ANTINEMATODAL METHODS AND COMPOSITIONS
20170086465 ยท 2017-03-30
Inventors
Cpc classification
A61K35/57
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/02
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61K35/12
HUMAN NECESSITIES
International classification
A01N63/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
A61K35/12
HUMAN NECESSITIES
Abstract
There are provided methods and compositions useful in cell-cell fusion using Fusion Family (FF) proteins of nematode origin. There are further provided antinematodal methods and compositions, utilizing fusogenic proteins of the nematode Fusion Family.
Claims
1-43. (canceled)
44. A composition comprising a non-insect cell or viral particle expressing an exogenous nematode fusogenic protein.
45. The composition of claim 44, wherein the non-insect cell is selected from mammalian, avian, and plant cells.
46. The composition according to claim 44, wherein the fusogenic protein is capable of mediating fusion of the cell or viral particle to a second cell expressing a second nematode fusogenic protein.
47. The composition of claim 46, wherein the second cell is selected from a mammalian, an avian, and a plant cell exogenously expressing a second nematode fusogenic protein, or a nematode cell endogenously expressing a nematode fusogenic protein.
48. The composition of claim 46, wherein the second nematode fusogenic protein is the same or different from the fusogen of the non-insect cell.
49. A method for fusing a first cell and a second cell, the method comprising: incubating a first cell comprising a first exogenous nematode fusogenic protein with a second cell comprising a second exogenous nematode fusogenic protein; thereby fusing the first cell and the second cell to form a fused cell, wherein at least one of the cells is not of insect origin.
50. The method of claim 49, wherein the first cell and the second cell are of the same origin, or wherein the first cell and the second cell are of different origin.
51. The method of claim 49, wherein the cells are selected from: virus, plant, avian, animal, human, or combinations thereof.
52. The method of claim 49, wherein the first fusogenic protein and the second fusogenic protein are selected from AFF-1, EFF-1 or homologs thereof.
53. The method of claim 49, wherein expression of the first exogenous nematode fusogenic protein in the first cell and/or the second cell is transient or stable.
54. An antinematodal composition comprising: a cell comprising an exogenous nematode fusion protein, capable of mediating fusion of the cell to a cell of the nematode; wherein the composition induces killing or inhibition of growth of the nematode.
55. The antinematodal composition of claim 54, wherein the cell is selected from mammalian cell, avian cell, plant cell, and a virus.
56. The antinematodal compositing of claim 55, wherein the virus is selected from Retrovirus, Hepadnavirus, Poxyvirus, Rhabdoviridae, Paramyxoviruses, Herpes viruses and Coronavirus.
57. The antinematodal composition of claim 56, wherein said exogenous nematode fusogenic protein is selected from AFF-1, EFF-1 and homologs thereof.
58. The composition of claim 54, wherein said nematode is selected from: Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis japonica, Caenorhabditis ramanei, Caenorhabditis brenneri, Caenorhabditis sp5,7,9,11, Trichinella spiralis, Trichinella pseudospiralis, Trichinella papuae, Pristionchus entomophagus, Pristionchus maupasi, Pristionchus pacificus, Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla Globodera pallida, Ancylostoma caninum, Brugia Malayi, Haemonchus contortus, Ascaris suum, Oscheius tipulae, Dirofilaria immitis, Howardula aoronymphium, Litomosoides sigmodontis, Heterodera glycines, Romanomermis culicivorax, Trichuris muris, Strongyloids ratti, Onchocerca volvulus, Teladorsagia circumcincta, Wuchereria bancrofti, and Loa loa.
59. The composition of claim 54, wherein the exogenous nematode fusogenic protein is transiently expressed in the cell or stably expressed in the cell.
60. The composition of claim 54, wherein the cell further comprises an antinematodal agent, selected from a chemical substance, a protein, a nucleic acid, a toxin and combinations thereof.
61. The composition of claim 60, wherein said antinematodal agent is expressed by the cell.
62. A method for targeted killing of a nematode, the method comprising: contacting the nematode with a the composition of claim 54, wherein said cell is a virus comprising an exogenous nematode fusogenic protein, capable of mediating fusion of the virus to a cell of the nematode; whereby the fusion results in killing of the nematode.
63. A method for the targeted killing of a nematode, the method comprising: contacting the nematode with the composition of claim 60, whereby the fusion of the nematode and the cell induces killing of the nematode.
64. A method for the treatment of a nematode infection in a subject, the method comprising administering to the subject the composition of claim 54; wherein fusion of the cell and a nematode cell infecting the subject induces death or inhibition of growth of the nematode.
65. The method of claim 64, wherein the subject is human or animal.
66. The method of claim 64, wherein said administering is selected from oral administration, injection, suppository and topical application.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The accompanying drawings, which are incorporated in and form a part of the specification, illustrate certain embodiments of the present invention, and together with the description serve to explain the principles of the invention. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive. The figures are listed below.
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046] Anti AFF-1 polyclonal antibodies followed by immunogold labeling and negative stain of:
[0047] Cryo TEM:
[0048]
[0049] Scale bars are 100 nm and 10 nm for insets; Arrows: surface spike assemblies; Arrowheads: gold particles; White square: indicating area shown magnified in inset.
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0064] To facilitate an understanding of the present invention, a number of terms and phrases are defined below. It is to be understood that these terms and phrases are for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.
[0065] The term construct, as used herein, refers to an artificially assembled or isolated nucleic acid molecule which may include one or more nucleic acid sequences, wherein the nucleic acid sequences may include coding sequences (that is, sequence which encodes an end product), regulatory sequences, non-coding sequences, or any combination thereof. The term construct includes, for example, vector but should not be seen as being limited thereto.
[0066] Expression vector refers to constructs that have the ability to incorporate and express heterologous nucleic acid fragments (such as, for example, DNA), in a foreign cell. In other words, an expression vector comprises nucleic acid sequences/fragments (such as DNA, mRNA, tRNA, rRNA), capable of being transcribed. Many prokaryotic and eukaryotic expression vectors are known and/or commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art.
[0067] The term expression, as used herein, refers to the production of a desired end-product molecule in a target cell. The end-product molecule may include, for example an RNA molecule; a peptide or a protein; a virus; and the like; or combinations thereof.
[0068] As used herein, the terms introducing and transfection may interchangeably be used and refer to the transfer of molecules, such as, for example, nucleic acids, polynucleotide molecules, vectors, and the like into a target cell(s), and more specifically into the interior of a membrane-enclosed space of a target cell(s). The molecules can be introduced into the target cell(s) by any means known to those of skill in the art, for example as taught by Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001), the contents of which are incorporated by reference herein. Means of introducing molecules into a cell include, for example, but are not limited to: heat shock, calcium phosphate transfection, PEI transfection, electroporation, lipofection, transfection reagent(s), viral-mediated transfer, and the like, or combinations thereof. The transfection of the cell may be performed on any type of cell, of any origin, such as, for example, human cells, animal cells, plant cells, virus, nematode cell, stem cells, cancer cells, and the like. The cells may be selected from isolated cells, tissue cultured cells, cell lines, cells present within an organism body, and the like.
[0069] As referred to herein, the terms nucleic acid, nucleic acid molecules oligonucleotide, polynucleotide, and nucleotide may interchangeably be used herein. The terms are directed to polymers of deoxyribonucleotides (DNA), ribonucleotides (RNA), and modified forms thereof in the form of a separate fragment or as a component of a larger construct, linear or branched, single stranded, double stranded, triple stranded, or hybrids thereof. The term also encompasses RNA/DNA hybrids. The polynucleotides may include sense and antisense oligonucleotide or polynucleotide sequences of DNA or RNA. The DNA or RNA molecules may be, for example, but not limited to: complementary DNA (cDNA), genomic DNA, synthesized DNA, recombinant DNA, or a hybrid thereof or an RNA molecule such as, for example, mRNA, tRNA, shRNA, siRNA, miRNA, and the like. The terms further include oligonucleotides composed of naturally occurring bases, sugars, and covalent internucleoside linkages, as well as oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions.
[0070] The terms polypeptide, peptide and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
[0071] The term homology, homologous and homologs as used herein are directed to sequence similarity between different sequences of peptides or different sequences of nucleic acids. For example, if two or more proteins have highly similar amino acid sequences, it is likely that they are homologs. In some embodiments, homologs may include homologs within species, between species and/or between phyla. In some embodiments, the term homologs include orthologs and/or prologs.
[0072] As referred to herein, the term exogenous gene is directed to a gene (or any part thereof) which is introduced from the exterior into a cell. In some embodiments, the exogenous gene is inserted in the form of a polynucleotide (for example, DNA, RNA, and the like), for example, in the form of an expression vector. In some embodiments, the exogenous gene is capable of being expressed in the cell. In some embodiments, the exogenous gene is overexpressed within the cell.
[0073] As referred to herein, the term Kill with respect to a cell/cell population/organism is directed to include any type of manipulation that will lead to the death of that cell/cell population/organism.
[0074] The terms treating and treatment as used herein refer to reduction in severity and/or frequency of symptoms, elimination of symptoms and/or underlying cause, prevention of the occurrence of symptoms and/or their underlying cause, and improvement or remediation of damage. Thus, for example, treating a subject involves prevention of a particular disorder, or infection or adverse physiological event in a susceptible subject as well as treatment of a clinically symptomatic subject.
[0075] As referred to herein, the terms anthelmintic(s) or antihelminthic(s) or anti-nematode may interchangeably be used. The terms are directed to agents/compositions that are directed against helminths (parasitic round worms or nematodes). The agents/compositions may include various molecules, such as, for example, but not limited to: chemical compound, drug, nucleic acid molecule (such as, for example, DNA, RNA, siRNA, ribozyme, modified nucleic acids and the like), a protein or a peptide (such as, for example, an enzyme, an antibody, and the like), a toxin, or combinations thereof. In various embodiments, the antihelminthic may be used to stun, inhibit/suppress growth, and/or kill helminths cells. In some embodiments, the term antinematodal relates to antihelminthic which are directed against nematodes. In some embodiments, the terms antihelminthic and antinematodal may interchangeably be used. In some embodiments, the antinematodal is nematocidal (that is an agent that is able to kill the nematode/nematode cell). In some embodiments, the antinematodal is nematostatic (that is an agent that is able to stun/inhibit/suppress growth of the nematode/nematode cell).
[0076] As referred to herein, the terms fusion protein, fusogen and fusogenic protein may interchangeably be used. The terms are directed to a protein/peptide which is able to induce/mediate cell to cell fusion, for example, through fusion of the lipid bi-layers of the cells. In some embodiments, the fusogenic protein is an endogenous protein (that is, a protein encoded by the authentic genome of the cell and is usually expressed by an unmodified cell). In some embodiments, the fusogenic protein is an exogenous protein (that is, a protein which is encoded by a foreign gene introduced into the cell). In some embodiments, the fusogenic protein comprises a portion/domain of the full length fusogenic protein. The portion of the fusogenic protein may be any domain of the fusogenic portion or combinations of such domains, such as, for example, Signal peptide (SP) domain; Pro-domain; TGF-RI-like domain; [LMF]-G-W-[YFL]-[RK] motif domain; the Putative protein-protein interaction domain; Membrane proximal stem domain, Trans-membrane domain (TM), Fusion loop, and the like, or any desired peptide derived from the fusogenic protein sequence.
[0077] As referred to herein, the term FF protein(s) is directed to Fusion Family proteins. The term CeFF proteins is directed to FF proteins of C. elegans origin. Members of the FF proteins include, for example, AFF-1 and/or EFF-1 proteins and homologs thereof. Wherein said fusogenic protein of nematode origin it is meant to include members of the Fusion Family (FF) proteins as well as homologs thereof, wherein homologs may include homologs within species, between species and/or between phyla. In some embodiments, the term homologs include orthologs and/or paralogs. As referred to herein, homologs of the FF Family protein are proteins that share primary and/or secondary amino acid sequence signatures including a pattern of cysteins in the ectodomain of the type I membrane glycoprotein. To consider membership to the FF family the candidate protein is to share at least 15% identity or similarity with a known FF or protein of related secondary or tertiary structure (as further demonstrated in
[0078] As used herein, the term pseudotyped virus relates to a virus in which the endogenous viral envelope proteins have been replaced by envelope proteins from other sources, such as, for example, from other viruses, by exogenous proteins or peptides (for example, of nematode origin), and the like.
[0079] As referred to herein, the term virus cell is meant to include a virus, viral particle, viral envelope, viral vector and/or pseudotyped virus.
[0080] As used herein, the term bald virus relates to an enveloped viral particle or a pseudoviral particle lacking one or more viral envelope proteins.
[0081] As used herein, the term homotypic with respect to fusion is directed to fusion between cells that express the same fusion protein, or cells that express fusogenic protein of the same family.
[0082] As used herein, the term non-insect cell is directed to include cells which are not of insect origin. The term includes, for example, such cells as, mammalian cells, avian cells, plant cell, viral particle, human cells, animal cells, and the like.
[0083] As referred to herein, where a color is mentioned by name with respect to a figure (for example, red, cyan, purple, green, pink, yellow, etc.) it refers to the color as can be identified in the figure when reproduced in color scale. Where applicable, and as indicated in the brief description of the Figures, where a color is mentioned it is further indicated by an identifier, such as, arrow (solid, dash, long dash arrow head, and the like), asterisk, box, numerical or any other indication. The original figures reproduced in color can be found in publication by some of the inventors of the present application (Avinoam, et. al. (19), the contents of which is incorporated by reference herein in its entirety.
[0084] According to some embodiments, and as exemplified herein, nematode fusogenic proteins of the FF family and homologs thereof, such as for example, CeFF proteins, may be capable of mediating fusion of a virus to a cell (such as, for example, a mammalian cell), when the FF proteins are expressed and presented on the membranes of the virus and the cell. In some embodiments, the FF proteins expressed by the virus are replacing the endogenous fusogenic proteins of the virus. In some embodiments, the fusogenic protein expressed by the virus is the same fusogenic protein as that expressed by the cell. In some embodiments, the fusogenic protein expressed by the virus is not the same fusogenic protein as the fusogenic protein expressed by the cell, but rather a family member thereof. For example, the fusogenic protein expressed by both the virus and the cell is AFF-1 protein or homologs thereof. For example, as further shown below, the fusion protein expressed by the virus is AFF-1 whereas the fusion protein expressed by the cell is EFF-1, and vice versa. Accordingly, in some embodiments, a nematode fusogenic protein may replace the endogenous viral fusogen as the minimal fusogenic machinery. Moreover, the infection biology of the virus may be transformed from a mechanism in which the endogenous viral fusogen, (for example, VSVG), is required only in the virus, to a homotypic, fusion protein-dependent mode-of-action in which the fusogen(s) is expressed in the membranes of both the virus and the target cell.
[0085] According to some embodiments, the fusion family protein may be any member of the family of fusogenic proteins that may be of nematode origin, or even of other phylum, such as, for example, chordates. Sequence comparisons (ref. 4, and herein) identified putative FF members in thirty five nematode species, suggesting that the FF family is conserved in the phylum Nematoda (4). In addition, similar proteins were found in the arthropods Calanus finmarchicus and Lepeophtheirus salmonis (Crustacea), the ctenophore Pleurobrachia pileus, the chordate Branchiostoma floridae (order Amphioxi) and the protist Naegleria gruberi, (as shown in
[0086] According to some embodiments, and as further demonstrated below, FF proteins are a family of membrane fusogens in nematodes that may be interchangeable between species and even beyond the nematode phylum and hence homologs of the family can be used for fusion of cells, when expressed on the membranes of those cells. As exemplified hereinbelow (for example, in
[0087] According to some embodiments, Fusion Family proteins of nematode origin and homologs thereof can mediate homotypic or heterotypic fusion of a virus and a cell without additional membrane co-factors. The fusion of the virus and the cell results in infection of the cell by the virus.
[0088] According to other embodiments, the Fusion Family proteins of nematode origin and homologs thereof can mediate homotypic fusion of two cells (a first cell and a second cell), wherein the cells express the fusogenic protein of nematode origin. In some embodiments, the cells are not-insect cells. In some embodiments, at least one of the fused cells is not an insect cell. Each possibility is a separate embodiment.
[0089] According to some embodiments, the nematode may be any type of nematode. For example, the nematode may be selected from, but not limited to: Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis japonica, Caenorhabditis ramanei, Caenorhabditis brenneri, Caenorhabditis sp5,7,9,11, Trichinella spiralis, Trichinella pseudospiralis, Trichinella papuae, Pristionchus entomophagus, Pristionchus maupasi, Pristionchus pacificus, Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla Globodera pallida, Ancylostoma caninum, Brugia Malayi, Haemonchus contortus, Ascaris suum, Oscheius tipulae, Dirofilaria immitis, Howardula aoronymphium, Litomosoides sigmodontis, Heterodera glycines, Romanomermis culicivorax, Trichuris muris, Strongyloids ratti, Onchocerca volvulus, Teladorsagia circumcincta, Wuchereria bancrofti, Loa loa, and any other nematode known in the art. Each possibility is a separate embodiment.
[0090] According to some embodiments, in order to express an exogenous fusogenic protein in a cell, the cell may be introduced with a construct, such as, for example, an appropriate expression vector, encoding the desired fusion protein. The construct that encode for the fusogenic protein may include a plasmid, vector, viral construct, or others known in the art, used for replication and expression in the appropriate target cell (which may include, for example, mammalian cells, avian cell, plant cells, viruses, and the like). The construct may be used for transient transfection and/or stable transfection of the cells. Expression of the fusogenic protein can be regulated by any promoter known in the art to act in the target cell. Such promoters can be inducible or constitutive. Such promoters include, for example, but are not limited to: the SV40 early promoter region, the promoter contained in the 3 long terminal repeat of Rous sarcoma virus, the herpes thymidine kinase promoter, the regulatory sequences of the metallothionein gene, the viral CMV promoter, the human chorionic gonadotropin-beta promoter, and the like. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the construct which can be introduced directly into the cell, by any method known in the art. Alternatively, when the target cell is not a virus, viral vectors can be used which selectively infect the desired target cell. In some embodiments, expression of the fusogenic protein in the cell is transient. In other embodiments, expression of the fusogenic protein in the cell is chronic. In some embodiments, expression of the fusogenic protein in the cell may be inducible (that is, the fusogenic protein is expressed only under certain conditions).
[0091] According to some embodiments, there is thus provided a method for a specific, protein-mediated virus to cell fusion, wherein the virus and the cell express a fusogenic protein of the nematode family, or homologs thereof. The method includes placing/incubating/mixing the virus and the cell in close proximity, thereby allowing interaction of the fusogenic proteins which consequently may lead to fusion of the cells. According to some embodiments, the fusogenic protein is selected from AFF-1, EFF-1 and homologs thereof. In some exemplary embodiments, the fusogenic protein is a CeFF protein. In some embodiments, the same fusogenic protein is expressed on the surface of both the virus and the cell. In some embodiments, each of the virus and the cell express a different fusogenic protein, both fusogenic proteins belong to the family of Fusion Family proteins. In some embodiments, for at least one of the cells, the fusogenic protein is an exogenous protein. The method may be performed in-vitro and/or in vivo. When performed in vitro, the virus and the cell may be placed in the same growth medium and incubated under favorable conditions which allow the growth of the cells.
[0092] According to some embodiments, there is further provided a method for a targeted and specific fusion of a nematode cell and a virus expressing an exogenous fusogenic protein of nematode origin, wherein the exogenous fusogenic protein expressed by the virus replaces an endogenous fusogenic protein that may be expressed by the virus.
[0093] In some embodiments, the virus expressing the exogenous fusogenic protein of nematode origin may be any type of virus capable of fusing with other cells. In some embodiments, the native (unmodified) virus may be capable of inducing fusion by virtue of endogenous fusogenic proteins expressed by the unmodified virus. For example, but without limitation, the virus may be of the retrovirus family (for example, HIV, MLV); Hepadnavirus, Poxyvirus, Rhabdoviridae viruses (for example, Vesicular stomatitis virus (VSV)); Paramyxoviruses; Herpes viruses; Coronavirus, and the like, or combination thereof.
[0094] According to further embodiments, there is thus provided a method for the targeted killing or inhibition of a nematode/nematode cell, the method comprises contacting the nematode with a virus expressing an exogenous fusogenic protein of nematode origin, thereby allowing fusion of the virus to a cell of the nematode. Consequent to the fusion between the virus and the nematode cell, the virus may induce lysis of the nematode/nematode cell and/or inhibit the growth of the nematode/nematode cell. The nematode may further become unviable if too many of its cells are killed.
[0095] According to further embodiments, there is provided a method for a specific, protein mediated, cell to cell fusion. The method includes having the cells express a fusogenic protein on their membranes and mixing/placing/incubating the cells in close proximity, thereby allowing interaction of the fusogenic proteins which may lead to fusion of the cells. The protein which mediates the fusion may be a fusogenic protein of nematode origin or homologs thereof, and is expressed on the surface of the cells and thereby allows fusion of the cells. According to some embodiments, the fusogenic protein is selected from AFF-1, EFF-1 and homologs thereof. In some embodiments, the fusogenic protein is a CeFF protein. In some embodiments, the same fusogenic protein is expressed on the surface of both cells. In some embodiments, each cell expresses a different fusion protein, both fusogenic proteins belong to the family of Fusion Family proteins. In some embodiments, the fusogenic proteins are endogenously expressed proteins. In some embodiments, for at least one of the cells, the fusogenic protein is an exogenous protein. In some embodiments, the cells are of similar origin. In some embodiments, the cells are of different origin. For example, the cells may be of human origin, animal origin, plant origin, avian origin, and the like. In some exemplary embodiments, both cells (i.e. the first cell and the second cell) express an exogenous Ce-AFF-1 protein. In some exemplary embodiments, both cells (i.e. the first cell and the second cell) express an exogenous Ce-EFF-1 protein. In some embodiments, the first cell expresses an exogenous Ce-AFF-1 protein and the second cell expresses a Ce-EFF-1 protein. In some embodiments, upon fusion of the cells (i.e. the first cell and the seconds cell), and hybrid cell is formed. In some embodiments, the hybrid cell contains two nucleus.
[0096] According to additional embodiments, the method for the specific, protein mediated, cell to cell fusion may be used to specifically target antinematodal agents to nematodes. In such embodiments, fusion of a nematode cell to a foreign cell is dependant on the expression of a fusogenic protein of nematode origin (or homologs thereof) in the membranes of both fusing cells, wherein the fusogenic proteins may be identical or different. In some exemplary embodiments, one cell is of nematode origin (endogenously expressing the fusion protein) and the second cell is of different/foreign origin (such as, for example, of viral origin, plant origin, mammalian origin, avian origin, insect origin), wherein the second cell exogenously expresses a fusogenic protein of nematode origin. The second cell may comprise one or more antinematodal agents that may include any antinematodal agent known in the art or to be developed/identified in the future. The antinematodal agent that is comprised in the cell may be further carried in a carrier within the cell, wherein the carrier is configured to protect the agent within the cell. The carrier may include, for example, such carriers as, liposomes, vacuoles, capsules, microspheres, micelles, and the like. In some embodiments, the antinematodal agent is encoded/produced by the cell. Upon specific fusion of the cells, the antinematodal agent may be released/expressed and exert an effect on the nematode. The effect may be, for example, kill, stun, and/or inhibit/suppress growth of the nematode.
[0097] According to some exemplary embodiments, the antinematodal agent may be selected from, but not limited to: a chemical compound (such as, for example, but not limited to: organophospates, carbamates, imidazole derivatives, such as, for example, benzimidazole, Levamisole, Fumigant nematicides, macrolides, avermectin, milbemycin and the like); a nucleic acid (such as, for example, antisense DNA molecules directed against nematode genes; siRNA molecules directed against nematode genes, and the like); proteins (such as, for example, but not limited to: an enzyme capable of cleaving a nematode protein, an antibody directed against a nematode protein); toxins, antibodies and combinations thereof.
[0098] According to further embodiments, the method for the specific, protein mediated, cell to cell fusion may thus be used for the treatment of parasitic nematode infection of various organisms (such as, for example, animals and humans) and plants. In some embodiments, the method may include inducing one or more cells of the organism/plant to be treated to express a fusogenic protein of a nematode origin and an antinematodal agent, whereby upon expression of the fusogenic protein by the cell, a nematode infecting the organism or plant is fused to said cell expressing the fusion protein, thereby exposing the nematode to the antinematodal agent.
[0099] In some embodiments, a transgenic plant is provided, in which at least some of the plant cells have been modified to express a fusogenic protein of the nematode family and optionally further express an antinematodal agent (such as, for example a protein or a peptide having antinematodal effect, nucleic acid sequence capable of exerting an antinematodal effect, and the like). Upon infection of the transgenic plant with a nematode, the nematode cells will fuse with the plant cells expressing the fusogenic proteins, and the antinematodal agent comprised/encoded by those cells may exert a deleterious effect on the nematode, such as, for example, kill the nematode and/or inhibit/suppress its growth. In some embodiments, the expression of the nematode fusogenic protein by plant cells is constitutive (that is, the cells constitutively express the nematode fusion protein). In some embodiments, the expression of the nematode fusogenic proteins by plant cells are induced under different conditions (such as, for example, different lighting conditions, different watering conditions, different temperatures, different humidity, and the like, or combinations thereof).
[0100] According to some embodiments, the stable or transient expression of a nematode fusogenic protein in plants may be achieved by stable or transient transfection of plant cells with a nucleic acid encoding a nematode fusogenic protein. In stable transformation, the nucleic acid molecule encoding a nematode fusogenic protein is integrated into the plant genome, and as such it represents a stable and inherited trait. In transient transformation, the nucleic acid molecule is expressed by the cell transformed but not integrated into the genome, and as such represents a transient trait.
[0101] There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants. The principal methods of the stable integration of exogenous DNA into plant genomic DNA include two main approaches: (i) Agrobacterium-mediated gene transfer, which includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially useful for in the creation of transgenic dicotyledenous plants. (ii) Direct DNA uptake. There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the DNA is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
[0102] Following stable transformation, plant propagation then occurs. The most common method of plant propagation is by seed. Another method of regenerating a transformed plant is by micropropagation, which provides a rapid, consistent reproduction of the transformed plants.
[0103] Transient transformation of, for instance, leaf cells, meristematic cells, or the whole plant may also be used.
[0104] Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
[0105] Viruses that useful for the transformation of plant hosts include, for example, cauliflower mosaic virus (CaMV), tobacco mosaic virus (TMV), and baculovirus (BV). In some embodiments, pseudotyped BD virus expressing FF proteins can also be used to deliver toxins, nucleic acids and other molecules.
[0106] In addition, the nucleic acid molecule encoding a nematode fusogenic protein can also be introduced into a chloroplast genome.
[0107] According to additional embodiments, treatment of parasitic nematode infection of organisms such as mammals, avians, rodents, and the like, may include providing the infected organism with a composition (such as, for example, a pharmaceutical composition), which includes a virus particle/viral vector, which is genetically engineered to express an exogenous fusogenic protein of the nematode family. In some embodiments, the virus does not express an endogenous fusogenic protein. In exemplary embodiments, the viral endogenous protein is replaced by a fusogenic protein of the nematode origin. The virus cell/viral vector of the composition does not affect any of the cells of the organism, and upon specific fusion with a nematode cell, can induce killing or inhibition of growth of the nematode. The composition may be formulated by any method known in the art, such as disclosed, for example in the latest edition of Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., which is herein fully incorporated by reference. The composition may further include one or more excipients, as known in the art. The composition may be administered by any administration route, such as, for example, oral, rectal, transmucosal, especially trans-nasal, intestinal, or parenteral delivery, including intramuscular, subcutaneous, and intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections. In some embodiments, the composition is formulated for veterinary use. In some embodiments, the composition is in form of a viral vector, wherein administration of viral vectors can be performed by, for example, intravenous or subcutaneous injection into the organism. Following injection, the viral vectors can circulate until they recognize nematode cells, whereby they viral vector fuses to the nematode cells and induce their killing or suppression of their growth.
[0108] In some embodiments, the virus cell/viral vector, which is genetically engineered to express an exogenous fusogenic protein of the nematode family may be integrated into the genome of the treated organism.
[0109] In some embodiments, a transgenic animal is provided, in which at least some of the cells have been modified to express a fusogenic protein of the nematode family and optionally further express an antinematodal agent (such as, for example a protein or a peptide having antinematodal effect, nucleic acid sequence capable of exerting an antinematodal effect, and the like).
[0110] According to some embodiments, there is provided a method for treating a nematode infection in a subject, comprising administering to the subject a composition comprising a cell expressing an exogenous fusogenic protein of the nematode family, wherein fusion of said cell of the composition and a nematode cell infecting the subject, may lead to the death and/or inhibition of growth of the nematode, thereby treating the nematode infection. In some embodiments, the subject is human. In some embodiments, the composition is a pharmaceutical composition that may be formulated by any method known in the art. In exemplary embodiments, the composition is formulated to be administered orally and to release the cell expressing the nematode fusogenic protein in the intestines.
[0111] In additional embodiments, there is provided a use of a composition comprising a cell expressing an exogenous nematode fusogenic protein and optionally an antinematodal agent, for the treatment of nematode infection in a subject in need.
[0112] According to some embodiments, there is provided a method for treating a nematode infection in an animal, comprising administering to the animal a composition comprising a cell expressing an exogenous fusogenic protein of the nematode family, wherein fusion of said cell of the composition and a nematode cell may lead to the death and or inhibition of growth of the nematode, thereby treating the nematode infection in the animal. In some embodiments, the animal is a rodent, a mammal, an avian, and the like. In some exemplary embodiments, the animal is cattle, chicken, horse, canine, and the like, or any other animal that may be infected by nematode.
[0113] According to some embodiments, there is further provided a viral vector for the expression of a nematode fusogenic protein on the surface of a virus. The fusogenic protein may be selected from AFF-1, EFF-1 and homologs thereof.
[0114] According to further embodiments, there is provided a cell expressing an exogenous fusogenic protein of nematode origin, wherein said exogenous fusogenic protein is a Fusion Family protein member. The cell may be of any origin, such as, for example mammalian cell, avian cell, viral cell, plant cell, human cell, animal cell, and the like. In some embodiments, the cell is a non-insect cell. Each possibility is a separate embodiment.
[0115] In various embodiments, there are further provided kits for practicing antinematodal methods of various embodiments. The kits may include, for example, at least one or more of: a virus expressing an exogenous nematode fusogenic protein; a cell expressing an exogenous nematode fusion protein, wherein the cell may optionally express an antinematodal agent; a vector for expressing a nematode fusogenic protein on the surface of a cell; and a viral vector expressing a nematode fusogenic protein. The kits may further include additional components, such as, for example, suitable containers, suitable growth medium, buffers, reagents, and the like. Additionally, the kit may further include instructions for using the components of the kit for practicing various embodiments, such as, for example, for the treatment of nematode infection.
[0116] According to various embodiments, it is to be emphasized that wherein said fusogenic protein of nematode origin, it also encompasses homologs thereof. In some embodiments, the fusogenic protein comprises any protein having at list 15% identity or similarity with a known FF or protein of related structure (as demonstrated, for example, in
[0117] The term comprising includes the term consisting of.
[0118] While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain modifications, permutations, additions and sub-combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced be interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.
[0119] The following examples are presented in order to more fully illustrate certain embodiments of the invention. They should in no way, however, be construed as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
Materials and Methods
DNA Constructs
[0120] For transient expression of FF proteins, AFF-1::FLAG (SEQ ID NO:1), EFF-1::V5 (SEQ ID NO: 2), Tsp-FF-1::FLAG (SEQ ID NO: 3), and Bfl-FF-1::FLAG (SEQ ID NO: 4) were inserted into the pCAGGS mammalian expression vector (15) (Tables 2 and 4). Unless otherwise indicated, 5 KpnI and 3 NheI restrictions sites were used to clone into pCAGGS. To generate pOA20 (Table 2) the DNA encoded by pIZT-AFF-1 (10) was PCR amplified using primers OR55, OR56 (Table 3). To generate pOA19 (Table 2) the DNA encoded by pIZT-EFF-1A (9) was PCR amplified using primers OR54, OR55 (Table 3). To generate pOA35 (Table 2), DNA from a cDNA library (obtained from Nagano) was PCR amplified using nested primers OR100-OR103 (Table 3). The PCR product was ligated into pGEMT-easy as recommended by manufacturer (Promega) and then used as template for PCR amplification with primers OR111 and OR112 (Table 3). To generate pOA60 (Table 2), the cDNA sequence corresponding to accession gi12100900151 with Flanking 5 KpnI 3 NheI was optimized for expression and synthesized (GeneScript). To label cytoplasm, pRFPnes (16) was used. To label the nucleus, pCFPnls (SEQ ID NO. 21) encoding CFP with two tandem repeats of the nuclear localization signal (nls) from simian virus large T-antigen was used. To generate pCFPnls, primers OR147-148 (Table 3) were used with pCH44 (16) as template. The PCR product was cloned into the BamHI, EcoRI sites of pCDNA3.1 (+) (Invitrogen). To generate pOA6 P. pacificus genomic DNA (PS312) was used as template with primers OR-19 and OR-22 (Table 3). The PCR product was ligated into pPD49.78. To generate pRSETA-AFF1EC (SEQ. ID. NO: 27), primers AM66 and AM 67 (Table 3) were used with Ce-AFF-1 cDNA as template (10). The PCR product was cloned into the BglII, KpnI sites of pRSET-A (Invitrogen). All sequences were verified by sequencing.
TABLE-US-00001 TABLE 2 Plasmids used Plasmid Name Description pOA6 P. pacificus eff-1 genomic sequence (SEQ ID NO: 20) in pPD49.78 (hsp 16.2) pOA19 C. elegans eff-1 fused to a C-terminal V5 tag (EFF-1::V5) (SEQ ID NO 2) in pCAGGS vector. (V5 tag nt. 1974-2049) pOA20 C. elegans aff-1 fused to a C-terminal FLAG tag (AFF-1::FLAG) (SEQ ID NO: 1) in pCAGGS vector pOA35 T. spiralis ff-1 with a kozak sequence fused to a C-terminal FLAG tag (Tsp-FF-1::FLAG) (SEQ ID NO: 3) in pCAGGS vector (FLAG-tag nt. 1779-1803 of SEQ ID NO: 3). pOA60 B. floridae ff-1 with a kozak sequence fused to a C-terminal FLAG tag (Bfl-FF-1::FLAG) (SEQ ID NO: 4) in pCAGGS vector (FLAG tag: nt. 1740-1764 of SEQ ID NO: 4) pCFPnls CFP with two tandem nuclear localization signals (SEQ ID NO: 21) pCAGGS A chicken beta-actin/rabbit beta-globin hybrid promoter with a human cytomegalovirus immediate early promoter (CMV-IE) enhancer pCAGGS- VSV G Indiana strain (ref. 20) Gind pRFPnes DsRed2 with a nuclear export signal (pCH19) (Ref. 16) pRSETA- The extracellular domain of Ce-AFF-1 including 6-His tag AFF1EC (SEQ ID NO. 27). (6XHis tags, nt. 1692-1710 of SEQ ID including NO: 27). 6His tags
TABLE-US-00002 TABLE3 Primersused Name Sequence OR-19 ATGATCTTCTCTTCTCTTCTACTGTATAC (SEQID NO:5) OR-22 TCATACATAATCTCCAGGTAGAACATC (SEQID NO:6) OR-54 TTAATTGGTACCACTATGGAACCGCCGTTTGAGTGG (SEQID NO:7) OR-55 AATTAAGCTAGCTCAACCGGTACGCGTAGAATCGAGACC (SEQID NO:8) OR-56 TTAATTGGTACCACTATGGTACTGTGGCAATGGTCAATA (SEQID GCC NO:9) OR-100 ATGTTCTCACCACTTTTTTGTCTTCTTCTTCTGC (SEQID NO:10) OR-101 AACTGCCTCGCCCAAGAATATGCC (SEQID NO:11) OR-102 ATATTCTTGGGCGAGGCAGTTGACC (SEQID NO:12) OR-103 TCACAATTTGTTAGCATTCGTTCTGCC (SEQID NO:13) OR-111 TTAATTGGTACCATGTTCTCACCACTTTTTTGTCTTCTT (SEQID CTTCTGC NO:14) OR-112 AATTAAGCTAGCTCATTTGTCATCGTCGTCCTTGTAGTC (SEQID CAATTTGTTAGCATTCGTTCTGCCATTTCC NO:15) OR-147F AATTAAGGATCCATGGTGAGCAAGGGCGAGGAGCTG (SEQID NO:16) OR-148R AATTAAGAATTCTTATACCTTTCTCTTCTTTTTTGGATC (SEQID TACC NO:17) AM-66 TATGTCTTAGATCTCCAAAGTCTCATCAGTACACAGTAC (SEQID T NO:18) AM-67 TGTATCATGGTACCCTCTGTGAAATCCCCACCATGAGC (SEQID NO:19)
Nematode Strains
[0121] Nematode strains were maintained according to standard protocols. In addition to the wild-type strain N2, the following strains were used: LGII: BP347 eff-1(ok1021) (9). LGIV: SU93 jcIs1[ajm-1::gfp, pRF4] (7), BP421 eff-1(ok1021)II, hyEx161[ajm-1::gfp, (21) pOA6 (Ce-hsp::Ppa-ff-1) (SEQ ID NO: 20). To drive Ppa-ff-1 ectopic expression in C. elegans, 10 ng/l of pOA6 (Table 2) were co-injected with 10 ng/l of the apical junction marker AJM-1::GFP (hyExl61).
Bioinformatics
Identification and Characterization of New Members of the FF Family
[0122] FF proteins in nematodes were identified as described in Reference 4. For the Chordate, Ctenophore and Arthropod sequences, the BLAST search provided by the National Center for Biotechnology Information (NCBI) was used. For annotation, the Augustus gene prediction software with the training set for C. elegans was used. In some cases, the gene model was manually corrected based on the multiple sequence alignment (for example, as shown in
Phylogeny of FF Proteins (FIG. 4A)
[0123] Phylogenetic analyses were conducted in MEGA4. The evolutionary history was inferred using the Maximum Parsimony (MP) method. The MP tree was obtained using the Close-Neighbor-Interchange algorithm with search level 3 in which the initial trees were obtained with the random addition of sequences (10 replicates). All positions containing gaps and missing data were eliminated from the dataset (Complete Deletion option). The signal sequence was removed from the final dataset. Evolutionary relationships of 14 (right) and 25 (left) taxa is shown (
Secondary Structure Prediction (FIG. 6C)
[0124] Predictions were performed using the JNET method available from the web services of the Jalview 2.5 software.
Structural Homology (FIGS. 8A-B)
[0125] The multiple sequence alignment was used as query to scan the protein data bank (PDB) for homologues by sequence-structure comparison either using FUGUE v2.s.07 or HHpred. Searches identified several putative distant homologues belonging to the Class II family of viral fusogens (14). The most probable homology was to Dengue2 envelope glycoprotein (loke, lok8, (accession: GI: 34811077/8)) (FUGUE confidence 95% and HHpred probability 61%). In addition, Tick-Born Encephalitis envelope glycoprotein (lsvb), Semliki Forest Virus (lala), and Dengue 1 and 3 were identified with lower probabilities (lp58, luzg).
Cells and Reagents
[0126] All Baby Hamster Kidney cells (BHK) are BHK-21(ATCC). BHK cells and their growth conditions were according to standard protocols. Dulbecco's modified Eagle's medium (DMEM), Penn/Strep, L-glutamine, and sodium pyruvate obtained from Gibco. Fetal Bovine Serum was obtained from Biological Industries, Kibbutz Belt Haemek, Israel. Experiments with Sf9 cells and their growth conditions were as described (9, 10).
Cell-Cell Fusion Assay
[0127] BHK cells at 70% confluence were transfected using Fugene6 (Roche) with 2 g of pCAGGS DNA (including an insert (FF coding sequence as detailed above) or an empty vector) and 0.5 g of pRFPnes DNA in 35 mm tissue culture dishes (Corning) containing a glass cover slip on the bottom (Knittel). At 14-24 hours post transfection the cells were fixed with 4% paraformaldehyde in PBS and processed for immunofluorescence. To assay multinucleated cells, cell nuclei was stained with Hoechst (1 g/ml, H3570, Molecular Probes) or 1 g/ml DAPI for 10 min at room temperature (9). The number of nuclei in expressing cells as marked by pRFPnes or antibody staining (see below), was counted using either a Zeiss Axiovert 200M inverted or a Nikon Eclipse E800 upright fluorescence microscope. The fusion indexes (shown as percentage of fusion) were defined as the ratio between the number of nuclei in multinucleated cells and the total number of nuclei in fused cells and expressing cells that were in contact but did not fuse. The fusion indexes are presented as meansstandard errors of at least eight independent experiments. Each experiment consisted of at least two replicates of the same transfection (2, 3). Transfection efficiency was evaluated as 40-60% based on pRFPnes and antibody staining.
Color Mixing Assay
[0128] Cytoplasmic content mixing assays were performed as described (16) with some modifications. The cytoplasm of cells that express AFF-1 was marked with a red fluorescent protein by expressing RFPnes. The nuclei of cells that express EFF-1 were marked with a CFPnls. Fused hybrid cells could be distinguished by their red cytoplasm surrounding multiple blue nuclei. The percentages of fused hybrid cells (red and cyan; purple) and multinucleated cells (red or cyan alone) were calculated by dividing the mean number of red, cyan and purple cells by the mean number of cells from four independent experiments. Experiments were repeated at least five times yielding similar results independent of whether the co-transfection fluorescent marker was RFPnes or CFPnls.
Pseudoviruses Preparation
[0129] Recombinant viruses were recovered as described (17) with some modifications. BHK cells were grown to 70% confluence on 10 cm plates and then transfected with plasmids encoding pCAGGS empty vector, pOA19 or pOA20 (Table 3). Following 24 hour incubation at 37 C. in 5% CO.sub.2, cells were infected with VSVG-complemented VSVG recombinant virus (VSVG-G) at a multiplicity of infection (MOI) of 2-5 for 1 hour at 37 C. in a 5% CO.sub.2 incubator in serum free culture medium (DMEM). Virus infected cells were washed at least 3 times with serum-free DMEM or PBS to remove unabsorbed VSVG-G virus. Following a 24 hour incubation period at 37 C. the supernatant and cells containing the VSVG, VSVG-EFF-1, or VSVG-AFF-1 pseudoviruses were harvested and centrifuged at 600 g for 10 min at 4 C. to clear cell debris. Virions were removed from the supernatant by pelleting at 100,000 g through a 20% sucrose cushion and resuspended in 10% sucrose in Hepes/NaCl buffer (25 mM Hepes, 130 mM NaCl pH 7.4).
Titering VSV Pseudotype Viruses on BHK Cells
[0130] To determine the titer of each pseudovirus preparation, 310.sup.4 BHK cells were plated into each well of a 96 well tissue culture plate (NUNC). For titering of VSVG-AFF-1 or VSVG-EFF-1, BHK cells were initially transfected with 1 g/ml aff-1 or eff-1, pOA20 or pOA19, respectively. Cells transfected with empty vector served as control. Six serial dilutions of the virus were performed and added to cells. After 18-24 hours of incubation, GFP expressing cells were counted in at least two dilutions using a Zeiss Axiovert 200M fluorescence microscope. Each experiment was repeated at least three times with duplicates. Inoculation was performed in the presence of anti-VSVG antibody mAb I1 diluted 1:100 to inhibit infection due to residual presence of VSVG. Results were also confirmed by FACS analysis. For FACS analysis BHK cells were grown to 70% confluence and transfected with 1 g/ml of plasmid encoding aff-1 or eff-1 (plasmids pOA20 or pOA19, respectively). Following 24 hour incubation, cells were infected with VSVG-AFF-1 and incubated for 24 hours. To measure the titer cells were collected using EDTA and fixed in 4% paraformaldehyde. Samples were maintained on ice and examined for GFP expression using BD FACS Calibur (N=20,000 cells,
Immunoblotting
[0131] To detect proteins by Western blotting, samples were treated with SDS-PAGE sample buffer containing 10% of -mercaptoethanol or RIPA buffer (50 mM Tris, 150 mM NaCl, 1% NP40, 5% Deoxycholate) for 20 min at 4 C. Samples were boiled in the presence of 20 mM DTT for 5 min and the protein profile was examined on an 8%, 10% or 12% SDS polyacrylamide gel. For AFF-1 expressing cells (BHK-AFF-1) and viruses (VSVG-AFF-1) bands were visualized using mouse anti-FLAG (M2, Sigma F3165) monoclonal antibody and mouse anti-M polyclonal antibody (
Production of Mouse Anti-AFF-1 Polyclonal Antibodies
[0132] The extracellular domain of AFF-1 (AFF-1EC) was sub-cloned into pRSET-A that introduced 6 His at the N terminus (Table 2). The AFF-1EC::6 His (SEQ ID NO: 27) fusogenic protein was over-expressed in E. coli by adding 0.5 mM IPTG and incubating the culture overnight at 16 C. Rosetta and affinity purification with NiNTA beads (Qiagen Cat#30210) was according to the QIAexpressionist manual (June 2003, QIAGEN). The protein was eluted by adding four 0.5 ml aliquots of elution buffer A (8M urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl, pH 5.9) followed by another four aliquots of elution buffer B (8M urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl, pH 4.5). Mouse polyclonal antibodies were prepared using AFF-1EC as antigen (Adar Biotech Inc., Israel).
Immunofluorescence
[0133] BHK-21 cells were grown on tissue culture plates with glass cover slips on the bottom (Knittel). Cells were fixed with 4% paraformaldehyde in PBS, incubated in 40 mM NH.sub.4Cl to block free aldehydes, washed in PBS, permeabilized in 0.1% tritonX-100 in PBS and blocked in 1% FBS in PBS. The cover slips were incubated 1 hour at 23 C. with either anti-V5 1:500 (Invitrogen) or anti-FLAG 1:2000 (Sigma) mouse monoclonal antibodies. The secondary antibodies were goat anti-mouse and goat anti-rabbit coupled to Alexa488, 633 or 643 (Molecular Probes/Invitrogen). Transfected cells expressed cytoplasmic RFP from the pRFPnes vector and nuclei were visualized with DAPI or Hoechst staining as described above.
[0134] Sera obtained from mice immunized with AFF-1EC were tested by immunofluorescence using Sf9 cells expressing AFF-1::Flag. Sera #8 diluted 1:500 showed membrane and intracellular vesicular staining (
Transmission Electron Microscopy (TEM)
Negative Staining-TEM
[0135] A 400-mesh carbon-coated grid was placed on a 20 l sample drop for 2 min and blotted with a filter paper. The sample was chemically stained by placing the grid on a 20 l drop of 2% uranyl acetate for 2 min followed by blotting with a filter paper and air-drying. Specimens were examined in a Tecnai T12 G.sup.2 TEM (FEI) or in a Philips CM120 transmission electron microscopes operated at 120 kV. Images were recorded digitally on a Gatan UltraScan 1000 2k2k camera or the Gatan 791 wide-angle camera using the DigitalMicrograph software (Gatan, U.K.)
Cryo Electron Microscopy
[0136] A 3-l drop of the sample was placed on a glow-discharged holey carbon coated copper electron microscopy grid (C-flat, Protochips). The drop was blotted, and the sample was vitrified by plunging into liquid ethane (183 C.). The specimen was then transferred to liquid nitrogen (196 C.) for storage. Vitrified specimens were examined on a Tecnai F30 Polara TEM (FEI) operated at 300 kV and equipped with a GIF2002 postcolumn energy filter (Gatan) operated in zero loss mode. 2K2K images were acquired at a calibrated magnification of 27,500, resulting in a pixel size of 0.5 nm at the specimen level. Projection images were recorded at defocus settings between 4 m to 6 m using SerialEM. Alternatively, specimens were examined in a Tecnai T12 G.sup.2 TEM (FEI) operated at 120 kV and images were recorded digitally on a Gatan UltraScan 1000 2K2K camera using the DigitalMicrograph software (Gatan, U.K.).
Cryo Electron Tomography
[0137] A 4-l aliquot of the pseudotyped virus preparations was pipetted onto a glow-discharged holey carbon coated copper electron microscopy grid (Cflat, Protochips). Colloidal 10 nm diameter gold particles coupled to bovine serum albumin (BSA) were added, excess liquid was absorbed using a filter paper and the grids were vitrified by plunge-freezing in liquid ethane. Vitrified grids were stored in liquid nitrogen until examined on a Tecnai Polara TEM (FEI) operated at 300 kV and equipped with a GIF2002 or Tridem postcolumn energy filter (Gatan) operated in zero loss mode. 2K2K images were acquired at a calibrated magnification of 27,500, resulting in a pixel size of 0.5 nm at the specimen level. Tilt series were collected at a defocus of either 6 m for the viral tomogram or 8 m for the vesicle tomogram in two-degree increments covering an angular range from 60 to 600 using SerialEM. The total electron dose was kept below 100 electrons/.sup.2. Tilt series were aligned using gold beads as fiducials. Three dimensional reconstructions were calculated from the tilt series in IMOD using weighted back projection. Slices for figures were prepared using Amira 5.2 (Visage Imaging).
Measurements
[0138] The width and length of the particles on the surface of viruses and vesicles were measured from images of negatively stained samples using ImageJ Software 1.410. The G glycoprotein was measured as control and the obtained size was compared to published dimensions. Unpaired t tests were performed (P<0.0001).
Immunogold Labeling
[0139] Virus samples were pipetted onto carbon-coated grids and incubated for 5 min and then blocked with 1% BSA in PBS for 30 min at room temperature. The grids were then placed on a 50 l drop of anti-AFF-1 (#8 serum; see Immunofluorescence section above) diluted 1:100 in PBS containing 1% BSA and incubated overnight at 4 C. in a sealed humidified chamber. Excess antibody was removed by placing grids sequentially onto three 50 l drops of 0.1% BSA in PBS for 2 min each time. The grids were then placed on a 20 l drop of goat anti-mouse IgG conjugated with 12-nm gold particles (Jackson lab, 1:20) for 1 hour at room temperature. Unbound gold conjugates were removed by three sequential 2-min washes with PBS. Samples were fixed by placing the grids on a 50 l drop of 0.1% glutaraldehyde in PBS for 5 min. The grids were washed twice in PBS for 2 min and were then negatively stained by incubating the grids for 2 min on a 20 l drop of 2% phosphotungstic acid in water (pH 7). Excess stain was removed and the grids were air-dried. Images were recorded digitally as described above.
Example 1: CeFF Proteins are Capable of Mediating Virus-Cell Fusion
[0140] In order to test whether CeFF proteins are capable of mediating virus-cell fusion when presented on the membrane of Vesicular Stomatitis Virus (VSV), AFF-1 complemented VSVG pseudoviruses, in which the gene encoding the fusogenic glycoprotein (VSVG) was replaced by GFP (VSVG-AFF-1; scheme of
Example 2Structure-Function of AFF-1
[0141] To study the relationship between structure and function of AFF-1, transmission electron microscopy (TEM) was used. Negatively stained samples of VSVG to VSVG and AFF-1 complemented VSVG preparations were compared. VSVG virions have the typical VSV bullet shape with a smooth membrane, hence termed bald, while both VSVG-G and VSVG-AFF-1 virions displayed distinct spikes on their envelopes (
TABLE-US-00003 TABLE 1 Measured size of AFF-1 and VSVG VSVG AFF-1 Length (nm) Width (nm) Length (nm) Width (nm) Mean Size 14.5 8.7 10.9 6.0 SEM 0.5 0.4 0.5 0.3 N 20 32 Size (38) 12.5 6.0 *SEMStandard Error, Nnumber of measurements
Example 3FF Proteins can Interact
[0142] To show that FF proteins can interact, cytoplasmic mixing between cells using a color mixing-assay (
Example 4Divergent FFs can Function as Fusogens
[0143] To determine whether divergent FFs can function as fusogens, Tsp-ff-1 was expressed in BHK cells and its activity was compared to AFF-1 (
Example 5Identification and Characterization of New Members of the FF Family
[0144] FF proteins in nematodes were identified as described in (4). For the Chordate, Ctenophore and Arthropod sequences the BLAST search provided by the National Center for Biotechnology Information (NCBI) was used. For annotation, the Augustus gene prediction software with the training set for C. elegans was used. In some cases, the gene model was manually corrected based on the multiple sequence alignment (
TABLE-US-00004 TABLE 4 Sequence identifiers/Accession numbers Species Sequence Identifier/Accession number Caenorhabditis elegans CeAFF-1 (SEQ ID NO: 23) (WP: CE41369) CeEFF-1 (SEQ ID NO: 24) (WP: CE03028, WP: CE30881, WP: CE31159, WP: CE32594) C26D10.7 (CeEFF-2) (WP: CE36985) Caenorhabditis briggsae Cbr-aff-1 (CBP17138) Cbr-eff-1 (BP: CBP34546, BP: CBP37650) Caenorhabditis japonica CJA05978 (CJA05978/JA11265) CJA03218 (CJA03218/JA03456) Caenorhabditis ramanei Cre-aff-1 (RP: RP19336) Cre-eff-1 (RP: RP32670, RP: RP36929) Caenorhabditis brenneri Database: Caenorhabditis_ (CBN32067, CN35418, Database: Caenorhabditis_PB2801-4.0-contigs [Contig1645.2]) CBN17896 (CBN17896, CN30500, CN18501) Caenorhabditis sp5, 7, 9, 11 Cs5-AFF-1(Database: Caeno_sp5_DRD-2008_JU800_2.fna, contig2451) Cs5-EFF-1(Database: Caeno_sp5_DRD-2008_JU800_2.fna, contig6234) Database: Caeno_sp5_DRD-2008_JU800_1.fna [contig_262626] Database: Caeno_sp7_ju1286_454scaffolds_1.fna [scaffold00005] Database: Caeno_sp9_ju1422_454scaffolds_1.fna [scaffold00235, scaffold00002] Cs7/9-AFF-1 (Database: Caeno_sp7_ju1286_454scaffolds_1.fna scaffold00007; Database: Caeno_sp9_ju1422_454scaffolds_1.fna scaffold00001, scaffold00169) Cs7/9-EFF-1 (Database: Caeno_sp7_ju1286_454scaffolds_1.fna scaffold00005; Database: Caeno_sp9_ju1422_454scaffolds_1.fna scaffold00002) Cs7/9-EFF-1 (Database: Caeno_sp9_ju1422_454scaffolds_1.fna scaffold00235) Cs7/9-EFF-1 (Database: Caeno_sp9_ju1422_454scaffolds_1.fna scaffold00235) Cs11-FF (gi|319532004|gb|AEKS01003493.1|, Contig629.1546) Database: Caeno_sp11_JU1373_454scaffolds_1.fna [scaffold01488] Pristionchus pacificus Ppa-FF-1 (Database: PpaFreeze1.bases Contig235.2) Ppa-FF-2 (Database: PpaFreeze1.bases Contig162.2) Ppa- FF-3 (Database: PpaFreeze1.bases Contig735.1 + Contig735.2) Pristionchus entomophagus Pen-FF-1 (Database: Pristionchus_entomophagus-3.0.bases Contig1225.3) Pristionchus maupasi Pma-FF-1 (Database: p. maup genome Contig3990.1) Trichinella spiralis gi|162730680 (Tsp-ff-1) (gi|339236477|ref|XP_003379793.1) gi|339234943|ref|XP_003379026.1| gi|339234945|ref|XP_003379027.1| Trichinella pseudospiralis Tps-FF gi|149208398|gb|EF601568.1| (SEQ ID NO. Trichinella papuae Tpa-FF gi|149208399|gb|EF601569.1| Meloidogyne incognita Min-FF (gi|198718377|emb|CABB01003673.1| Meloidogyne incognita, whole genome shotgun sequence assembly, contig_3673, gi|19265127|gb|BM881383.1|BM881383 rb09d06.y1), gi|19265127| Meloidogyne arenaria Mar-FF (BI746953, rm34a12.y1) gi|15768755| Meloidogyne hapla Mha-FF (gi|207096946|gb|ABLG01001006.1| Meloidogyne hapla strain VW9 Mh10g200708_Contig1005, gi|207095745|gb|ABLG01002207.1| Meloidogyne hapla strain VW9 Mh10g200708_Contig2206) Globodera pallida Gpa-FF (gi|54548408|gb|CV578685.1|CV578685 kf14e11.y1) Gpa-FFA (Database: gpal.201011.contigs.fasta [Sanger] Contig 1004319) Gpa-FFB (Database: gpal.201011.contigs.fasta [Sanger] Contig 1004319) Ancylostoma caninum Aca-FF (gi|157997724|gb|EX544342.1|EX544342 AIAC-aaa88e02.g1) Aca-FF (gi|158000776|gb|EX547394.1|EX547394 AIAC-aaa14c06.g1) gi|157990577| Brugia Malayi Bma-FF-1 (gi|170576008|ref|XP_001893468.1| hypothetical protein Bm1_09975) gi|170582744|ref|XP_001896266.1| hypothetical protein Bm1_24045 gi|170576006|ref|XP_001893467.1| hypothetical protein Bm1_09970 gi|154234139|gb|AAQA01001677.1| Brugia malayi ctg_62087 gi|154209490|gb|AAQA01025369.1| Brugia malayi ctg_35248 gi|154234539|gb|AAQA01001277.1| Brugia malayi ctg_54442 Bm1_09970 + Bm1_09975 Bm1_24045 Haemonchus contortus Hco-FF (gi|27320801|gb|CA869252.1|CA869252 px01a04.y1) Hco-FF (Database: HAEM.contigs.fasta [Sanger] Contig 006057) Ascaris suum Asu-FF (gi|113050648|gb|ED245151.1|ED245151 AUAC-aag39g05.g1, gi|320312531|gb|AEUI01008540.1| Ascaris suum ASU_contig008540) gi|320301910|gb|AEUI01019161.1| Ascaris suum ASU_contig019161 gi|320309474|gb|AEUI01011597.1| Ascaris suum ASU_contig011597 gi|320297040|gb|AEUI01024031.1| Ascaris suum ASU_contig024031 Oscheius tipulae Oti-FF (Database: Oscheius_tipulae_clc3_1.fna, contig 5292) Oti-EFF-1 (Database: Oscheius_tipulae_clc3_1.fna, contig 4684) Database: Oscheius_tipulae_clc3_1.fna [Contig 4684, contig 5292] Dirofilaria immitis Dim-FF (Database: Dirofilaria_immitis_v1.3_Maker_Transcripts.fna, DimmContig4043_DIMM48125; Database: Dirofilaria_immitis_rnaseq_assembly_transabyss.v1.20110321.fna, k23_18675 1796 37333) Dim-FF (Database: Dirofilaria_immitis_rnaseq_assembly_transabyss.v1.20110321.fna, k27_51785 1538 23309, k31_119704 1392 19131) Database: Dirofilaria_immitis_clc_1.fna Howardula aoronymphium Hao-FF (Database: Howardula_aoronymphium_clc_1.fna, contig_147926) Hao-FF (Database: Howardula_aoronymphium_clc_1.fna, contig_103402) Database: Howardula_aoronymphium_clc_1.fna Litomosoides sigmodontis Lsi-FF-1 (Database: Litomosoides_sigmodontis_abyss_1.fna, 342875) Lsi-FF-2 (Database: Litomosoides_sigmodontis_abyss_1.fna, 344431, 332390) Database: Litomosoides_sigmodontis_abyss_1.fna Heterodera glycines Hgl-FF (gi|170569983|gb|ABLA01000927.1|) Romanomermis culicivorax contig05859, contig06497 (Kindly provided by W. Kelley Thomas) Trichuris muris Tmu-FF-1 (Database: T_muris_contigs.fasta [Sanger]; NODE_192365_length_12375_cov_11.496000) Tmu-FF-2 (Database: T_muris_contigs.fasta [Sanger]; NODE_99371_length_23257_cov_11.624845) Strongyloids ratti Sra-FF-1 (Database: RATTI.contigs.fasta [Sanger] Contig 75311) Sra-FF-2 (Database: RATTI.contigs.fasta [Sanger] Contig 74980) Sra-FF-3 (Database: RATTI.contigs.fasta [Sanger] Contig 75430) Database: S.ratti.reads Onchocerca volvulus Ovo-FF (Database: O_volvulus_all454_contigs.fna [Sanger], contig25914) Teladorsagia circumcincta Tci-FF (Database: T_circumcincta_reads.fasta [Sanger] Supercontig_0000831) Wuchereria bancrofti Wba-FF (gi|285840565|gb|ADBV01004176.1| cont1.4176) GI:285822425, GI:285835743 Loa loa Llo-FF (gi|285859024|gb|ADBU01000052.1| contig1.52) GI:285852521, GI:285851695 Branchiostoma floridae Bfl-FF-1 (Database: fgenesh2_pg.scaffold_465000022; Protein ID: 104514)jgi|Brafl1|104514|fgenesh2_pg.scaffold_465000022 (SEQ ID NO. 26) Bfl-FF-3 (Database: fgenesh2_pg.scaffold_46500002; Protein ID: 104513) jgi|Brafl1|104513|fgenesh2_pg.scaffold_465000021 Pleurobrachia pileus Ppi-FF (gi|167791107|gb|CU417832.1|CU417832) Calanus finmarchicus Cfi-FF (gi|190134016|gb|FG632618.1) Lepeophtheirus salmonis Lsa-FF (gi|293020530|gb|ADND01294772.1|) gi|293020530| Naegleria gruberi Ngr-FF-1 (gi|284087402|gb|EFC41072.1|) Ngr-FF-2 (gi|284087338|gb|EFC41008.1|) Ngr-FF-3 (gi|284083966|gb|EFC37664.1| NAEGRDRAFT_81886) Ngr-FF-4 (gi|284083965|gb|EFC37663.1| NAEGRDRAFT_81885) est's GI:168534442; GI:168542950 Bursaphelenchus xylophilus Bxy-FF-1 (gi|351002770|emb|CADV01009240.1) Bxy-FF-2 (gi|351002016|emb|CADV01009994.1| Caenorhabditis angaria Can-FF (gi|308940912|gb|AEHI01101512.1|, contigRNAPATHr2484_10) Heterorhabditis bacteriophora Hba-FF-1 (gi|343491313|gb|ACKM01000079.1|, Contig56.1) Hba-FF-2 (gi|343491313|gb|ACKM01000079.1|, Contig56.1) Romanomermis culicivorax Rcu-FF Heligmosomoides polygyrus Hpo-FF (Database: Heligmosomoides_polygyrus_clc_1.fna, contig_126399) Hpo-FF (Database: Heligmosomoides_polygyrus_clc_1.fna, contig_3 72600) Hpo-FF (Database: Heligmosomoides_polygyrus_clc_1.fna, contig 376900) Acrobeloides nanus Ana-FF-1 Ana-FF-2 Mnemiopsis leidyi Mle-FF-1A (gi|346671607|gb|AGCP01008927.1| c605800073.Contig1) Mle-FF-1B (gi|346671607|gb|AGCP01008927.1| c605800073.Contig1) Mle-FF-2 (gi|346671607|gb|AGCP01008927.1| c605800073.Contig1) Mel-FF-3 (gi|346680498|gb|AGCP01000036.1| c600000000.Contig54) Mel-FF-4 (gi|346673076|gb|AGCP01007458.1| c605700043.Contig1) Mel-FF-5 (gi|346661390|gb|AGCP01019144.1| c601500011.Contig6) Mel-FF-6 (gi|346674975|gb|AGCP01005559.1| c606400022.Contig1)
REFERENCES
[0145] 1. W. Wickner, R. Schekman, Nat Struct Mol Biol 15, 658 (July, 2008). REV. [0146] 2. S. Martens, H. T. McMahon, Nat Rev Mol Cell Biol 9, 543 (July, 2008). REV. [0147] 3. J. M. White, S. E. Delos, M. Brecher, K. Schomberg, Crit Rev Biochem Mol Biol 43, 189 (May-June, 2008). REV [0148] 4. A. Sapir, O. Avinoam, B. Podbilewicz, L. V. Chemomordik, Dev Cell 14, 11 (January, 2008). [0149] 5. M. Oren-Suissa, B. Podbilewicz, Trends Cell Biol 17, 537 (November, 2007). [0150] 6. E. H. Chen, E. Grote, W. Mohler, A. Vignery, FEBS Lett, (Mar. 21, 2007). [0151] 7. W. A. Mohler et al., Dev Cell 2, 355 (March, 2002). [0152] 8. G. Shemer et al., Curr Biol 14, 1587 (Sep. 7, 2004). [0153] 9. B. Podbilewicz et al., Dev Cell 11, 471 (2006). [0154] 10. A. Sapir et al., Dev Cell 12 683 (2007). [0155] 11. M. Oren-Suissa, D. H. Hall, M. Treinin, G. Shemer, B. Podbilewicz, Science 328, 1285 (June 4). [0156] 12. Hugot, J. P.; Baujard, P. & Morand, S. (2001): Biodiversity in helminths and nematodes as a field of study: an overview. Nematology 3: 199-208 [0157] 13. Parasitology textbook Chitwood, B. G., and Chitwood, M. B. H. (1974). Introduction to Nematology (Baltimore, University Park Press). [0158] 14. M. Kielian, F. A. Rey, Nature Rev. Microbiol. 4, 67 (2006). [0159] 15. H. Niwa, K. Yamamura, J. Miyazaki, Gene 108, 193 (1991). [0160] 16. C. Hu et al., Science 300, 1745 (2003). [0161] 17. K. Schomberg et al., J Virol 80, 4174 (2006). [0162] 18. Gottesman A., et. al., BioTechniques, Vol. 49, No. 4, 747-750 (2010) [0163] 19. Avinoam O. et. al., Science, 332, 589-92 (2011). [0164] 20. A. Takada et. al., Proc. Natl. Acad. Sci. USA, vol 94, pp. 14764-14769, (1997). [0165] 21. Koppen M, et. al., Nature Cell Biology Vol 3, pp. 983-991 (2001).