Microorganism modified for the production of 1,3-propanediol
09605283 · 2017-03-28
Assignee
Inventors
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12Y401/01072
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12Y101/01202
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to a modified microorganism for the production of PDO from a carbon substrate wherein the microorganism includes a three-step metabolic pathway including a first step of conversion of 2,4-dihydroxybutyrate (DHB) to obtain 2-oxo-4-hydroxybutyrate (OHB) by an enzyme having 2,4-DHB dehydrogenase activity, a second step of decarboxylation of the OHB to obtain 3-hydroxypropionaldehyde by an enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity, and a third step of reduction of the obtained 3-hydroxypropionaldehyde to obtain PDO with an enzyme having 3-hydroxypropionaldehyde reductase activity and the genes enabling the microorganism for the synthesis of DHB.
Claims
1. A modified microorganism for producing 1,3-propanediol (PDO) from a carbon substrate, the microorganism comprising: a pathway for synthesis of 2,4-dihydroxybutyrate (DHB); and a three-step metabolic pathway comprising: conversion of DHB to obtain 2-oxo-4-hydroxybutyrate (OHB) by an enzyme having 2,4-DHB dehydrogenase activity, decarboxylation of the OHB to obtain 3-hydroxypropionaldehyde by an enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity, and reduction of the obtained 3-hydroxypropionaldehyde to obtain PDO with an enzyme having 3-hydroxypropionaldehyde reductase activity, wherein the modified microorganism has been transformed by the introduction of at least three genes respectively encoding the enzyme having DHB dehydrogenase activity, the enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity, and the enzyme having 3-hydroxypropionaldehyde reductase activity.
2. The modified microorganism of claim 1, wherein the pathway for the synthesis of DHB is from malate.
3. The modified microorganism according to claim 2, wherein the microorganism has been further modified by the introduction of genes encoding: a malate kinase catalyzing the transformation of malate into 4-phospho-malate, a malate semialdehyde dehydrogenase catalyzing the transformation of 4-phospho-malate into malate-4-semialdehyde, and a malate semialdehyde reductase catalyzing the transformation of malate-4-semialdehyde into 2,4-DHB.
4. The modified microorganism of claim 1, wherein the enzymes are encoded by an endogenous or a heterologous gene.
5. The modified microorganism of claim 1, wherein the enzyme having 2,4-DHB dehydrogenase activity is an enzyme having lactate dehydrogenase or malate dehydrogenase activity.
6. The modified microorganism of claim 1, wherein the enzyme having 2,4-DHB dehydrogenase activity is obtained by at least one mutation of an enzyme, said mutation improving activity and/or substrate affinity of the enzyme for DHB.
7. The modified microorganism of claim 5, wherein the enzyme having 2,4-DHB dehydrogenase activity is a gene product encoded by a gene selected from the group consisting of IdhA from Lactococcus lactis, lldD from Escherichia coli, lldD from E. coli carrying a mutation at position Val108 (by reference to SEQ ID No. 122), mdh from E. coli, mdh from Bacillus subtilis, and mdh from E. coli carrying a mutation in at least one position selected from the group consisting of (by reference to SEQ ID No. 124): Ile12, Arg81, Lys82, Met85, Asp86, Val93, Ile117, Gly179, Thr211, and Met227 (by reference to SEQ ID No.126).
8. The modified microorganism of claim 7, wherein the enzyme having 2,4-DHB dehydrogenase activity is: encoded by a polynucleotide having the sequence of SEQ ID No. 119, SEQ ID No. 121, SEQ ID No. 153, SEQ ID No. 155, SEQ ID No. 157, SEQ ID No. 159, SEQ ID No. 161, SEQ ID No. 163, SEQ ID No. 165, SEQ ID No. 167, SEQ ID No. 169, SEQ ID No. 171, SEQ ID No. 173, or any sequence sharing a homology of at least 50% with the sequence of SEQ ID No. 119, SEQ ID No. 121, SEQ ID No. 153, SEQ ID No. 155, SEQ ID No. 157, SEQ ID No. 159, SEQ ID No. 161, SEQ ID No. 163, SEQ ID No. 165, SEQ ID No. 167, SEQ ID No. 169, SEQ ID No. 171, or SEQ ID No. 173, and/or a polypeptide having the sequence of SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 154, SEQ ID No. 156, SEQ ID No. 158, SEQ ID No. 160, SEQ ID No. 162, SEQ ID No. 164, SEQ ID No. 166, SEQ ID No. 168, SEQ ID No. 170, SEQ ID No. 172, SEQ ID No. 174, or any sequence sharing a homology of at least 50% with the sequence of SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 154, SEQ ID No. 156, SEQ ID No. 158, SEQ ID No. 160, SEQ ID No. 162, SEQ ID No. 164, SEQ ID No. 166, SEQ ID No. 168, SEQ ID No. 170, SEQ ID No. 172, or SEQ ID No. 174.
9. The modified microorganism of claim 1, wherein the enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity is an enzyme having a 2-keto acid decarboxylase activity.
10. The modified microorganism of claim 1, wherein the enzyme having 4-hydroxybutyrate decarboxylase activity is obtained by at least one mutation of an enzyme, said mutation improving activity and/or substrate affinity of the enzyme for OHB.
11. The modified microorganism of claim 9, wherein the enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity is a gene product encoded by a gene selected from the group consisting of PDC1, PDC5, PDC6, ARO10, and THI3 genes from Saccharomyces cerevisiae; kivD and kdcA genes from Lactococcus lactis; pdc gene from Clostridium acetobutylicum; PDC2 and PDC3 genes from Arabidopsis thaliana; PDC1, PDC2, and ARO10 genes from Pichia stipitis; pdc gene from Zymomonas mobilis; sucA gene from Escherichia coli; dxs gene from Escherichia coli; pdc gene from Z. mobilis carrying a mutation in at least one position selected from the group consisting of: Tyr290, Trp392, Gly413, and Ile476 (by reference to SEQ ID No.128); and kdcA gene from L. lactis carrying a mutation in at least one position selected from the group consisting of: Gln377, Phe381, Phe382, Gly402 Val461, Ile465, and Phe542 (by reference to SEQ ID No.130).
12. The modified microorganism of claim 11, wherein the enzyme having 4-hydroxybutyrate decarboxylase activity is encoded by a polynucleotide having the sequence of SEQ ID No. 129, SEQ ID No. 127, SEQ ID No. 207, SEQ ID No. 189, SEQ ID No. 191, SEQ ID No. 193, SEQ ID No. 195, SEQ ID No. 197, or any sequence sharing a homology of at least 50% with the sequence of SEQ ID No. 129, SEQ ID No. 127, SEQ ID No. 207, SEQ ID No. 189, SEQ ID No. 191, SEQ ID No. 193, SEQ ID No. 195, or SEQ ID No. 197, and/or a polypeptide having the sequence of SEQ ID No. 130, SEQ ID No. 128, SEQ ID No. 208, SEQ ID No. 190, SEQ ID No. 192, SEQ ID No. 194, SEQ ID No. 196, SEQ ID No. 198, or any sequence sharing a homology of at least 50% with the sequence of SEQ ID No. 130, SEQ ID No. 128, SEQ ID No. 208, SEQ ID No. 190, SEQ ID No. 192, SEQ ID No. 194, SEQ ID No. 196, or SEQ ID No. 198.
13. The modified microorganism of claim 1, wherein the enzyme having 3-hydroxypropionaldehyde reductase activity is an enzyme having hydroxyaldehyde reductase activity, alcohol dehydrogenase activity, lactaldehyde reductase activity, or methylglyoxal reductase activity.
14. The modified microorganism of claim 13, wherein the enzyme having 3-hydroxypropionaldehyde reductase activity is: a gene product encoded by a gene selected from the group consisting of yqhD, fucO, dkgA, and dkgB genes from Escherichia coli, dhaT gene from K. pneumoniae, and ADH1 and ADH2 genes from Saccharomyces cerevisiae, or an enzyme having 3-hydroxypropionaldehyde reductase activity obtained by at least one mutation of an enzyme, said mutation improving activity and/or substrate affinity of the enzyme for 3-hydroxypropionaldehyde.
15. The modified microorganism according to claim 1, wherein the production of PDO is enhanced.
16. The modified microorganism according to claim 1, wherein the 2,4-dihydroxybutyrate dehydrogenase, 2-oxo-4-hydroxybutyrate decarboxylase, and/or 3-hydroxypropionaldehyde reductase activities, and/or enzymatic activities allowing the synthesis of DHB are enhanced.
17. The modified microorganism of claim 1, being a bacterium, a yeast, or a fungus.
18. The modified microorganism of claim 1, wherein the expression of: at least one enzymatic activity selected from the group consisting of phosphoenolpyruvate carboxylase, phosphoenol pyruvate carboxykinase, isocitrate lyase, pyruvate carboxylase, and hexose symporter permease is increased, and/or at least one enzymatic activity selected from the group consisting of lactate dehydrogenase, alcohol dehydrogenase, acetate kinase, phosphate acetyltransferase, pyruvate oxidase, isocitrate lyase, fumarase, 2-oxoglutarate dehydrogenase, pyruvate kinase, malic enzyme, phosphoglucose isomerase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, pyruvate-formate lyase, succinic semialdehyde dehydrogenase, sugar-transporting phosphotransferase, ketohydroxyglutarate aldolase, homoserine-O-succinyl transferase, homoserine kinase, diaminopimelate decarboxylase, and methylglyoxal synthase is decreased.
19. The modified microorganism according to claim 17, wherein the modified microorganism is Escherichia coli that: overexpresses at least one gene selected from the group consisting of ppc, pck, aceA, galP, asd, thrA, metL, and lysC from E. coli, and pycA from L. lactis, and/or has at least one deleted gene selected from the group consisting of IdhA, adhE, ackA, pta, poxB, focA, pfIB, sad, gabABC, sfcA, maeB, ppc, pykA, pykF, mgsA, sucAB, ptsl, ptsG, pgi, fumABC, aldA, lldD, icIR, metA, thrB, lysA, and eda.
20. A method of production of PDO comprising: contacting the modified microorganism of claim 1 with a carbon substrate in an appropriate culture medium, and recovering PDO from the culture medium.
21. The method of claim 20, wherein the PDO is further purified.
22. A modified microorganism for producing 1,3-propanediol (PDO) from a carbon substrate, the microorganism comprising: a pathway for synthesis of 2,4-dihydroxybutyrate (DHB); and a three-step metabolic pathway comprising: conversion of DHB to obtain 2-oxo-4-hydroxybutyrate (OHB) by an enzyme having DHB dehydrogenase activity, decarboxylation of the OHB to obtain 3-hydroxypropionaldehyde by an enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity, and reduction of the obtained 3-hydroxypropionaldehyde to obtain PDO with an enzyme having 3-hydroxypropionaldehyde reductase activity, wherein: the gene encoding the enzyme having DHB dehydrogenase activity is selected from the group consisting of IdhA from Lactococcus lactis, lldD from Escherichia coli, lldD from E. coli carrying a mutation at position Val108 (by reference to SEQ ID No. 122), mdh from E. coli, mdh from Bacillus subtilis, and mdh from E. coli carrying a mutation in at least one position selected from the group consisting of (by reference to SEQ ID No. 124): Ile12, Arg81, Lys82, Met85, Asp86, Val93, Ile117, Gly179, Thr211, and Met227 (by reference to SEQ ID No.126); the gene encoding the enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity is selected from the group consisting of PDC1, PDC5, PDC6, ARO10, and THIS genes from Saccharomyces cerevisiae; kivD and kdcA genes from Lactococcus lactis; pdc gene from Clostridium acetobutylicum; PDC2 and PDC3 genes from Arabidopsis thaliana; PDC1, PDC2, and ARO10 genes from Pichia stipitis; pdc gene from Zymomonas mobilis; sucA gene from Escherichia coli; dxs gene from Escherichia coli; pdc gene from Z. mobilis carrying a mutation in at least one position selected from the group consisting of: Tyr290, Trp392, Gly413, and Ile476 (by reference to SEQ ID No.128); and kdcA gene from L. lactis carrying a mutation in at least one position selected from the group consisting of: Gln377, Phe381, Phe382, Gly402 Val461, Ile465, and Phe542 (by reference to SEQ ID No.130); and the enzyme having 3-hydroxypropionaldehyde reductase activity is: a gene product encoded by a gene selected from the group consisting of yqhD, fucO, dkgA, and dkgB genes from Escherichia coli, dhaT gene from K. pneumoniae, and ADH1 and ADH2 genes from Saccharomyces cerevisiae, or an enzyme having 3-hydroxypropionaldehyde reductase activity obtained by at least one mutation of an enzyme, said mutation improving activity and/or substrate affinity of the enzyme for 3-hydroxypropionaldehyde.
23. The method according to claim 22, wherein: the enzyme having DHB dehydrogenase activity is Ec-Mdh R81A; the enzyme having 2-oxo-4-hydroxybutyrate decarboxylase activity is Zm-Pdc; and the enzyme having 3-hydroxypropionaldehyde reductase activity is Ec-YqhD.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1)
(2)
(3)
(4)
EXAMPLES
Example 1
Demonstration of 2,4-dihydroxybutyrate Dehydrogenase Activity
(5) Construction of Plasmids Containing Wild-Type Genes Coding for Candidate DHB Dehydrogenase Enzymes:
(6) The genes coding for (L)-lactate dehydrogenase of Lactococcus lactis, IdhA, (L)-malate dehydrogenase of Escherichia coli, mdh, (L)-malate dehydrogenase of Bacillus subtilis, mdh, and for the membrane associated (L)-lactate dehydrogenase of E. coli, lldD, were amplified by PCR using the high-fidelity polymerase Phusion (Fermentas) and the primers listed in Table 1. Genomic DNAs of E. coli MG1655, L. Lactis IL1403, and B. subtilis strain 168 were used as the template. The primers introduced restriction sites (Table 1) upstream of the start codon and downstream of the stop codon, respectively, facilitating the ligation of the digested PCR products into the corresponding sites of the pET28a+ (Novagen) expression vector using T4 DNA ligase (Fermentas). Ligation products were transformed into E. coli DH5 cells. The resulting pET28-Ec-mdh, pET28-Ll-ldh, pET28-Bs-mdh, and pET28-Ec-lldD plasmids were isolated and shown by DNA sequencing to contain the correct full-length sequence of the E. coli mdh (SEQ ID No. 123), L. lactis IdhA (SEQ ID No. 119), B. subtilis mdh (SEQ ID No. 125), and E. coli lldD (SEQ ID No. 121) genes, respectively. The corresponding protein sequences are represented by SEQ ID No. 124, SEQ ID No. 120, SEQ ID No. 126 and SEQ ID No. 122, respectively.
(7) TABLE-US-00001 TABLE1 Primersequencesandrestrictionsitesusedfor amplificationandcloningofcandidateenzymes Re- Forwardandreverse striction Gene primersequence5-3 sites Ec-mdh TATAATCATATGAAAGTCGCAGTCCTC NdeI (SEQIDNo.131) TATAATGGATCCTTACTTATTAACGAA BamHI CTC(SEQIDNo.132) Ll-IdhA TATAATCATATGGCTGATAAACAACGT NdeI AAAAAA(SEQIDNo.133) TATAATGGATCCTTAGTTTTTAACTGC BamHI AGAAGCAAA(SEQIDNo.134) Bs_mdh CATATGGGAAATACTCGTAAAAAAGTT Nde1 (SEQIDNo.135) GGATCCTTAGGATAATACTTTCATGAC BamH1 (SEQIDNo.136) Ec-lldD CATATGATTATTTCCGCAGCCAGC Nde1 (SEQIDNo.137) AGATCTCTATGCCGCATTCCCTTTC BgI2 (SEQIDNo.138)
(8) Expression of Enzymes:
(9) E. coli BL21 (DE3) star cells were transformed with the appropriate plasmids using standard genetic protocols (Sambrook, Fritsch, & Maniatis, 1989). Enzymes with an N-terminal hexa-His tag were expressed in 50 mL LB cultures that were inoculated from an overnight culture at OD.sub.600 of 0.1 and grown to OD.sub.600 of 0.6 before protein expression was induced by addition of 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) to the culture medium. After 3 h of protein expression, cells were harvested by centrifugation at 4000 g at 4 C. for 10 min and discarding the supernatant. Cell pellets were stored at 20 C. until further analysis. Growth and protein expression were carried out at 37 C. Culture media contained 50 g/mL kanamycin.
(10) Purification of Enzymes:
(11) Frozen cell pellets of expression cultures were resuspended in 0.5 mL of breakage buffer (50 mM Hepes, 300 mM NaCl, pH 7.5) and broken open by four successive rounds of sonication (sonication interval: 20 s, power output: 30%, sonicator: Bioblock Scientific, VibraCell 72437). Cell debris was removed by centrifuging the crude extracts for 15 min at 4 C. at 4000 g and retaining the clear supernatant. RNA and DNA were removed from the extracts by adding 15 mg/mL streptomycin sulfate (Sigma), centrifuging the samples at 13000 g for 10 min at 4 C. and retaining the supernatant. Clear protein extract was incubated for 1 h at 4 C. with 0.75 mL (bed volume) of Talon Cobalt affinity resin (Clontech). The suspension was centrifuged at 700 g in a table top centrifuge and supernatant was removed. The resin was washed with 10 bed volumes of wash buffer (50 mM Hepes, 300 mM NaCl, 15 mM Imidazole, pH 7.5) before proteins were eluted with 0.5 mL of elution buffer (50 mM Hepes, 300 mM NaCl, 250 mM Imidazole, pH 7.5). Purity of eluted enzymes was verified by SDS-PAGE analysis. Protein concentrations were estimated with the method of Bradford (Sambrook, Fritsch, & Maniatis, 1989). To stabilize the lactate dehydrogenase of L. lactis, the elution buffer was systematically exchanged by 100 mM phosphate buffer adjusted to pH 7. The protein sample was transferred to an Amicon Ultra centrifugal filter (cut-off 10 kDa), and centrifuged during 8 min at 4000 g at 4 C. to remove the buffer. The protein was re-diluted into phosphate buffer and the procedure was repeated 4 times.
(12) Enzymatic Assay:
(13) Activity of the cytosolic DHB dehydrogenases (Ec-Mdh, Bs-Mdh, Ll-LdhA) was assayed by following the DHB-dependent reduction of NAD.sup.+.
(L)-2,4-dihydroxybutyrate+NAD.sup.+.fwdarw.2-oxo-4-hydroxybutyrate+NADHReaction Scheme 1:
(14) The reaction mixture contained 60 mM Hepes (pH 8), 50 mM potassium chloride, 5 mM MgCl.sub.2, 10 mM NAD, (optionally, 5 mM fructose-1,6-bisphosphate (F16bP)) (all products from Sigma), and appropriate amounts of purified enzyme or cell extract. Reactions were started by adding 50 mM (L)-2,4-dihydroxybutyrate (Rhodia).
(15) Activity of the membrane-associated DHB dehydrogenase (Ec-LldD) was assayed by following the DHB-dependent reduction of 2,6-dichloroindophenol (DCIP).
(L)-2,4-dihydroxybutyrate+DCIP.sub.ox.fwdarw.2-oxo-4-hydroxybutyrate+DCIP.sub.redReaction scheme 2:
(16) The reaction mixture contained 60 mM Hepes (pH 7), 50 mM potassium chloride, 5 mM MgCl.sub.2, 0.06 mM DCIP (all products from Sigma), and appropriate amounts of purified enzyme or cell extract. Reactions were started by adding 20 mM (L)-2,4-dihydroxybutyrate (Rhodia).
(17) All enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADH at 340 nm (.sub.NADH=6.22 mM.sup.1 cm.sup.1) or the absorbtion of DCIP at 655 nm (.sub.DCIP=5.9 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).
(18) Results:
(19) The results of the enzymatic measurements are summarized in Table 2. It was shown that Ec-Mdh and Bs-Mdh have no measurable DHB dehydrogenase activity. Both the cytosolic and membrane-associated lactate dehydrogenases Ll-LdhA and Ec-LldD, respectively, have DHB dehydrogenase activity.
(20) TABLE-US-00002 TABLE 2 Summary of kinetic parameters of selected candidate enzymes on their natural substrate and DHB Max. specific activity Substrate affinity, Km [mol/(mg min)] [mM] Natural Natural Enzyme substrate.sup.a DHB.sup.b substrate.sup.a DHB Ec-Mdh 52.5 0 0.56 nd Bs-Mdh 10.5 0 2.6 nd Ll-LdhA 8.8 1 21.2 ns Ec-LldD 6.22 0.37 0.13 1.31 .sup.aNatural substrates for malate dehydrogenases and lactate dehydrogenases are (L)-malate and (L)-lactate, respectively .sup.bWhen enzymes could not be saturated, maximum specific activity refers to the activity estimated at 50 mM substrate concentration nsnot saturated ndnot determined
Example 2
Construction of Malate Dehydrogenase Enzymes with Improved DHB Dehydrogenase Activity
(21) Site-directed mutagenesis of the E. coli mdh and the B. subtilis mdh genes were carried out using the oligonucleotide pairs listed in Table 3 and the pET28-Ec-mdh and the pET28-Bs-mdh plasmids as the templates. Point mutations to change the amino acid sequence were introduced by PCR (Phusion 1U, HF buffer 20% (v/v), dNTPs 0.2 mM, direct and reverse primers 0.04 M each, template plasmid 50 ng, water) using the oligonucleotide pairs listed in Table 3. Mutated genes contained a new restriction site listed in Table 3 (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into competent E. coli DH5-alpha cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.
(22) TABLE-US-00003 TABLE3 Oligonucleotidesusedtomutatemalate dehydrogenasemdhfromE.coliandmdh fromB.subtilis.(nnkdenotesadegenerated codonwithkrepresentingeither thymineorcytosine) Restr. Protein Mutation Primersequences5-3 site Bs-Mdh R87A TTACAGCCGGTATCGCAGCAAA Sma1 ACCCGGGATGAGCAGAGAT (SEQIDNo.139) ATCTCTGCTCATCCCGGGTTTT GCTGCGATACCGGCTGTAA (SEQIDNo.140) Ec-Mdh R81nnk TTATCTCTGCAGGCGTAGCGNN Sma1 KAAACCCGGGATGGATCGTTC (SEQIDNo.141) GAACGATCCATCCCGGGTTTMN NCGCTACGCCTGCAGAGATAA (SEQIDNo.142) Ec-Mdh R81AM85E TTATCTCTGCAGGCGTAGCGGC no TAAACCGGGTGAGGATCGTTCC Sma1 GACCTG(SEQIDNo.143) CAGGTCGGAACGATCCTCACCC GGTTTAGCCGCTACGCCTGCAG AGATAA(SEQIDNo.144) Ec-Mdh R81AM85Q TTATCTCTGCAGGCGTAGCGGC no TAAACCGGGTCAGGATCGTTCC Sma1 GACCTG(SEQIDNo.145) CAGGTCGGAACGATCCTGACCC GGTTTAGCCGCTACGCCTGCAG AGATAA(SEQIDNo.146). Ec-Mdh I12V GTCGCAGTCCTCGGCGCCGCTG Nar1 GCGGTGTCGGCCAGGCGCTTGC AC(SEQIDNo.147) GTGCAAGCGCCTGGCCGACACC GCCAGCGGCGCCGAGGACTGCG AC(SEQIDNo.148) Ec-Mdh G179D CCGGTTATTGGCGGCCAC Eae1 TCTGATGTTACCATTCTG CCGCTGCTG (SEQIDNo.149) CAGCAGCGGCAGAATGGTAACAT CAGAGTGGCCGCCAATAACCGG (SEQIDNo.150) Ec-Mdh R81AD86S GGCGTAGCGGCTAAACCGGGTAT no GTCTCGTTCCGACCTG Sma1 (SEQIDNo.151) CAGGTCGGAACGAGACATACCCG GTTTAGCCGCTACGCC (SEQIDNo.152)
(23) Mutant enzymes were expressed, purified and tested for DHB dehydrogenase activity as described in Example 1.
(24) The activities on DHB and malate obtained upon mutating Arg81 in Ec-Mdh are summarized in
(25) The mutation R81A in Ec-Mdh (by reference to SEQ ID No. 124) was combined with additional changes in the protein sequence. The results are listed in Table 4. It can be demonstrated that the introduction of mutation M85Q, M85E, I12V, G179D, and/or D86S in addition to mutation R81A results in a further increased activity on DHB.
(26) TABLE-US-00004 TABLE 4 Summary of kinetic parameters of malate dehydrogenase mutants from E. coli and B. subtilis on malate and DHB Max. specific activity Km Mutant [mol/(mg min)] [mM] Enzyme Seq ID malate.sup.a DHB.sup.b malate DHB Bs-MdhR87C SEQ ID No. 0.13 0.06 6.8 5.4 154 Ec-MdhR81A SEQ ID No. 0.12 0.3 0.7 33 156 Ec-MdhR81A SEQ ID No. 0.57 2.98 2.2 29 M85Q 158 Ec-MdhR81A SEQ ID No 0.65 2.38 8.6 48 M85E 160 Ec-MdhR81A SEQ ID No. 0.66 2.5 8.5 ns I12V 162 Ec-MdhR81A SEQ ID No. 0.98 7.1 12.5 19 M85Q I12V 164 Ec-MdhR81A SEQ ID No. 0.91 10.3 11.2 20 M85E I12V 166 Ec-MdhR81A SEQ ID No. 0.52 2.1 nd ns G179D 168 Ec-MdhR81A SEQ ID No. 0.42 0.79 10.3 28 D86S 170 Ec-MdhR81A SEQ ID No 0.64 2.51 4 25 D865 G179D 172 .sup.aactivity was measured at 50 mM malate .sup.bactivity was measured at 50 mM DHB nsnot saturated at concentrations of up to 100 mM
Example 3
Construction of (L)-Lactate Dehydrogenase Enzymes with Improved DHB Dehydrogenase Activity
(27) Site-directed mutagenesis of the E. coli lldD gene was carried out using the oligonucleotide pairs listed in Table 5 and the pET28-Ec-lldD plasmid as the template.
(28) TABLE-US-00005 Table5 Oligonucleotidesusedtomutate (L)-lactatedehydrogenase IIdDfromE.coli. Primersequences Restriction Protein Mutation 5-3 site Ec-LldD V108C TTCCGTTTACTCTGTC HinCII GACGTGTTCCGTTTGC CCGA (SEQIDNO.173) TCGGGCAAACGGAACC CGTCGACAGAGTAAAC GGAA (SEQIDNO.174)
(29) Mutant enzymes were expressed, purified and tested for DHB dehydrogenase and lactate dehydrogenase activity as described in Example 1. The results of the enzymatic measurements are summarized in Table 6. It was demonstrated that replacement of Val108 by cysteine changes the specificity of the enzyme in favour of DHB.
(30) TABLE-US-00006 TABLE 6 Summary of kinetic parameters of E. coli lactate dehydrogenase, LldD, mutants on lactate and DHB Max. specific activity Km Mutant [mol/(mg min)] [mM] Enzyme Seq ID lactate DHB lactate DHB Specificity.sup.a Wild- SEQ ID 6.22 0.37 0.13 1.31 0.006 type No. 122 V108C SEQ ID 0.55 0.24 0.42 0.85 0.21 No. 174 .sup.aSpecificity is expressed as (Vmax/Km).sub.DHB/(Vmax/Km).sub.nat. substrate
Example 4
Demonstration of 2-Oxo-4-Hydroxybutyrate Decarboxylase Activity
(31) The branched-chain alpha-ketoacid decarboxylase encoding gene Ll-kdcA from L. lactis B1157-NIZO was codon-optimized for expression in E. coli. The whole optimized coding sequence flanked with NheI and EcoRI restriction sites upstream of the start codon and downstream of the stop codon respectively was synthesized by Eurofins MWG and cloned into the corresponding sites of pET28a+ (Novagen) in frame with a N-terminal hexa-His tag. The resulting pET28-Ll-kdcA plasmid was shown by DNA sequencing to have the correct sequence.
(32) The pyruvate decarboxylases of Saccharomyces cerevisiae, Sc-PDC1 and of Zymomonas mobilis, Zm-PDC, were amplified by PCR using the high-fidelity polymerase Phusion (Fermentas) and the primers listed in Table 7. Genomic DNAs of S. cerevisiae BY4741, and Z. mobilis (Lindner) Kluyver and van Niel (ATCC 31821) were used as the template. The primers introduced restriction sites (Table 7) upstream of the start codon and downstream of the stop codon, respectively, facilitating the ligation of the digested PCR products into the corresponding sites of the pET28a+ (Novagen) expression vector using T4 DNA ligase (Fermentas). Ligation products were transformed into competent E. coli DH5 cells (NEB). The resulting pET28-Sc-pdc1, and pET28-Zm-pdc plasmids were isolated and shown by DNA sequencing to contain the correct full-length sequence of the S. cerevisiae PDC1, and Z. mobilis PDC genes, respectively. The corresponding protein sequences are represented by SEQ No. 208 and SEQ ID No. 208 128 respectively.
(33) TABLE-US-00007 TABLE7 Primersequencesandrestrictionsites usedforamplificationandcloning ofcandidateenzymes Forwardandreverse Restriction Gene primersequence5-3 sites Sc-PDC1 CATATGTCTGAAATTACTTTG Nde1 GGTAA(SEQIDNo.175) GGATCCTTATTGCTTAGCGTT BamH1 GGT(SEQIDNo.176) Zm-PDC CATATGAGTTATACTGTCGGT Nde1 ACC(SEQIDNo.177) GGATCCCTAGAGGAGCTTGTT BamH1 AAC(SEQIDNo.178)
(34) The plasmids were used to transform E. coli BL21 (DE3) star cells and the enzymes carrying an N-terminal hexa-His tag were expressed and purified as described in Example 1. Decarboxylase activity on 2-oxo-4-hydroxybutyrate (OHB), pyruvate (Sigma), and 4-methyl-2-oxovaleric acid (Sigma) was quantified.
(35) Enzymatic Assays:
(36) OHB decarboxylase activity was assayed by coupling the decarboxylase activity to the NADPH-dependent reduction of the released 3-hydroxypropanal by purified aldehyde reductase, YqhD, from E. coli. The decarboxylation of pyruvate was coupled to the NADH-dependent reduction of acetaldehyde catalysed by yeast alcohol dehydrogenase. Branched-chain alpha-ketoacid decarboxylase activity was measured on 4-methyl-2-oxovaleric acid by coupling to the NADH-dependent reduction of 3-methylbutanal catalysed by horse liver alcohol dehydrogenase. The reaction mixtures contained 60 mM Hepes (pH 7), 50 mM potassium chloride, 2 mM MgCl.sub.2, 0.25 mM NAD(P)H, (all products from Sigma), 0.5 mM thiamine pyrophosphate, 10 Unit/mL purified E. coli YqhD, or horse liver alcohol dehydrogenase (Sigma), or yeast alcohol dehydrogenase (Sigma), and appropriate amounts of purified enzyme or cell extract. Reactions were started by adding 20 mM 2-oxo-4-hydroxybutyrate (OHB), 10 mM 4-methyl-2-oxovaleric acid (MOV), or 5 mM pyruvate. Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NAD(P)H at 340 nm (.sub.NAD(P)H=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).
(37) Results:
(38) The results of the decarboxylase assays are summarized in Table 8. It was demonstrated that the enzymes KdcA from L. lactis and the pyruvate decarboxylases Sc-Pdc1 and Zm-Pdc have significant OHB decarboxylase activity.
(39) TABLE-US-00008 TABLE 8 Summary of kinetic parameters of selected candidate enzymes on their natural substrate and OHB Max. specific activity Substrate affinity, Km [mol/(mg min)] [mM] Natural Natural Enzyme substrate.sup.a OHB.sup.b substrate.sup.a OHB Ll-KdcA 4 0.08 0.15 4 SEQ ID No. 130 Zm-Pdc 65 0.052 2.5 1.5 SEQ ID No .128 Sc-Pdc1 1.3 0.055 nd nd SEQ ID No. 208 .sup.aNatural substrates for KdcA and pyruvate decarboxylases are4-methyl-2-oxovaleric and pyruvate, respectively .sup.bWhen enzymes could not be saturated, maximum specific activity refers to the activity estimated at 20 mM substrate concentration nsnot saturated ndnot determined
Example 5
Construction of Enzymes with Improved OHB Decarboxylase Activity
(40) Site-directed mutagenesis of the L. lactis kdcA and the Z. mobilis Pdc genes was carried out using the oligonucleotide pairs listed in Table 9 and the pET28-Ll-kdcA and pET28-Zm-Pdc plasmids, respectively, as the template.
(41) TABLE-US-00009 TABLE9 Oligonucleotidesusedtomutatebranched chain2-oxoaciddecarboxylase,kdcA,from L.lactisandpyruvatedecarboxylase, PDC,fromZ.mobilis Restr. Protein Mutation Primersequences5-3 site Zm-Pdc. W392Q GTTATTGCTGAAACCGGTGACT FSP1 CTCAGTTCAATGCGCAGCGCAT GAAGC(SEQIDNO.179) GCTTCATGCGCTGCGCATTGAA CTGAGAGTCACCGGTTTCAGCA ATAAC(SEQIDNO.180) Zm-Pdc W392L ACGGTTATTGCTGAAACCGGTG FSP1 ACTCTTTATTCAATGCGCAGCG CATGAAGCTC (SEQIDNO.181) GAGCTTCATGCGCTGCGCATTG AATAAAGAGTCACCGGTTTCAG CAATAACCGT (SEQIDNO.182) Zm-Pdc G413N TATGAAATGCAGTGGAACCACA KPNI TTGGTTGGTCGGTACCTGCCGC CTTC(SEQIDNO.183) GAAGGCGGCAGGTACCGACCAA CCAATGTGGTTCCACTGCATTT CATA(SEQIDNO.184) Ll-Kdc G402S GGACAACCGCTGTGGTCCAGTA ACC1 TTGGGTATACGTTTCCAGCG (SEQIDNO.185) CGCTGGAAACGTATACCCAATA CTGGACCACAGCGGTTGTCC (SEQIDNO.186) Ll-Kdc V461I TTTGCTTTATCATTAATAATGA ASE1 CGGCTACACAATCGAGCGCGAA ATTCA((SEQIDNO.187) TGAATTTCGCGCTCGATTGTGT AGCCGTCATTATTAATGATAAA GCAAA(SEQIDNO.188)
(42) Mutant enzymes were expressed, purified and tested for OHB decarboxylase, pyruvate decarboxylase and MOV decarboxylase activity as described in Example 4. The results of the enzymatic measurements are summarized in Table 10. It was demonstrated that mutations W392Q, W392L and G413N in Zm-Pdc, and mutations G402S and V461I in Ll-KdcA increased activity and/or specificity for OHB.
(43) TABLE-US-00010 TABLE 10 Summary of kinetic parameters of decarboxylase mutants on OHB, pyruvate and MOV Max. specific activity Km [mol/(mg min)] [mM] Mutant Natural Natural Enzyme Seq ID substrate.sup.a OHB.sup.b substrate OHB Zm-Pdc SEQ ID 1.39 0.19 9.2 2.9 W392Q No. 190) Zm-Pdc SEQ ID 0.09 0.04 ns 3.7 W392L No. 192) Zm-Pdc SEQ ID 0.1 0.04 ns 1.4 G413N No. 194) Ll-KdcA SEQ ID 3.1 0.09 1.5 1.5 G402S No. 196) Ll-KdcA SEQ ID 2.76 0.24 0.15 2.8 V461I No. 198) .sup.aactivity was measured at 10 mM MOV in case of KdcA mutants and 50 mM pyruvate in case of Pdc mutants .sup.bactivity was measured at 20 mM OHB nsnot saturated at concentrations of up to 50 mM
Example 6
Demonstration of 1,3-Propanediol Dehydrogenase Activity
(44) The coding region of the alcohol dehydrogenase yqhD from Escherichia coli was amplified by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers 5 -TATCGTGCTAGCATGAACAACTTTAATCTGCACA-3 (SEQ ID No. 199) and 5-TATAATGAATTCTTAGCGGGCGGCTTCGTATATACGGCGGCTGACA-3 (SEQ ID No. 200) that introduced NheI and EcoRI restriction sites upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli MG1655 was used as the template. The PCR product was digested with NheI and EcoRI, ligated into the corresponding sites of pET28a+ (Novagen), in frame with a N-terminal hexa-His tag, using T4 DNA ligase (Biolabs). The ligation product was transformed into E. coli DH5 cells. The resulting pET28-Ec-yqhD plasmid was isolated and shown by DNA sequencing to contain the correct full-length sequence of the E. coli yqhD gene. The plasmid was used to transform E. coli BL21 (DE3) star cells and the enzyme with an N-terminal hexa-His tag was expressed and purified as described in Example 1.
(45) Enzymatic assay:
(46) PDO dehydrogenase activity was assayed by following the PDO-dependent reduction of NADP.
1,3-propanediol+NADP.sup.+.fwdarw.3-hydroxypropional+NADPHReaction scheme:
(47) The reaction mixture contained 60 mM Hepes (pH 8), 50 mM potassium chloride, 2 mM ZnSO.sub.4, 10 mM NADP, (all products from Sigma), and appropriate amounts of purified enzyme or cell extract. Reactions were started by adding 100 mM 1,3-propanediol (PDO, Sigma). Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADPH at 340 nm (.sub.NADH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR). The enzyme exhibited a PDO dehydrogenase activity of 0.15 mol/(min mg).
Example 6
Demonstration of In Vitro Production of 1,3-Propanediol by the Synthetic Pathway
(48) The enzymes DHB dehydrogenase (Ec-Mdh R81A or Ec-LldD), OHB decarboxylase (Zm-Pdc or Sc-Pdc), and PDO dehydrogenase (Ec-YqhD) were expressed and purified as described in Example 1. In vitro synthesis of PDO was demonstrated by adding 20 mM DHB to a reaction mixture that contained 50 mM Hepes (pH 7), 50 M thiamine pyrophosphate, 2 mM NADPH, 2 mM MgCl.sub.2, 10 mM NAD or 1 mM DCIP, 160 g/mL of DHB dehydrogenase, 10 g/mL OHB decarboxylase, and 20 g/mL PDO dehydrogenase. Control reactions contained all components but were lacking either DHB dehydrogenase (Control 1) or OHB decarboxylase (Control 2).
(49) After 10 h of incubation at 37 C., the reaction mixtures were analysed by gas chromatography [GCMS-QP2010 Ultra Shimadzu; equipped with a FID detector (FID-2010 Plus Shimadzu); autosampler AOC20s (Shimadzu); splitless injector AOC20i (Shimadzu) (240 C.); column: Zebron ZB-WAX, 30 m0.25 mm, d.sub.f 0.25 m; and liner: Tapered focus Liner5953.4 mm (SGE). Carrier gas was hydrogen at a total flow rate of 4.9 mL/min. Flame ionization was carried out using an air-hydrogen mixture (flow rates were 400 mL/min and 40 mL/min, respectively). Detector temperature was 250 C. Injected sample volume was 1 L. The temperature program is provided in Table 11.
(50) TABLE-US-00011 TABLE 11 Temperature program used for GC-FID analyses of reaction mixtures Columntemperature Hold Gradient Runtime [ C.] [min] [ C./min] [min] 50 0 0 0 95 0 20 2.15 160 5 40 3.52 230 2 50 12.27
(51) Chromatograms showing presence of PDO in the reactions containing all pathway enzymes and absence of PDO in samples containing only two out of three pathway enzymes are shown in
Example 7
Construction of Optimized Propanediol Producer Strains
(52) Construction of the Plasmid pACT3-Op-PDO for Expression of DHB Dehydrogenase (Ec-Mdh R81A), OHB Decarboxylase (Zm-Pdc), and PDO Dehydrogenase (Ec-YqhD)
(53) Vector pACT3-yqhD was constructed by amplifying the coding sequence of yqhD using the forward and reverse primers 5-TATAATGAGCTCTTTAACTTTAAGAAGGAGATATACCATGAACAACTTTAAT CTGCACACCCCAACC-3 (SEQ ID No. 201) and 5 -TATAATGGATCCTTAGCGGGCGGCTTCGTA-3 (SEQ ID No. 202) that added a SacI and a BamH1 restriction site upstream of the start codon and downstream of the stop codon. Plasmid pET28-yqhD was used as the template. The PCR fragment was purified and ligated into the SacI and BamHI sites of vector pACT3 (Dykxhoorn, et al. (1996) A set of compatible tac promoter expression vectors. Gene 177, 133-136.). Vector pACT3-yqhD was then digested in XbaI and HindIII sites, situated at the end of the Ec-yqhD coding sequence. Ec-mdh R81A and Zm-pdc genes were amplified by PCR using the primer pairs 5-GCCCGCTAAGGATCCTCTAGGGAGGTCTAGAATGAAAGTCGCAGTCCTCG GC-3 (SEQ ID No. 203); 5-CGAGCCTCCTTACTTATTAACGAACTCTTCGCC-3 (SEQ ID No. 204), and 5-CATAGGGAGGCTCGAGATGTATACCGTTGGGGATTATCTG-3 (SEQ ID No. 205); 5-CGCCAAAACAGAAGCTTGACGTCCTAGAGGAGCTTGTTAACAGGCTT-3, (SEQ ID No. 206) respectively. Amplified PCR fragments (2 L each) and digested pACT-yqhD plasmid (3 L) were mixed and incubated with 2 L of In-fusion enzyme (Clontech) for 20 min at 50 C. 2 L of the reaction mix were then transformed into Stellar Competent Cells. Presence of the complete operon in the resulting plasmid pACT3-op-PDO was confirmed by sequencing isolated plasmid DNA recovered from transformed clones.
(54) Construction of Strains with Optimized Carbon Flux Repartitioning for Propanediol Production
(55) Several genes were disrupted in E. coli strain MG1655 in order to optimise carbon flux repartitioning and cofactor supply for PDO production. Gene deletions were carried out using the lambda red recombinase method according to Datsenko et al. (Datsenko & Wanner, 2000), which can be refined to allow for more efficient multiple gene deletions using the protocol of Mizoguchi (Mizoguchi, Tanaka-Masuda, & Mori, 2007). Another alternative to introduce multiple chromosomal gene deletions in E coli relies on the transfer of mutations from one strain to another by P1 phage transduction (Thomason, Costantino, Shaw, & Court, 2007).
(56) The deletion cassettes were prepared by PCR using high fidelity polymerase Phusion (Finnzymes), and the FRT-flanked kanamycin resistance gene (kan) of plasmid pKD4 as the template (Datsenko & Wanner, 2000). Sense primers contained sequences corresponding to the 5 end of each targeted gene (underlined) followed by 20 bp corresponding to the FRT-kan-FRT cassette of pKD4. Anti-sense primers contained sequences corresponding to the 3 end region of each targeted gene (underlined) followed by 20 bp corresponding to the cassette. The primers are described in Table 11. PCR products were digested with DpnI and purified prior to transformation.
(57) E. coli MG1655 strain was rendered electro-competent by growing the cells to an OD.sub.600 of 0.6 in LB liquid medium at 37 C., concentrating the cells 100-fold, and washing them twice with ice-cold 10% glycerol. The cells were transformed with plasmid pKD46 (Datsenko & Wanner, 2000) by electroporation (2.5 kV, 200 , 25 F, in 2 mm gap cuvettes). Transformants were selected at 30 C. on ampicillin (100 g/mL) LB solid medium.
(58) Disruption cassettes were transformed into electro-competent E. coli strains harbouring the lambda Red recombinase-expressing plasmid pKD46. The cells were grown at 30 C. in liquid SOB medium containing ampicillin (100 g/mL). The lambda red recombinase system was induced by adding 10 mM arabinose when OD.sub.600 of the cultures reached 0.1. Cells were further grown to an OD.sub.600 of 0.6 before they were harvested by centrifugation, washed twice with ice-cold 10% glycerol, and transformed with the disruption cassette by electroporation. After an overnight phenotypic expression at 30 C. in LB liquid medium, cells were plated on solid LB medium containing 25 g/mL kanamycin. Transformants were selected after cultivation at 30 C.
(59) The gene replacement was verified by colony PCR using Crimson Taq polymerase (NEB). A first reaction was carried out with the flanking locus-specific primers (see Table 12) to verify simultaneous loss of the parental fragment and gain of the new mutant specific fragment. Two additional reactions were done by using one locus-specific primer together with one of the corresponding primers k1 rev, or k2 for (see Table 6) that align within the FRT-kanamycin resistance cassette (sense locus primer/k1 rev and k2 for/reverse locus primer).
(60) The resistance gene (FRT-kan-FRT) was subsequently excised from the chromosome using the FLP recombinase-harbouring plasmid pCP20 (Cherepanov & Wackernagel, 1995) leaving a scar region containing one FRT site. pCP20 is an ampicillin and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP recombinase synthesis. Kanamycin resistant mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C. Transformants were then grown on solid LB medium at 37 C. and tested for loss of all antibiotic resistances. Excision of the FRT-kanamycin cassette was analysed by colony PCR using crimson taq polymerase and the flanking locus-specific primers (Table 13). Multiple deletions were obtained by repeating the above described steps.
(61) TABLE-US-00012 TABLE12 Primersusedforgenedisruptions.Sequences homologoustotargetgenesareunderlined Gene Primer Sequence IdhA _IdhA_for gaaggttgcgcctacactaagcatagttg ttgatgagtgtaggctggagctgcttc (SEQIDNo.1) _IdhA_rev ttaaaccagttcgttcgggcaggtttcgc ctttttcatgggaattagccatggtcc SEQIDNo.2) adhE _adhE_for atggctgttactaatgtcgctgaacttaa cgcactcgtagagcgtgtgtaggctggag ctgcttc(SEQIDNo.3) _adhE_rev ttaagcggattttttcgcttttttctcag ctttagccggagcagccatatgaatatcc tccttag(SEQIDNo.4) ackA _ackA_for atgtcgagtaagttagtactggttctgaa ctgcggtagttcttcagtgtaggctggag ctgcttc(SEQIDNo.5) _ackA_rev tcaggcagtcaggcggctcgcgtcttgcg cgataaccagttcttccatatgaatatcc tccttag(SEQIDNo.6) focA- _focA- ttactccgtatttgcataaaaaccatgcg pflB pflB_for agttacgggcctataagtgtaggctggag ctgcttc(SEQIDNo.7) _focA- atagattgagtgaaggtacgagtaataac pflB_rev gtcctgctgctgttctcatatgaatatcc tccttag(SEQIDNo.8) pta _pta_for gtgtcccgtattattatgctgatccctac cggaaccagcgtcggtgtgtaggctggag ctgcttc(SEQIDNo.9) _pta_rev ttactgctgctgtgcagactgaatcgcag tcagcgcgatggtgtacatatgaatatcc tccttag(SEQIDNo.10) poxB _poxB_for atgaaacaaacggttgcagcttatatcgc caaaacactcgaatcggtgtaggctggag ctgcttc(SEQIDNo.11) _poxB_rev ttaccttagccagtttgttttcgccagtt cgatcacttcatcacccatatgaatatcc tccttag(SEQIDNo.12) sad _sad_for atgaccattactccggcaactcatgcaat ttcgataaatcctgccgtgtaggctggag ctgcttc(SEQIDNo.13) _sad_rev tcagatccggtctttccacaccgtctgga tattacagaattcgtgcatatgaatatcc tccttag(SEQIDNo.14) gabD _gabD_for atgaaacttaacgacagtaacttattccg ccagcaggcgttgattgtgtaggctggag ctgcttc(SEQIDNo.15) _gabD_rev ttaaagaccgatgcacatatatttgattt ctaagtaatcttcgatcatatgaatatcc tccttag(SEQIDNo.16) gadA _gadA_for atggaccagaagctgttaacggatttccg ctcagaactactcgatgtgtaggctggag ctgcttc(SEQIDNo.17) _gadA_rev tcaggtgtgtttaaagctgttctgctggg caataccctgcagtttcatatgaatatcc tccttag(SEQIDNo.18) gadB _gadB_for atggataagaagcaagtaacggatttaag gtcggaactactcgatgtgtaggctggag ctgcttc(SEQIDNo.19) _gadB_rev tcaggtatgtttaaagctgttctgttggg caataccctgcagtttcatatgaatatcc tccttag(SEQIDNo.20) gadC _gadC_for atggctacatcagtacagacaggtaaagc taagcagctcacattagtgtaggctggag ctgcttc(SEQIDNo.21) _gadC_rev ttagtgtttcttgtcattcatcacaatat agtgtggtgaacgtgccatatgaatatcc tccttag(SEQIDNo.22) sfcA _sfcA_for atggaaccaaaaacaaaaaaacagcgttc gctttatatcccttacgtgtaggctggag ctgcttc(SEQIDNo.23) _sfcA_rev ttagatggaggtacggcggtagtcgcggt attcggcttgccagaacatatgaatatcc tccttag(SEQIDNo.24) maeB _maeB_for atggatgaccagttaaaacaaagtgcact tgatttccatgaatttgtgtaggctggag ctgcttc(SEQIDNo.25) _maeB_rev ttacagcggttgggtttgcgcttctacca cggccagcgccaccatcatatgaatatcc tccttag(SEQIDNo.26) pykA _pykA_for atgtccagaaggcttcgcagaacaaaaat cgttaccacgttaggcgtgtaggctggag ctgcttc(SEQIDNo.27) _pykA_rev ttactctaccgttaaaatacgcgtggtat tagtagaacccacggtcatatgaatatcc tccttag(SEQIDNo.28) pykF _pykF_for atgaaaaagaccaaaattgtttgcaccat cggaccgaaaaccgaagtgtaggctggag ctgcttc(SEQIDNo.29) _pykF_rev ttacaggacgtgaacagatgcggtgttag tagtgccgctcggtaccatatgaatatcc tccttag(SEQIDNo.30) mgsA _mgsA_for atggaactgacgactcgcactttacctgc gcggaaacatattgcggtgtaggctggag ctgcttc(SEQIDNo.31) _mgsA_rev ttacttcagacggtccgcgagataacgct gataatcggggatcagcatatgaatatcc tccttag(SEQIDNo.32) iclR _iclR_for atggtcgcacccattcccgcgaaacgcgg cagaaaacccgccgttgtgtaggctggag ctgcttc(SEQIDNo.33) _iclR_rev tcagcgcattccaccgtacgccagcgtca cttccttcgccgctttcatatgaatatcc tccttag(SEQIDNo.34) icd _icd_for atggaaagtaaagtagttgttccggcaca aggcaagaagatcaccgtgtaggctggag ctgcttc(SEQIDNo.35) _icd_rev ttacatgttttcgatgatcgcgtcaccaa actctgaacatttcagcatatgaatatcc tccttag(SEQIDNo.36) sucA _sucA_for atgcagaacagcgctttgaaagcctggtt ggactcttcttacctcgtgtaggctggag ctgcttc(SEQIDNo.37) _sucA_rev ttattcgacgttcagcgcgtcattaacca gatcttgttgctgtttcatatgaatatcc tccttag(SEQIDNo.38) sucB _sucB_for atgagtagcgtagatattctggtccctga cctgcctgaatccgtagtgtaggctggag ctgcttc(SEQIDNo.39) _sucB_rev ctacacgtccagcagcagacgcgtcggat cttccagcaactctttcatatgaatatcc tccttag(SEQIDNo.40) frdA _frdA_for gtgcaaacctttcaagccgatcttgccat tgtaggcgccggtggcgtgtaggctggag ctgcttc(SEQIDNo.41) _frdA_rev tcagccattcgccttctccttcttattgg ctgcttccgccttatccatatgaatatcc tccttag(SEQIDNo.42) frdB _frdB_for atggctgagatgaaaaacctgaaaattga ggtggtgcgctataacgtgtaggctggag ctgcttc(SEQIDNo.43) _frdB_rev ttagcgtggtttcagggtcgcgataagaa agtctttcgaactttccatatgaatatcc tccttag(SEQIDNo.44) frdC _frdC_for atgacgactaaacgtaaaccgtatgtacg gccaatgacgtccaccgtgtaggctggag ctgcttc(SEQIDNo.45) _frdC_rev ttaccagtacagggcaacaaacaggatta cgatggtggcaaccaccatatgaatatcc tccttag(SEQIDNo.46) frdD _frdD_for atgattaatccaaatccaaagcgttctga cgaaccggtattctgggtgtaggctggag ctgcttc(SEQIDNo.47) _frdD_rev ttagattgtaacgacaccaatcagcgtga caactgtcaggatagccatatgaatatcc tccttag(SEQIDNo.48) ptsI _ptsI_for atgatttcaggcattttagcatccccggg tatcgctttcggtaaagtgtaggctggag ctgcttc(SEQIDNo.49) _ptsI_rev ttagcagattgttttttcttcaatgaact tgttaaccagcgtcatcatatgaatatcc tccttag(SEQIDNo.50) ptsG _ptsG_for atgtttaagaatgcatttgctaacctgca aaaggtcggtaaatcggtgtaggctggag ctgcttc(SEQIDNo.51) _ptsG_rev ttagtggttacggatgtactcatccatct cggttttcaggttatccatatgaatatcc tccttag(SEQIDNo.52) lacI _lacI_for gtgaaaccagtaacgttatacgatgtcgc agagtatgccggtgtcgtgtaggctggag ctgcttc(SEQIDNo.53) _lacI_rev tcactgcccgctttccagtcgggaaacct gtcgtgccagctgcatcatatgaatatcc tccttag(SEQIDNo.54) pgi _pgi_for atgaaaaacatcaatccaacgcagaccgc tgcctggcaggcactagtgtaggctggag ctgcttc(SEQIDNo.55) _pgi_rev ttaaccgcgccacgctttatagcggttaa tcagaccattggtcgacatatgaatatcc tccttag(SEQIDNo.56) eda _eda_for atgaaaaactggaaaacaagtgcagaatc aatcctgaccaccggcgtgtaggctggag ctgcttc(SEQIDNo.57) _eda_for ctcgatcgggcattttgacttttacagct tagcgccttctacagccatatgaatatcc tccttag(SEQIDNo.58)
(62) TABLE-US-00013 TABLE13 Primerpairsusedfor verificationofgenedisruptions Deleted- Sequence(5-3) gene Forwardprimer Reverseprimer K2for/ cggtgccctgaatgaactgc cagtcatagccgaatagcct k1rev (SEQIDNo.59) (SEQIDNo.60) IdhA atacgtgtcccgagcggtag tacacatcccgccatcagca (SEQIDNo.61) (SEQIDNo.62) adhE gaagtaaacgggaaaatcaa agaagtggcataagaaaacg (SEQIDNo.63) (SEQIDNo.64) ackA ccattggctgaaaattacgc gttccattgcacggatcacg (SEQIDNo.65) (SEQIDNo.66) focA_pflB atgccgtagaagccgccagt tgttggtgcgcagctcgaag (SEQIDNo.67) (SEQIDNo.68) pta gcaaatctggtttcatcaac tcccttgcacaaaacaaagt (SEQIDNo.69) (SEQIDNo.70) poxB ggatttggttctcgcataat agcattaacggtagggtcgt (SEQIDNo.71) (SEQIDNo.72) sad gctgattctcgcgaataaac aaaaacgttcttgcgcgtct (SEQIDNo.73) (SEQIDNo.74) gabD tctgtttgtcaccaccccgc aagccagcacctggaagcag (SEQIDNo.75) (SEQIDNo.76) gadA aagagctgccgcaggaggat gccgccctcttaagtcaaat (SEQIDNo.77) (SEQIDNo.78) gadB ggattttagcaatattcgct cctaatagcaggaagaagac (SEQIDNo.79) (SEQIDNo.80) gadC gctgaactgttgctggaaga ggcgtgcttttacaactaca (SEQIDNo.81) (SEQIDNo.82) sfcA tagtaaataacccaaccggc tcagtgagcgcagtgtttta (SEQIDNo.83) (SEQIDNo.84) maeB attaatggtgagagtttgga tgcttttttttattattcgc (SEQIDNo.85) (SEQIDNo.86) pykA tttatatgcccatggtttct atctgttagaggcggatgat (SEQIDNo.87) (SEQIDNo.88) pykF ctggaacgttaaatctttga ccagtttagtagctttcatt (SEQIDNo.89) (SEQIDNo.90) iclR gatttgttcaacattaactc tgcgattaacagacaccctt atcgg (SEQIDNo.92) (SEQIDNo.91) mgsA tctcaggtgctcacagaaca tatggaagaggcgctactgc (SEQIDNo.93) (SEQIDNo.94) icd cgacctgctgcataaacacc tgaacgctaaggtgattgca (SEQIDNo.95) (SEQIDNo.96) sucA acgtagacaagagctcgcaa catcacgtacgactgcgtcg (SEQIDNo.97) (SEQIDNo.98) sucB tgcaactttgtgctgagcaa tatcgcttccgggcattgtc (SEQIDNo.99) (SEQIDNo.100) frdA aaatcgatctcgtcaaattt aggaaccacaaatcgccata cagac (SEQIDNo.102) (SEQIDNo.101) frdB gacgtgaagattactacgct agttcaatgctgaaccacac (SEQIDNo.103) (SEQIDNo.104) frdC tagccgcgaccacggtaaga cagcgcatcacccggaaaca aggag (SEQIDNo.106) (SEQIDNo.105) frdD atcgtgatcattaacctgat ttaccctgataaattaccgc (SEQIDNo.107) (SEQIDNo.108) lacI gaatctggtgtatatggcga tcttcgctattacgccagct (SEQIDNo.109) (SEQIDNo.110) pgi ttgtcaacgatggggtcatg aaaaatgccgacataacgtc (SEQIDNo.111) (SEQIDNo.112) ptsG ccatccgttgaatgagtttt tggtgttaactggcaaaatc (SEQIDNo.113) (SEQIDNo.114) ptsI gtgacttccaacggcaaaag ccgttggtttgatagcaata (SEQIDNo.115) (SEQIDNo.116) eda Gacagacaggcgaactgacg Gcgcagatttgcagattcgt (SEQIDNo.117) (SEQIDNo.118)
(63) The plasmid expressing the enzymes that build up the pathway leading from DHB to PDO (pACT3-op-PDO) was transformed into the E. coli MG1655 wild-type strain. Transformants were selected on solid LB medium containing chloramphenicol (25 g/mL) and kanamycin (50 g/mL). Non-exclusive examples of constructed strains are listed in Table 14.
(64) TABLE-US-00014 TABLE 14 Examples of strains constructed for DHB production Strain Relevant Genotype MG1655 Wild-type ECE90 pACT3 (empty plasmid) ECE91 pACT3-op-PDO
Example 8
Zymotic Production of Propanediol
(65) Strains and medium: Experiments were carried out with strains listed in Table 14. 1 Liter culture medium contained, 20 g glucose, 18 g Na.sub.2HPO.sub.4*12H.sub.2O, 3 g KH.sub.2PO.sub.4, 0.5 g NaCl, 2 g NH.sub.4Cl, 0.5 g MgSO.sub.4*7H.sub.2O, 0.015 CaCl.sub.2*2H.sub.2O, 1 mL of 0.06 mol/L FeCl.sub.3 stock solution prepared in 100 times diluted concentrated HCl, 2 mL of 10 mM thiamine HCl stock solution, 20 g MOPS, and 1 mL of trace element solution (containing per liter: 0.04 g Na.sub.2EDTA*2H.sub.2O, 0.18 g CoCl.sub.2*6H.sub.2O, ZnSO4*7H.sub.2O, 0.04 g Na.sub.2MoO4*2H.sub.2O, 0.01 g H.sub.3BO.sub.3, 0.12 g MnSO.sub.4*H.sub.2O, 0.12 g CuCl.sub.2*H2O). Medium pH was adjusted to 7 and medium was filter-sterilized. Chloramphenicol (Sigma) was added at a concentration of 25 g/mL.
(66) Cultivation Conditions:
(67) All cultivations were carried out at 37 C. on an Infors rotary shaker running at 170 rpm. Cells were grown on glucose-containing mineral medium. PDO production was assayed under two conditions: (A) Growth on glucose-containing mineral medium in the presence of 20 mM DHB, or (B) Incubation of a cell suspension in phosphate buffer with 20 mM DHB.
(68) Experimental details for condition (A): Overnight cultures (3 mL medium in test tube) were inoculated from glycerol stocks and used to adjust an initial OD.sub.600 of 0.05 in 100 mL growth cultures cultivated in 500 mL shake flasks. IPTG was added at a concentration of 1 mmol/L when OD.sub.600 in the growth cultures reached 1. At the same time DHB was added to the cultures at a concentration of 20 mM. Supernatant of the cultures was analysed after 20 h of incubation.
(69) Experimental details for condition (B): Overnight cultures (3 mL medium in test tube) were inoculated from glycerol stocks and used to adjust an initial OD.sub.600 of 0.05 in 100 mL growth cultures cultivated in 500 mL shake flasks. IPTG was added at a concentration of 1 mmol/L when OD.sub.600 in the growth cultures reached 1. Cells were harvested by centrifugation after having been incubated with IPTG during 4 h. Cells were washed twice with distilled water and were resuspended in 0.5 mL of 50 mM phosphate buffer at pH 7 to adjust a cell concentration of 5.5 g (cellular dry weight)/L. DHB was added at a concentration of 20 mM. PDO content was quantified after 20 h of incubation.
(70) Estimation of PDO Concentration by LC-MS Analyses:
(71) Liquid anion exchange chromatography was performed on an ICS-3000 system from Dionex (Sunnyvale, USA) equipped with an automatic eluent (KOH) generator system (RFIC, Dionex), and an autosampler (AS50, Dionex) holding the samples at 4 C. Analytes were separated on an IonPac AS11 HC (2502 mm, Dionex) column protected by an AG11 HC (502 mm, Dionex) pre-column. Column temperature was held at 25 C., flow rate was fixed at 0.25 mL/min, and analytes were eluted applying the KOH gradient described earlier (Groussac E, Ortiz M & Francois J (2000): Improved protocols for quantitative determination of metabolites from biological samples using high performance ionic-exchange chromatography with conductimetric and pulsed amperometric detection. Enzyme. Microb. Technol. 26, 715-723). Injected sample volume was 15 L. For background reduction, an ASRS ultra II (2 mm, external water mode, 75 mA) anion suppressor was used. Analytes were quantified using a mass-sensitive detector (MSQ Plus, Thermo) running in ESI mode (split was , nitrogen pressure was 90 psi, capillary voltage was 3.5 kV, probe temperature was 450 C.).
(72) Results:
(73) Condition A: The PDO concentration in the supernatant of strains ECE 90 and ECE91 after 20 h of incubation was 0 mg/L and 0.92 mg/L, respectively.
(74) Condition B: The PDO concentration in the supernatant of strains ECE 90 and ECE91 after 20 h of incubation was 0.11 mg/L and 7.56 mg/L, respectively.
(75) Zymotic production of PDO via the synthetic pathway was therefore demonstrated.
REFERENCES
(76) Cherepanov, P. P. & Wackernagel, W. (1995). Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158, 9-14. Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A 97, 6640-6645. Emptage, M., Haynie, S. L., Laffend, L. A., Pucci, J. P. & Whited, G. M. (2000). process for the biological production of 1,3-propanediol with high titer. Hadicke, O. & Klamt, S. (2010). CASOP: a computational approach for strain optimization aiming at high productivity. J. Biotechnol 147, 88-101. Klamt, S., Saez-Rodriguez, J. & Gilles, E. D. (2007). Structural and functional analysis of cellular networks with CellNetAnalyzer. BMC Syst Biol 1, 2. Laffend, L. A., Nagarajan, V. & Nakamura, C. E. (1995). Bioconversion of a fermentable carbon source to 1,3-propandiol by a single microorganism. Mizoguchi, H., Tanaka-Masuda, K. & Mori, H. (2007). A simple method for multiple modification of the Escherichia coli K-12 chromosome. Biosci. Biotechnol. Biochem 71, 2905-2911. Nakamura, C. E. & Whited, G. M. (2003). Metabolic engineering for the microbial production of 1,3-propanediol. Curr. Opin. Biotechnol 14, 454-459. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2 d. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. Saxena, R. K., Anand, P., Saran, S. & Isar, J. (2009). Microbial production of 1,3-propanediol: Recent developments and emerging opportunities. Biotechnol. Adv 27, 895-913. Schuster, S., Dandekar, T. & Fell, D. A. (1999). Detection of elementary flux modes in biochemical networks: a promising tool for pathway analysis and metabolic engineering. Trends Biotechnol 17, 53-60. Thomason, L. C., Costantino, N., Shaw, D. V. & Court, D. L. (2007). Multicopy plasmid modification with phage lambda Red recombineering. Plasmid 58, 148-158.