGAL 344-417VP16 has been previously described (O'Rourke). Plasmids bearing mutations were generated using a site-directed mutagenesis kit (QuickChange; Stratagene) and mutagenic oligonucleotides designed according to the manufacturer's recommendations. All PCRs were performed using pfu DNA polymerase (Stratagene).
[0533] Cell Culture and Transient Transfection
[0534] 7860, U2OS and RCC4 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, glutamine (2 mM), penicillin (50 IU/ml) and streptomycin sulfate (50 g/ml). Ka13 cells (Wood et al) were grown in Ham's F12 medium with the same supplements.
[0535] Cell Extract Preparation and Western Blotting
[0536] Cytoplasmic extract for ubiquitylation assays was prepared as previously described (Cockman et al). S100 extract was obtained by an additional ultracentrifugation step at 100,000 g at 4 C. for 4h. Extracts for Western blotting were prepared by resuspending cell pellets in 7M urea, 10% glycerol, 1% SDS, 10 mM Tris pH6.8, containing 50 M phenylmethylsulfonyl fluoride and leupeptin, pepstatin and aprotinin all at 0.1 g/ml, followed by disruption using a hand-held homogenizer (Ultra-Turrax T8 with 5G dispersing tool; Janke & Kunkel GmbH). Following SDS-PAGE. proteins were transferred onto Immobilon-P membrane (Millipore) and processed for western blotting using the indicated antibody.
[0537] Antibodies
[0538] Anti-HA antibody (12CA5) was from Roche Molecular Biochemicals, anti-GAL4(DBD) (RK5C1) agarose conjugate from Santa Cruz Biotechnology and anti-HIF-1 clone 54) antibody from Transduction Laboratories.
[0539] Ubiquitylation Enzymes and Assays
[0540] The E1 activating enzyme used in ubiquitylation assays was either obtained from Affiniti Research (Exeter, UK) or purified from BL21 (DE3) E. coli transfected with plasmid expressing Hiss-tagged mouse E1. His.sub.6-E1 was purified by Ni.sup.2+-agarose affinity chromatography. After dialysis against phosphate buffered saline, glycerol was added to 10% (vol/vol) and 25 ng/l aliquots stored at 80 C. Human CDC34 recombinant E2 enzyme was from Affiniti Research (Exeter, UK). VHL E3 was obtained by anti-HA immunoprecipitation from stably transfected 7860-VHLHA cell lysates (Iliopoulos el al). GAL-HIF-1 substrate was prepared by anti-GAL immunoprecipitation from [3S] methionine-labeled TnT rabbit reticulocyte (Promega) translates. Each 40 l ubiquitylation reaction consisted of 4 l of 5 mg/ml ubiquitin, 41 l of 10ATP regenerating system (20 mM Tris pH7.5, 10 mM ATP, 10 mM magnesium acetate, 300 mM creatine phosphate, 0.5 mg/ml creatine phosphokinase), 2 l E1, 3 l E2, 6 l VHL E3 immunopurified on protein G sepharose, 6 l GAL-HIF-1 substrate immunopurified on agarose beads. Reactions were incubated at 30 C. for 2h with occasional mixing, stopped by the addition of SDS sample buffer and analysed by SDS-PAGE and autoradiography. Cytoplasmic extract-based ubiquitylation assays have been previously described (Cockman).
[0541] In Vitro Interaction Assays
[0542] TnT rabbit reticulocyte (Promega) translates (4 l [.sup.35S]methionine-labeled) were mixed either in 70 ul hypotonic extraction buffer (20 mM Tris ph7.5; 5mMKCl; 1.5mMMgCl2; 1 mM DTT) or RCC4 cytoplasmic extract at 30 degrees C. for 1 hour. Samples were then cooled and incubated with 400 l extract from 786-0 cells stably transfected with pcDNA3 VHL.HA for 90 minutes on ice prior to immunoprecipitation with excess anti-HA antibodies and protein G beads. Input samples of the GAL-HIF-1 alpha fusion proteins and retrieved immunoprecipitates were analysed by SDS/PAGE and autoradiography.
[0543] Luciferase and Beta-Galactosidase Assays
[0544] Luciferase activities in cell extracts were determined using a commercially available luciferase assay system (Promega) and a TD-20e luminometer (Turner Designs). Relative beta-galactosidase activity in extracts were measured using o-nitrophenyl-beta-D-galactopyranoside (0.67 mg/ml) as substrate in a 0.1 M phosphate buffer (pH 7.0) containing 10 mM KCl, 1 mM MgSO.sub.4 and 30 mM beta-mercaptoethanol incubated at 30 C. for 15-45 min. The A.sub.420 was determined after stopping the reaction by the addition of 0.4M sodium carbonate (final concentration).
[0545] Cell Extract Preparation and Western Blotting
[0546] Cytoplasmic extract for ubiquitylation assays was prepared as previously described (Cockman et al). S100 extract was obtained by an additional ultracentrifugation step at 100,000 g at 4 C. for 4h. Extracts for Western blotting were prepared by resuspending cell pellets in 7M urea, 10% glycerol, 1% SDS, 10 mM Tris pH6.8, containing 50 M phenylmethylsulfonyl fluoride and leupeptin, pepstatin and aprotinin all at 0.1 g/ml, followed by disruption using a hand-held homogenizer (Ultra-Turrax T8 with 5G dispersing tool; Janke & Kunkel GmbH). Following SDS-PAGE. proteins were transferred onto Immobilon-P membrane (Millipore) and processed for western blotting using the indicated antibody.
3.1 the VHL E3 Ligase can Interact Functionally with Two Distinct Regions of the HIF-1 ODDD In Vitro.
[0547] In order to understand more about the interactions of pVHL with HIF-1 we analysed VHL-dependent ubiquitylation of the HIF-1 ODDD in an in vitro assay using cytoplasmic extracts as a source of ubiquitylation enzymes. 35S-methionine labelled GAL-HIF-1 alpha fusion proteins containing the amino acids 344 to 698, 344 to 553, 554 to 698 or 504 to 554 of HIF-1 were generated by IVTT and subjected to in vitro ubiquitylation in cytoplasmic extracts from RCC4 cells, which lack pVHL (RCC4), or RCC4 cells stably transfected with pcDNA3 VHL.HA (RCC4/VHL) in the presence or absence of exogenous ubiquitin. PVHL dependent ubiquitylation, resulting in a strong signal of decreased mobility at the top of the lane, was clearly observed when the substrate contained HIF-1 alpha amino acids 344-698, 344-553 and 554-698, but not amino acids 504-554. HIF- residues 344-553 and 554-698 are both capable of oxygen-dependent regulation in vivo (O'Rouke et al) and when analysed in vitro here both regions exhibit VHL-dependent ubiquitylation. This indicates that the VHL E3 ligase can interact functionally with at least two sites in HIF-1.
3.2 Requirements for Functional Interactions.
[0548] To investigate this further, it was necessary to develop a ubiquitylation assay using purified components. 35S-methionine labelled GAL-HIF-1 amino acids 344-698 fusion protein was generated by IVTT, immunopurified with anti-Gal antibody conjugated agarose and subjected to in vitro ubiquitylation with purified components. This resulted in the production of high molecular weight GAL344-698-related species in a ubiquitin and ATP-dependent manner. These high molecular weight species correspond to ubiquitylated forms of GAL344-698 as their production is E1-, E2- and VHLE3-dependent.
[0549] In vitro ubiquitylation was then performed on a variety of GAL-HIF-1 fusions. 35S-methionine labelled immunopurified GAL-HIF-1 fusions comprising amino acid residues 344 to 698, 344 to 553, 554 to 698 or 652 to 826 of HIF-1 were used as substrates using reaction mixtures containing E1, E2, VHL E3 ligase, ubiquitin and ATP or reaction mixtures where ubiquitin or VHL E3 ligase were omitted to act as controls. VHL E3 ligase dependent ubiquitylation was clearly seen when the substrate contained HIF-1 amino acids 344-698, 344-553 or 554-698 but not for substrates containing residues 652-826 of HIF-1 t. The fusion containing residues 652-826 of HIF-1 acted as a control as residues 652-826 of HIF-1 show no oxygen-dependent regulation at the protein level in vivo (O'Rouke) and do not interact with pVHL in vitro (Cockman et al). As the GAL 344-553 and GAL 554-698 substrates were both found to be targets for the VHL E3 but GAL652-826 are not, the results obtained using the purified component assay concurs with the cytoplasmic extract assay in identifying HIF-1 residues 344-553 and 554-698 as independent VHL E3 targets in vitro.
3.3 Cytoplasmic Extract Enhances Functional Interaction of the VHL E3 Ligase with the 5 Target Site in HIF-1.
[0550] It was noted however that VHL-dependent ubiquitylation of the GAL 344-553 substrate differed greatly between the two assays. In the cytoplasmic extract assay GAL 344-553 is a much better substrate for VHL-dependent ubiquitylation than GAL 554-698, but in the purified component assay the position is reversed with GAL 344-553 an extremely weak substrate. We wondered whether cytoplasmic extract was important for recognition of the 344-553 region by VHL E3. To test this 35S-methionine labelled GAL 344-553 substrate was generated by IVTT, incubated in buffer, cytoplasmic extract or nuclear extract prior to in vitro ubiquitylation in the purified component assay in the presence or absence of the VHL E3 ligase. Treatment with cytoplasmic extract dramatically enhanced the VHL dependent ubiquitylation of the substrate. Thus, whilst the buffer-treated substrate remains an extremely weak target for VHL E3, pre-treatment with cytoplasmic extract has a dramatic effect, converting the GAL 344-553 substrate into a strong target for VHL-dependent ubiquitylation. Accompanying this effect a marked mobility shift of the GAL 344-553 substrate was seen due to phosphorylation in the cytoplasmic extract.
[0551] Phosphorylation is known to play an important role in regulating recognition of substrates by the SCF E3 ligase. HIF-1 is known to be a phosphoprotein, although an oxygen-dependent phosphorylation event has not been identified. A potential link between HIF-1 phosphorylation and ubiquitylation was therefore of interest. Pre-incubation of the GAL 344-553 substrate with nuclear extract also resulted in a phosphorylation-induced mobility shift, but this was not accompanied by increased VHL-dependent ubiquitylation.
[0552] To clarify the role of phosphorylation in the cytoplasmic extract effect, hexokinase treatment was used. 35S-methionine labelled GAL-HIF-1 alpha amino acids 344-553 fusion protein substrate was generated by IVTT, incubated in buffer, cytoplasmic extract, cytoplasmic extract that had been depleted of ATP by pre-incubation with hexokinase or cytoplasmic extract which had been heat denatured. Enhanced VHL dependent substrate ubiquitylation was found to persist in the absence of ATP (and consequent absence of phosphorylation) but not following heat denaturation. As the ATP-depleted extract can no longer support GAL 344-553 phosphorylation but is still capable of supporting enhanced VHL-dependent ubiquitylation, phosphorylation of GAL 344-553 is therefore not the key event mediating interaction with VHL E3. As heat-treated cytoplasmic extract was unable to support enhanced VHL-dependent ubiquitylation this suggests that a protein factor may be involved either in binding to, or modifying the GAL 344-553 substrate.
[0553] The demonstration in Example 1 above that interaction of VHL with the VHL binding site in HIF-1 is promoted by cytoplasmic extract and iron led us to test the effect of cytoplasmic extract on ubiquitylation of the GAL 554-698 substrate and to test the effect of iron on ubiquitylation of GAL 344-417. 35S-methionine labelled GAL-HIF-1 fusions comprising amino acids 344-417 or 554-698 of HIF-1 substrates were generated by IVTT, incubated in buffer, cytoplasmic extract, cytoplasmic extract supplemented with 100 M iron chloride prior to in vitro ubiquitylation in the purified component assay in the presence or absence of the VHL E3 ligase. Iron was found to enhance the ubiquitylation of Gal-HIF-1 344-417 fusions in the presence of cytoplasmic extract. Cytoplasmic extract enhanced the ubiquitylation of Gal-HIF-1 alpha 554-698 although the effect was less pronounced than that of GAL344-417. These data suggested that the two independent VHL E3 ligase target sites may be regulated by a similar mechanism.
3.4 Mapping of 380-417 as a Minimal Domain Targeted by Cytoplasmic Extract and VHL E3.
[0554] To begin to understand the mechanism it was necessary to define a minimal functional domain. Residues 344-553 correspond to exons 9-11 of HIF-1 and so an exon-based deletional strategy was used. 35S-methionine labelled GAL-HIF-1 alpha amino acids 344-553 fusion protein substrate was generated by IVTT, incubated in buffer or cytoplasmic extract prior to in vitro ubiquitylation in the purified component assay in the presence or absence of the VHL E3 ligase. The GAL 344-503 fusion (corresponding to exons 9 and 10 of HIF-1) still displayed enhanced VHL-dependent ubiquitylation following cytoplasmic extract pre-treatment. Exons 9 and 10 were then assayed individually by generating fusions carrying GAL-HIF-1 amino acid residues 344 to 503, 344 to 417 or 418 to 503. The only fusion which was not ubiquitylated was that carrying residues 418 to 503. Thus both ubiquitylation and the cytoplasmic extract effect were found to localise to exon 9, represented by GAL 344-417. VHL dependent extract enhanced ubiquitylation therefore clearly depends on HIF-1 amino acids 344-417.
[0555] The corresponding exon in HIF-2 was then assayed. The substrates used were Gal-HIF-2 fusion comprising amino acids 344-417 or 345-416. Residues 345-416 of HIF-2 were also found to be a target for VHL-dependent ubiquitylation and also exhibited enhanced ubiquitylation following cytoplasmic extract pre-treatment. The function of this region is therefore conserved between HIF-1 and HIF-2 and sequence comparisons will help to identify critical residues.
[0556] Deletional analysis was further extended to screen the HIF-1 344-417 region. Gal-HIF-1 fusions comprising amino acids 344 to 417, 344 to 400, 344 to 379, 360 to 417 or 380 to 417 of HIF-1 were individually assessed as above. Deletions made at the C-terminus completely ablated VHL-dependent ubiquitylation (GAL 344-400 and GAL 344-379), whereas deletions made at the N-terminus retained activity. The minimal functional domain defined by this analysis was HIF-1 residues 380-417. Although the output ubiquitylation signal was reduced, GAL 380-417 was still a target for VHL-dependent ubiquitylation and still displayed enhanced ubiquitylation following cytoplasmic extract pre-treatment.
3.5 Identification of a Potential Functional Motif Conserved Between the 5 and 3 VHL E3 Target Sites.
[0557] The HIF-1 380-417 sequence was analysed in an attempt to identify residues critical to the functional effect. The HIF-1 sequence was aligned with the corresponding region of HIF-2 and the VHL-binding site. Within the VHL-binding site, hydroxylation at proline 564 is identified in Example 1 above as a key regulatory event. Interestingly, a potential conserved motif encompassing this proline can be identified between the two VHL E3 ligase target sites (
[0558] Mutations of the 344-417 region were then tested for their effects on oxygen-dependent regulation in vivo. The HIF-1 344-417 region is known to confer oxygen-dependent regulation on a GAL-VP6 fusion (O'Rouke). The C-terminal deletion (344-400) and the P 402 A mutation were tested in this context and both were found to abolish oxygen-dependent regulation in vivo (
3.6 Identification of Critical Point Mutations.
[0559] Identification of critical point mutations allows these two VHL E3 target sites to be assayed within the full-length HIF-1 molecule. The P 402 A mutation was introduced to ablate activity of the 5 VHL E3 target site and the P 564 G mutation to ablate activity of the 3 VHL E3 target site. 35S-methionine labelled full length HIF-1 wild type and mutant substrates were generated by IVTT and subjected to in vitro ubiquitylation in cytoplasmic extracts from RCC4 cells, which lack pVHL (RCC4), or RCC4 cells stably transfected with pcDNA3 VHL.HA (RCC4/VHL) in the presence or absence of exogenous ubiquitin. The double mutant P402A+P564G was found to show no VHL dependent ubiquitylation, but isolated mutations of the critical prolines at each individual VHL E3 target site did not ablate ubiquitylation. Thus when these mutations are introduced individually the mutant HIF-1 proteins still remain targets for VHL-dependent ubiquitylation (presumably because each retains an active VHL E3 target site).HIF-1 therefore appears to contain two, and only two target sites for VHL-dependent ubiquitylation. To assay importance in vivo, the single and double VHL E3 target site mutants were transfected into the HIF-1 deficient cell line KA13 (Wood et al) and tested for their ability to mediate oxygen-dependent transcriptional regulation (
3.7 the 5 and 3 VHL E3 Target Sites Differ in their Functional Requirements.
[0560] The ability of pVHL to interact directly with both the 5 and 3 E3 target sites was tested in vitro. The 35S-methionine labelled GAL-HIF-1 fusion proteins GAL 344-553 P402A, GAL 344-553, GAL 652-826, GAL 554-698 were made by IVTT, incubated in buffer or cell extract from RCC4 cells lacking pVHL at 30 degrees C. for 1 hour. Samples were then cooled and incubated with extract from 786-0 cells stably transfected with pcDNA3 VHL.HA for 90 minutes on ice prior to immunoprecipitation with anti-HA antibodies and protein G beads. Input samples of the GAL-HIF-1 alpha fusion proteins and retrieved immunoprecipitates were analysed by SDS/PAGE and autoradiography. The 3 VHL E3 target site is already known to bind VHL in an in vitro interaction assay (Cockman et al) and the results obtained confirmed this. In contrast the 5VHL E3 target site (represented by GAL 344-553) does not appear to bind pVHL in this assay. Either the interaction of pVHL with the 5 E3 target site is transient and too weak to be detected, or the interaction is not direct. After treatment of the Gal-Hif-1 alpha fusion proteins with cytoplasmic extract both the 5 and 3 VHL E3 target sites can be captured by the anti-HA immunoprecipitation. Interaction is not seen when the Gal-Hif-1 alpha fusion protein contains the P402A mutation known to disrupt function of the 5 site.
[0561] In a previous domain analysis of HIF-1 the 5 VHL E3 target site was not detected (Ohh et al). We wondered whether this was due to the use of S100 extract. VHL-dependent ubiquitylation of both the 5 and 3 E3 target sites was compared using the standard cytoplasmic extract or S100. 35S-methionine labelled GAL-HIF-alpha amino acids 344-553 fusion protein and GAL-HIF-1 alpha amino acids 554-698 fusion protein substrates were generated by IVTT. Ubiquitylation was performed in fresh cytoplasmic extract, cytoplasmic extract which had been left at 4 degrees C. for 4 hours or the S100 supernatant of cytoplasmic extract from RCC4 cells, which lack pVHL or RCC4 cells stably transfected with pcDNA3 VHL.HA. The S100 extracts clearly enabled VHL dependent ubiquitylation of GAL-HIF-1 alpha amino acids 554-698 fusion protein but not GAL-HIF-1 alpha amino acids 344-553 fusion protein. A factor specifically required for recognition of the 5 VHL E3 target site is either lost or inactivated during S100 preparation.
3.8 the 5 VHL E3 Target Site is Also Regulated by Proline Hydroxylation.
[0562] It has been shown above that the 3 VHL E3 target site responds to oxygen level via hydroxylation at proline residue 564. This proline residue forms part of a potential motif conserved between the 5 and 3 target sites. Mutation of the corresponding proline residue (P402A) in the 5 target site also results in functional inactivation. It was possible therefore that proline residue 402 was also a target for regulatory hydroxylation. To test this we asked whether polypeptides corresponding to the 3 VHL E3 target site could interfere with the cytoplasmic extract-dependent modification of the 5 VHL E3 target site. 35S-methionine labelled GAL-HIF-1 alpha amino acids 344-553 fusion protein substrate was generated by IVTT and incubated in vitro in buffer or cytoplasmic extracts from RCC4 cells in the presence of wild-type 19mer peptide representing HIF-1 alpha amino acids 556-574 (12.5SM); a polypeptide where the critical proline is mutated to glycine (P564G); or a polypeptide where the proline is modified to a hydroxy-proline (POH). The products of this reaction were then used as substrates in an in vitro ubiquitylation assay in the presence or absence of VHL E3 ligase. The 19mer wild-type polypeptide (P) was found to completely ablate the cytoplasmic extract effect. In contrast a polypeptide in which the critical proline is mutated to glycine (P-G) was found to have no effect. The 3 VHL E3 target site polypeptide can therefore compete the cytoplasmic extract-dependent modification at the 5 site in a manner dependent upon integrity of proline 564. Pre-hydroxylation of proline 564 rendered the polypeptide unable to compete for modification at the 5VHL E3 target site presumably because it is no longer a substrate for the enzymatic modification which is occurring at the 5 VHL E3 target site. Thus proline hydroxylation appears to be involved in regulating VHL-dependent ubiquitylation at both the 5 and 3 E3 target sites.
3.9 Discussion.
[0563] Through the use of in vitro ubiquitylation assays we have identified 2 independent regions of HIF-1 targeted by the VHL E3 ligase. Both target sites are located within the ODDD and are functional in vivo. Identification of the two VHL E3 target sites is consistent with published data which implied the existence of more than one oxygen-dependent degradation domain within HIF-1. Residues 532-585 of HIF-1 encompasssing the 3 VHL E3 target site has previously been shown to be a target for VHL-dependent ubiquitylation. Identification of a second VHL E3 target site provides further evidence of the critical role played by VHL in HIF-1-mediated oxygen-sensing.
[0564] Although HIF-1 possesses two target sites for VHL E3, they appear to be functionally different. The 3 VHL E3 target site corresponds to the previously identified VHL-binding site. This region of HIF-1 appears to be targeted directly by VHL acting as the recognition component of the VHL E3 ligase. In contrast we have no evidence that the 5 VHL E3 site can bind VHL directly although it can interact with the complete VHL E3 ligase complex. This may be because the interaction of VHL with the 5 site is indirect or weak compared to the 3 site and difficult to detect by the in vitro binding assay used. Both target sites contain a potential consensus motif LXXLAP but differ in the sequences surrounding the motif. Since the sites also differ functionally (i.e. in their ability to interact with VHL and their ability to be ubiquitylated by VHL E3 in S100 extract), this indicates that determinants other than the conserved core residues are important. It is important to understand the key determinants both for oxygen-dependent proline hydroxylation and for subsequent interaction with VHL E3. Particularly since database searches identify LXXLAP motifs in a wide variety of cellular proteins.
[0565] Although the two sites have functional differences, they both seem to be regulated by the same enzymatic modification. Hydroxylation at proline 564 is the key modification controlling activity of the 3 VHL E3 site. The corresponding proline in the 5 VHL E3 site is also critical for function and polypeptide competition experiments implicate regulatory hydroxylation. Direct evidence of this will come from mass spectrometric analysis. Also of interest is whether the same enzyme is responsible for oxygen-dependent proline hydroxylation at both sites. Sequence differences in the target sites may allow recruitment of different enzymes which in turn may allow graded or cell-type specific differences in the oxygen response. S100 extract was found to be incapable of supporting VHL-dependent ubiquitylation at the 5 site. This may be due to removal of a 5 site-specific enzyme. Alternatively it may be due to removal of a bridging protein proposed to act between the 5 VHL E3 target site and VHL E3. The bridging protein may be an unknown protein or an already identified component of the VHL E3 ligase.
REFERENCES
[0566] Cockman, M. E., et al., Hypoxia inducible factor-alpha binding and ubiquitylation by the von Hippel-Lindau tumor suppressor protein. J Biol Chem, 2000. 275: p. 25733-41. [0567] 2. Brenner, S., The genetics of Caenorhabditis elegans. Genetics, 1974. 77: p. 71-94. [0568] 3. Wood, S. M., et al., Selection and analysis of a mutant cell line defective in the hypoxia-inducible factor-1 alpha-subunit (HIF-1alpha). Journal of Biological Chemistry, 1998. 273: p. 8360-8368. [0569] 4. Huang, L. E., et al., Regulation of hypoxia-inducible factor 1 is mediated by an oxygen-dependent domain via the ubiquitin-proteasome pathway. Proceedings of the National Academy of Sciences, USA, 1998. 95: p. 7987-7992. [0570] 5. Iliopoulos, O., et al., Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein. Proceedings of the National Academy of Sciences, USA, 1996. 93: p. 10595-10599. [0571] 6. Ohh, M., et al., Ubiquitination of hypoxia-inducible factor requires direct binding to the beta-domain of the von Hippel-Lindau protein. Nat Cell Biol, 2000. 2(7): p. 423-427. [0572] 7. O'Rourke, J. F., et al., Oxygen-regulated and transactivating domains in endothelial PAS protein 1: comparison with hypaoxia inducible factor-1 alpha. Journal of Biological Chemistry, 1999. 274: p. 2060-2071. [0573] 8. Lewis, J. A. and Fleming J. T. Basic culture methods (1995) In Methods in Cell Biology, Vol 48 (ed. H. F. Epstein and D. C. Shakes) p.3 Academic Press, San Diego, Calif.
Experimental for Example 4
Materials and Methods
[0574] C. elegans Culture, Strains and Extract Preparation.
[0575] Worms were cultured using standard methods. Exposure to hypoxia was in bell jars gassed with humidified air or certificated nitrogen I oxygen mixes (British Oxygen Company). Exposure to 2.2 dipyridyl (200 m), or dimethyl-oxalylglycine (1 mM) was performed during growth in a liquid medium. Wild type worms were Bristol strain (N2). Mutant strains were obtained from the Caenorhabdltis Genetics Centre and are as indicated in table 5. A deletion mutant in the vhl-1 gene (ok1610) was generated using trimethylpsoralen. The vhl-1 strain CB5603 was constructed by backcrossing ok161 twice against wildtype (N2), then constructing a triple mutant with markers on either side of vhl-1 (genotype: dpy-6 (e2062) vhl-1 (ok161) unc-9 (8101), and then removing these markers by further crosses against N2. Worm extracts were prepared by homogenisation (Ultraturax T20, IKA Labortechnlk) in 4 volumes extraction buffer (100 mM NaCl, 1 mm EDTA, 50 mM Tris pH7.5, 1% NP-40, 1% sodium deoxycholate) for immunoblotting or in 2 volumes of hypotonic extraction buffer, HEB (20 mM Tris pH7.5 5 mM KCl, MgCl.sub.2 1 mM DTT) for modification reactions.
Mammalian Cells and Extract Preparation
[0576] HeLa and RCC4 cells were cultured in DMEM. Cell extracts were prepared in HEB.
Antibodies for Immunoblotting and Immunoprecipitation.
[0577] For detection of native C. elegans HIF-1 and VHL-1 proteins, antisera were produced in rabbits immunised with either a glutathione-S-transferase fusion protein expressing amino acids 360-467 of HIF-1, or a maltose binding protein fusion linked to full length (1-174) VHL-1. Recombinant proteins were expressed in E. coli. Antisera were tested for reactivity using extracts of appropriately transfected Cos7 cells, and purified by ammonium sulphate precipitation. Mouse anti-HA antibody was 12CAS (Roche), and mouse anti-Gal4 antibody was RK5C (Santa Cruz).
Riboprobes and RNAse Protection.
[0578] Details of riboprobe templates are provided in table 4. RNAse protection assays were performed as described (Wiesener et al., (1998) Blood 92 2260-2268) using total RNA prepared from a mixed population of worms using Tri-Reagent (Sigma), or total RNA prepared from HeLa cells using RNAzolB (Biogenesis).
Plasmid C. elegans cDNAs.
[0579] The hif-1 cDNA was assembled from 4 overlapping cDNA clones, yk510h7, yk4a2, yk383g1 and yk272d11 (Yuji Kohara, National Institute of Genetics, Japan), and inserted into pcDNA1AMP (Invitrogen). The vhl-1 cDNA and the cDNA encoding the predicted ORF of T20B3.7 were obtained by RT-PCR of worm RNA and inserted into pcDNA3 (with linkers that encoded an N-terminal HA tag), and pSP72 (Promega) respectively. The egl-9 cDNA was subcloned into pcDNA1 from yk130h5 (Yuji Kohara). Phy-1 and phy-2 cDNAs were subcloned in pCR-Script (Winter and Page, (2000) Mol. Cell. Biol. 20 4084-4093) Gal4/HIF-1 fusion proteins were generated by PCR and inserted into pcDNA3Gal (O'Rourke et al., (1999) J. Biol. Chem. 274 2060-2071).
[0580] For insect cell expression, sequences encoding Gal4/HIF-1 (289-790) and EGL-9 (1-723) were subcloned into pFastBac1 (Gibco BRL). For bacterial expression, sequences encoding Gal4/HIF-1 (590-790) and EGL-9 (359-723) were subcloned into pET-28a (Novagen), and pMAL-p2X (NEB) respectively.
Mammalian cDNAs
[0581] The cDNAs encoding the human polypeptides designated EGLN-2 (PHD1), EGLN1 (PHD2), and EGLN3 (PHD3) were obtained by PCR amplification and/or restriction endonuclease digestion from publicly available cDNA banks (The I.M.A.G.E consortium, end NEDO human cDNA sequencing project) or a human colonic cDNA library. Products were ligated into pcDNA3 for expression in reticulocyte lysate IVTTs, or into pMAL-c2X for expression in E. coli as maltose binding protein fusions. pPDS15 (Lipscomb et. al. (1999) J. Neurochem. 73 429-432) was used for expression of rat SM-20 in reticulocyte lysate IVTT; sequences encoding amino acids 60-355 were subcloned into pTYB11 (NEB) for expression in E. coli.
[0582] For bacterial expression, human HIF-1 sequences encoding amino acids 344-503 or 530-698 were subcloned into pET28a.
[0583] Mutations were generated using a site directed mutagenesis system (Stratagene). All plasmid sequences were verified by DNA sequencing.
Protein Expression.
[0584] .sup.35S-labelled or unlabelled proteins were generated in TNT reticulocyte lysate or wheat germ lysate (Promega). Protein expression in insect cells was performed using the Bac-to-BacI/Sf9 system (Gibco BRL). Bacterially expressed proteins were produced in E. coli strain BL21 (DE3). Proteins were used in lysates or purified using amylase resin, DEAE-Sepharose, nickel affinity chromatography, or anti-Gal antibodies, as appropriate.
Interaction Assays
[0585] Assays for interaction between recombinant VHL and HIF polypeptides conformed to the following experimental design. Recombinant VHL and HIF polypeptides were produced separately in vitro. The HIF polypeptide was then pre-incubated with extract or a recombinant enzyme as described below, then mixed with VHL and incubated in EBC buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.5% v/v Igepal, 0.5 mM EDTA) at 4 C. for 1 hour, before immunoprecipitation with anti HA antibodies (for HA tagged VHL) or anti Gal antibodies (for Gal4HIF fusions) and analysis by PAGE (Jaakkola et al. (2001) supra).
[0586] A schematic of the on bead modification assay is shown in
[0587] Preincubation of C. elegans HIF-1 with worm extract or recombinant EGL-9 was for 30 min at 25 C. Preincubation of mammalian HIF- polypeptides with cell extract or recombinant enzymes was at 37 C. for 10-30 min unless otherwise stated. For assays of recombinant enzymes, 2-oxoglutarate (2 mM), iron (100 M), and ascorbate (2 mM) were added to the reaction buffer unless otherwise indicated. Reactions performed in hypoxia were in the stated atmospheric oxygen concentration (balance nitrogen) obtained using a controlled environment Invivo.sub.2 400 hypoxia work-station (Ruskinn Technologies) and buffers pre-equilibrated with the appropriate atmosphere. Reactions (50 l) were performed in open Eppendorf tubes with mixing and stopped by the addition of 20 volumes desferrioxamine (100 M).
[0588] For peptide blocking experiments peptides (final conc. 1 M) were pre-incubated with VHL-1 for 15 min before addition to the interaction.
[0589] For VHL capture assays using synthetic biotinylated H1F1- peptides, peptide was preincubated as indicated for 30 min at 37 C., then bound to strepavidin beads, washed, mixed with recombinant VHL or extract, re-captured using beads, and bound VHL analysed by PAGE.
[0590] For HIF-1 capture assays using 786-0/VHL cell extract, HIF-1 polypeptides were produced by IVTT, pre-incubated with enzyme, then interacted with cell extract under conditions (10 mM Tris pH7.5, 0.25M NaCl, 0.5% NP40, at 4 C.) that do not permit modification of H1F1- (Masson et al. (2001) EMBO), then immunoprecipitated with anti-HA and analysed by PAGE.
[0591] Details of the capture assay protocol are provided below.
HPLC Analyses
[0592] Hydroxylation of the HIF-1 peptide B19Pro (residues 556-574) was analysed by reverse phase HPLC using a Phenomenex Hypersil 5 C18(octadecylsilane) 2504.6 mm column and a 5% to 95% acetonitrile gradient in 0.1% TFA at 1 ml/min as the mobile phase. A Gilson HPLC system using 306 pumps and 115 UV detector controlled by Gilson 715 software was used. Standards were unmodified B19Pro and a synthetic peptide (B19Hyp) bearing a hydroxyproline substitution at Pro564.
[0593] Assays were performed with 2.5 mM ascorbate, 1.25 mM DTT, 50 M KG, 1.25 mM Fe(II), 25M peptide, 0.66 mg/ml catalase, 1.75 mg/ml EGLN2pMAL, in 50 mM Tris/HCl, 1.5 mM MgCl.sub.2 5 mM KCl. All cofactors were mixed simultaneously by the addition of enzyme to separate drops and incubation was at 37 C. for 30 mins. Assays stopped with methanol (70 l) and frozen on dry-ice before centrifugation and injection.
[0594] For analysis of hydroxyproline, peptides or proteins were subject to acid hydrolysis, derivatisation with phenylisothiocyanate and HPLC using standard methods.
[0595] Decarboxylation assays were performed using 1-[.sup.14C]-2-oxoglutarate purified polypeptide substrates at approximately 25 M, and a purified EGLN2 (PHD1) fusion as described in Mukheji et al. (2001) supra.
On Bead Modification
[0596] Gal/549-582/VP16 In vitro transcription translation (IVTT) was prepared using 20 l Promega TnT Quick Coupled Retic lysate (Promega, Madison, USA) 1 l DNA (1 g/ul), 2 l 1 mM desferrioxamine (DFO) and 2 l cold methionine (supplied with IVTT kit). For a positive control, the 2 l DFO was replaced with 2 l 1 mM FeCl.sub.2 (freshly made). The IVTT reaction was incubated at 30 C. for 90 min
[0597] Beads were prepared using 2 l gal beads (Santa Cruz no. sc-S10 AC), 5 l IVTT, & 100 l EBC+100 M DFO and incubated in an End-Over-End rotator for 30-60 min. The beads were then spun at 2,000 rpm for 1 minute, the supernatant removed and the beads washed in 1 ml of EBC (no EDTA or DFO). This was repeated three times.
[0598] The beads were then re-suspended in 1000 l HEB (hypotonic extraction buffer: 20 mM Tris pH7.5, 5 mM KCl, 1.5 mM MgCl.sub.2, 1 mM dithiothreitol) for each reaction. 100 l of the re-suspended beads were transferred into fresh microfuge tubes containing 500 l of HEB+DTT. The tubes were spun at 2000 rpm for 1 minute and the supernatant removed. Beads were then incubated at room temperature for ten minutes in an end-over-end rotator with a lysate sample under modification conditions as described below then spun at 2000 rpm for 1 minute.
[0599] Supernatant was removed and the beads washed three times in 500 l EBC (50 mM Tris pH 7.5, 150 mM NaCl, 0.5% v/v Igepal, 0.5 mM EDTA)+DFO (In the case of incubation with neat retic lysate, removal of supernatant was facilitated by addition of 500 ul of EBC+DFO prior to the first spin). The supernatant was then removed from the final wash and the beads used for pull down assays.
VHL Capture Assays
[0600] VHL capture or pull-down assays on the Gal/549-582/VP16 beads modified as described above were performed on ice. VHL-HA (T2. 1) IVTT performed by mixing 20 l Promega TnT Quick Coupled Retic lysate (Promega) with 3 l H.sub.2O, 1 l DNA (1 ug/l) and 1 l (0.37 MBq) .sup.35S-methionine (Amersham Redivue no. AG1094) and incubating at 30 C. for 90 minutes. VHL-HA IVTT was then diluted in 100 l of EBC+100 M DFO, for each set of beads to be assayed. To the modified, washed gal/ODD/PI6 beads, 100 l of the VHL IVTT (T2.1) were added in EBC buffer+100 M DFO.
[0601] The reaction was incubated in an end-over-end rotator for 2 hours in cold room, then spun at 2.000 rpm for 1 minute and the supernatant removed(radioactive liquid waste). The beads were washed with 500 l of EBC buffer and 100 M DFO and spun again at 2.000 rpm for 1 minute. The wash steps were repeated a total of 5 times. The supernatant was removed from the final wash and eluted in 15 l of 2SDS sample buffer.
[0602] Samples were stored at 20 C. and examined by SDS-PAGE.
DNA and Protein Manipulation
[0603] DNA manipulation and cloning and protein expression and analysis by SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) were performed according to standard techniques which are well known to those of skill in the art and described in detail in Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press and Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 1992.
4:1 Identification and Characterization of a HIF-1 Homologue in C. elegans
[0604] A tBLASTn enquiry with the HIF- human sequence was used to identify HIF- subunit homologues in the C. elegans EST database. An EST contig was identified which was identical to an open reading frame (ORF: F38A6.3). This ORF was predicted following determination of the C. elegans genome sequence, with the exception of a 104 amino acid amino terminal extension in the latter. No further ESTs or PCR products corresponding to the extension were identified and RACE-PCR products contained a putative trans spliced leader sequence. These findings predict that F38A8.3 encodes a 119 amino acid polypeptide that lacks the proposed amino terminal extension.
[0605] To characterize the regulation of the putative HIF- homologue (HIF-1), we raised antisera to a recombinant polypeptide and immunoblotted worm extracts. Extracts were prepared from worms exposed to hypoxia, or the cell penetrating iron chelator 2, 2 dipyridyl.
[0606] Immunoblotting showed a striking induction of HIF-1 by both stimuli. Induction by hypoxia was progressively below 5% oxygen and maximal at the lowest tested concentrations of 0.5% and 0.1% oxygen. In 0.1% oxygen, HIF-1 protein level was strongly induced within 4 hrs, and sustained over 24 hrs, but disappeared within minutes following re-oxygenation. In contrast, hif-1 mRNA levels were unchanged by hypoxia. Thus, these experiments confirmed up-regulation of HIF-1 by hypoxia, and suggested a mode of regulation at the protein level similar to that described for mammalian HIF- subunits.
4.2 Critical Function of a pVHL Homologue VHL-1 in the Regulation of HIF-1 in C. elegans.
[0607] We compared HIF-1 expression in wild type and a series of mutant worms that were selected because of potential relevance to previously proposed models for oxygen sensing and signal transduction processes in the mammalian HIF system (Chandel et al., (2000) J. Biol. Chem. (August) 1-37; Ehleben et al. (1997) Kidney Int. 51 483-491; Zundel et al. (2000) Genes & Dev. 14 391-396) for review see (Semenza, (1999) Cell 98 281-284). These included mutants in the PTEN/insulin receptor/PI-3-kinase pathway (daf-18, daf-1, age-1), a mutant in a putative homologue of VHL (vhl-1), mutants affecting mitochondrial proteins (mev-1, clk-1, gas-1), a mutant that affects cytosolic catalase activity ctl-1, and others selected for resistance or sensitivity to oxidant stresses but where the mutant gene is not yet characterized (mev-2, mev-3).
[0608] With the exception of vhl-1 all mutant worms showed preserved regulation of HIF-1 protein levels. In contrast, the vhl-1 worms showed high levels of HIF-1 in normoxia that were essentially unregulated by oxygen. These results confirmed that proposed homology for vhl-1 (Woodward et al. (2000) Genomics 65 253-265), and indicated a conserved role for C. elegans VHL-1 protein in the response to hypoxia.
4.3 Interaction of HIF-1 with VHL-1 is Regulated by Prolyl Hydroxylation.
[0609] To address the mechanism of regulation of HIF-1 by VHL-1, interaction between the two proteins was tested. .sup.35S-methionine labelled hemagglutinin (HA) tagged VHL-1 (HA.VHL-1), and HIF-1 were produced separately in vitro in coupled transcription translation reactions (IVTT) in reticulocyte lysate. IVTTs were then mixed and assayed for interaction by anti-HA immunoprecipitation. When produced this way, the proteins did not interact. However, when recombinant HIF-1 was pre-incubated with worm extract, a clear interaction was observed.
[0610] A series of N-terminal truncations of HIF-1 linked to a Gal4 DNA binding domain was constructed. The Gal/HIF-1 fusion proteins were expressed in reticulocyte lysates, pre-incubated with worm extracts and then tested for interaction with HA.VHL-1. These experiments demonstrated that whilst N terminal truncations up to and including Gal4/HIF-1(590-719) were captured efficiently by HA.VHL-1, Gal4/HIF-1(641-719) was not, implicating HIF-1 amino acids 590-641 in the interaction.
[0611] Inspection of this region revealed homology to pVHL-binding domains in human HIF-1 that have recently been shown to contain sites of prolyl hydroxylation (Ivan et al., (2001) Science 292 464-468; Jaakkola et al. Science (2001) 292 468-472). We therefore mutated the homologous prolyl residue in C. elegans HIF-1 (P621 to G) and found that this mutation ablated interaction with HA.VHL-1.
[0612] The demonstration of a critical conserved prolyl residue in C. elegans HIF-1, together with the need for pre-incubation with worm extract provided indication that the mechanism regulating the HIF-1/VHL-1 interaction through enzymatic prolyl hydroxylation might also be conserved in C. elegans. To verify this, N-oxalyl-2S-alanine, a 2-oxoglutarate analogue that inhibits this class of enzymes (Cunliffe et al. (1992) supra) was added to the worm extract during pre-incubation with HIF-1. This strongly inhibited activity in a manner that was competed by excess 2-oxoglutarate, as inhibition was antagonized by 5 mM 2-OG.
[0613] To test whether hydroxylation of the critical P621 residue in C. elegans HIF-1 could indeed promote binding to VHI-1, we synthesised N-terminal biotinylated peptides corresponding to residues 607-634 of C. elegans HIF-1 that contained either a proline (B28Pro) or a (2S.4R)-trans-hydroxyproline residue (B28Hyp) at position 621. We found that B28Hyp but not B28Pro blocked capture of pretreated HIF-1 by HA.VHL-1, when added to the interaction mix.
[0614] Furthermore. B28Hyp but not B28Pro captured immunodetectable native VHL-1 when mixed with extracts from wild type but not vhl-1 mutant worms. Finally, to test the importance of prolyl hydroxylation in regulating C. elegans HIF-1 in vivo we exposed worms to the cell-penetrating prolyl hydroxylase inhibitor, dimethyloxalylglycine. This strongly induced HIF-1 in normoxic worms. These results demonstrated that conservation of the HIF/pVHL system in C. elegans extends to the mode of regulation by prolyl hydroxylation.
4.4 the C. elegans Egl-9 Gene Product is a Prototype HIF-PH.
[0615] The best characterised prolyl hydroxylases are the procollagen-modifying enzymes (Kivirikko and Myllyhaiju, (1998) Matrix Biol. 16 357-368). However, worms containing inactivating mutations in each of two isoforms of the catalytic subunits, dpy-1B (also termed phy-1) and phy-2 (Friedman et al., 2000 supra: Winter and Page, 2000 supra) showed normal HIF-1 regulation, consistent with HIF-PH being distinct from the collagen modifying enzymes.
[0616] We searched C. elegans and mammalian databases for additional HIF-PH candidate genes that were well conserved between these species and possessed a common -barrel jelly roll motif.
[0617] Of particular interest was a family of genes related to the C. elegans gene egl-9, a gene of previously unknown function that was first identified on the basis of an egg-laying abnormal (egl) phenotype (Trent et al., (1983) Genetics 104 619-647).
[0618] Sequence analyses coupled with secondary structure predictions in the light of crystallographic data (Valegard et al. (1998) supra: Zhang et al, (2000) Nature Structural Biology 7 127-133) predicted that these genes would encode a family of enzymes conserved in C. elegans and mammals. The predictions suggested that the enzymes would contain not only the jelly roll motif, but also conserved iron and 2-oxoglutarate binding residues in the same relationship that they occur in crystallographically characterised enzymes e.g. the HXD . . . H iron binding motif on the second and seventh strands of the jelly roll motif.
[0619] Mutants worms containing defective egl-9 alleles were therefore assessed for regulation of HIF-1 by immunoblotting. Three strains bearing inactivating mutant alleles of egl-9. (sa307, sa330, and n571) (Darby et al., (1999) PNAS 96 15202-15207; Trent et al. (1983) Genetics 104 619-647) all showed striking constitutive up-regulation of HIF-1 in normoxia and loss of induction by hypoxia. Moreover, a further temperature sensitive egl-9 mutant, n586 showed enhanced normoxic HIF-1 level at the non-permissive temperature.
[0620] To determine the effect of EGL-9 on the HIF-1 transcriptional response, we measured mRNA levels of a range of hypoxia inducible transcripts and found striking up-regulation in egl-9 worms. A strongly inducible mRNA of unknown function (F22B6.4) was also identified. These findings demonstrated a critical function for EGL-9 in the regulation of HIF-1 and provided further indication that EGL-9 functions as a HIF.PH that targets HIF-1 to VHL-1.
[0621] We produced recombinant EGL-9 and assessed its ability to catalyse the posttranslational modification of HIF-1. HIF-1 was captured efficiently by HA.VHL-1 after incubation with EGL-9 programmed reticulocyte or wheat germ lysates, but not unprogrammed lysate.
[0622] In contrast, IVTTs expressing recombinant C. elegans PHY-1, PHY-2 and the gene product of the predicted ORF T20B3.7 that also has significant homology to known prolyl hydroxylases, had no activity in these assays.
[0623] To test whether EGL-9 could act directly on HIF-1, further preparations were made by baculoviral expression in insect cells and by expression as maltose binding protein (Map) fusion proteins in E. coli. Since full length MBP/EGL-9 protein was insoluble when expressed in E. coli we prepared an N-terminal truncation containing residues 359-723 (MBP/N.EGL-9) that preserved the predicted catalytic domain and had HIF.1 modifying activity when expressed as an IVTT. C. elegans HIF-1 substrates were made as N-terminal Gal4 fusion proteins in either insect cells or E. coli and purified by anti-Gal immunoprecipitation. These substrates were incubated with lysates of insects cell expressing full length EGL-9 or purified MBP/N.EGL.9, and tested for ability to capture VHL-1.
[0624] Both forms of recombinant EGL-9 efficiently promoted modification of HIF.1 as indicated by HA.VHL-1 capture. Moreover analysis of this activity demonstrated 2-oxoglutarate, iron, and oxygen dependence, and direct inhibition by cobaltous ions.
[0625] To demonstrate that activity in the HA.VHL-1 capture assays corresponded to hydroxylation of the critical HIF-1 residue P621, we assayed modified HIF-1 polypeptides for 4-hydroxyproline content by HPLC. To provide larger quantities of protein for this analysis, we co-transformed E. coli with wild type or the P621 to G mutant form of a His.sub.6/Gal4/HIF-1(590-719) (HGH) fusion protein and either MBP/N.EGL-9 or MBP. His/Gal4/HIF-1 substrates were retrieved by nickel affinity chromatography and aliquots assayed for ability to capture 35S-methionine labelled HA.VHL-1 using anti-Gal immunoprecipitation, or subjected to acid hydrolysis and HPLC analysis for the presence of phenylisothiocyanate derivatised 4-hydroxyproline.
[0626] In concordance with the HA.VHL-1 capture assay results, 4-hydroxyproline was produced in the wild type but not the mutant HiS.sub.6/Gal4/HIF-1 substrate following exposure to active enzyme (
4.5 Identification of a Series of Mammalian HIF-PH Isoforms.
[0627] Sequence similarity between EGL-9 and a rat gene product termed SM-20 (Wax et al., (1994) J. Biol. Chem. 269 13041-13047) has been noted previously though no functional connection was recognised (Darby et al. (1999) supra). Our sequence-structure search identified a larger series of homologies and predicted three closely related genes in each of the human and rodent genomes that bore striking homology to egl-9, in particular over the core putative catalytic domain.
[0628]
[0629] The human protein products have been termed EGLN1, 2, and 3 or Prolyl Hydroxylase Domain containing (PHD) 2, 1 and 3 respectively. Note that the gene termed EGLN3 or PHD3 has previously been identified as human homologue of rat SM-20 (Dupuy et al. (2000) Genomics 69 348-354).
[0630] To test the role of these gene products in regulating the interaction between human HIF sub-units and the VHL E3 ligase complex, we first produced the proteins by reticulocyte IVTT. Since unprogrammed lysate has a low level of HIF-PH activity (Jaakkola. et. al., 2001 supra) we tested for enhanced ability of the programmed lysates to promote the HIF./VHL E3 interaction. After incubation with relevant enzyme, HIF- substrates were mixed with extracts from 786-0N/VHL cells that stably express HA tagged human pVHL, and tested for interaction by anti-HA immunoprecipitation.
[0631] With full length wild-type HIF-1, striking activity was observed with rat SM-20 and all three human gene products, but not a mutant EGLN1 bearing an H358A substitution at the predicted catalytic site, and not a different human 2-oxoglutarate dependent oxygenase (phytanoyl coenzyme A hydroxylase (Mukherji et al. 2001) that was tested as a negative control. Similar results were obtained with HIF-2.
[0632] Examination of HIF.1 mutants bearing missense substitutions at the critical prolyl residues in the: HIF-1 ODDD (Masson et al 2001) showed that that enzymes were differentially efficient at promoting interaction via the C-terminal (P564) and N-terminal. (P402) prolyl hydroxylation sites. Whereas interaction through the C-terminal site could be promoted by all enzymes, VHL E3 capture was less efficient when only the N-terminal site (P402) was intact, and was only promoted by EGLN2 (PHD1) and EGLN1(PHD2). No activity at all was observed with a double HIF-1 mutant, P402A P564G, that ablates both hydroxylation sites.
[0633] In keeping with these results, all enzymes strongly promoted interaction of pVHL with isolated HIF-1 sequences {residues 549-582) from the C-terminal site. Further analysis demonstrated that this activity was strongly inhibited by iron chelation, cobaltous ions, and the 2-oxogluarate analogue N-oxalylglycine.
[0634] To confirm direct action on HIF- sequences, we prepared purified EGLN2 as an MBP fusion protein in E. coli and assayed activity using either purified His-tagged HIF-1 polypeptides containing the N-terminal (344-503) or C-terminal (530-698) hydroxylation sites, or a synthetic peptide consisting of the minimal HIF-1 C-terminal substrate (B19Pro, residues 556-574). These experiments demonstrated activity by pVHL capture assays, HPLC/MS detection of the hydroxylated peptide product or derivatised 4-hydroxyproline, and by 2-oxoglutarate decarboxylation assays.
[0635] To verify expression of all three isoforms, we performed RNase protection analysis using riboprobes specific for each transcript. Since recently published work has indicated that the rate of HIF degradation in normoxia is enhanced by prior exposure of cells to a period of hypoxia (Berra et al. (2001) FEBS Letters 491 85-90) it has been predicted that HIF-PH would itself be induced by the transcriptional response to hypoxia.
[0636] RNase protection demonstrated that all three HIF-PH mRNAs are expressed in HeLa cells and that, in this cell line, transcripts for EGLN1 (PHD2) and EGLN3 (PHD3) but not EGLN2 (PHD1) are induced by hypoxia. In keeping with this, semi-quantitative analysis of lysates prepared from HeLa cells that had been grown in normoxla or exposed to hypoxia for 16 hours then assayed for HIF-PH activity in vitro using the pVHL capture assay, demonstrated induction of total HIF-PH activity that was blocked by actinomycin D.
[0637] Finally, we used pVHL capture assays to measure the activity in vitro of recombinant EGLN2 on a HIF-1 549-582 substrate at graded levels of hypoxia in a controlled hypoxia work-station. We first measured the effect of graded hypoxia on the HIF modifying activity of extracts of vhl-defective RCC4 cells that contain a relatively high level of total HIF-PH activity. A progressive reduction in activity was observed with graded hypoxia. Similar assays were then performed using EGLN2 produced in reticulocyte lysate by IVTT, or purified MBP/PHD-1 obtained by expression in E. coli. Closely similar progressive reductions in the activity of each preparation were observed with graded hypoxia. Thus, the oxygen dependent activity of recombinant PHD-1 from either source parallels that observed in crude cell extracts, and mirrors the progressive increases in HIF-1 protein and DNA binding that are observed when cells are exposed to graded hypoxia in culture (Jiang et al., (1996) Am. J. Physiol. 271 C1172-C1180).
4.6 HIF Prolyl Hydroxylase Activity
[0638] Full length rat SM20, a truncated form of rat SM 20 lacking the amino terminal 59 amino acids and the human homologue EGLN-2 were shown to modify HIP amino acids 549-582 in a manner which facilitates interaction with the VHL protein. This is known to depend on hydroxylation of proline 564.
[0639] Wheat germ lysate was programmed with pcDNA3 based plasmids containing no insert, an insert encoding the full open reading frame of rat SM20, a truncated form of rat SM20 lacking the amino terminal 59 amino acids or the human homologue known as EGLN-2 in the absence of exogenous iron or with the addition of 100 M ferrous chloride. The nucleotide sequence corresponding to these putative proteins were generated by PCR and their identity was confirmed by sequencing. The protein products generated conformed with their predicted molecular weights.
[0640] Protein containing HIF-1 sequence (amino acids 549-582) was generated in a reticulocyte in vitro transcription translation reaction in the presence of 100 micromolar desferrioxamine, retrieved and then exposed to wheat germ translates containing the putative enzymes as described above. These proteins contain the critical proline (564) which can be modified by hydroxylation and which enables recognition by von Hippel Lindau tumour suppressor protein (pVHL).
[0641] The modification of the HIF-1 sequence was assayed by the binding of the HIF-1 to radiolabelled pVHL, generated by in vitro transcription and translation of a pcDNA3 vector containing the human wild type pVHL open reading frame in a rabbit reticulocyte lysate in the presence of .sup.35S-methionine.
[0642] SDS PAGE analysis indicated that the plasmids encoding the genes EGLN-2, full length and truncated rat SM20 produced, in the presence of Fe.sup.2+, a clear modification of HIF-1 which allowed capture of labeled pVHL.
[0643] No pVHL binding was observed in the absence of Fe.sup.2+ for SM20, or EGLN-2 and only a low level of binding was observed for truncated SM20.
4.7 Mutation of EGLN2
[0644] Modification and pVHL binding assays were performed as described above. Rabbit reticulocyte lysate was programmed with pcDNA3 based plasmids containing no insert, an insert encoding the full open reading frame of the human homologue known as EGLN-2, a mutant form of EGLN-2 with a Histidine to Alanine substitution at amino acid residue 358 or a naturally occurring splice variant lacking amino acids 369-389.
[0645] pVHL binding was observed only with the full length wild type PHD-3 polypeptide. The full length wild type enzyme was able to modify HIF-1 sequence whilst neither the mutant form nor the deleted splice variant was able to do so. This demonstrates that His358 and the region between residues 369 and 389 are necessary for HIF hydroxylase activity.
4.8 Effects of HIF and pVHL Mutations
[0646] Modification and pVHL binding assays were performed as described above. Wheat germ lysate was programmed with pcDNA3 based plasmids containing no insert, an insert encoding the full open reading frame of the human homologue known as EGLN-2, or an insert encoding the full open reading frame of the human homologue known as PHD-3 or EGLN-3.
[0647] HIF substrates for modification were wild type or contained mutation of proline 564 to glycine. The pVHL target for capture was wild type or contained the mutation of tyrosine 98 to histidine.
[0648] Binding of labeled pVHL was observed in assays using wild type HIF and pVHL. No binding was observed in assays using mutant HIF or pVHL.
[0649] Both EGLN2 and EGLN3 were therefore able to modify wild type but not mutant HIF in a manner allowing capture of wild type but not mutant pVHL.
4.9 Oxygen Dependence of Modification of HIF by Recombinant Enzymes
[0650] Modification and pVHL binding assays were performed as described above except that enzymes were generated by expression in COS cells or rabbit reticulocyte lysate.
[0651] Plasmids used to generate enzymes were as follows; pcDNA3 (without insert); pcDNA3 containing sequence encoding rat SM20 lacking the first 59 amino acids; pcDNA3 containing sequence encoding EGLN2 (PHD 1). Modification of HIF substrate by enzymes was performed in either normoxia (21% O.sub.2) or anoxia (2% O.sub.2) conditions using a hypoxia workstation.
[0652] Given the regulation of HIF-1 by oxygen and the known substrate requirement of 2-oxoglutarate dependent dioxygenases for oxygen, the oxygen dependence of the HIF modifying activity was examined.
[0653] In anoxia, EGLN2(PHD1) or rat SM20 (lacking the amino terminal 59 amino acids) were unable to modify HIF for pVHL binding, in contrast to the clear modification at 21% O.sub.2. This demonstrates oxygen dependence and a means of oxygen sensing in the regulation of HIF-1.
4.10 Effects of Oxalylglycine and 2-Oxoglutarate on EGLN2 and EGLN3 In Vitro
[0654] Modification and pVHL binding assays were performed as described above. Rabbit reticulocyte lysate was programmed with pcDNA3 based plasmids containing no insert, an insert encoding the full open reading frame of the human homologue of C. elegans Egl-9 known as EGLN-2, or an insert encoding the full open reading frame of the human homologue known as EGLN-3. Modification was performed in the absence of additives, in the presence of oxalylglycine, oxalylglycine plus 2-oxoglutarate, 200 M desferrioxamine or 200 M cobaltous chloride.
[0655] Enzyme activity was observed to be diminished by oxalylglycine, desferrioxamine and cobaltous ions. The inhibitory effect of oxalylglycine was partially competed by addition of excess 2-oxoglutarate. The family of 2-oxoglutarate dependent dioxygenases demonstrate a requirement for oxygen, iron and 2-oxoglutarate. The ability of these gene products to modify HIF-1 to a VHL binding form was examined in differing conditions of iron availability, 2-oxoglutarate availability and in the presence of a 2-oxoglutarate inhibitor. These results demonstrated an iron and 2-oxoglutarate dependence of activity in reticulocyte lysate.
4.11 Effects of Dimethyl Oxalyl Glycine on HIF Activity In Vivo.
[0656] Hep3b and U20S cells were co-transfected with a mixture of three plasmids; pUAS.tk.luc, encoding a GAL 4 responsive luciferase gene, pgal-hif775-826, a mammalian expression plasmid leading to expression of a fusion between a 147 amino acid DNA binding domain of GAL 4 and the carboxy terminal transactivator of human HIF-1 alpha, and pCMV.beta-gal, encoding a constitutively expressed beta-galactosidase gene as a transfection control.
[0657] 48 hours following transfection, cells were incubated in normoxia or 2% hypoxia overnight in the presence or absence of dimethyl oxalyl glycine as indicated. Cell lysates were assayed for luciferase and beta galactosidase activity and the relative luciferase activity in each sample determined.
[0658] In both cell lines, the presence of the HIF prolyl hydroxylase inhibitor resulted in enhanced activity of the carboxy terminal transactivator in both normoxia and hypoxia compared to the untreated samples (
[0659] Potentiation of the action of the carboxy terminal transactivator coupled with inhibition of destruction via the oxygen dependent degradation domains enhances the overall inhibitor mediated increase in HIF activity.
[0660] Addition of dimethyloxalylglycine to Hep3B and U20S cells in tissue culture (0.1 mM, 1 mM) was also observed to increase intracellular levels of HIF-1 in Western Blot experiments.
[0661] Effects of forced expression of EGLN2 (PHD 1) or a naturally occurring splice variant lacking amino acids 369-389 (PHD4) on HIF Activity
[0662] Hep3b cells were co-transfected with a mixture of three plasmids; pHRE.luc, encoding a HIF responsive luciferase gene, pcDNA3 or pcDNA3.HIF, mammalian expression plasmids leading to expression of no product or full length human HIF-1 alpha, and pCMV.beta-gal, encoding a constitutively expressed betagalactosidase gene as a transfection control.
[0663] 48 hours following transfection, cells were incubated in normoxia or 2% hypoxia overnight. Cell lysates were assayed for luciferase and beta galactosidase activity and the relative luciferase activity in each sample determined.
[0664] In all circumstances, relative luciferase activity was lower when co-expression included the full length EGLN2 (PHD) rather than the deleted, non-functional version (PHD4)(
[0665] The effect was even more prominent in circumstances where the level of HIF-la would be expected to be higher (e.g. when co-expressed from a plasmid or partially stabilised by modest hypoxia). This demonstrates that expression of these gene products is able to enhance HIF-1 degradation in vivo.
4.12 Effect of Inhibitors of HIF Prolyl Hydroxylase Activity
[0666] Modification and pVHL binding assays were performed as described above (and by reverse phase HPLC) to determine the effect of inhibitors on the ability of cell extract to modify Gal-Hif549-582-VPI6, thereby allowing capture of radiolabelled recombinant pVHL.
[0667] Binding of pVHL was determined using SDS-PAGE and autoradiography.
[0668] In the absence of treatment with cell extract, no binding of pVHL was observed, showing the Gal-Hif549-582-VPI6 was unmodified.
[0669] Treatment with cell extract in the absence of inhibitor showed strong binding of pVHL. Treatment with cell extract in the presence of oxalyl glycine (NK 87) showed reduced binding of pVHL, showing that oxalyl glycine inhibits the HIF prolyl hydroxylase. Treatment with cell extract supplemented with additional 2-oxoglutarate produced strong pVHL binding. Treatment with cell extract in the presence of NK87 and additional 2-oxoglutarate also produced strong binding, indicating that HK87 competes with the oxoglutarate co-substrate.
[0670] Treatment with cell extract in the presence of 1 mM NMPG produces strong binding of pVHL. However, treatment in the presence of 5 mM NMPG reduced the amount of pVHL binding.
[0671] As a positive control, pVHL was captured when Gal-HIF-VP16 substrate was synthesised in rabbit reticulocyte lysate in the presence of additional ferrous chloride. Other potential inhibitors as shown in Table 3 were screened for the ability to inhibit HIF hydroxylase activity as described above.
[0672] Of the compounds screened in this assay, reduced pVHL binding indicative of inhibition of HIF hydroxylation was observed for Is1, Is3, Is8, benzohydroxamic acid, ethyl dihydroxybenzoate, and NK45.
[0673] The present application relates to the characterization of a HIF-1/VHL prolyl hydroxylase system and the identification of a new functional group of 2-oxoglutarate dependent oxygenase that function as HIF prolyl hydroxylases (HIF-PHs). The critical role of these enzymes in the regulation of HIF is emphasised by analysis of vhl-1 and egl-9 mutant worms, which show essentially complete loss of regulation of HIF-1 by oxygen. The availability of recombinant HIF-PHs permits further investigation of the HIF/VHL system and an important challenge will be to determine the extent to which the complex demands of physiological oxygen homeostasis are met by the biochemical properties of these enzymes.
[0674] Identification of the HIF system in nematode worms that obtain oxygen directly by diffusion reveals that this system of gene regulation must have evolved before the development of complex systemic oxygen delivery systems, presumably to regulate; responses to oxygen availability at the cellular level.
[0675] In mammals, the HIF system regulates not only cellular responses to oxygen, but also a range of systemic functions such as the control of oxygen delivery through effects on angiogenesis, vasomotor control, and erythropoiesis. These complex requirements have argued against the concept of a single oxygen sensor. However, the existence in mammalian cells of (at least) three isoforms of HIF.PH, and (at least) two isoforms of HIF-, each with more than one site of prolyl hydroxylation (Masson et al., 2001 supra), may provide the potential for different physiological responses to oxygen availability to be generated through combinatorial interactions amongst these molecules.
[0676] The characterisation of the HIF PH enzymes described herein has various therapeutic applications, in particular as targets in the development of pharmacological agents which modulate HIF- levels in a cell.
Example 5
[0677] In this Example it is shown that HIF-1 protein and the endogenous HIF target gene encoding carbonic anhydrase 9 (CA-9) are induced by exposure of cells to the PHD inhibitor, dimethyl oxalylglycine. In previous studies we have demonstrated that N-oxalylglycine is an inhibitor of PHD activity in vitro, but seems to be incapable of entering intact cells. The esterified form, dimethyloxalylglycine, has therefore been used to deliver the compound to tissue culture cells.
[0678] Hep3B and U2OS cells were exposed to either 0.1 mM or 1 mM dimethyloxalylglycine for 6 hours, harvested and assayed by immunoblotting (Western blotting) for changes in the level of HIF-1 and CA-9 expression. Controls, where no inhibitor was added, were also performed. Clear upregulation of both HIF-1 and the HIF target gene product CA-9 are observed in the presence of dimethyloxalylglycine. Upregulation of HIF-1 increased with increasing concentration of dimethyloxalylglycine, whilst the level of CA-9 expression was similar after exposure to both 0.1 and 1 mM of dimethyloxalylglycine.
Example 6
[0679] In this example it is shown that enhanced new vessel growth can be stimulated in a murine subcutaneous sponge angiogenesis assay by injection of the HIF prolyl hydroxylase inhibitor, dimethyl oxalylglycine.
[0680] In previous studies we have demonstrated that N-oxalylglycine is an inhibitor of PHD activity in vitro but seems to be incapable of entering intact cells. Application of an esterified form, dimethyloxalylglycine, to tissue culture cells results in stabilisation of HIF alpha chains (Example 1) and activation of transcription of endogenous HIF target genes (Example 5).
[0681] Implantation of a polyurethane sponge subcutaneously in a mouse provides an inflammatory stimulus to angiogenesis and is a well established model for assessing the pro- and anti-angiogenic effects of compounds. To test the effects of dimethyl oxalylglycine in vivo, sterile 8 mm sponge discs were inserted under the dorsal skin of C57 Black mice on Day 0. Test solutions were injected through the skin into the sponges of mice once per day on days 1, 2, 4 and 5. Individual mice received 100 microlitres aliquots of either sterile dimethyloxalylglycine (0.1 mM, 1 mM or 10 mM) or carrier solution. Animals were sacrificed on day 7 and the sponges removed. The sponges were fixed in 3.7% formaldehyde, paraffin embedded and stained immunohistochemically for von Willebrand factor to identify blood vessels.
[0682] Considerably more blood vessels were observed in sponges injected with dimethyloxalylglycine (1 mM) than those receiving solvent alone.
Example 7: The Effect of PK-Tagged PHD1 Expression on HIF-1- Induction by Hypoxia
[0683] In this Example it is shown that a recombinant PHD (PHD 1) may be overexpressed in a tissue culture cell line in such a manner as to affect the metabolism of a HIF polypeptide.
[0684] U2OS cells were stably transfected with a binary system encoding a tetracycline operator fused to an activator, and a plasmid encoding C-terminal PK epitope tagged PHD1 under control of a tetracycline response element. The transfected cells were incubated with 21%, 3% or 0% oxygen in either the presence or absence of doxycycline for 16 hours. Immunoblots were then performed on cell lysates to quantify levels of HIF-1 and also to check for expression of PHD via the PK tag.
[0685] Exposure of cells to doxycycline for 16 hours induced expression of PK tagged PHD1. The induced expression of PHD1 substantially reduced expression of HIF-1 in modest hypoxia (3% oxygen) and also reduced expression to a lesser extent under total hypoxia (0% oxygen). Thus in this Example, the expression of endogenous HIF-1 is shown to be strikingly dependent on the activity of the specifically induced PHD1 isoform under the conditions of assay.
Example 8
(S)-2-(Methoxyoalyl-amino)-pentanedioic acid diethylester (IS12) or: Diethyl N-methoxyoxalyl-(L)-glutamate (IS12)
[0686] ##STR00016##
[0687] To a stirred solution of 10 mmol (2.40 g) of diethyl (L)-glutamate hydrochloride in 10 ml of toluene, 10 mmol (1.23 g, 0.93 ml) of methyl oxalyl chloride was added and heated until no further HCl gas evolved (4-6 hr). The solvent was evaporated yielding 2.86 g (9.9 mmol, 99%) of IS12 as a yellowish oil, [].sub.D.sup.2528.3 (c 1 in methanol); v.sub.max (NaCl)/cm.sup.1 1738, 1705 (CO); .sub.H(200 MHz; CDCl.sub.3) 1.22, 1.26 (6H, 2 t, .sup.3J.sub.HH 7.3, OCH.sub.2CH.sub.3), 1.95-2.47 (3H, m, CHCH.sub.2CH.sub.2), 3.88 (3H, s, OCH.sub.3), 4.10, 4.20 (4H, 2 quart, .sup.3J.sub.JH 7.3, OCH.sub.2CH.sub.3), 4.60 (1H, ddd, .sup.3J.sub.HH 8.1, .sup.3J.sub.HH 8.1, .sup.3J.sub.HH 4.8, CH), 7.76 (1H, d, .sup.3J.sub.HH 8.1, NH); .sub.C(50 MHz; CDCl.sub.3) 14.1 (OCH.sub.2CH.sub.3), 27.0, 30.1 (CH.sub.2CH.sub.2), 52.1, 53.6 (CH, OCH.sub.3), 60.8, 62.0 (OCH.sub.2CH.sub.3), 156.1, 160.4, 170.5, 172.4 (CO); m/z (AP+) 290 (MH.sup.+, 68%).
Example 9
(S)-2-(Oxaly-amino)pentanedioic acid (IS13) or: N-Oxalyl-(L)-glutamate (IS13)
[0688] ##STR00017##
3 mmol (0.87 g) of
IS12 was heated with 5.0 ml of 2 N aqueous sodium hydroxide solution ensuring 1.1 equivalents of sodium hydroxide for the sum of the ester functions to be cleaved in the compound. The reaction was percolated through a column of Amberlite IR 120H ion exchange resin (previously washed with water to about pH 4) and cluated with water until pH raised to 4 again. The water evaporated in vacuo and the residue dried in vacuum. This yielded 0.65 g (2.9 mmol, 97%) of IS13 as a yellowish hygroscopic solid, mp ca. 60 C.; [].sub.D.sup.252.2 (c 1 in methanol); v.sub.max (NaCl, MeOH)/cm.sup.1 1697 (CO); .sub.H(200 MHz; D.sub.2O) 1.77-2.35 (3H, m, CHCH.sub.2CH.sub.2), 4.30 (1H, dd, .sup.3J.sub.HH 9.1, .sup.3J.sub.HH 5.0, CH); .sub.C(50 MHz; D.sub.2O) 25.8, 30.3 (CH.sub.2CH.sub.2), 52.6, (CH), 161.4, 162.9, 174.5, 177.3 (CO); m/z (AP) 218 (M-H.sup.+, 5%), 168 (M-H.sup.+oxalyl, 85%).
Example 10
(S)-2-(Methoxyoxalyl-amino)-propionic acid (IS68) or: Methyloxalyl-L-alanine (IS68)
[0689] ##STR00018##
[0690] This compound was prepared as in Example 8 using 10 mmol (0.89 g) of (L)-alanine and 10 mmol (1.23 g, 0.93 ml) of methyl oxalyl chloride yielding 1.96 g crude yellow oil. The crude product was chromatographed over silica gel (ethyl acetate eluent) resulting in 1.42 g of IS68 as a yellowish oil, which still contained traces of impurities. A pure sample was obtained from recrysallization from a mixture of ethyl acetate and diethyl ether (0.39 g, 2.2 mmol, 22%), mp 129-130 C.; 1.1 (c 1 in MeOH); v.sub.max (NaCl, MeOH)/cm.sup.1 1744, 1693 (CO); .sub.H(200 MHz; DMSO-d.sub.6) 1.35 (3H, d, .sup.3J.sub.HH 7.3, CHCH.sub.3), 3.43 (1H, br, COOH), 3.81 (3H, s, OCH.sub.3), 4.28 (1H, pseudo-quint, .sup.3J.sub.HH 7.4, CH), 9.16 (1H, d, .sup.3J.sub.HH 7.5, NH); .sub.C(50 MHz; DMSO-d) 17.3 (CHCH.sub.3), 48.8 (CH), 53.7 (OCH.sub.3), 157.6, 161.8, 173.8 (CO).
Example 11
(R)-2-(Methoxyoxalyl-amino)-propionic acid (IS69) or: Methyloxalyl-D-alanine (IS69)
[0691] ##STR00019##
[0692] This compound was prepared as for IS68 but with (L)-alanine substituted by (D)-alanine yielding 0.36 g (2.1 mmol, 21%) of IS69 as a colourless solid, mp 131-132 C.; [].sub.D.sup.25+1.9 (c 1 in MeOH). Analytical data except optical rotation corresponded to those of IS68.
Example 12
(S)-2-(3-Mercapto-propionylamino)-propionic acid (S37) or: N-(3-Mercaptopropanoyl)-(L)-alanine (IS37)
[0693] ##STR00020##
[0694] Prepare according to literature procedure: M. A. Ondetti, D. W. Cushman, U.S. Pat. No. 4,053,651, 1977, E. R. Squibb & Sons (Chem. Abstr., Volume 88, 136977). No analytical details but melting point were given in the literature work. A solution of 4 mmol (1.13 g) of IS20 in 2 ml of water was treated with 1.6 ml of conc. aqueous ammonia solution for one hour at room temperature, while a colourless precipitate formed. The mixture was diluted with water and the solids filtered off. The filtrate was washed with ethyl acetate, the aqueous phase was acidified with conc. hydrochloric acid and extracted with ethyl acetate. The combined organics were washed with water, dried over magnesium sulfate and evaporated in vacuo resulting in 0.49 g of crude IS37. Recrystallization from a mixture of ethyl acetate and n-hexane yielded 0.32 g (1.8 mmol, 45%) of IS37 as a colourless solid, mp 78-79 C.; [].sub.D.sup.2539.4 (c 1 in methanol); v.sub.max (NaCl, MeOH)/cm.sup.1 1728, 1638 (CO); .sub.H(200 MHz; DMSO-d.sub.6) 1.28 (3H, d, .sup.3J.sub.HH 7.3, CH.sub.3), 2.31 (1H, t, .sup.3J.sub.HH 7.9, SH), 2.40-2.48, 2.60-2.73 (4H, 2 m, CH.sub.2CH.sub.2), 4.22 (1H, quint, .sup.3J.sub.HH 7.3, CH), 8.26 (1H, d, .sup.3J.sub.HH 7.3, NH), 12.56 (1H, br s, COOH); .sub.C(50 MHz; DMSO-d.sub.6) 18.0 (CH.sub.3), 20.8 (CH.sub.2CH.sub.2, second signal covered by DMSO, recording in CDCl.sub.3 revealed it at 40.0), 48.3, (CH), 171.0, 175.1 (CO); m/z (AP) 176 (M-H.sup.+, 100%).
Example 13
(R)-2-(3-Mercapto-propionylamino-propionic acid (IS38) or: N-(3-Mercaptopropanoyl)-(D)-alanine (S38)
[0695] ##STR00021##
[0696] The title compound was prepared as for IS37 but with IS20 substituted by IS21 yielding 0.18 g (1.0 mmol, 25%) of IS38 as a colourless solid, mp 64 C.; [].sub.D.sup.25+39.5 (c 1 in methanol). Analytical data except optical rotation correspond to those of IS37.
Example 14
(S)-2-(3-Benzoylsulfanyl-propionylamino)-propionic acid (IS20) or: N-(3-Benzoythiopropanoyl)-(L)-alanine (IS20)
[0697] ##STR00022##
[0698] Prepared according to literature procedure: M. A. Ondetti, D. W. Cushman, U.S. Pat. No. 4,053,651, 1977, E. R. Squibb & Sons (Chem. Abstr., Volume 88, 136977). No analytical details but melting point were given in the literature work.
[0699] In 16.7 ml of 1 N aqueous sodium hydroxide solution, 16.7 mmol (1.48 g) of (L)-alanine were dissolved. After adding another 9 ml of 2 N sodium hydroxide solution at ice temperature, 16.7 mmol (2.85 g) of 3-bromopropionic acid were added and the reaction was stirred for 3.5 h at room temperature. A mixture of 18.1 mmol (2.50 g) of thiobenzoic acid and 11.6 mmol (1.6 g) of potassium carbonate in 16.7 ml of water and 5 ml of THF was than added to the reaction, which was then stirred overnight. The resultant mixture was acidified with conc. hydrochloric acid, stirred for 30 min. and extracted with ethyl acetate. The combined organics were dried and the solvents evaporated in vacuo. The remaining thick (5.15 g) yellow oil was crystallized from ether yielding 1.83 g (6.5 mmol, 39%) of IS20 as a colourless powder, mp 98-99 C.; [].sub.D.sup.2519.1 (c 1 in methanol); v.sub.max (NaCl, MeOH)/cm.sup.1 1730, 1660 (CO); .sub.H(200 MHz; CDCl.sub.3) 1.44 (3H, d, .sup.3J.sub.HH 7.1, CH.sub.3), 2.66, 3.32 (4H, 2 d, .sup.3J.sub.HH 7.1, CH.sub.2CH.sub.2), 4.61 (1H, quint, .sup.3J.sub.HH 7.1, CH), 6.77 (1H, d, .sup.3J.sub.HH 7.1, NH), 7.37-7.61, 7.89-7.96 (5H, 2 m, ar), 10.08 (1H, br s, COOH); .sub.C(50 MHz; CDCl.sub.3) 18.0 (CH.sub.3), 24.6, 36.1 (CH.sub.2CH.sub.2), 48.3, (CH), 127.2, 128.7, 133.6, 136.7 (ar), 171.5, 176.0, 192.4 (CO); m/z (AP) 280 (M-H.sup.+, 10%).
Example 15
(R)-2-(3-Benzoylsulfanylpropionylamino)propionic acid (1S21) or: N-(3-Benzoylthloprpanoyl)-(D)-alanine (IS21)
[0700] ##STR00023##
[0701] This compound was prepared as for IS20 but with (L)-alanine substituting for (D)-alanine yielding 1.78 g (6.3 mmol, 38%) of IS20 as a colourless powder, mp 98-99 C.; [].sub.D.sup.25+19.1 (c 1 in methanol). Analytical data except optical rotation corresponded to those of IS20.
Example 16Peptide Blockade of HIF- Degradation Modulates Cellular Metabolism and Angiogenesis
16.1 Introduction
[0702] Ischaemia is a major cause of morbidity and mortality and effective molecular therapies are being intensively sought.sup.1 2. The transcription factor hypoxia-inducible factor-1 (HIF) is a master regulator of the hypoxic response, controlling genes involved in diverse processes that balance metabolic supply and demand within tissues.sup.3 4 5. Modulation of HIF activity therefore provides an attractive approach for the treatment of ischaemic disease. Furthermore, HIF driven angiogenesis produces more mature and less leaky vessels than those generated by individual growth factors.sup.6 7 8.
[0703] Regulation of HIF is mediated at multiple levels via its a chain.sup.9 10 11 12 13. It has been reported that PR39, a macrophage derived peptide, results in HIF accumulation and angiogenesis.sup.14. Analysis of the HIF oxygen-dependent degradation domains (ODD) by transient transfection studies.sup.11 12 13 15 16 17 18 suggested a possible specific, alternative approach to HIF stabilisation. We have used peptides containing the sites of regulated prolyl hydroxylation identified as necessary in the previous Examples for proteasomal destruction in the presence of oxygen mediated by the von Hippel-Lindau E3 (VHL E3) ubiquitin ligase complex.sup.19 20 21 22. Despite the multiple steps involved in HIF activation we demonstrate unequivocally that peptides from two regions of the ODD not only stabilise HIF but produce a transcriptional response that modulates normoxic angiogenesis and metabolism In vivo, suggesting that the peptides affect mechanisms that are common to all activation steps. These results indicate that these polypeptides, or molecules based on them, provide a possible therapeutic approach for ischaemic tissues.
16.2 Overexpression of CODD and NODD Polypeptides can Induce HRE-Dependent Reporter Gene Expression
[0704] Since normoxic HIF degradation is saturable.sup.17 and depends on sub-regions within the ODD we tested whether peptides encoding the HIF-1 amino terminal ODD (NODD) and carboxy terminal ODD (CODD).sup.21 could affect HIF activity as measured by hypoxia response element (HRE)-dependent reporter gene expression. The proposed model by which the NODD and CODD peptides inhibit HIF activity is shown in
[0705] We tested shorter fragments of NODD and CODD peptides, defining amino acids 390-417 and amino acids 556-74 as minimal domains capable of HRE-dependent luciferase activation. (results shown in
[0706] HIF chain degradation depends on recognition by the VHL E3 ubiquitin ligase following oxygen-dependent enzymatic hydroxylation of prolyl residues at positions 402 and 564.sup.19 20 21. Using mutated expression plasmids (P402A or P564G) we demonstrated complete ablation of HRE-dependent induction of luciferase activity (results shown in
16.3 Stable NODD and CODD Polypeptide Expression Results in Endogenous HIF-1 Accumulation
[0707] To explore further the therapeutic potential of NODD and CODD polypeptides to activate endogenous HIF we stably transfected U2OS cells with doxycycline-inducible NODD (doxNODD) and CODD constructs (doxCODD) encoding identical sequences to those used for transient transfections.
[0708] Cells stably transfected with NODD or CODD controlled by the tetracycline-inducible system were exposed to doxycycline. Cell extracts were prepared 0, 16, 24 and 48 hours after exposure to doxycycline. The extracts of doxNODD (HIF-1 aa343-417), doxCODD (HIF-1 aa549-82) and control cells (empty vector) were then immunoblotted for HIF-1 protein. Increased HIF-1 signals were detected from 16-48 hours following doxycycline administration in doxNODD and doxCODD cells but not in empty vector cells. Levels of HIF-1 induced by hypoxia were also measured for comparison. The endogenous HIF-1 induction was doxycycline dose (0.2-3.2 g/ml) and time dependent, peaking after 48 hours. Maximal levels were about 20% and about 70% of HIF-1 levels seen following hypoxic or DFO treatment of the doxNODD and doxCODD cells respectively. Doxycycline did not induce HIF-1 protein in cells transfected with empty vector despite its weak ability to chelate iron.
[0709] Immunofluorescence microscopy allowed visualisation of both the c-myc tag of the expressed fusion proteins and endogenous HIF-1. In doxycycline activated doxCODD cells both were located in nuclei. HIF-1 expression varied considerably from cell to cell. In cells which had not been exposed to doxycycline strong staining was only seen from the endogenous HIF-1-.
[0710] Combined treatment of doxCODD cells with doxycycline and optimal DFO (75 m) or hypoxic stimuli (1% O.sub.2) did not lead to further increases in HIF-1 signals on immunoblots confirming that the peptides had no additional action when endogenous HIF chains were fully induced by physiological stimuli.
[0711] To test directly whether the polypeptides prevented cellular HIF-1 targeting by the VHL-ubiquitin-proteasome system we showed that ubiquitination of exogenous .sup.35S-methionine labelled HIF-1 was markedly reduced in the presence of doxCODD extracts compared with control cell extracts lacking the peptide transfected with empty vector.
[0712] HIF and HIF-dependent target gene expression has been suggested to be subject to a number of negative feedback controls. To investigate the consequences of continuous activation of the system we exposed doxCODD cells to doxycycline for two, four, six or eight days. HIF-1 protein levels were significantly elevated on days 2 and 4 but decreased thereafter. Switching off the system by removing doxycycline from the medium for 48 hours prior to re-exposure resulted in re-induction of elevated HIF-1 protein levels, indicating that the suppressive effects were reversible. This phenomenon will need to be considered in using the HIF system to modulate complex physiological downstream effects for example through the administration of modulators of the invention at spaced intervals or alternatively by inducing the constructs of the invention at spaced intervals.
16.4 NODD and CODD Fusion Proteins Induce Target Gene mRNA and Protein Levels
[0713] Results thus far presented indicate that under normoxic conditions NODD and CODD polypeptide expression results in stabilisation of endogenous HIF-1 chains and consequent activation of transiently transfected artificial HRE-dependent promoters. Expression of natural HIF target genes in chromosomal DNA may be constrained by other factors. We therefore investigated peptide modulation of endogenous genes known to be HIF targets.
[0714] Carbonic anhydrase IX (CAIX) is transcriptionally up-regulated under hypoxic conditions.sup.24.We used a ribonuclease protection assay to measure CAIX mRNA at intervals following doxycycline treatment in doxCODD and empty vector transfected cells. Levels of mRNA were measured at 0, 24 and 48 hours following treatment. SnRNA (small nuclear RNA) was also probed to ensure equivalent loading. Doxycycline markedly induced mRNA levels in doxCODD cells after 24 and 48 hours to levels similar to those obtained by hypoxic incubation. Cells transfected with empty vector showed no induction of CAIX. Immunoblots demonstrated an associated increase of CAIX protein, paralleling detection of the CODD peptide, visualised by immunoblotting using the c-myc tag. To test the generality of this effect we performed comparable experiments on glucose transporter-1 (Glut-1) mRNA expression, obtaining similar results. When doxycycline was repeatedly added to cell culture medium Glut-1 mRNA, detected by ribonuclease protection, measured after 0, 2, 4, 6 and 8 days Glut-1 mRNA levels increased for the first 4 days and then declined in parallel with the HIF-1 protein levels as observed above. Maximal Glut-1 mRNA levels were comparable to those induced following exposure to 75 M desferrioxamine.
[0715] To test for the physiological relevance of increased Glut-1 expression we conducted glucose uptake experiments. .sup.3H-glucose uptake was measured. An enhanced uptake of .sup.3H-glucose was measured in doxCODD cells compared with empty vector transfected cells after 24 hours induction with doxycycline. In contrast, basal levels in cells untreated with doxycycline and hypoxically induced levels (hypoxia) of H-glucose uptake were comparable between cell lines. (*: P<0.01; Error bars represent the SEM of 3 replicates.)
[0716] Thus, in contrast to control cells, expression of the CODD polypeptides mimicked the effect of hypoxia by inducing glucose uptake in stably transfected cells.
16.5 Tat-NODD and Rat-CODD Fusion Proteins Enter Cultured Cells and Induce HIF-1 Under Normoxic Conditions
[0717] Experiments presented above show that oxygen-dependent gene expression can be modulated in normoxia by plasmid based expression of NODD and CODD polypeptides. To extend this approach we chose to study the effects of transducing comparable peptides into cells. The transduction domain of HIV tat-protein delivers fused proteins across cell membranes in a transporter independent mechanism.sup.25 26. We fused the NODD and CODD peptides to the tat-sequence in combination with HA and HIS tags to facilitate detection and nickel affinity purification. We did not include exogenous nuclear localisation sequences because the tat sequence itself is sufficient for nuclear entry.sup.27.
[0718] We performed VHL E3 interaction assays.sup.21 with tat-NODD and tat-CODD, demonstrating their ability to undergo the necessary modifications for interaction with VHL. .sup.35S-Methionine labelled IVTT products of tat-ODD expression vectors were tested for their ability to bind to VHL E3 ligase. Concordant with the ubiquitination assays discussed above NODD (HIF-1 343-417) and CODD (HIF-1 549-582) polypeptides, but not their corresponding proline mutants (HIF-1 343-417/P402A and HIF-1 549-582/P564G), bound to VHL E3 ubiquitin ligase after modification by cell extracts. The .sup.35S-methionine labelled recombinant polypeptides therefore interacted with VHL, supporting the results of the ubiquitination experiments discussed above. The interaction was enhanced by the presence of cell extracts which promote hydroxylation of the prolines at positions 402 and 564.sup.19. In contrast, no binding occurred using peptides in which prolines were mutated.
[0719] We next tested, by immunoblotting, if these tat-fusion proteins could traverse cell membranes and induce HIF-1. Two hours following addition of tat-NODD or tat-CODD fusion proteins to cell cultures intact peptide was detectable in whole cell protein extracts by immunoblotting for the HA tag. The HA tag of tat-NODD (tat-343-417) and tat-CODD (tat-549-582) polypeptides were detected in cell extracts, following repetitive polypeptide administration indicating their uptake by the cells. HIF-1 protein was induced by the tat-NODD and the tat-CODD polypeptides (0.5 M), but not by the corresponding proline mutants. Maximal levels were comparable to those induced following exposure to 75 M desferrioxamine (DFO). In experiments with repetitive polypeptide administration, endogenous HIF-1 was detectable in normoxia 20 hours after initial exposure of the cells to fusion proteins. In controls, using the corresponding mutant peptides lacking the prolines, we detected no HIF-1 signals. It has been reported that denaturation enhances uptake of tat-fused proteins.sup.25. Denatured tat-NODD and tat-CODD peptides were still able to enter cells, but were inactive in mediating HIF-1 upregulation, perhaps because they were no longer capable of being hydroxylated.
16.6 Endothelial Activation and In Vivo Angiogenesis Assays
[0720] Artificial activation of the HIF signalling pathway using the methods of the invention should induce angiogenesis and will therefore be of potential therapeutic use in ischaemic disease. We tested the effect of polypeptide induced HIF stabilisation in an in vitro angiogenesis assay, co-culturing human microvascular endothelial cells (HMEC-1) with empty vector transfected or doxCODD cells. In view of the possibility of sustained activation inducing a negative feedback loop we opted to test the effects of intermittent induction. In doxCODD, but not in empty vector transfected cells, intermittent exposure to doxycycline over a period of 5 days led to assembly of co-cultured endothelial cells into complex tubular structures visualised by immunostaining for von Willebrand factor but not in control cells. As a positive control epidermal Growth Factor (EGF; 5 ng/ml), which is known to induce growth of HMEC-1, was used. T o extend these observations into an in vivo model we assayed the effects of injecting tat-fusion proteins into polyurethane sponges implanted subcutaneously in mice. Intermittent injections on days 1,2, 4 and 5 led to a markedly accelerated angiogenic response assayed on day 7 when compared with sponges injected with proline mutant fusion proteins, excluding a contribution from the tat component 28. Immunohistochemistry for von Willebrand factor revealed increased vessel density in sponges explanted after 7 days following treatment with tat-CODD, but not with mutant peptide (tat-CODD/P564G). Staining for VEGF and Glut-1 was enhanced in tat-NODD or tat-CODD treated animals compared to controls. Cells surrounding the sponge showed particularly intense staining. The vessel endothelium within sponges was surrounded by cells expressing smooth muscle actin.
16.7 Summary
[0721] Hypoxia-inducible factor-1 (HIF) is a transcription factor known to regulate pro-angiogenic genes and modulate metabolism in response to hypoxic stress. Modulation of HIF activity therefore provides an attractive theoretical route to ameliorating ischaemic disease. Under normoxic conditions HIF chains are ubiquitylated and destroyed by the proteasome following enzymatic hydroxylation of critical prolyl residues. Here we demonstrate use of polypeptides bearing these prolyl residues to stabilise endogenous HIF, thereby up-regulating HIF target genes. Peptide expression in cell cultures affects physiologically important functions such as glucose transport and leads to tubule formation by co-cultured endothelial cells. Subcutaneous injection of polypeptides results in a markedly accelerated local angiogenic response and induction of glucose transporter-1 gene expression. These results demonstrate the feasibility of utilising these polypeptides to enhance normoxic HIF activity, opening new therapeutic avenues for ischaemic diseases.
[0722] In this Example we have described the use of polypeptides which stabilise the hypoxia-regulated transcription factor HIF-1. We provide evidence that complex physiological systems like glucose uptake and angiogenesis can be induced strongly, even under normoxic conditions.
[0723] Related molecular approaches to treating ischaemic disease include use of single growth factors.sup.2 or gene therapy with HIF based sequences lacking the degradation domains.sup.6 29. The approach used here has advantages over the former in that it co-opts the entire physiological response resulting in metabolic adaptation as well as angiogenesis and provides an alternative to gene therapy that should be easier to apply.
[0724] Influences of HIF on cancer growth and apoptosis.sup.30 31 lead to concerns that long-term HIF activation might have deleterious effects, including pro-neoplastic actions. However, these processes probably require additional events beyond HIF activation and are likely to have a much longer time course than that required for therapeutic angiogenesis. Furthermore, the peptides used here are inherently unstable and act locally, allowing circumscribed dosing schedules that avoid continued and general exposure.
[0725] The NODD and CODD polypeptides were effective alone and in combination. Mechanisms of polypeptide action within cells include competition for HIF prolyl hydroxylase activity or VHL binding capacity. Three lines of evidence suggest the latter is more probable. Firstly, we have demonstrated that these NODD and CODD fusion proteins bind to VHL, presumably following their own hydroxylation. Secondly, the action of either peptide is sufficient to stabilise HIF even though it contains both prolyl residues, which can be targeted by different hydroxylase isoforms.sup.22. Thirdly, concentrations of synthetic peptide necessary to quench HIF prolyl hydroxylase activity in cell extracts are unlikely to be produced in cells.
[0726] Comparison of the NODD and CODD sequences coupled with structural studies clarifying the nature of their interactions with VHL and different prolyl hydroxylase isoforms will allow further refinements to these agents. Use of other protein transduction domains and/or tissue specific targeting sequences, including tripeptides such as GFE for lung or RDV for retina, will lead to new formulations with lower risks of side effects.sup.32 33.
[0727] The polypeptides reported here are exciting reagents, allowing controlled activation of the HIF pathway in normoxia. Animal models of ischaemia may be used to demonstrate the net therapeutic benefits of the peptides followed by clinical trials.
16.8 Methods
Plasmids, Transient and Stable Transfections
[0728] Plasmid Constructs:
[0729] For reporter gene assays DNA fragments encoding HIF-1 amino acids 343-417, 380-417, 390-417, 390-410, 343-400, 530-95, 530-82, 549-82, 556-74 and 530-62 were generated by PCR using oligonucleotides containing 5 SacII or 3 AscI sites and inserted into a pCMV/myc/nuc (Invitrogen) derivative bearing these sites in frame with the NLS and epitope tag. Site directed mutagenesis (QuikChange, Stratagene) was used to mutate the constructs containing HIF-1 aa343-417 or aa549-82 at aa402 [cca to gca] or aa564 [cca to ggc] converting prolines to alanine or glycine respectively. To generate tet-operator dependent plasmids the open reading frames from the aa343-417 and aa549-82 constructs were subcloned into pUHD 10.sup.34. Fragments coding for HIF-1 aa343-417 and aa530-82 (with and without P402A and P564G mutants) were subcloned into ptat-HA.sup.25. All constructs were confirmed by DNA sequencing.
[0730] Reporter Gene Assays:
[0731] Cells were co-transfected with an HRE containing reporter gene, pCMV/myc/nuc constructs and a constitutively expressed beta-galactosidase gene using Fugene6 (RocheMolecular).sup.35. Transfectants were maintained in normoxia for 24 hours or in hypoxia for the final 16 hours. Luciferase activities in cell extracts were determined using a commercial kit (Promega) and a TD-20e luminometer (Turner Designs). Beta-galactosidase activity was measured spectrophotometrically using o-nitrophenyl-beta-D-galactopyranoside as substrate.
[0732] Stably transfected cell lines were generated by transfecting U2OS cells bearing the reverse tetracycline responsive transactivator.sup.34 and the tetKRAB silencer construct.sup.36 with pUHD/HIF plasmids. Following selection in G418 (1 mg/ml) individual colonies were picked. DoxNODD (F21) and doxCODD (myc19) clones expressed pUHD/HIF-1 aa343-417/3NLS/c-myc and pUHD/HIF-1 aa549-82/3NLS/c-myc respectively.
mRNA and Protein Detection
[0733] RNA Analysis:
[0734] Total RNA extracted using RNAzol B (Biotec Laboratories) was analysed by ribonuclease protection using .sup.32P-GTP labelled Glut-1, CAIX and snRNA (as internal control) riboprobes using templates previously described.sup.10 24. Immunoblotting: Cell extracts were prepared in buffer (8M urea, 10% glycerol, 1% SDS, 5 mM DTT, 10 mM Tris/pH 6.8), separated by SDS-PAGE and transferred to Immobilon-P membrane (Millipore). Primary antibodies against HIF-1, c-myc tag and HA tag were from Transduction Laboratories, Innogenex and Roche Molecular respectively.
Ubiquitination and Interaction Assays
[0735] Empty vector and doxCODD cells grown to confluence were induced with doxycycline (0.8 g/ml) for 48 hours and ubiquitination assays performed using cytoplasmic extracts as described previously.sup.37.
[0736] For VHL E3 interaction assays .sup.35S-methionine labelled HIF-1 substrates were prepared by transcription/translation using TnT7 rabbit reticulocyte lysate (Promega). 100 M DFO was added to the reaction to suppress prolyl hydroxylase activity of the reticulocyte lysate. Substrate modification was achieved by incubation of HIF-1 translate with RCC4 cell lysate in the presence of ferrous chloride (100 M). Interaction with VHL E3 was analysed as described previously.sup.21.
Glucose Uptake
[0737] Empty vector and doxCODD cells were grown to confluence, exposed to 1%, 21% oxygen or 0.8 g/ml doxycycline for 16h, washed with glucose-free DMEM and incubated for 10 min with 1 Ci/ml 2-deoxy-D.sup.3H-glucose (Amersham, UK), before lysis in 0.5% NP-40, 0.25 M NaCl, 10 mM HEPES/pH 7.6. Glucose uptake was determined by liquid scintillation counting.sup.35.
Tat-Protein Synthesis and Purification
[0738] HIF-1-tat-fusion proteins were purified by sonication of transformed BL21pLysS (Novagen) in lysis buffer (0.5% Tween-20, 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 5 mM imidazole) after 4 hours induction with 1 mM IPTG. Lysates were spun down at 10.sup.3 g before loading on a Ni-NTA column (Qiagen). Proteins were eluted with 100 mM imidazole and desalted on a PD10 column (Amersham).sup.25 in 10 mM Tris/pH 7.0 or in 10 mM Tris/pH 8.0, 30 mM KCl. Aliquots were snap frozen in liquid nitrogen. Tat-proteins (0.5 M final concentration) were given to cultures in DMEM/1%/FCS at the beginning and 8 hours after starting the experiments before harvesting the cells after 24 hours.
Angiogenesis Assays
[0739] Tubule Formation Assay:
[0740] doxCODD or empty vector cells were co-cultivated with human microvascular endothelial cells (HMEC-1) in a ratio of 2:1 in DMEM 10% doxycyline free FCS (Clontech), 2 mM Glutamine and 100.U/ml Penicillin/100 g/ml Streptomycin. Stimulation with doxycycline (0.8 g/ml) or epidermal growth factor (5 ng/ml) (Sigma) or control medium was renewed every second day. On day 5 cells were fixed with 70% ethanol, pre-blocked with 1% BSA/PBS. Endothelial cells were detected using antibodies to von Willebrand factor (vWF) (Dako).
[0741] Murine Sponge Model:
[0742] Sterile polyurethane sponges (8 mm diameter) were inserted subcutaneously under the dorsal skin of anaesthetised black C57 female mice on day 0. On the 1.sup.st, 2.sup.nd, 4.sup.th and 5.sup.th days 100 l of tat-fusion proteins (1 M) in Tris buffer (10 mM, pH 7.0) were injected into the sponges. On day 7 mice were sacrificed and sponges were excised with surrounding tissue and fixed in 3.5% paraformaldehyde.
[0743] Immunohistochemistry:
[0744] Paraffin embedded sponges were cut into 6 m sections, dewaxed with xylene, rehydrated and stained with vWF (Dako), Glut-1 (Alpha Labs), VEGF (Santa Cruz) and smooth muscle cell actin (DAKO) antibodies. Antigen retrieval, blocking of sections, secondary, HRP labelled antibodies and chromogenic reactions were performed according to the manufacturers' recommendations (DAKO Envision System and Vector Labs ABC Vectastain).
REFERENCES
[0745] 1. Marti, H. H. & Risau, W. Angiogenesis in ischemic disease. Thromb Haemost 82 Suppl 1, 44-52. (1999). [0746] 2. Ferrara, N. & Alitalo, K. Clinical applications of angiogenic growth factors and their inhibitors. Nat Med 5, 1359-64. (1999). [0747] 3. Semenza, G. L. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev 8, 588-94. (1998). [0748] 4. Ratcliffe, P. J., O'Rourke, J. F., Maxwell, P. H. & Pugh, C. W. Oxygen sensing, hypoxia-inducible factor-1 and the regulation of mammalian gene expression. J Exp Biol 201, 1153-62. (1998). [0749] 5. Semenza, G. L. Surviving ischemia: adaptive responses mediated by hypoxia-inducible factor 1. J Clin Invest 106, 809-12. (2000). [0750] 6. Elson, D. A. et al. Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1alpha. Genes Dev 15, 2520-32 (2001). [0751] 7. Yancopoulos, G. D. et al. Vascular-specific growth factors and blood vessel formation. Nature 407, 242-8. (2000). [0752] 8. Carmeliet, P. & Jain, R. K. Angiogenesis in cancer and other diseases. Nature 407, 249-57. (2000). [0753] 9. Kallio, P J. et al. Signal transduction in hypoxic cells: inducible nuclear translocation and recruitment of the CBP/p300 coactivator by the hypoxia-inducible factor-1alpha. Embo J 7, 6573-86. (1998). [0754] 10. Maxwell, P. H. et al. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271-5. (1999). [0755] 11. Salceda, S. & Caro, J. Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J Biol Chem 272, 22642-7. (1997). [0756] 12. Huang, L. E., Gu, J., Schau, M. & Bunn, H. F. Regulation of hypoxia-inducible factor 1alpha is mediated by an 02-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA 95, 7987-92. (1998). [0757] 13. Arany, Z. et al. An essential role forp300/CBP in the cellular response to hypoxia. PNAS 93, 12969-73. (1996). [0758] 14. Li, J. et al. PR39, a peptide regulator of angiogenesis. Nat Med 6, 49-55. (2000). [0759] 15. Srinivas, V., Zhang, L. P., Zhu, X. H. & Caro, J. Characterization of an oxygen/redox-dependent degradation domain of hypoxia-inducible factor alpha (HIF-alpha) proteins. Biochem Biophys Res Commun 260, 557-61. (1999). [0760] 16. Yu, F., White, S. B., Zhao, Q. & Lee, F. S. Dynamic, site-specific interaction of hypoxia-inducible factor-1 alpha with the von Hippel-Lindau tumor suppressor protein. Cancer Res 61, 4136-42 (2001). [0761] 17. O'Rourke, J. F., Tian, Y. M., Ratcliffe, P. J. & Pugh, C. W. Oxygen-regulated and transactivating domains in endothelial PAS protein 1: comparison with hypoxia-inducible factor-1alpha. J Biol Chem 274, 2060-71. (1999). [0762] 18. Pugh, C. W., O'Rourke, J. F., Nagao, M., Gleadle, J. M. & Ratcliffe, P. J. Activation of hypoxia-inducible factor-1; definition of regulatory domains within the alpha subunit. J Biol Chem 272, 11205-14. (1997). [0763] 19. Jaakkola, P. et al. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by 02-regulated prolyl hydroxylation. Science 292, 468-72. (2001). [0764] 20. Ivan, M. et al. HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: implications for 02 sensing. Science 292, 464-8. (2001). [0765] 21. Masson, N., Willam, C., Maxwell, P. H., Pugh, C. W. & Ratcliffe, PJ. Independent function of two destruction domains in hypoxia-inducible factor-alpha chains activated by prolyl hydroxylation. Embo J 20, 5197-206 (2001). [0766] 22. Epstein, A. C. et al. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell 107, 43-54 (2001). [0767] 23. Wood, S. M. et al. Selection and analysis of a mutant cell line defective in the hypoxia-inducible factor-1 alpha-subunit (HIF-1 alpha). Characterization of hif-1alpha-dependent and -independent hypoxia-inducible gene expression. J Biol Chem 273, 8360-8. (1998). [0768] 24. Wykoff, C. C. et al. Hypoxia-inducible expression of tumor-associated carbonic anhydrases. Cancer Res 60, 7075-83. (2000). [0769] 25. Nagahara, H. et al. Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat Med 4, 1449-52. (1998). [0770] 26. Schwarze, S. R. & Dowdy, S. F. In vivo protein transduction: intracellular delivery of biologically active proteins, compounds and DNA. Trends Pharmacol Sci 21, 45-8. (2000). [0771] 27. Truant, R. & Cullen, B. R. The arginine-rich domains present in human immunodeficiency virus type 1 Tat and Rev function as direct importin beta-dependent nuclear localization signals. Mol Cell Biol 19, 1210-7 (1999). [0772] 28. Albini, A. et al. The angiogenesis induced by HIV-1 tat protein is mediated by the Flk-1/KDR receptor on vascular endothelial cells. Nat Med 2, 1371-5 (1996). [0773] 29. Vincent, K. A. et al. Angiogenesis is induced in a rabbit model of hindlimb ischemia by naked DNA encoding an HIF-1alpha/VP16 hybrid transcription factor. Circulation 102, 2255-61. (2000). [0774] 30. Maxwell, P. H., Pugh, C. W. & Ratcliffe, P. J. Activation of the HIF pathway in cancer. Curr Opin Genet Dev 11, 293-9. (2001). [0775] 31. Carmeliet, P. et al. Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature 394, 485-90. (1998). [0776] 32. Ho, A., Schwarze, S. R., Mermelstein, S. J., Waksman, G. & Dowdy, S. F. Synthetic protein transduction domains: enhanced transduction potential in vitro and in vivo. Cancer Res 61, 474-7. (2001). [0777] 33. Rajotte, D. et al. Molecular heterogeneity of the vascular endothelium revealed by in vivo phage display. J Clin Invest 102, 430-7 (1998). [0778] 34. Gossen, M. et al. Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-9. (1995). [0779] 35. Vaux, E. C. et al. Selection of Mutant CHO Cells with Constitutive Activation of the HIF System and Inactivation of the von Hippel-Lindau Tumor Suppressor. J Biol Chem 276, 44323-30 (2001). [0780] 36. Deuschle, U., Meyer, W. K. & Thiesen, H. J. Tetracycline-reversible silencing of eukaryotic promoters. Mol Cell Biol 15, 1907-14. (1995). [0781] 37. Cockman, M. E. et al. Hypoxia inducible factor-alpha binding and ubiquitylation by the von Hippel-Lindau tumor suppressor protein. J Biol Chem 275, 25733-41. (2000).
Example 17
Effect of Iron Chelation on N-Oxalylglycine Inhibitory Activity and Direct Comparison of the Inhibitory Activity of a Pair of Enantiomers
[0782] To determine whether N-oxalylglycine inhibits HIF-1 modification via iron chelation we performed capture assays using a Gal/HIF-1/VP16 fusion protein expressing HIF-1 residues 549-582 in the presence of varying concentrations of inhibitor and iron.
[0783] The unlabelled HIF-1 substrate was immunopurified on beads, washed, and aliquots incubated in the presence of RCC4 cell extract with 0, 20, 50, 200, 500 or 2000 M N-oxalylglycine and either 5 or 100 M FeCl.sub.2. After washing, the beads were assayed for their ability to interact with 35-S labelled pVHL IVTT, which was then visualised by fluorography. The results obtained are shown in
[0784] The inhibitory effect of the pair of enantiomers, N-oxalyl-2S-alanine and N-oxalyl-2R-alanine, on HIF-1 modification was also studied. This was done using the same pVHL capture assay described above again using the Gal/549-582/VP16 fusion protein as a substrate. The effect of 0, 20, 50, 200, 500 and 2000 M concentrations of each enantiomer on pVHL capture was then assessed. The results obtained are shown in
Example 18
[0785] In vitro screening of potential inhibitors of HIF modification was performed using a capture assay. A Gal/HIF-1/VP16 fusion protein expressing HIF-1 residues 549-582 was prepared by IVTT and used as a substrate in the assay. The unlabelled substrate was immunopurified on beads, washed, and aliquots incubated in the presence of RCC4 cell extract, with 100 M FeCl.sub.2 and 2 mM of the potential inhibitor. The inhibitors were either dissolved in DMSO or Tris as indicated. Controls, where no inhibitor but the equivalent amount of DMSO or Tris was added, were also performed. After washing, the beads were assayed for their ability to interact with 35-S labelled pVHL IVTT. Hydroxylation of the fusion protein by HIF hydroxylase present in the cell extract leads to the ability to capture the labelled pVHL and the amount of labelled protein bound to the fusion protein can then be measured to determine relative HIF hydroxylase activity.
TABLE-US-00007 TABLE 1 Nucleotide Protein Name Species Accession Accession(s) Egl-9 C. elegans AF178536 GI5923812 GI5923811 CG1114 D. melanogaster AE003603 AAF52050 C1orf12 H. sapiens AF229245 NP071334 PHD2 AJ310543 gi14547145 Gi14547146 M. musculus AJ310546 PHD1 H. sapiens BC01723 NP071334 AJ310543 gi14547147 Gi14547148 FALKOR M. musculus AF340231 Gi13649965 gi13649964 FLJ21620 H. sapiens AK025273 BAB15101 Colo7838 PHD3 H. sapiens AJ310545 Gi14547150 gi14547149 M. musculus AJ310548 Gi14547243 gi14547242
TABLE-US-00008 TABLE 2 Disruption In-vivo Induction In-vitro of HIF- esterified of HIF in inhibitor VHL interaction equivalent tissue culture NK80 No NK81 Yes Methylmethoxalyl- No D/L-alanine NK82 No Methylmethoxalyl- No L/D-alanine NK87 Yes Methylmethoxalyl Yes glycine 2,4 pyridine Yes 2,4 diethylpyridine No dicarboxylic acid dicarboxylate 2,5 pyridine Not tested 2,5 diethylpyridine No dicarboxylic acid dicarboxylate 2,6 pyridine Not tested 2,6 diethylpyridine No dicarboxylic acid dicarboxylate
[0786] NK80 is
##STR00024##
di Na Salt (free acid is IS70) NK81 is oxalyl L-alanine-
##STR00025##
di Na Salt (free acid is IS70) NK81 is oxalyl D-alanine-
##STR00026##
di NaS alt (free acid is IS71) NK87 is oxalylglycine
##STR00027##
di Na Salt (IS2)
[0787]
TABLE-US-00009 TABLE 3
TABLE-US-00010 TABLE 4 Designation Accession No. Protected Fragment EGLN1/PHD2 BC 001723 1136-1481 EGLN2/PHD1 AF 229245 4050-4213 EGLN3/PHD3 AK 025273 817-1046 F22B5.4(C. elegans) 210-359 HIF-1(C. elegans) 1366-1496
TABLE-US-00011 TABLE 5 Gene Strain Allele daf-18 CB1375 e1375 daf-2 CB1370 e1370 age-1 TJ1052 hx546 mev-1 TK22 knl clk-1 CB4876 e2519 gas-1 CW152 fc21 ctl-1 TU2463 u800 mev-2 TK93 kn2 2mev-3 TK66 kn10 dpy-18 CB364 e364 phy-2 JK2757 ok177 egl-9 MT1201 n571 egl-9 MT1216 n586 egl-9 JT307 sa307 egl-9 JT330 sa330 vhl-1 CB5603 ok161