Adeno-associated virus (AAV) vector having hybrid HGF gene introduced thereto

Abstract

The present invention relates to an AAV vector carrying a predetermined hybrid HGF gene sequence. Use of the AAV vector of the present invention allows a hybrid HGF gene to be delivered to a subject at a high delivery yield.

Claims

1. An adeno-associated virus (AAV) vector, comprising a foreign nucleic acid sequence consisting of: (a) the nucleotide sequence set forth in SEQ ID NO: 5; or (b) a codon-modified nucleotide sequence having homology of at least 80% to the nucleotide sequence set forth in SEQ ID NO: 5, wherein said codon-modified nucleotide sequence encodes the same amino acid sequence as the coding region of the nucleotide sequence set forth in SEQ ID NO: 5.

2. An isolated recombinant cell transformed with the AAV vector of claim 1.

3. A composition comprising the AAV vector of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram showing a method for preparing downsized mutants of HGF-X7 from pCK-HGF-X7.

(2) FIG. 2 is a schematic diagram showing a method for cloning downsized mutants of HGF-X7 into pCA vectors.

(3) FIG. 3 is a graph showing the expression level of HGF protein in C2C12 cells infected with AAV-pCA-HGF-X7-d3 and AAV-pCA-HGF-X7-d4, respectively.

(4) FIG. 4 is a graph showing the expression level of HGF protein in C2C12 cells infected with AAV2-pCA-HGF-X7-d4 and AAV2-pCA-HGF-X8.

(5) FIG. 5 is a graph showing a delay of progression of disease after intramuscular injection of AAV6-pCA-HGF-X7-d4 in ALS mice.

(6) FIG. 6 is a graph showing the degree of improvement in survival rate after intramuscular injection of AAV6-pCA-HGF-X7-d4 in ALS mice.

(7) FIG. 7 is a graph showing the degree of slowdown in weight loss after intramuscular injection of AAV6-pCA-HGF-X7-d4 in ALS mice.

(8) FIG. 8 depicts graphs showing the results of survival rate investigation and behavioral test analysis after intrathecal administration of AAV1-pCA-HGF-X7-d4 in ALS mice.

DETAILED DESCRIPTION

(9) Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.

EXAMPLES

Test Example 1: Preparation of HGF-X7 Derivatives

(10) To construct an AAV vector expressing two isoforms of HGF, four derivatives were prepared from SEQ ID NO: 1 (pCK-HGF-X7) through site-directed mutagenesis. The detailed description of the method is as follows. First, PCR (site-directed mutagenesis kit, Stratagene, US) was performed using DNA of SEQ ID NO: 1 as a template. The primer sequences that were used are as follows.

(11) TABLE-US-00001 TABLE 1  d1 Forward  TCTCGGTATTTGTGGATCCTATTATGATCTT (SEQ ID NO: 8) TTGTGTAAA Reverse  TTTACACAAAAGATCATAATAGGATCCACAA (SEQ ID NO: 9) ATACCGAGA d2 Forward  TCTCGGTATTTGTGGATCCTTTACTATTATA (SEQ ID NO: 10) AACCAAAAC Reverse  GTTTTGGTTTATAATAGTAAAGGATCCACAA (SEQ ID NO: 11) ATACCGAGA d3 Forward  TCTCGGTATTTGTGGATCCTAAGGTGTAAGA (SEQ ID NO: 12) TGTTAAAGG Reverse  CCTTTAACATCTTACACCTTAGGATCCACAA (SEQ ID NO: 13) ATACCGAGA d4 Forward  TCTCGGTATTTGTGGATCCTTATAAGAAAAG (SEQ ID NO: 14) CAATAAACA Reverse  TGTTTATTGCTTTTCTTATAAGGATCCACAA (SEQ ID NO: 15) ATACCGAGA

(12) Out of the colonies obtained by delivering PCR products to C2Cl2 cells, colonies containing pCK-HGF-X7-d1, pCK-HGF-X7-d2, pCK-HGF-X7-d3, and pCK-HGF-X7-d4 were selected, and plasmid DNA was extracted therefrom (see FIG. 1).

Test Example 2: Construction of pCA-HGF-X7 Derivatives

(13) For the production of AAVs containing the four derivatives obtained in Test Example 1, theses derivatives were cloned into respective pCA vectors (AAV helper-free system, Agilent, USA). First, pCK-HGF-X7-d1, pCK-HGF-X7-d2, pCK-HGF-X7-d3, and pCK-HGF-X7-d4 in Test Example 1 were digested with ClaI and SalI restriction enzymes to give four types of fragments, HGF-X7-d1, HGF-X7-d2, HGF-X7-d3, and HGF-X7-d4. The pCA vectors were also digested with ClaI and SalI restriction enzymes, and then were subjected to ligation with the four types of fragments, HGF-X7-d1, HGF-X7-d2, HGF-X7-d3, and HGF-X7-d4, thereby constructing pCA-HGF-X7-d1, pCA-HGF-X7-d2, pCA-HGF-X7-d3, and pCA-HGF-X7-d4, respectively (see FIG. 2).

Test Example 3: Production of AAV-pCA-HGF-X7 Derivatives

(14) The respective plasmid DNAs constructed in Test Example 2 were used to produce AAVs. For the production of AAVs, 239T cells (ATCC) were prepared the day before and stabilized for 24 hours. The 293T cells were transfected with the plasmid DNAs constructed in Test Example 2, pHelper as DNA necessary for AAV production, and pAAV-RC (AAV helper-free system, Agilent, USA), and after three days, AAVs were collected. The titers of the collected AAVs were measured using a titration kit (AAVpro Titration Kit, Takara, JP). AAVs were produced using a total of four serotypes (AAV1, AAV2, AAV5, and AAV6).

Test Example 4: Verification of hHGF Expression or not of AAV-pCA-HGF-X7 Derivatives

(15) 4-1. Methods

(16) Out of the AAVs produced in Test Example 3, AAV2-pCA-HGF-X7-d3 and AAV2-pCA-HGF-X7-d4 were tested to investigate hHGF expression. First, C2C12 cells (ATCC) were plated at 8×104 cells/well in a 12-well plate, and the cells were stabilized for 24 hours. The C2C12 cells were respectively infected with equivalent titers of AAV2-pCA-HGF-X7-d3 and AAV2-pCA-HGF-X7-d4. The supernatant was collected two days after infection, and the amount of HGF protein was analyzed by performing HGF ELISA (R&D systems, US).

(17) 4-2. Results

(18) As a test result, it was confirmed that both AAV2-pCA-HGF-X7-d3 and AAV2-pCA-HGF-X7-d4 expressed the HGF protein. Especially, it was confirmed that the HGF expression level by AAV2-pCA-HGF-X7-d4 was higher than that by AAV2-pCA-HGF-X7-d3 (see FIG. 3).

Test Example 5: Comparison of hHGF Expression Between AAV-pCA-HGF-X7-d4 and AAV-pCA-HGF-X8

(19) 5-1. Methods

(20) AAV2-pCA-HGF-X7-d4 and AAV2-pCA-HGF-X8 were tested to compare the hHGF expression level as follows. First, C2C12 cells (ATCC) were plated at 8×10.sup.4 cells/well in a 12-well plate, and the cells were stabilized for 24 hours. The C2C12 cells were respectively infected with equivalent titers of AAV2-pCA-HGF-X7-d4 and AAV2-pCA-HGF-X8. The supernatant was collected two days after the infection, and the amount of HGF protein was analyzed by performing HGF ELISA (R&D systems, US).

(21) 5-2 Results

(22) As a test result, it was confirmed that both AAV2-pCA-HGF-X7-d4 and AAV2-pCA-HGF-X8 expressed HGF protein, but AAV2-pCA-HGF-X7-d4 showed a significantly higher HGF expression level by about 9-10 times when compared with AAV2-pCA-HGF-X8 (see FIG. 4).

Test Example 6: Effect of Intramuscular Injection of AAV-pCA-HGF-X7-d4 in ALS Mouse Models

(23) 6-1. Methods

(24) 6-1-1. Fabrication of ALS Mouse Models and Gene Delivery

(25) The widely used hSOD1-G93A models were used as ALS models. The models were obtained through crossbreeding of ALS mice (Jackson Laboratory, US), subjected to genotyping, and then examined for the presence or absence of Tg. Ten weeks after birth, the mice were organized into two groups (Tg-AAV6-MCS: 8 animals, Tg-AAV6-pCA-HGF-X7-d4: 7 animals). Non-Tg individuals were sorted out and used as negative control (non-Tg: 5 animals). The mice aged 90 days were administered with AAV at 1×10.sup.8 GC/site via the thigh muscle, anterior tibial muscle, and gastrocnemius muscle. A total of 3×10.sup.8 GC/head was administered.

(26) 6-1-2. Measurement of Disease Progression Rate, Survival Rate, and Weight

(27) For the evaluation of efficacy, the disease progression rate and the weight were determined, and whether or not the individuals survived was observed. ALS disease eventually causes death according to the progression of the disease, and thus the above three indicators are representative analysis criteria that are widely used in ALS animal tests. The disease progression rate was measured according to the following standards and numerically expressed.

(28) Symptom Score

(29) 5 points: normal

(30) 4 points: lower body balance was maintained for 1-2 seconds when mouse tail was grasped.

(31) 3 points: lower body balance was maintained for less than 1 second when mouse tail was caught, but walking was normal

(32) 2 points: lower body balance was not maintained with legs dragging

(33) 1 point: lower body balance was not maintained, walking on tops of feet.

(34) 0 points: Death

(35) 6-2 Results

(36) It was confirmed that the disease worsened over time in ALS mice (AAV6-MCS administration group). However, it was confirmed that the progression of the disease was delayed by the administration of AAV6-pCA-HGF-X7-d4. When the progression of the disease was numerically expressed, ALS mice had an average symptom score of 2.36 throughout the test period, whereas the group administered with AAV6-pCA-HGF-X7-d4 showed an average symptom score of 2.88, indicating a higher value than that for the ALS mice (AAV6-MCS administration group) (see FIG. 5).

(37) It was also confirmed that the administration of AAV6-pCA-HGF-X7-d4 led to a notable improvement effect in survival rate. With regard thereto, the group administered with AAV6-MCS survived an average of 139 days after birth, whereas the group administered with AAV6-pCA-HGF-X7-d4 survived an average of 147 days, indicating an increase of about 8 days (see FIG. 6).

(38) It was lastly confirmed that ALS mice (AAV6-MCS) had a noticeable increase in weight loss due to muscle loss, but the administration of AAV6-pCA-HGF-X7-d4 slowed weight loss. That is, it was confirmed through a relative comparison of weight that the ALS mice had an average weight change of about 34% from the time of administration to the end of the test, but administration of AAV6-pCA-HGF-X7-d4 showed an average weight change of 22%, indicating slower weight loss (see FIG. 7).

Test Example 7: Effect of Intrathecal Administration of AAV-pCA-HGF-X7-d4 in ALS Mouse Models

(39) 7-1. Methods

(40) 7-1-1. Fabrication of ALS Mouse Models and Gene Delivery

(41) The widely used hSOD1-G93A models were used as ALS models. The models were obtained through crossbreeding of ALS mice (Jackson Laboratory, US), subjected to genotyping, and then examined for the presence or absence of Tg. Individuals retaining a predetermined level of mutant gene were selected and used in the test. Non-Tg individuals were used as a negative control (13 animals). The Tg individuals were organized into a Tg-AAV1-MCS group and a Tg-AAV1-pCA-HGF-X7-d4 group, containing 14 and 16 animals, respectively. At 60 days of age, the mice were intrathecally administered once with AAV at 5×109 GC/site.

(42) 7-1-2. Survival Rate Investigation and Behavioral Test Analysis

(43) For a detailed examination of efficacy, a survival rate, one of the most important indicators in ALS, was investigated, and for the examination of individual motor ability in ALS disease-afflicted individuals, rotarod and hanging-wire tests were carried out. In addition, for the examination of muscular function strength, grip strength was measured.

(44) The survival rate was investigated by checking the survival or death of the individuals every day. As for the rotarod test, an acceleration method was used, in which a mouse was placed on a rotating rod and then the time was measured for how long the mouse spent on the rotating rod, and especially, the speed of the rotating rod was accelerated over time.

(45) As for the hanging-wire test, a mouse was placed on a structure with a lattice pattern, and then the structure was inverted, and the time that the individual spent hanging on to the structure upside down was measured.

(46) As for the grip strength test, the front and back feet of a mouse were placed on a strength measuring device, and then the muscular strength was measured.

(47) Data are expressed as mean±SEM, and statistical analysis for each data set was performed using one-way ANOVA for each time, followed by Tukey post-hoc test (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

(48) 7-2 Results

(49) It was confirmed that a treatment effect was observed in the intrathecal administration of AAV1-pCA-HGF-X7-d4. First, as a result of survival investigation, the AAV1-pCA-HGF-X7-d4 administration group showed a significant survival increase compared with the AAV1-MCS administration group. It was confirmed that the mice had an average lifespan of 144 days when administered with AAV1-MCS, whereas individuals administered with AAV1-pCA-HGF-X7-d4 showed an average lifespan of 160 days, indicating an increase of about 16 days.

(50) Motor ability was observed to be actually enhanced. In the rotarod test, the negative control remained on the rotarod for an average of 226 seconds, whereas the time was significantly decreased to 112 seconds in the Tg-AAV1-MCS group. However, the time was improved to an average of 151 seconds for the test group administered with AAV1-pCA-HGF-X7-d4. Similar treatment effects were also observed in the hanging-wire and grip strength tests. In particular, at the last stage of disease progression (on day 137 after birth), the time spent hanging from the wire was about 31 seconds in the AAV1-pCA-HGF-X7-d4 administration group, indicating a great increase compared with about 7 seconds in the AAV1-MCS administration group. Also in the grip strength measurement results, the AAV1-MCS administration group showed a strength of approximately 28 g, but the strength was significantly increased to 66 g in the pCA-HGF-X7-d4 administration group (see FIG. 8).

(51) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e).