DELIVERY OF ANTIBODIES TO THE CENTRAL NERVOUS SYSTEM

20170080100 ยท 2017-03-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to improvements in the field of drug delivery. More particularly, the invention relates to polypeptide derived from aprotinin and from aprotinin analogs as well as conjugates and pharmaceutical compositions comprising these polypeptides. The present invention also relates to the use of these polypeptide for transporting an antibody or antibody fragment across the blood-brain barrier of an individual and in the treatment and diagnosis of neurological diseases.

    Claims

    1. A biologically active polypeptide able to cross a cell layer mimicking a mammalian blood brain barrier in an in vitro assay, said polypeptide being selected from the group of; a) an aprotinin fragment comprising the amino acid sequence defined In SEQ ID NO.:1, b) an aprotinin fragment consisting of SEQ ID NO.:1, c) a biologically active analogue of SEQ ID NO.:1, d) a biologically active fragment of SEQ ID NO.:1, and; e) a biologically active fragment of a SEQ ID NO.:1 analogue.

    2. The biologically active polypeptide of claim 1, wherein the amino acid of position 10 of SEQ ID NO.:1 is a lysine.

    3. The biologically active polypeptide of claim 1, wherein the amino acid of position 5 of SEQ ID NO.:1 is a lysine.

    4. The biologically active polypeptide of claim 2, wherein the amino acid of position 15 of SEQ ID NO.:1 is a lysine.

    5. The biologically active polypeptide of claim 4, wherein the amino acid of position 7 is a serine.

    6. The polypeptide of claim 1, wherein said polypeptide is In multimeric form.

    7. The polypeptide of claim 6, wherein said multimeric form is a dimer.

    8. The polypeptide of claim 1, wherein said biologically active analogue of SEQ ID NO.:1 comprises an amino acid sequence selected from the group consisting of an amino acid sequence defined in SEQ ID NO.:107 to 112.

    9. The polypeptide of claim 1, wherein said polypeptide is acetylated.

    10. The polypeptide of claim 1, wherein said biologically active analogue is from 10 to 54 amino acids in length.

    11. The polypeptide of claim 1, wherein said biologically active analogue is from 10 to 18 amino acids in length.

    12. A conjugate comprising; a) a carrier selected from the group consisting of the polypeptides of claim 1, and; b) an agent selected from the group consisting of an antibody and an antibody fragment thereof.

    13. A method for transporting an antibody or an antibody fragment across a blood brain barrier of an individual, the method comprising administering the conjugate of claim 12 in a mammal in need thereof.

    14. The method of claim 13, wherein the mammal has a neurological disease.

    15. The method as defined in claim 14, wherein said neurological disease s selected from the group consisting of a brain tumor and a brain metastasis.

    16. A method for treating a patient having a neurological disease comprising administering the conjugate of claim 12 to said patient.

    17. A method for diagnosing a neurological disease in a patient in need thereof comprising administering the conjugate of claim 12 to said patient and wherein said conjugate comprises a label.

    18. A pharmaceutical composition comprising a) the conjugate of claim 12 and; b) a pharmaceutically acceptable carrier.

    19. The pharmaceutical composition of claim 18, wherein said pharmaceutical composition is used for the treatment of a neurological disease.

    20. The pharmaceutical composition of claim 18, wherein said pharmaceutical composition is used for the diagnosis of a neurological disease.

    21. A pharmaceutical composition comprising a) the polypeptide of claim 6 and; b) a pharmaceutically acceptable carrier.

    22. A pharmaceutical composition comprising a) the polypeptide of claim 8 and; b) a pharmaceutically acceptable carrier.

    23. A nucleotide sequence encoding the polypeptides of claim 8.

    24. The nucleotide sequence of claim 23, wherein said sequence is composed of a nucleotide selected from the group consisting of a ribonucleotide, a deoxyribonucleotide and nucleotide analogs thereof.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0194] In drawings which illustrates exemplary embodiments of the invention,

    [0195] FIG. 1 illustrates an example of analysis using Tricine gels;

    [0196] FIG. 2 illustrates the method of attachment of the vector or carrier of the present invention to paclitaxel;

    [0197] FIG. 3 illustrates the effect of treatment of glioblastoma model in Lewis rats with paclitaxel conjugated to aprotinin;

    [0198] FIG. 4 illustrates the effect of treatment of glioblastoma model in nude mice with paclitaxel conjugated to AngioPep-1;

    [0199] FIG. 5 illustrates the protocol used to conjugate aprotinin with IgG using cross-linker BS.sup.3;

    [0200] FIG. 6 illustrates the protocol used to conjugate aprotinin with IgG using cross-linker sulfo-EMCS;

    [0201] FIG. 7 illustrates the brain penetration for IgG-aprotinin conjugates;

    [0202] FIG. 8 illustrates the effect of treatment of Taxol-Angiopep-2 conjugate on the survival of glioblastoma-implanted mice (athymic, nude mice);

    [0203] FIG. 9 illustrates the structure of exemplary polypeptides of the present invention;

    [0204] FIG. 10A illustrates the protocol used to conjugate Angiopep-2 with antibodies using cross-linker SATA;

    [0205] FIG. 10B illustrates the association of Angiopep-2 with the light and heavy chain of IgG,

    [0206] FIG. 11 illustrates the protocol used to conjugate Angiopep-2 with antibodies using carbohydrate targets via hydrazide;

    [0207] FIG. 12 illustrates an autoradiogram of radiolabeled [.sup.125I]-IgG-Angiopep conjugates;

    [0208] FIG. 13 illustrates other possible linkers which may be used in the making of a conjugate;

    [0209] FIG. 14A illustrates the protocol used to conjugate Angiopep-2 with antibodies using cross-linker ECMS;

    [0210] FIG. 14B illustrates increased brain distribution volume of IgG-Angiopep-2 conjugates cross-linked with sulfo-EMCS;

    [0211] FIG. 15 illustrates the brain penetration for IgG-Angiopep-2 conjugates using in situ brain perfusion;

    [0212] FIG. 16 illustrates the distribution volume in the brain parenchyma of free and Angiopeps conjugated IgG;

    [0213] FIG. 17 illustrates the similar detection of EGFR on U87 cells with anti-EGFR and anti-EGFR-Angiopep-2 conjugate by FACS analysis;

    [0214] FIG. 18 illustrates the distribution volume in the brain parenchyma of free and Angiopep-2 conjugated EGFR antibody; and

    [0215] FIG. 19 illustrates the distribution volume in the brain parenchyma of free and Angiopep-2 conjugated VEFG antibody; and

    [0216] FIG. 20 illustrates the transcytosis capacity of IgG versus IgG-Angiopep-1 dimer.

    [0217] FIG. 21 illustrates the uptake of conjugates comprising different ratios of carrier to the agent (antibody) in the parenchyma.

    DETAILED DESCRIPTION OF THE INVENTION

    [0218] The present invention relates to new molecules that can act as vectors or carriers for transporting an agent, medicine or other molecule to the brain and/or central nervous system (CNS). Agents, medicines or other molecules which are unable or ineffective at crossing the blood-brain barrier by themselves, may be transported across the blood-brain barrier when attached or coupled (conjugated) to the vector or carrier. Alternatively, an agent that is able to cross the blood-brain barrier by itself may also see its transport increase when conjugated to the carrier of the present invention. Such conjugates can be in the form of a composition, such as a pharmaceutical composition, for treatment of a condition or disease or for the diagnosis of a condition or disease.

    Design of Candidate Molecules as Carrier Vectors

    [0219] In international publication no. WO2004/060403, the inventors have disclosed that AngioPep-1 (SEQ ID NO.:67) and aprotinin (SEQ ID NO.:98) are effective vectors for transporting desirable molecules across the blood brain barrier. The inventors herein demonstrate that other molecules could also be used as carriers for transporting an agent across the blood brain barrier. Accordingly, peptides having similar domains as aprotinin and Angiopep-1 and a modified form of Angiopep-1 (amidated, peptide no. 67) were therefore conceived as potential carrier vectors. These derived peptides resemble aprotinin and Angiopep-1 but comprise different amino acid insertions and bear different charges. Thus far, 96 peptides presented in Table 2 as well as additional peptides listed in Table 6 as well as in the sequence listing were tested for their potential as carriers.

    [0220] It is to be understood herein that in the following experiments, peptides have been selected based on their higher activity compared to others. Those which have not been selected for further experimentations are by no means being disclaimed and are not intended to be regarded as non-functional. These peptides show substantial activity and have utility has (biologically active) carriers and are also encompassed by the present invention.

    TABLE-US-00002 TABLE 2 Design of 96 peptides from similar domain to aprotinine and Angiopep-1 with different charges and amino acid insertions 96 PEPTIDES ORDERED AT SYNPREP (California, USA) Characteris- # Proteins tics Pep 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Aprot-synth CHARGE (+6) 1 T F V Y G G C R A K R N N F K S A E D Bikunin HI-30 2 T F Q Y G G C M G N G N N F V T E K E Amyloid 3 P F F Y G G C G G N R N N F D T E E Y Kunitz-Inhib 1 4 S F Y Y G G C L G N K N N Y L R E E E Peptides 5 T F F Y G G C R A K R N N F K R A K Y 6 T F F Y G G C R G K R N N F K R A K Y 7 T F F Y G G C R A K K N N Y K R A K Y 8 T F F Y G G C R G K K N N F K R A K Y 9 T F Q Y G G C R A K R N N F K R A K Y 10 T F Q Y G G C R G K K N N F K R A K Y CHARGE (+5) 11 T F F Y G G C L G K R N N F K R A K Y 12 T F F Y G G S L G K R N N F K R A K Y 13 P F F Y G G C G G K K N N F K R A K Y 14 T F F Y G G C R G K G N N Y K R A K Y 15 P F F Y G G C R G K R N N F L R A K Y 16 T F F Y G G C R G K R N N F K R E K Y 17 P F F Y G G C R A K K N N F K R A K E 18 T F F Y G G C R G K R N N F K R A K D CHARGE (+4) 19 T F F Y G G C R A K R N N F D R A K Y 20 T F F Y G G C R G K K N N F K R A E Y 21 P F F Y G G C G A N R N N F K R A K Y 22 T F F Y G G C G G K K N N F K T A K Y 23 T F F Y G G C R G N R N N F L R A K Y 24 T F F Y G G C R G N R N N F K T A K Y 25 T F F Y G G S R G N R N N F K T A K Y CHARGE (+3) 26 T F F Y G G C L G N G N N F K R A K Y 27 T F F Y G G C L G N R N N F L R A K Y 28 T F F Y G G C L G N R N N F K T A K Y 29 T F F Y G G C R G N G N N F K S A K Y 30 T F F Y G G C R G K K N N F D R E K Y 31 T F F Y G G C R G K R N N F L R E K E 32 T F F Y G G C R G K G N N F D R A K Y 33 T F F Y G G S R G K G N N F D R A K Y CHARGE (+2) 34 T F F Y G G C R G N G N N F V T A K Y 35 P F F Y G G C G G K G N N Y V T A K Y 36 T F F Y G G C L G K G N N F L T A K Y 37 S F F Y G G C L G N K N N F L T A K Y HUMAN 38 T F F Y G G C G G N K N N F V R E K Y HUMAN 39 T F F Y G G C M G N K N N F V R E K Y HUMAN 40 T F F Y G G S M G N K N N F V R E K Y HUMAN 41 P F F Y G G C L G N R N N Y V R E K Y HUMAN 42 T F F Y G G C L G N R N N F V R E K Y HUMAN 43 T F F Y G G C L G N K N N Y V R E K Y CHARGE (+1) 44 T F F Y G G C G G N G N N F L T A K Y 45 T F F Y G G C R G N R N N F L T A E Y 46 T F F Y G G C R G N G N N F K S A E Y 47 P F F Y G G C L G N K N N F K T A E Y 48 T F F Y G G C R G N R N N F K T E E Y 49 T F F Y G G C R G K R N N F K T E E D HUMAN 50 P F F Y G G C G G N G N N F V R E K Y HUMAN 51 S F F Y G G C M G N G N N F V R E K Y HUMAN 52 P F F Y G G C G G N G N N F L R E K Y HUMAN 53 T F F Y G G C L G N G N N F V R E K Y HUMAN 54 S F F Y G G C L G N G N N Y L R E K Y HUMAN 55 T F F Y G G S L G N G N N F V R E K Y CHARGE (+0) 56 T F F Y G G C R G N G N N F V T A E Y 57 T F F Y G G C L G K G N N F V S A E Y 58 T F F Y G G C L G N R N N F D R A E Y HUMAN 59 T F F Y G G C L G N R N N F L R E E Y HUMAN 60 T F F Y G G C L G N K N N Y L R E E Y HUMAN 61 P F F Y G G C G G N R N N Y L R E E Y HUMAN 62 P F F Y G G S G G N R N N Y L R E E Y Aprotinin vs APROTININ 63 M R P D F C L E P P Y T G P C V A R I M-term (1 helix , 64 A R I I R Y F Y N A K A G L C Q T F V Y G A-term) (2 sheets, 65 Y G G C R A K R N N Y K S A E D C M R T C G Y term) (1 , 1 ) 66 P D F C L E P P Y T G P C V A R I I R Y F Y AngioPep AngioPep-1 67 T F F Y G G C R G K R N N F K T E E Y AngioPEP1 68 K F F Y G G C R G K R N N F K T E E Y (lysine) AngioPEP1 (4Y) 69 T F Y Y G G C R G K R N N Y K T E E Y cys bridge 70 T F F Y G G S R G K R N N F K T E E Y cys-Nterminal 71 C T F F Y G C C R G K R N N F K T E E Y cys-Cterminal 72 T F F Y G G C R G K R N N F K T E E Y C cys-Nterminal 73 C T F F Y G S C R G K R N N F K T E E Y cys-Cterminal 74 T F F Y G G S R G K R N N F K T E E Y C pro 75 P F F Y G G C R G K R N N F K T E E Y charge (+3) 76 T F F Y G G C R G K R N N F K T K E Y charge (+3)-cys 77 T F F Y G G K R G K R N N F K T E E Y charge (+4) 78 T F F Y G G C R G K R N N F K T K R Y charge (+4)-cys 79 T F F Y G G K R G K R N N F K T A E Y charge (+5) 80 T F F Y G G K R G K R N N F K T A G Y charge (+6) 81 T F F Y G G K R G K R N N F K R E K Y charge (+7) 82 T F F Y G G K R G K R N N F K R A K Y charge (0) 83 T F F Y G G C L G N R N N F K T E E Y permut cys() 84 T F F Y G C G R G K R N N F K T E E Y permut cys(+) 85 T F F Y G G R C G K R N N F K T E E Y charge (4) 86 T F F Y G G C L G N G N N F D T E E E Q instead of F 87 T F Q Y G G C R G K R N N F K T E E Y ANGIOPEP scramble 88 Y N K E F G T F N T K G C E R G Y R F TFPI TFPI (similar 89 R F K Y G G C L G N M N N F E T L E E domain) Charge + 5 90 R F K Y G G C L G N K N N F L R L K Y (HUMAN) Charge + 5 91 R F K Y G G C L G N K N N Y L R L K Y (HUMAN) TFPI (c-terminal) 92 K T K R K R K K Q R V K I A Y E E I F K N Y (2Y) TFPI (c-terminal 93 K T K R K R K K Q R V K I A Y tronqu) Basic- SynB1 94 R G G R L S Y S R R F S T S T G R Peptides SynB3 95 R R L S Y S R R R F Penetratin 96 R Q I K I W F Q N R R M K W K K (pAntp43-68)
    Selection with In Vitro Model

    [0221] An in vitro model was used for screening assay and for mechanistic studies of drug transport to the brain. This efficient in vitro model of the blood-brain barer was developed by the company CELLIAL Technologies. Yielding reproducible results, the in vitro model was used for evaluating the capacity of different carriers to reach the brain. The model consists of a co-culture of bovine brain capillary endothellal cells and rat glial cells. It presents ultrastructural features characteristic of brain endothelium including tight junctions, lack of fenestration, lack of transendothelial channels, low permeability for hydrophilic molecules and a high electrical resistance. Moreover, this model has shown a good correlation coefficient between in vitro and in vivo analysis of wide range of molecules tested. To date, all the data obtained show that this BBB model closely mimics the in vivo situation by reproducing some of the complexities of the cellular environment that exist in vivo, while retaining the experimental advantages associated with tissue culture. Many studies have validated this cell co-culture as one of the most reproducible in vitro model of the BBB.

    [0222] The in vitro model of BBB was established by using a co-culture of BBCECs and astrocytes. Prior to cell culture, plate inserts (Millicell-P 3.0 M; 30-mm diameter) were coated on the upper side with rat tail collagen. They were then set in six-well microplates containing the astrocytes and BBCECs were plated on the upper side of the filters in 2 mL of co-culture medium. This BBCEC medium was changed three times a week. Under these conditions, differentiated BBCECs formed a confluent monolayer 7 days later. Experiments were performed between and 7 days after confluence was reached. The permeability coefficient for sucrose was measured to verify the endothelial permeability.

    [0223] Primary cultures of mixed astrocytes were prepared from newborn rat cerebral cortex (Dehouck M. P., Meresse S., Delorme P., Fruchart J. C., Cecchelli, R. An Easier, Reproductible, and Mass-Production Method to Study the Blood-Brain Barrier In Vitro. J. Neurochem, 54, 1798-1801, 1990). Briefly, after removing the meninges, the brain tissue was forced gently through an 82 m nylon sieve. Astrocytes were plated on six-well microplates at a concentration of 1.210.sup.5 cells/mL in 2 mL of optimal culture medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum. The medium was changed twice a week.

    [0224] Bovine brain capillary endothelial cells (BBCECs) were obtained from Cellial Technologies. The cells were cultured in the presence of DMEM medium supplemented with 10% (v/v) horse serum and 10% heat-inactivated calf serum, 2 mM of glutamine, 50 g/mL of gentamycin, and 1 ng/mL of basic fibroblast growth factor, added every other day.

    [0225] Originally, at a first level of selection, 96 peptides as described in Table 2 were tested as carrier with the in vitro model of the BBB. Each peptide was added to the upper side of the inserts covered or non-covered with endothelial cells for 90 minutes at 37 C. After the incubation, the peptides in the lower side of the chambers were resolved by electrophoresis. Electrophoresis gels were stained with Coomassie blue to visualize the peptides as illustrated with some peptides (without limitation) in FIG. 1. AngioPep-1 (either SEQ ID NO.:67 or peptide no. 67 (amidated form)) is often used herein as a reference or for comparison purpose. In FIG. 1 each initial peptide applied to the upper side of the filters was loaded on electrophoresis gel (ini) as control. After 90 minutes of transcytosis, a volume of 50 l from the basolateral side of the filters covered with endotheal cells (+) or non-covered () was also loaded on Tricine gels. To visualize the peptides gels were stained with Coomassie blue.

    [0226] Following the first level of screening, peptides detected in the lower side of the chambers by Coomassie blue staining (5, 8, 45, 67, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 81, 82, 90 and 91) were selected for further study with the iodinated peptides. Briefly, the selected peptides were iodinated with standard procedures using iodo-beads from Sigma. Two iodo-beads were used for each protein. These beads were washed twice with 3 ml of phosphate buffer (PB) on a Whatman filter and resuspended in 60 l of PB. .sup.125I (1 mCi) from Amersham-Pharmacia biotech was added to the bead suspension for 5 min at room temperature. The iodination for each peptide was initiated by adding 100 g (80-100 l) of the bead suspension. After an incubation of 10 min at room temperature, the supernatants were applied on a desalting column prepacked with 5 ml of cross-linked Dextran from Pierce and .sup.125I-proteins were eluted with 10 ml of PBS. Fractions of 0.5 ml were collected and the radioactivity in 5 l of each fraction was measured. Fractions corresponding to .sup.125I-proteins were pooled and dialyzed against Ringer/Hepes buffer, pH 7.4. The efficiency of radiolabeling was between 0.6-1.010.sup.8 cpm/100 g of protein.

    [0227] The iodinated peptides were also investigated with the in vitro model of the BBB. Each peptide was added to upper side of the inserts covered or non-covered with endothelial cells for 90 minutes at 37C. After the incubation, peptides in the lower side of the chambers were TCA precipitated. Results were expressed as cpm ratios. For each [.sup.125I]-peptide the number of cpm in the bottom chamber was divided by the total number of cpm added to filter covered with endothelial cells (+cells/initial) or uncovered (cells/initial). The ratio between the number of [.sup.125I]-peptide found in the bottom chamber of filters covered with or without endothelial cells was also calculated (+cells/cells). A very low cells/initial ratio indicates that filters may interfere with the peptides (peptides 5 and 8). A high +cells/initial and +cells/cells ratio indicate a better passage of the peptides across the bra endothelial cells. The results for the previously selected 18 peptides are shown in Table 3.

    TABLE-US-00003 TABLE 3 Results of the peptide screening following the second screening level Ratios #Peptides cells/initial +cells/initial +cells/cell 5 0.111 0.051 0.46 8 0.086 0.039 0.46 45 0.163 0.049 0.30 67 0.403 0.158 0.39 70 0.143 0.032 0.23 71 0.072 0.027 0.37 72 0.209 0.029 0.014 73 0.056 0.017 0.30 74 0.146 0.036 0.24 75 0.207 0.087 0.42 76 0.222 0.084 0.38 77 0.224 0.063 0.28 78 0.125 0.075 0.60 79 0.194 0.078 0.40 81 0.203 0.088 0.43 82 0.120 0.043 0.36 90 0.284 0.134 0.47 91 0.406 0.158 0.30 Aprotinin 0.260 0.022 0.08

    [0228] From these results, 12 peptides with +cells/cells ratios generally higher than 0.35 were selected namely; 5, 8, 67, 75, 76, 77, 78, 79, 81, 82, 90 and 91. Peptides #91 and #77 were also selected for further investigation because of their +cells/cells ratios (>0.2).

    [0229] The 12 selected peptides were then investigated by assessing their permeability coefficients using the in vitro BBB model. The effect of each selected peptide at 250 nM on the BBB integrity was determined by measuring [.sup.14C] sucrose permeability in the BBB model on BBCEC monolayers grown on filters in the presence of astrocytes. To achieve this test, brain endothelial cell monolayers grown on inserts were transferred to 6-well plates containing 2 m of Ringer-Hepes per well (basolateral compartment) for two hours at 37 C. Ringer-Hepes solution was composed of 150 mM NaCl, 5.2 mM KCl, 2.2 mM CaCl.sub.2, 0.2 mM MgCl.sub.2, 6 mM NaHC0.sub.3, 5 mM Hepes, 2.8 mM Hepes pH 7.4. In each apical chamber, the culture medium was replaced by 1 mL Ringer-Hepes containing the labeled [.sup.14C]-sucrose. At different times, inserts were placed into another well. [.sup.14C] sucrose passage was measured at 37 C., on filters without cells or with filters coated with BBCEC cells. The peptides are added at the start of the experiment at time zero. The results were plotted as the sucrose clearance (l) as a function of time (min).


    Clearance (l)=[C]AVA/[C]L [0230] [C]A=Abluminal tracer concentration [0231] VA=Volume of abluminal chamber [0232] [C]L=Luminal tracer concentration

    [0233] The slope of the linear variation (l/min) is the sucrose permeability coefficient for the filter without cells (Psf) and one with coated with BBCEC cells (PSt) in the presence of the peptide.

    [0234] The permeability coefficient (Pe) was calculated as:


    1/Pe=(1/PSt1/PSf)/filter area (4.2 cm.sup.2)

    [0235] The peptides with highest Pe were selected: 67, 76, 90, 91, 5, 79, 8, and 78.

    [0236] The in situ cerebral perfusion (in mice) was used as the fourth level of selection to select the best peptides. This procedure also distinguishes between compounds remaining in the brain vascular compartment from those having crossed the abluminal endothelial membrane to enter the brain parenchyma. Indeed, the technique of post-perfusion capillary depletion allows to measure whether the molecule really crosses the endothelium to enter the brain parenchyma. Using this technique it is demonstrated herein that specific peptides tend to accumulate in the brain parenchyma fraction (see Table 4).

    TABLE-US-00004 TABLE 4 Volume of distribution (perfusion 5 min) Homogenate Capillaries Parenchyma #Peptides (ml/100 g) (ml/100 g) % (ml/100 g) % 5 312 217 73 95 27 8 250 204 82 46 18 25 1141 1082 95 60 5 67 38 13 34 25 65 76 40 16 40 24 60 78 198 181 90 16 10 79 70 52 74 18 26 90 87 76 88 11 12 91 47 24 59 23 41

    [0237] Four peptides, namely 5, 67, 76 and 91, showed the highest levels of distribution in the parenchyma with a volume higher than 20 mV/100 g and which represents at least 25% of the volume found for the total brain (homogenate), thus showing the highest potential as carrier for use as transport vectors. Peptide 79 was eliminated because of its lower volume of distribution in the brain parenchyma (18 ml/100 g). Peptide 67 represents the amidated form of AngioPep-1 described in the previous application that the inventors filed. Amidation of a peptide affect the overall charge of the peptide. As is apparent in Tables 2 and 3, two peptides having a different charge do not have necessary the same activity.

    [0238] The vector or carrier of the present invention may thus be used in a method for transporting an agent across the blood-brain barrier which comprises administering to an individual in need, an agent that comprises an active ingredient or a pharmaceutical agent attached to a carrier, such as aprotinin or a functional derivative thereof (i.e., an aprotinin analog, an aprotinin fragment, an aprotin derivative, an analogue of an aprotinin fragment).

    [0239] The carrier and conjugate may be administered intra-arterially, intra-nasally, intra-peritoneally, intravenously, intramuscularly, sub-cutaneously, transdermally or per os to the patient. The agent may be, for example, an anti-angogenic compound. The agent may have a maximum weight of 160,000 Daltons. As discussed herein, the agent may be a marker or a drug such as a small molecule drug, a protein, a peptide or an enzyme. The drug may be adapted to treat, for example, a neurological disease or a central nervous system disorder of a patient. The drug may be a cytotoxic drug and the marker may be a detectable label such as a radioactive label, a green fluorescent protein, a histag protein or -galactosidase. The agent may be delivered, for example, into the central nervous system of a patient.

    [0240] According to another embodiment, the uses, methods, compounds, agents, drugs or medicaments therein mentioned may not alter the integrity of the blood-brain barrier of the patient.

    [0241] According to a further embodiment of the present invention the peptide may be selected from the group consisting of aprotinin, an aprotinin fragment (SEQ ID NO.:1) and any one of the peptides defined in SEQ ID NO.:1 to 97, 99, 100, 101, or 107-112.

    [0242] For example, peptides 5, 76, 91 and 97 as well as peptide 67 may be used in the present invention by linking them to an agent or a compound for transporting the agent or compound across the blood-brain barrier of a patient. The agent or compound may be adapted to treat a neurological disease or to treat a central nervous system disorder.

    [0243] The carrier of the present invention, such as for example, peptides 5, 76, 91 and 97 as well as peptide 67 may be linked to or labelled with a detectable label such as a radioimaging agent, such as those emitting radiation, for detection of a disease or condition, for example by the use of a radioimaging agent-antibody-carrier conjugate, wherein the antibody binds to a disease or condition-specific antigen. Other binding molecules besides antibodies and which are known and used in the art are also contemplated by the present invention. Alternatively, the carrier or functional derivative thereof of the present invention or mixtures thereof may be linked to a therapeutic agent, to treat a disease or condition, or may be linked to or labelled with mixtures thereof. Treatment may be effected by administering a carrier-agent conjugate of the present invention to an individual under conditions which allow transport of the agent across the blood-brain barrier.

    [0244] A therapeutic agent as used herein may be a drug, a medicine, an agent emitting radiation, a cellular toxin (for example, a chemotherapeutic agent) and/or biologically active fragment thereof, and/or mixtures thereof to allow cell killing or it may be an agent to treat, cure, alleviate, improve, diminish or inhibit a disease or condition in an individual treated. A therapeutic agent may be a synthetic product or a product of fungal, bacterial or other microorganism, such as mycoplasma, viral etc., animal, such as reptile, or plant origin. A therapeutic agent and/or biologically active fragment thereof may be an enzymatically active agent and/or fragment thereof, or may act by inhibiting or blocking an important and/or essential cellular pathway or by competing with an important and/or essential naturally occurring cellular component.

    [0245] Examples of radioimaging agents emitting radiation (detectable radio-labels) that may be suitable are exemplified by indium-111, technitium-99, or low dose iodine-131.

    [0246] Detectable labels, or markers, for use in the present invention may be a radiolabel, a fluorescent label, a nuclear magnetic resonance active label, a luminescent label, a chromophore label, a positron emitting isotope for PET scanner, chemiluminescence label, or an enzymatic label. Fluorescent labels include but are not limited to, green fluorescent protein (GFP), fluorescein, and rhodamine. Chemiluminescence labels include but are not limited to, luciferase and -galactosidase. Enzymatic labels include but are not limited to peroxidase and phosphatase. A histag may also be a detectable label. For the purpose of detection or diagnostic, the conjugate of the present invention may be labeled. For example, conjugates may comprise a carrier moiety and an antibody moiety (antibody or antibody fragment) and may further comprise a label. It is to be understood herein that the label may be attached to either the carrier moiety or antibody moiety. An exemplary embodiment of the invention, the label s attached to the antibody moiety. The label may be for example a medical isotope, such as for example and without limitation, Technetium-99, Iodine-123 and -131, Thallium-201, Galliu-67, Fluorin-18, Indium-111, etc.

    [0247] It is contemplated that an agent may be releasable from the carrier after transport across the blood-brain barrier, for example by enzymatic cleavage or breakage of a chemical bond between the carrier and the agent. The release agent may then function in its intended capacity in the absence of the carrier.

    [0248] The present invention will be more readily understood by referring to the following examples which are given to Illustrate the invention rather than to limit its scope. The following examples have been given with aprotinin. However, it has been demonstrated herein the molecules of the present invention share common properties with aprotinin with respect to their potential as carrier for transporting an agent across the blood brain barrier. These examples thus apply to the molecules of the present invention.

    Example I

    Strategies for Drug Conjugation (Paclitaxel)

    [0249] For conjugation, paclitaxel (TAXOL) has 2 strategic positions (position C2 and C7). FIG. 2 illustrates the method of attachment of the vector or carrier of the present invention to paclitaxel. Briefly, paclitaxel is reacted with anhydride succinic pyridine for 3 hours at room temperature to attach a succinyl group in position 2. Such 2-succinyl paclitaxel has a cleavable ester bond in position 2 which upon cleavage can simply release succinic acid. This cleavable ester bond can be further used for various modifications with linkers, if desired. The resulting 2-O-succinyl-paclitaxel is then reacted with EDC/NHS in DMS for 9 hours at room temperature, followed by the addition of the carrier or vector in Ringer/DMSO for an additional reaction time of 4 hours at room temperature. The reaction of conjugation depicted in FIG. 2 is monitored by HPLC. Each Intermediate, such as paclitaxel, 2-O-succinyl-paclitaxel and 2-ONHS-succinyl-paclitaxel, is purified and validated using different approaches such as HPLC, thin liquid chromatography, NMR (.sup.13C or .sup.1H exchange), melting point mass spectrometry. The final conjugate is analyzed by mass spectrometry and SDS-polyacrylamide gel electrophoresis. This allows determining the number of paclitaxel molecules conjugated on each vector.

    [0250] Transcytosis capacity of Aprotinin-Paclitaxel conjugate was determined and is reported below in Table 5.

    TABLE-US-00005 Determination of aprotinin-Taxol conjugate transcytosis capacity across the BBB Transcytosis Sucrose Integrity (Pe 10.sup.3 cm/min) (Pe 10.sup.3 cm/min) Control Aprotinin 0.2 0.28 Aprotinin- 0.21 0.24 Taxol 0.22 Conjugation does not affect the aprotinin capacity to cross the barrier The integrity of the barrier is also maintained

    [0251] As seen in Table 5, conjugation of paclitaxel to aprotin still was able to cross the in vitro model of the blood brain barrier without affecting the sucrose integrity, thus proving that the molecules (also referred herein as vectors or carriers) of the present invention still retain their activity when conjugated to a large chemical entity such as paclitaxel.

    [0252] Survival study in the rat brain tumor model was then conducted to verify whether the paclitaxel that was conjugated is still active in vivo. For the rat brain tumor model, rats received an intra-cerebral implantation of 50 000 CNS-1 glioma cells. Three (3) days after, animals received treatment with vehicle (aprotinin), Paclitaxel (5 mg/kg) or Paclitaxel-Aprotinin (5 mg/kg) by intravenous injection. Treatment was then administered every week until animal was sacrificed (see FIG. 3). Rats were monitored every day for clinical symptoms and weight loss. According to the protocol of good animal practice, animals were sacrificed when a weight loss was observed for 3 consecutive days or before if the weight loss was more than 20% of the animal initial weight.

    [0253] Using the same experimental protocol, paclitaxel when injected alone at the maximal tolerated dose (54 mg/kg) was unable to increase mouse survival (Laccabue et al., 2001 Cancer, 92 (12): 3085-92).

    [0254] Survival study was also conducted in mice implanted with a human brain tumor xenograft. For the mice brain tumor model, mice received an intra-cerebral implantation of 500 000 human U87 glioma cells. 3 days after Implantation animals received treatment with Paclitaxel-Angiopep1 (5 mg/kg) or vehicle by intravenous injection. Treatment was then administered every week until animal was sacrificed. Mice were monitored every day for clinical symptoms and weight loss. According to the protocol of good animal practice, animals were sacrificed when a weight loss was observed for 3 consecutive days or before if the weight loss was more than 20% of the animal initial weight. It was now observed that the medium survival for the control group was 192 days. For the statistical analysis a 20% increase in survival was considered significant. As can be seen in FIG. 4, the conjugate Paclitaxel-AngioPep-1 retained its activity, having a statistically significant effect. The survival time of the paclitaxel-angioPep1 treated animals is significantly extended when compared to control group (p<0.05, n8).

    [0255] Results obtained in the two survival studies indicate that the conjugation of paclitaxel with the vector of the present invention increases the animal survival.

    Example II

    Effect of Taxol-Angiopep-2 Conjugate on Mice Survival

    [0256] This study with Taxol-Angiopep-2 (herein referred to peptide no. 97 was conducted to determine whether conjugation of Taxol to Angiopep-2 could increase mice survival. The structure of Angiopep-2 is illustrated in SEQ ID NO.:97. For this experiment, mice received an intra-cerebral implantation of 500 000 human U87 glioma cells. After 3 days following implantation, animals were treated with the vehicle (DMSO/Ringer-Hepes 80:20 v/v (i.e., control)) or Taxol-Angopep-2 conjugate (3:1. i.e., ratio of 3 Taxol molecules for each peptide; TxlAn2 (5 mg/kg)) by tail vein injections (FIG. 8). Mice were monitored every day for clinical symptoms and weight loss. Treatments were administered until animals were sacrificed. As shown in Table 6, we observed that the median survival was 18 days for the control group whereas the median survival for mice receiving the Taxol-Angiopep-2 conjugate was 21 days (FIG. 8). Survival curve obtained for mice treated with Taxol-Angiopep-2 conjugate (in red) indicates that the median survival was significantly increased by 17% (FIG. 8). The statistical analysis presented also in Table 6 indicates that administration of Taxol-Angiopep-2 conjugate significantly increased survival by 17% (p values=0.048).

    TABLE-US-00006 TABLE 6 Results summary of the survival study a. Median survival Days Increased (%) Mice (n) Control 18.0 7 TxlAn2 conjugate 21.0 +17 7 b. Statistical analysis differences (p values) Stat. Control vs Txlan2 conjugate p = 0.048 Yes

    Example III

    Strategies for Antibody Conjugation

    Linkers

    [0257] Proteins such as the carriers of the present invention and/or antibody molecules present various groups available for conjugation (coupling; cross-linking). For example, antibodies may be conjugated, without limitation, through sulfhydryl groups, amino groups (amines) and/or carbohydrates. The peptides described herein may be used for generating conjugates. The conjugation methods or cross-linker used is not intended to be limitative.

    [0258] Homobifunctional and heterobifunctional cross-linkers (conjugation agents) are available from many commercial sources. Different conjugation agents (homobifunctional and/or heterobifunctional), targeting various available regions were tested for conjugation of antibody molecules to the carriers (vectors) of the present invention. Regions available for cross-linking may be found on heavy and/or light chains of antibodies and/or on the carriers of the present invention. The cross-linker may comprise a flexible arm, such as for example, a short arm (<2 carbon chain), a medium-size arm (from 2-5 carbon chain), a long arm (6 carbon chain), Exemplary cross-linkers included:

    [0259] BS.sup.3 [Bis(Sulfosuccinimidyl)Suberate]

    [0260] BS.sup.3 is a homobifunctional N-hydroxysuccinimide ester that targets accessible primary amines. A conjugation scheme Is exemplified In FIG. 5.

    [0261] NHS/EDC (N-Hydroxysuccinimide and N-Ethyl-(Dimethyiaminopropyl)Carbodimide

    [0262] NHS/EDC allows for the conjugation of primary amine groups with carboxyl groups.

    [0263] Sufo-EMCS ([N-e-Maleimidocaproic Acid]Hydrazide)

    [0264] Sulfo-EMCS are heterobifunctional reactive groups (malemide and NHS-ester) that are reactive toward sulfhydryl and amino groups.

    [0265] Amine coupling using sulfo-NHS/EDC activation may be used to cross-link therapeutic antibodies with the vectors (carriers) of the present invention as exemplified In FIG. 6 and FIG. 14A. This is a fast, simple and reproducible coupling technique. The resulting conjugate is stable and retains the biological activity of the antibody. Moreover, it has a high conjugation capacity that can be reliably controlled and a low non-specific interaction during coupling procedures.

    [0266] SATA (N-Succinimidyl-S-Acetylthioacetate)

    [0267] SATA is reactive towards amines and adds protected sulfhydryls groups. NHS-ester react with primary amines to form stable amide bonds. Sulfhydryl groups may be deprotected using hydroxylamine The conjugation method is exemplified in FIG. 10A.

    [0268] Hydrazide

    [0269] Most proteins contain exposed carbohydrates and hydrazide is a useful reagent for linking carboxyl groups to primary amines as shown in FIG. 11.

    [0270] Others

    [0271] Other exemplary linkers are also illustrated in FIG. 13. However, as indicated herein, other linkers may be used.

    Analysis of Conjugates

    [0272] Antibodies and/or antibody fragments (Fab and Fab.sub.2) have been conjugated with the vector of the present invention to increase their delivery to the brain. Various conjugation approaches have been used to first conjugate IgGs with aprotinin having proven that the carriers of the present invention behave exactly as aprotinin. Conjugation of peptides (Angiopep-1, Angiopep-2 etc.,) to IgG was also studied.

    [0273] Conjugation of IgG with aprotinin using the cross-linker BS.sup.3 (FIG. 5) or sulfo-EMCS (FIG. 6) was assessed.

    [0274] Transport of IgG or IgG-conjugates across the BBB was then tested. The uptake of [.sup.125I]-IgG to the luminal side of mouse brain capillaries was measured using the in situ brain perfusion method adapted in the inventor's laboratory for the study of drug uptake in the mouse brain (Dagenals et al., 2000, J. Cereb. Blood Flow Metab. 20(2):381-386). The BBB transport constants were determined as previously described by Smith (1996, Pharm. Botechnol. 8:285-307). IgG uptake was expressed as the volume of distribution (Vd) from the following equation:


    Vd=Q*br/C*pf

    where Q*br Is the calculated quantity of [.sup.125I]-IgG or [.sup.125I]-IgG-aprotinin conjugate per gram of right brain hemisphere and C*pf is the labelled tracer concentration measured in the perfusate.

    [0275] The results of this experiment indicate that there is higher brain uptake for [.sup.125I]-IgG-aprotinin conjugate than that of unconjugated [.sup.125I]-IgG (see FIG. 7).

    [0276] Theses results indicate that conjugation of IgGs with aprotinin increases their accumulation in the brain parenchyma in vivo.

    [0277] Angiopep-2 was conjugated to IgG using SATA. It was shown by detecting the conjugate by western blot analysis that Angiopep-2 is associated with both the light and heavy chains of IgG (FIG. 10B). From FIG. 10B, it was estimated that about 3 to 5 Angiopep-2 are associated to the light and heavy chain of IgGs. Therefore, using this approach, 2 to 6 molecules of peptide (e.g. Angiopep-1, Angiopep-2, etc.) is expected be conjugated for each molecule of antibody (heavy and light chains).

    [0278] Conjugation of Angiopep-2 using sulfo-EMCS was also performed. This conjugation scheme is illustrated in FIG. 14A.

    [0279] The brain distribution of IgG-Angiopep2 conjugates coupled via sulfhydryl groups using EMCS-Angiopep-2 was tested in various brain tissues (total brain, capillaries, parenchyma). The results indicate that there is higher (about three fold difference) brain uptake of [.sup.125I]-IgG-Angiopep-2 conjugate than that of unconjugated [.sup.125I]-IgG (see FIG. 14B). The conjugation of IgG with Angiopep-2 therefore increases IgG accumulation in the brain in vivo.

    [0280] The transport of Angiopep-2-IgG conjugates coupled using the SATA method was also tested using in situ brain perfusion experiments. As shown in FIG. 15 IgG-An2 conjugates uptake in brain tissues is excellent. For example, IgG-Angiopep-2 conjugates were accumulated in the parenchyma about 50 times better than IgG.

    [0281] Following conjugation of IgG with carriers, SDS-polyacrylamide gel electrophoresis, immunodetection and autoradiography were performed to ensure proper conjugation. An exemplary result is shown in FIG. 12. In this autoradiogram, only [.sup.125I]-IgG-Angiopep conjugates were detected and there was no evidence for the presence of free Angiopep-2 conjugate showing the efficiency of the conjugation approach.

    Example IV

    Design of Carriers with Variable Amine Group Targets

    [0282] Amine groups are commonly found in proteins. Angiopep-1 (SEQ ID NO.67) and Angiopep-2 (SEQ ID NO.97) both have three amine groups available for conjugation. To study the role of amine groups in conjugation and their impact in the overall transport capacity of these carriers, analogs of Angiopep-1 and Angiopep-2 were designed to bear variable reactive amine groups and variable overall charge. These designed peptides are shown in Table 7 below.

    TABLE-US-00007 TABLE7 Carrierswithvariableaminegrouptargets Reactive SEQ Peptide amines ID Name PeptideSequences (positions) Charge No. Angiopep- Ac.sup.1- 2(10,15) +1 107 3* TFFYGGSRGKRNNFKTEEY Angiopep- RFFYGGSRGKRNNFKTEEY 3(1,10, +3 108 4b 15) Angiopep- Ac.sup.1- 2(10,15) +2 109 4a RFFYGGSRGKRNNFKTEEY Angiopep- Ac.sup.1- 1(10) +2 110 5 RFFYGGSRGKRNNFRTEEY Angiopep- TFFYGGSRGKRNNFRTEEY 2(1,10) +2 111 6 Angiopep- TFFYGGSRGRRNNFRTEEY 1(1) +2 112 7 *Angiopep-3 is an acetylated form of Angiopep-2. .sup.1Ac represents acetylation.

    [0283] Brain uptake of these carriers was measured using the previously described in situ brain perfusion experimental model. Results (shown in Table 8 below) revealed that lysines at position 10 and 15 are important in these carriers transport function.

    TABLE-US-00008 TABLE 8 Brain uptake of Angiopeps measured by in situ brain perfusion Parenchyma Carrier (ml/100 g) Angiopep-1 (50 nM) 34.9 Angiopep-1 (250 nM) 22.45 Angiopep-1 (dimer) 27.03 (250 nM) Angiopep-2 (250 nM) 19.62 Angiopep-3 (250 nM) 17.08 Angiopep-4a (250 nM) 17.57 Angiopep-4b (250 nM) 12.05 Angiopep-5 (250 nM) 11.82 Angiopep-6 (250 nM) 8.64 Angiopep-7 (250 nM) 2.99

    [0284] The Angiopep peptides were conjugated to IgG using the SATA cross-linker and their transport capacity was studied using in situ brain perfusion. As shown FIG. 16, Angiopep-2 is the most highly distributed conjugate in brain parenchyma. However, it appears that peptide dimers are efficiently transported.

    Example V

    Coupling of an Anti-EGFR Antibody to Angiopep-2

    [0285] Signaling via the epidermal growth factor receptor induces cell proliferative signals and is associated with the transformation of normal to malignant cells. Several mutations in EGFR may be detected in tumor cells. One of the most common mutation of EGFR is the EGFRvIII mutation wherein amino acids 6-273 are deleted.

    [0286] To show that coupling of carriers of the present invention to antibodies other than IgG was possible, and that coupling maintained the antibody function, an EGFR antibody (monoclonal 528 available from ATCC) was cross-linked to the vector using the cross-linker SATA as an exemplary therapeutic peptide. The biological activity of the coupled EGFR antibody was tested by staining EGFR positive U87 cells. Similar detection of EGFR in U87 using both uncoupled and coupled EGFR antibodies by FACS analysis was demonstrated (FIG. 17) showing that coupling of the antibodies of the carriers of the present invention did not ater their activity.

    [0287] In Table 9, we show that the antibodies are not inactivated by conjugation and present the same affinity for binding in an in vitro assay.

    TABLE-US-00009 TABLE 9 Kinetics analysis of the conjugate binding to EGFR receptor by FACS Anti-EGFR Anti-EGFR-Angiopep2 Bmax (RFU) 23.6 22.0 Half saturation (nM) 1.7 1.8

    [0288] Transport of EGFR antibody-conjugates (e.g., Anti-EGFR-Angiopep2) across the BBB was then measured using labeled conjugate. The uptake of Anti-[.sup.125I]-EGFR-Angiopep-2 to the luminal side of mouse brain capillaries was measured using the in situ brain perfusion method as shown in FIG. 18.

    [0289] Experimental data indicates that there is higher brain uptake for [.sup.125I]-EGFR-Angiopep-2 conjugate than that of unconjugated [.sup.125I]-EGFR Ab in all tissues tested. Therefore, the conjugation of EGFR Ab with Angiopep-2 increases its accumulation in the brain parenchyma in vivo.

    [0290] These conjugates represent an interesting avenue as several different tumor types were show to express EGFR at various levels (see Table 10).

    TABLE-US-00010 TABLE 10 Tumor type Tumors with expressed EGFR (%) Head and Neck 90-95 Breast 82-90 Renal carcinoma 76-89 Cervix/uterus 90 Esophagael 43-89 Pancreatic 30-89 Non-small-cell lung 40-80 Prostate 40-80 Colon 25-77 Ovarian 35-70 Glioma 40-63 Bladder 31-48 Gastric 4-33

    Example VI

    Coupling of an Anti-VEGF Antibody to Angiopep-2

    [0291] To further demonstrate the versatility and applicability of antibody coupling to carriers of the present invention, another exemplary therapeutic antibody was used.

    [0292] This other exemplary antibody is Avastin, an anti-VEFG recombinant humanized monoclonal IgG1 kappa isotype antibody available from Roche Biochemical. This antibody binds to and inhibits all the biologically active forms of vascular endothelial growth factor (VEGF).

    [0293] The transport of Avastin conjugates across the BBB was measured using the in situ brain perfusion method. Results show that there is higher brain uptake for [.sup.125I]-Avastin-Angiopep-2 conjugate than that of unconjugated [.sup.125I]-Avastin. Therefore, the conjugation of Avastin antibody with Angiopep-2 increases its accumulation in the brain parenchyma in vivo (FIG. 19).

    [0294] Conjugation of therapeutic antibodies (such as, but not limited to, Avastin or MAb 528 available from ATCC) to carriers of the present invention is therefore a useful strategy for their transport into the brain.

    Example VII

    Angiopep-1 Dimer

    [0295] Incubation of Angiopep-1 at 4 C. for periods of 12 hours and longer leads to multimerization/dimerization of the peptide. The transcytosis capacity of the Angopep-1 dimer was evaluated in vitro and is shown in FIG. 20 where Angiopep-dimer is shown to be transcytosed better than IgG. Moreover, as shown in Table 8, the dimeric form of Angiopep-1 shows a distribution volume higher than that of Angiopep-1. Altogether, these results show that the even in a multimeric form, for example a dimer, Angiopep-1 can still traverse the blood-brain barrier effectively and be transported to the brain.

    Example VI

    Conjugation of Antibody to More than One Carrier

    [0296] Typically, cross-linking reactions yield between 1 to 6 molecules of carrier per one molecule of antibody, heavy and light chains.

    [0297] The level of conjugation of Angiopep-2 to IgGs was estimated using an assay allowing titration of the amount of sulfhydril groups after deprotection of SATA on the amine of the IgGs before and after reaction with the maleimide group on the N terminal of Angiopep-2. By changing the relative concentration of the different reactants used in the conjugation protocol the amount of Angiopep-2 conjugated to IgGs may be optimized.

    [0298] Using in vivo brain perfusion experiments, it was observed, as shown in FIG. 21 that the higher the level of conjugation, the higher was the parenchymal uptake of conjugates. Therefore, it may be useful to have a large number of carrier per molecule to be transported in order to optimize its transport. As such, more than 6 carriers may be used for transporting a compound (agent) across the BBB.

    [0299] The content of each publication, patent and patent application mentioned in the present application is incorporated herein by reference.

    [0300] Although the present invention has been described in details herein and illustrated in the accompanying drawings, it is to be understood that the invention is not limited to the embodiments described herein and that various changes and modifications may be effected without departing from the scope or spirit of the present invention.

    [0301] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, and as follows In the scope of the appended claims.

    TABLE-US-00011 SEQUENCELISTING: SEQ ID NO.: 1 TFVYGGCRAKRNNFKSAED 2 TFQYGGCMGNGNNFVTEKE 3 PFFYGGCGGNRNNFDTEEY 4 SFYYGGCLGNKNNYLREEE 5 TFFYGGCRAKRNNFKRAKY Peptideno.5comprisestheaminoacid sequencedefinedinSEQIDNO.:5and isamidatedatitsC-terminus(seefor exampleFIG.9) 6 TFFYGGCRGKRNNFKRAKY 7 TFFYGGCRAKKNNYKRAKY 8 TFFYGGCRGKKNNFKRAKY 9 TFQYGGCRAKRNNFKRAKY 10 TFQYGGCRGKKNNFKRAKY 11 TFFYGGCLGKRNNFKRAKY 12 TFFYGGSLGKRNNFKRAKY 13 PFFYGGCGGKKNNFKRAKY 14 TFFYGGCRGKGNNYKRAKY 15 PFFYGGCRGKRNNFLRAKY 16 TFFYGGCRGKRNNFKREKY 17 PFFYGGCRAKKNNFKRAKE 18 TFFYGGCRGKRNNFKRAKD 19 TFFYGGCRAKRNNFDRAKY 20 TFFYGGCRGKKNNFKRAEY 21 PFFYGGCGANRNNFKRAKY 22 TFFYGGCGGKKNNFKTAKY 23 TFFYGGCRGNRNNFLRAKY 24 TFFYGGCRGNRNNFKTAKY 25 TFFYGGSRGNRNNFKTAKY 26 TFFYGGCLGNGNNFKRAKY 27 TFFYGGCLGNRNNFLRAKY 28 TFFYGGCLGNRNNFKTAKY 29 TFFYGGCRGNGNNFKSAKY 30 TFFYGGCRGKKNNFDREKY 31 TFFYGGCRGKRNNFLREKE 32 TFFYGGCRGKGNNFDRAKY 33 TFFYGGSRGKGNNFDRAKY 34 TFFYGGCRGNGNNFVTAKY 35 PFFYGGCGGKGNNYVTAKY 36 TFFYGGCLGKGNNFLTAKY 37 SFFYGGCLGNKNNFLTAKY 38 TFFYGGCGGNKNNFVREKY 39 TFFYGGCMGNKNNFVREKY 40 TFFYGGSMGNKNNFVREKY 41 PFFYGGCLGNRNNYVREKY 42 TFFYGGCLGNRNNFVREKY 43 TFFYGGCLGNKNNYVREKY 44 TFFYGGCGGNGNNFLTAKY 45 TFFYGGCRGNRNNFLTAEY 46 TFFYGGCRGNGNNFKSAEY 47 PFFYGGCLGNKNNFKTAEY 48 TFFYGGCRGNRNNFKTEEY 49 TFFYGGCRGKRNNFKTEED 50 PFFYGGCGGNGNNFVREKY 51 SFFYGGCMGNGNNFVREKY 52 PFFYGGCGGNGNNFLREKY 53 TFFYGGCLGNGNNFVREKY 54 SFFYGGCLGNGNNYLREKY 55 TFFYGGSLGNGNNFVREKY 56 TFFYGGCRGNGNNFVTAEY 57 TFFYGGCLGKGNNFVSAEY 58 TFFYGGCLGNRNNFDRAEY 59 TFFYGGCLGNRNNFLREEY 60 TFFYGGCLGNKNNYLREEY 61 PFFYGGCGGNRNNYLREEY 62 PFFYGGSGGNRNNYLREEY 63 MRPDFCLEPPYTGPCVARI 64 ARIIRYFYNAKAGLCQTFVYG 65 YGGCRAKRNNYKSAEDCMRTCG 66 PDFCLEPPYTGPCVARIIRYFY 67 TFFYGGCRGKRNNFKTEEY Thepeptideno.67comprisestheamino acidsequencedefinedinSEQIDNO.:67 andisamidatedatitsC-terminus(see forexampleFIG.9) 68 KFFYGGCRGKRNNFKTEEY 69 TFYYGGCRGKRNNYKTEEY 70 TFFYGGSRGKRNNFKTEEY 71 CTFFYGcCRGKRNNFKTEEY 72 TFFYGGCRGKRNNFKTEEYC 73 CTFFYGSCRGKRNNFKTEEY 74 TFFYGGSRGKRNNFKTEEYC 75 PFFYGGCRGKRNNFKTEEY 76 TFFYGGCRGKRNNFKTKEY Thepeptideno.76comprisestheaminoacid sequencedefinedinSEQIDNO.:76andis amidatedatitsC-terminus(seeforexample FIG.9). 77 TFFYGGKRGKRNNFKTEEY 78 TFFYGGCRGKRNNFKTKRY 79 TFFYGGKRGKRNNFKTAEY 80 TFFYGGKRGKRNNFKTAGY 81 TFFYGGKRGKRNNFKREKY 82 TFFYGGKRGKRNNFKRAKY 83 TFFYGGCLGNRNNFKTEEY 84 TFFYGCGRGKRNNFKTEEY 85 TFFYGGRCGKRNNFKTEEY 86 TFFYGGCLGNGNNFDTEEE 87 TFQYGGCRGKRNNFKTEEY 88 YNKEFGTFNTKGCERGYRF 89 RFKYGGCLGNMNNFETLEE 90 RFKYGGCLGNKNNFLRLKY 91 RFKYGGCLGNKNNYLRLKY Peptideno.91comprisestheaminoacid sequencedefinedinSEQIDNO.:91and isamidatedatitsC-terminus(seefor exampleFIG.9). 92 KTKRKRKKQRVKIAYEEIFKNY 93 KTKRKRKKQRVKIAY 94 RGGRLSYSRRFSTSTGR 95 RRLSYSRRRF 96 RQIKIWFQNRRMKWKK 97 TFFYGGSRGKRNNFKTEEY 98 MRPDFCLEPPYTGPCVARI IRYFYNAKAGLCQTFVYGG CRAKRNNFKSAEDCMRTCGGA 99 TFFYGGCRGKRNNFKTKEY 100 RFKYGGCLGNKNNYLRLKY 101 TFFYGGCRAKRNNFKRAKY 102 NAKAGLCQTFVYGGCLAKRNNF ESAEDCMRTCGGA 103 YGGCRAKRNNFKSAEDCMRTCG GA 104 GLCQTFVYGGCRAKRNNFKSAE 105 LCQTFVYGGCEAKRNNFKSA 107 TFFYGGSRGKRNNFKTEEY Peptideno.107comprisestheaminoacid sequencedefinedinSEQIDNO.:97andis acetylatedatitsN-terminus. 108 RFFYGGSRGKRNNFKTEEY 109 RFFYGGSRGKRNNFKTEEY Peptideno.109comprisestheaminoacid sequencedefinedinSEQIDNO.:109and isacetylatedatitsN-terminus. 110 RFFYGGSRGKRNNFRTEEY PeptideNo.110isacetylatedatitsN- terminus 111 TFFYGGSRGKRNNFRTEEY 112 TFFYGGSRGRRNNFRTEEY SEQIDNO.:106 atgagaccagatttctgcctcaagccgccgtacactgggc cctgcaaagctcgtatcatccgttacttctacaatgcaaa ggcaggcctgtgtcagaccttcgtatacggcggctgcaga gctaagcgtaacaacttcaaatccgcggaagactgcatgc gtacttgcggtggtgcttag