HIGH EXPRESSION CEREAL PHYTASE GENE
20170081648 ยท 2017-03-23
Inventors
- Henrik Brinch-Pedersen (Skaelskor, DK)
- Claus Krogh Madsen (Ringsted, DK)
- Giuseppe Dionisio (Slagelse, DK)
- Preben Bach Holm (Valby, DK)
Cpc classification
C12N15/01
CHEMISTRY; METALLURGY
A01H6/46
HUMAN NECESSITIES
C12N15/8243
CHEMISTRY; METALLURGY
A23K10/30
HUMAN NECESSITIES
International classification
C12N15/01
CHEMISTRY; METALLURGY
A23K10/30
HUMAN NECESSITIES
Abstract
The present invention provides mutant cereal plants and mature grain thereof, characterised by enhanced levels of the enzyme phytase in the grain, and methods for inducing, detecting and selecting the mutant cereal plants. The invention further relates to animal feed comprising said grain having enhanced amounts of phytase.
Claims
1-15. (canceled)
16: A Tricticum variety capable of producing an average phytase endosperm content of greater than 4300 FTU/kg, produced by the following: a) obtaining a Tricticum plant which has been identified as having a nucleotide at the 5 end of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine. b) breeding said Tricticum plant comprising said nucleotide sequence with a second Tricticum variety plant which produces an average phytase content of about 1200 FTU/kg, to produce grains, c) growing at least one Tricticum plant from said grains; d) assaying said grains to confirm the presence of said nucleotide sequence in that said variety produces an average phytase endosperm content of greater than 4300 FTU/kg.
17: The variety of claim 16 wherein said Tricticum plant has been identified by a) obtaining a sample of nucleic acids from a Tricticum plant or portion thereof; b) detecting in said sample the presence of the nucleotide t the 5 end of a polynucleotide having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine.
18: The plant or variety according to claim 17, wherein said sample of nucleic acids comprises a first polynucleotide located 5 upstream of and operably linked to a second polynucleotide, wherein said first polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG CAT (SEQ ID NO:1) [SEQ ID NO:1] wherein V is a cytosine, and wherein said second polynucleotide encodes a phytase polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity.
19: A population of Tricticum plants grown from variety of claim 16 and having an average phytase grain content of greater than 4300 FTU/kg.
20: Grain having an average phytase content of greater than 4300FTU/kg, said grain harvested from the population of claim 19.
21: A method of producing a milled cereal composition having an average phytase content of greater than 4300FTU/kg, comprising: Obtaining the grain of claim 20 and milling said grain to produce a milled cereal composition.
22: The method of claim 21 further comprising the step of cleaning or conditioning the grain.
23: The method of claim 21 further comprising the step of gristing the grain.
24: The method of claim 21 further comprising the step of breaking the grain into its cereal parts cereal grain germ, bran and endosperm.
25: The method of claim 21 wherein said milled composition is flour.
26: A milled grain composition produced by the method of claim 21.
27: The method of claim 21 further comprising the step a combining said cereal grain composition with fodder ingredients to form an animal feed.
28: The method of claim 21 further comprising the step of reducing the microbial population in said animal feed.
29: The method of claim 28 where said microbial population is reduced by introducing said animal feed to a using a steam pelleting machine for a sufficient time to reduce the microbial population to safe levels for animal consumption.
30: The method of claim 28 further comprising the step of pelleting said animal feed.
31: An animal feed comprising the milled cereal gain with an average phytase activity of about 4300 FTU/kg produced by the method of claim 21.
32: Flour having an average phytase activity of about 4300 FTU/kg produced by the method of claim 21.
33: Bread dough with enhanced inorganic phosphate levels and mineral content and improved dough mixing made from the flour of claim 32.
34: A Tricticum variety produced by the following: a) Obtaining a plant with capable of producing an average phytase endosperm content of greater than 4300 FTU/kg; b) Cultivating said plant to produce sufficient grain for breeding; c) Growing said grain d) Determining the presence of a nucleotide sequence ACA VGA GTC ATG CAT (SEQ ID NO: 1), and wherein said V is a cytosine said plant producing an average phytase endosperm content of greater than 4300 FTU/kg; e) Repeating steps c and d until a variety with an average average phytase endosperm content of greater than 4300 FTU/kg is created.
35: A Tricticum plant wherein an ancestor of said plant is the plant of claim 16.
36: A cultivated Tricticum variety having a nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine, capable of producing grain with an average phytase endosperm content of greater than 4300 FTU/kg.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0034] Listing of the figures:
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042] The nucleotide sequence of the polynucleotides comprised within the NormalPhy element and the HighPhy enhancer element are included in the alignment.
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
ABBREVIATIONS
[0049] AS-PCR: Allele specificpolymerase chain reaction;
CTP: cytosine 5-triphosphate;
dNTP: Deoxynucleotide Triphosphate;
PAPhy: Purple acid phosphates (PAP) with phytase activity; also called PAP phytases
(PAPhy);
[0050] Pfu: plaque forming units;
SNP: single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide (A, T, C, or G) in the genome differs between members of a species or paired chromosomes in an individual
1SSPE buffer: 150 mM Sodium Chloride, 10 mM Sodium Hydrogen Phosphate, 1 mM EDTA, pH 7.4);
SPP: species;
V: is the nucleotide A or C or G (not T), where B is the nucleotide in the complementary sequence.
DEFINITIONS
[0051] Cereal: A plant belonging to the Poaceae family, in particular a plant belonging to the Genus and species thereof: Avena L (e.g. Avena sativa, Oats); Hordeum L e.g. Hordeum vulgare, Barley); Oryza L (e.g. Oryza sativa, rice); Secale L (e.g. Secale cereale, Rye); Sorghum L (e.g. Sorghum bicolor); Triticum (e.g. Triticum aestivum, Triticum durum; Triticum monococcum, Triticum spelta, wheat); Zea (e.g. Zea mays, maize).
Promoter operably-linked to a gene: a promoter is a DNA molecule that is located on the same DNA strand and upstream (towards the 5 region of the sense strand) of the transcriptional start site of a down-stream gene, where the operational function of the promoter is to regulate the expression of the down-stream gene to which it is operably-linked. DNA molecules, whose function is to regulate expression of a down-stream gene, typically comprise a smaller DNA molecule that acts as an enhancer, the enhancer serving to modulate expression levels of the down-stream gene. An Enhancer is characterised by a conserved nucleotide sequence, often comprising various conserved sequence motifs whose function is to modulate gene expression levels. A gene is defined to include a polynucleotide molecule comprising coding and optionally non-coding sequence(s), the coding sequence(s) encoding a polypeptide, e.g. phytase.
Triticum aestivum: line of T. aestivum, cultivar of T. aestivum is a cultivated variety of T. aestivum that has been created or selected intentionally for specific desirable characteristics and maintained through cultivation.
Sequence identity: Identity can be measured as percent identity. The term percent sequence identity indicates a quantitative measure of the degree of homology between two nucleotide sequences of equal length. When the two sequences to be compared are not of equal length, they are aligned to give the best possible fit, by allowing the insertion of gaps or, alternatively, truncation at the ends of the nucleotide sequences. The (Nref-Ndlf)100 can be calculated as <Nref>, wherein Nd[iota]f is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. The percent sequence identity between one or more sequence may also be based on alignments using the clustalW software (http://www.ebi.ac.uk/clustalW/index.html).
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
[0052] It is recognised that, in most cases, the amount of preformed phytase activity in mature cereal grain is not sufficient to ensure sufficient phytate degradation when included in animal feed. It is further recognised that bread dough having a low phytate content has superior mixing properties, and the resulting bread has a higher nutritional value, due to an enhanced availability of minerals, including inorganic phosphate. One solution to this problem has been to produce genetically modified cereal plants having higher levels of phytase in the grain, for example by expressing a transgene encoding a heterologous or homologous gene encoding phytase. Current agricultural policy in many parts of the world, in particular Europe, has restricted the growth of transgenic crop plants. Furthermore, organic farming, based on methods that are internationally regulated and legally enforced by many nations, are not certified to use genetically modified plants or feed enzymes derived from microbial phytases. Accordingly, there remains a need for non-transgenic plants producing grain having a high phytase phenotype. The present invention addresses this need.
I. A Polynucleotide Acting as an Enhancer of Grain-Specific Gene Expression in Mutant Cereal Plant
[0053] One embodiment of the invention provides a mutant cereal plant whose genome comprises an enhancer polynucleotide having the nucleotide sequence:
TABLE-US-00002 [SEQ ID NO: 1] ACA VGA GTC ATG CAT, or [SEQ ID NO: 2] T AGA ACA VGA GTC ATG CAT,
wherein said polynucleotide is capable of enhancing grain-specific gene expression. The enhancer polynucleotide comprises a mutation whereby the nucleotide V is any nucleotide other than T (i.e. C or G or A), as compared to the corresponding polynucleotide in a wild type cereal plant having normal wild type levels of phytase (e.g. the enhancer in the wild type normal phytase polynucleotide ACA TGA GTC ATG CAT [SEQ ID NO: 3] from wheat). In a preferred embodiment, the enhancer polynucleotide has SEQ ID NO: 1, wherein the nucleotide residue designated as V, is either G or C.
[0054] A series of four overlapping motifs have been identified in the polynucleotide having the sequence:
TABLE-US-00003 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA
which comprises the enhancer of the wild type wheat phytase gene. These motifs include an odd base palindrome sequence and a GCN4 motif, a skn-1 motif and a palindomic RY-repeat. The odd base palindrome and GCN4 motif have been shown to interact with Opaque2, a maize basic leucine zipper (bZIP) transcription factor that is involved in the regulation of seed storage protein expression [3,4], whereas the RY-repeat has been shown to interact with transcription factors containing the B3 domain.
[0055] Cereal plants comprising the mutant enhancer polynucleotide, show enhanced grain-specific expression of an operably-linked gene located down-stream of the enhancer polynucleotide, indicating that the mutant polynucleotide acts to regulate enhanced gene expression in a tissue-specific manner. Proteins encoded by the operably-linked gene, whose expression in cereal plants is regulated by a structurally- and operably-linked upstream promoter polynucleotide molecule comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, accumulate enhanced levels of the encoded protein in the grain when compared to wild-type cereal plants having the wild-type enhancer sequence (see Example 1 and 7).
[0056] The enhancer polynucleotide according to the invention is further characterised by an altered expression pattern of its operably-linked gene in the grain. The enhancer causes both increased gene expression throughout the grain, but also preferential expression in the endosperm tissue of the grain, which constitutes the majority of the grain as measured by weight (Example 1 and 13). The enhanced gene expression leads to enhanced levels of the gene-encoded proteins in the endosperm of the grain, having the advantage that down-stream grain processing steps, such a dehusking/milling does not lead to a loss the protein as is the case for proteins expressed in the aleurone tissue, and outer layers/coat of the grain.
II. A Mutant Cereal Plant, Whose Genome has a Promoter Polynucleotide Comprising an Enhancer of Grain-Specific Gene Expression
[0057] A further embodiment of the invention provides a mutant cereal plant, whose genome comprises a promoter polynucleotide molecule, said molecule comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2. The mutant cereal plant of the invention is a member of the Poaceae family, preferably belonging to the Genus L, and Species (spp) thereof of the following: Avena L (e.g. Avena sativa); Hordeum L (e.g. Hordeum vulgare); Oryza L (e.g. Oryza sativa); Secale L (e.g. Secale cereale); Sorghum L (e.g. sorghum bicolor); Triticum spp selected from Triticum aestivum, Triticum durum, and Triticum spelta; and Zea (e.g. Zea mays).
[0058] In one example, the mutant cereal plant is a mutant Triticum aestivum, whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Triticum aestivum may comprise a promoter polynucleotide having SEQ ID NO: 5 or 6 or 44, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 2. Wheat plants comprising a promoter having SEQ ID NO: 5 or 6 show enhanced endosperm-specific expression of a operably-linked gene located down-stream of this promoter, indicating that the promoter acts to regulate enhanced gene expression in a tissue-specific manner. The corresponding promoter polynucleotide in wild-type Triticum aestivum cv's and Triticum tauschii that lack the enhancing properties of the mutant are provided as SEQ ID NO: 7, 10 and 11 and in 8 respectively.
[0059] In one example, the mutant cereal plant is a mutant Secale cereale whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Secale cereale may comprise a promoter polynucleotide having SEQ ID NO: 15, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 2. The corresponding promoter polynucleotide in wild-type Secale cereale that lacks the enhancing properties of the mutant is provided as SEQ ID NO: 16.
[0060] In one example, the mutant cereal plant is a mutant Hordeum vulgare whose genome comprises the enhancer polynucleotide having SEQ ID NO: 1 or 2. The genome of the mutant Hordeum vulgare may comprise a promoter polynucleotide having SEQ ID NO: 14, this promoter itself comprising the enhancer polynucleotide having SEQ ID NO: 1. The corresponding promoter polynucleotide in wild-type Hordeum vulgare that lacks the enhancing properties of the mutant is provided as SEQ ID NO: 13.
III. A Mutant Wheat Plant with High Phytase Grain
[0061] A further embodiment of the invention provides a mutant cereal plant comprising a promoter polynucleotide, said promoter comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, wherein said promoter polynucleotide lies upstream and is operably linked to a cognate phytase gene encoding a polypeptide having myo-inositol hexakisphosphate phosphohydrolase activity (phytase [EC 3.1.3.26 and EC 3.1.3.8]). In one example, the cereal plant is a mutant Triticum aestivum plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 5 or 6, or 44, and the cognate phytase gene encodes a polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90, 95 or 98% sequence identity to a sequence selected from SEQ ID NO: 18, 20, and 22. In a further embodiment, said phytase polypeptide having an amino acid sequence selected from SEQ ID NO: 18, 20, and 22 is encoded by a polynucleotide having a nucleotide sequence that has at least 70, 75, 80, 85, 90, 95 or 98% sequence identity to a sequence selected from SEQ ID NO: 17, 19, 21, and 45 (nucleotides 2091-4090), respectively.
[0062] In one example, the cereal plant is a mutant Secale cereale plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 15, and the cognate phytase gene encodes a phytase polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90 or 95% sequence identity to a SEQ ID NO: 26 or 28. In a further embodiment, said phytase polypeptide having an amino acid sequence of SEQ ID NO: 26 or 28 is encoded by a polynucleotide having nucleotide sequence that has at least 70, 75, 80, 85, 90 or 95% sequence identity to SEQ ID NO: 25 or 27, respectively.
[0063] In one example, the cereal plant is a mutant Hordeum vulgare plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2, where the promoter polynucleotide preferably has SEQ ID NO: 14, and the cognate phytase gene encodes a phytase polypeptide having both myo-inositol hexakisphosphate phosphohydrolase activity and an amino acid sequence having at least 70, 75, 80, 85, 90 or 95% sequence identity to a SEQ ID NO: 30. In a further embodiment, said phytase polypeptide having an amino acid sequence of SEQ ID NO: 30 is encoded by a polynucleotide having nucleotide sequence that has at least 70, 75, 80, 85, 90 or 95% sequence identity to SEQ ID NO: 29.
III. Methods for Detecting a Cereal Germplasm Comprising the HighPhy SNP
[0064] The polynucleotide:
TABLE-US-00004 ACA.sup.VGAGTCATGCATG
in genomic DNA of a cereal plant e.g. Triticum spp, characteristic of the HighPhy SNP, can be detected using standard DNA analysis protocols (see Example 5). For example, amplification of genomic DNA comprising the HighPhy SNP with the forward TTTCAAGCTACACTTTGTAGAACAC [SEQ ID NO: 39] and reverse GCACTAGCCAAGTTTGGACG [SEQ ID NO: 40] primers will generate a 66 bp PCR product when using Taq polymerase, whereas amplification of genomic DNA comprising a wildtype cereal with wild-type levels of normal phytase will give a similar product with forward TTTCAAGCTACACTTTGTAGAACAT [SEQ ID NO: 41] and reverse GCACTAGCCAAGTTTGGACG [SEQ ID NO: 42] primers (where the second primer [SEQ ID NO: 42] is universal).
IV Methods for Inducing and Selecting Cereal Germplasm Comprising the HighPhy SNP
[0065] HighPhy cereals (e.g. Triticum spp) can be generated by mutagenesis and subsequent screening for individuals where the polynucleotide:
[0066] ACA TGA GTC ATG CAT, corresponding to the wild type (NormPhy) enhancer, in the cereal genome has been converted into the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT, where V can be A or C or G.
[0067] In one embodiment the mutagenesis is carried out with sodium azide which preferentially generates A:T to G:C substitutions in the cereal, barley (8). Screening mutagenized populations for the desired mutation could be done by allele specific polymerase chain reaction (AS-PCR), as described in Example 6.
[0068] In an alternative embodiment, mutagenesis is carried out on cereal grain using methylene Methyl Sulphonate (MMS) to generate a population of M1 plants with random point mutations in their genome. MMS treatment leads to errors during DNA replication and thus introduces mutations. Typically this means T/A nucleotides within a sequence are converted to G/C by transversion. The M1 plants are self-fertilised and the M2 seed harvested and sown. The M2 germplasm will allow recessive and lethal alleles to be recovered as heterozygotes. DNA is individually extracted from M2 plants into 96 well plates and their seed stored for further propagation. To increase throughput of analysis, the M2 DNA samples are 8 pooled and amplified, using gene specific primers, located up- and down-stream of the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT that is to be detected. Preferably each primer carries a different fluorescent label. For example, the forward strand may be labelled with FAM [5-Carboxyfluorescein; 3,6-Dihydroxy-3-oxospiro[2-benzofuran-1,9-xanthene]-5-carboxylic acid, CAS #: 76823-03-5] and the reverse strand with HEX [HEX being a hexa-chloro derivative of FAM]. In the presence of a mutant, the amplification products when heated and cooled will form mismatched heteroduplexes between the wild type and mutated DNA. To enable identification of the point mutations induced by EMS, the amplification products are incubated with a plant endonuclease called CEL I which preferentially cleaves at sites of heteroduplex mismatches that occur between wild-type and mutant DNA. The cleavage products are size-separated on a DNA sequencing instrument, for example a capillary DNA sequencer and the fluorescently labelled traces are analysed. The differential end-labelling of the amplification products permits the two cleavage fragments to be observed and to identify the position of the mismatch. When a mutation is detected in the pooled DNA, the DNA samples in the pool are individually sequenced to identify the specific plant carrying the mutation.
[0069] The amount of phytase enzyme in the grain of plants having the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT in their genome, is then determined to confirm that the selected mutant has the high phytase phenotype, for example by employing the phytase assay described in Example 1.
V Use of High-Phytase Cereal Grain for Producing a Composition
[0070] Processing of cereal grain (for example wheat of rye grain) having phytase activity in accordance with the present invention, is carried out using traditional processing steps including one or more of the following steps:
[0071] i. Cleaning/conditioning cereal grain: First the grain is cleaned. For example the grain may be passed through magnets and/or metal detectors to remove any metal contamination. Machines can be used to separate any other seeds, stones or dust that may have got mixed with the wheat.
[0072] ii. Gristing grain: The cleaned and conditioned grain is blended with other types of grain in different proportions to make different kinds of flour.
[0073] The gristed grain passes through special rollers called break rolls. They break each grain into its three parts: cereal grain germ, bran and endosperm. Sieves sift the three separated parts into different streams.
[0074] iii Mixing: The bran, germ and endosperm fractions, having been separated out, can optionally be blended, and can be milled to make different types of milled cereal grain composition, such as Wholemeal flour using all parts of the grain; Brown flour contains about 85% of the original grain, but with some bran and germ removed; and White flour is made from the endosperm only. A flour mix comprising flour prepared from high-phytase cereal grains of the invention has particular value for bread making, due to the rapid degradation of phytate during dough fermentation (see Example 12) that confers both improved dough mixing properties and enhances the nutritional value (by increasing mineral uptake from the diet, in particular zinc, iron, calcium and and inorganic phosphate ions) of the bread produced with the dough.
[0075] iv. Steam pelleting: Milled cereal grain composition may be combined with other fodder ingredients in a steam-pelleting machine, where the components are exposed to steam at a temperature of about 80 C.-90 C. for a period of time sufficient to reduce the microbial population to levels safe for animal consumption, and the product is converted to dried pellets. Steam pelleted animal feed prepared from HighPhy cereal grain of the invention retain sufficiently high levels of phytase activity following steam-treatment, that addition of supplementary phytase granules can be avoided.
VI A Composition Comprising High-Phytase Cereal Grain
[0076] In a further embodiment, the present invention provides animal fodder comprising grain derived from the mutant cereal plant of the present invention (for example a wheat, rye or barley high-phytase mutant), where the grain are characterized by enhanced levels of phytase. Animal fodder comprising grain from the mutant wheat plant have the advantage, that the need to supplement the fodder with phytase is considerably reduced and preferably avoided, and at the same time the added high phytase cereal grain has the advantage that it is not classified as genetically modified material.
VII A Wild-Type Triticum aestivum Gene TaPAPhy_a1
[0077] In a further embodiment, the present invention provides an isolated full-length Triticum aestivum gene TaPAPhy_a1 (SEQ ID NO: 45), comprising a promoter sequence (SEQ ID NO: 7) and down-stream coding sequence comprising 5 exons and 4 introns (
Example 1
Phytase Activity of Different Triticum aestivum Cultivars
[0078] 1.1 Comparative Levels of Total Phytase Enzymatic Activity in Mature Wheat Grain
[0079] The phytase activity was measured in mature seeds of 52 individual cultivars or lines of wheat (Triticum aestivum). Mature seeds were milled and protein was extracted from 0.250 g of flour by adding 2.5 ml 220 mM Na-acatete buffer (pH 5.5) including 68 mM CaCl.sub.2 and Tween 20 (100 mg/1). The suspension was vortexed for 1 hour at room temperature and subsequently centrifuged at 3000g for 10 min. The supernatant was collected and assayed for phytase activity as described by Engelen et al., 1994 [1]. One phytase unit (U) is defined as 1 mol of Pi released upon phytate hydrolysis at 37 C. at the enzymes pH optimum.
[0080] Phytase activity ranged from 650 to 1900 FTU/kg in grain from 50 of the wheat lines (
[0081] 2.2 Distribution of Phytase Enzymatic Activity in Mature Wheat Grain
[0082] The distribution of phytase activity between outer layers and endosperm tissues of wheat grain derived from HIGHPHY wheat lines and wild type wheat lines was determined. The wheat grain samples were milled and divided into outer bran and inner endosperm fractions. The phytase activities were measured in each fraction (
Example 2
Isolation of a Wheat Phytase Gene
[0083] 2.1 Construction of a Genomic Library from Genomic DNA from Triticum aestivum, Cv Skagen:
[0084] A genomic library of DNA extracted from Triticum aestivum, cultivar Skagen, was generated using the Lambda Fix II/Xho I Partial Fill-In Vector Kit (Agilent Technologies-Stratagene Products) according to the manufacturer's instructions. The initial library was titered and the size found to be 510.sup.6 pfu. Given the constraints of the vector, which will accommodate inserts of 9-23 kb, this corresponds to 45000-115000 Mb or 2.8-7.2 times the size of the wheat genome. The library was amplified on 150 120120 mm NZY agar plates according to the manufacturer's instructions to achieve a final titer of 310.sup.6 pfu/L.
[0085] 2.2 Screening a Triticum aestivum, Cv Skagen Genomic Library for a Phytase Gene:
[0086] The amplified library was plated out on 240240 mm NZY agar plates at a density of 600 pfu/cm.sup.2. Plaque lifts were performed with Hybond N+ membranes (GE Healthcare), and the DNA was fixed on the membrane by alkaline denaturation and UV cross linking. The membranes were prehybridized in 0.25 M sodium phosphate buffer, pH 7.2, with 7% SDS and 0.17 mg/mL salmon sperm DNA at 65 C. for two hours in rolling tubes. The membranes were then hybridised in a solution comprising the radiolabelled Triticeae PAPhy specific Probe (20 microcuries), 0.25 M sodium phosphate buffer, pH 7.2, with 7% SDS at 65 C. overnight. Preparation of the probe is set out below. Ten membranes were washed at a time for 15 min in the hybridization tubes at 65 C. with 1SSPE buffer followed by one wash for one hour at 65 C. in 1 L 1SSPE buffer and 10 seconds in room temperature 1SSPE. Finally the membranes were blot dried on filter paper for 10 min and sealed in plastic envelopes.
[0087] X-ray films were exposed with the membranes at 80 C., and the developed films subsequently analysed radiolabel signals. Positive clones were cut from the original plate and isolated by successive rounds of plaque screenings.
[0088] 2.3 a Triticeae PAPhy Phytase Gene Specific Probe:
[0089] A 20 Ci .sup.32P labelled probe was generated by PCR using [P32]dCTP and the primers:
TABLE-US-00005 (SEQ ID NO: 31) PAP ex3 Fw: CTTGAGCCTGGGACGAAGT and (SEQ ID NO: 32) PAP ex3 Rv: GAGAAGGACCCGCTCTCC,
[0090] and a template consisting of a plasmid comprising a cDNA molecule whose nucleotide sequence encoded the wheat Purple Acid Phosphatase Phytase b (TaPAPhy_b). The primers amplified a portion of the cDNA molecule whose nucleotide sequence corresponds to the highly conserved third exon of the Triticeae PAPhy_b gene. The amplified sequence generated a DNA probe of 479 nucleotides in length. Remaining unincorporated dNTPs were removed with an Illustra MicroSpin G-50 Column (GE Healthcare). The probe was denaturated by boiling followed by shock cooling in 500 L of 10 g/L sonicated salmon sperm DNA.
[0091] 2.4 Isolation and Characterisation of Triticeae PAPhy Phytase Gene:
[0092] Isolated lambda (2) clones, selected by the Triticeae PAPhy specific probe, were amplified on five to twenty 82 mm diameter NZY agar plates and DNA was isolated from the phage harvested from the plates using the Lambda midi kit (Qiagen) according to the manufacturer's instructions.
[0093] One isolated clone, comprising the genomic DNA molecule designated TaG2, was sequenced (SEQ ID NO: 45) and found to comprise a polynucleotide comprising a 2000 bp promoter region having the sequence (SEQ ID NO: 43).
Example 3
Amplification and Characterization of Phytase Gene Promotors from Different Triticum aestivum and Triticum tauschii Cultivars
[0094] 3.1 Isolation of Phytase Gene Promoters by PCR
[0095] Genomic DNA was isolated from 10 cultivars of T. aestivum and 2 accessions of T. tauschii (also known as Ae. Tauschii), as shown in table 1.
TABLE-US-00006 TABLE 1 Cultivars and accessions from which the TaPAPhy_a1 promoter was amplified. Cultivar/accession Notes Bob White T. aestivum model cultivar Skagen T. aestivum commercial cultivar Flair T. aestivum commercial cultivar Spelt T. aestivum spp spelta commercial sample Pentium T. aestivum commercial cultivar Landrace 01 T. aestivum Landrace Landrace 02 T. aestivum Landrace HighPhy 01 Novel high phytase T. aestivum cultivar HighPhy 02 Novel high phytase T. aestivum cultivar NGB90403 T. tauschii NGB9855 T. tauschii
[0096] TaPAPhy_a1 promoter region was amplified from genomic DNA isolated from each of the above cultivars using primer pairs based on the sequence of the high phytase gene, designated, clone: TaG2. The first primer pair was designed for amplifying the first exon and 2041 bp 5 upstream flanking region (promoter) of the TaPAPhy_a1 gene:
TABLE-US-00007 (SEQ ID NO: 33) TaPAPhy_a1-pro-ex1 Fw: TTATGTGTCCGCGTGAAGTG and (SEQ ID NO: 34) TaPAPhy_a1-pro-ex1 Rv: ACCAAGAGTCAATGCCATCC
[0097] An additional primer pair was designed to amplify a shorter sequence which includes 288 bp of the 5 flanking region (promoter) and 147 bp of the first exon of the TaPAPhy_a1 gene:
TABLE-US-00008 (SEQ ID NO: 35) TaPAPhy_a1 311 cons Fw: TTTGGACGAGCCATAGCTGCATA and (SEQ ID NO: 36) TaPAPhy_a1 167 Rv: CGCTGCACCCGGGGGTCCGT
[0098] The latter primer pair was used with cultivars where the first primer pair failed to yield an amplification product.
[0099] PCR was performed with Herculase II (Agilent TechnologiesStratagene Products) according to the manufacturer's instructions, but with the modification that 6% DMSO was used in the reaction mixture.
[0100] Amplicons of the expected size were isolated from agarose gels and cloned in the pCR4Blunt TOPO vector (Invitrogen) and sequenced.
[0101] 3.2 Characterization of the Promoter Region of Isolated T. aestivum and T. tauschii Phytase GenesAlignment of 1000 bp
[0102] The long PCR amplicon, (corresponding to 2041 bp 5 upstream flanking promoter region the first exon and of the TaPAPhy_a1 gene) was obtained from 10 cultivars of T. aestivum, whereas only the short amplicon (corresponding to 147 bp of the first exon and 288 bp of the 5 flanking promoter region of the TaPAPhy_a1 gene) was obtained from two accessions of T. tauschii. The 1000 bp 5flanking region and start codon of each of the T. aestivum genes were aligned, and used for a pair wise comparison (see
[0103] The T. aestivum PAPhy phytase gene (in clone TaG2) and the PCR amplicon obtained from amplifying genomic DNA from the same cultivar, Skagen, had the same nucleotide sequence, and are included in
[0104] 3.3 Characterization of the Promoter Region of Isolated T. aestivum and T. tauschii Phytase GenesAlignment of 288 bp
[0105] The 288 bp 5flanking region and start codon of each of the T. aestivum genes together with the corresponding sequence from T. tauschii were aligned, and used for a pair wise comparison (
[0106] The amplified 288 bp 5flanking promoter region from each of: wild-type T. aestivum cultivars; HighPhy T. aestivum cultivars; and T. tauschii cultivars shared nucleotide sequence identity within each of the three groups. However, the nucleotide sequence of the promoter regions of the two HighPhy T. aestivum cultivars differs from the wild-type 9 T. aestivum cultivars in two nucleotides, and differs from the two T. tauschii cultivars in 3 nucleotides. In turn the nucleotide sequence of the promoter regions from the two T. tauschii cultivars differs from wild-type T. aestivum cultivars in 3 nucleotides.
[0107] It can be seen from the alignment in
Example 4
Genomic Context of the SNP in HighPhy T. aestivum Cultivars
[0108] Sequence analyses of the immediate surroundings of the HighPhy SNP reveals sequence motifs known to be involved in gene regulation. Consider first the sequence found in wild type T. aestivum (wheat) cultivars (wt):
TABLE-US-00009 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA
[0109] It consists of four overlapping motifs:
[0110] In bold font, the odd base palindrome sequence reported by [3];
[0111] In enlarged font, GCN4 motif, involved in endosperm specific gene expression [4];
[0112] In italic font, the skn-1 motif reported by [5];
[0113] In underlined font, the palindomic RY-repeat identical to that reported by [6].
[0114] Note that the skn-1 and GCN4 motifs are contained within the odd base palindrome. The odd base palindrome and GCN4 motif have been shown to interact with Opaque2, a maize basic leucine zipper (bZIP) transcription factor involved in the regulation of seed storage proteins [3,4], whereas the RY-repeat has been shown to interact with transcription factors containing the B3 domain. It is known to be an enhancer of seed-specific expression and a repressor of vegetative expression in A. thaliana [7].
[0115] Consider now the sequence from the HighPhy T. aestivum cultivars:
TABLE-US-00010
[0116] The mutation, identified by the elevated C, abolishes the odd base palindrome and the GCN4 motif, but leaves the skn-1 motif and the RY-repeat unchanged. A new motif, boxed, is thereby introduced. This motif shows similarity to the G-box CACGTG (1) but lacks the highly conserved palindromic nature of the G-box, and represents a completely novel motif, acting as a cis-acting regulatory element. This mutation, found in HighPhy T. aestivum cultivars, is either the result of the abolition of the odd base palindrome or the result of the introduction of the novel motif
Example 5
Method for Detecting the HighPhy SNP in the Genome of Cereal Plants
[0117] The SNP in the genome of a cereal plant that is located in a polynucleotide comprising the enhancer element having the nucleotide sequence
TABLE-US-00011 CGAGTCATGCATGGGA
was detected using the technique of High Resolution Amplicon Melting Analysis [10]. PCR was performed in 10 L volumes in a LightCycler (Roche Applied Systems) with programmed transitions of 20 C./s unless otherwise indicated. The amplification mixture included 50 ng genomic DNA as template, 200 M each deoxynucleotide triphosphate (dNTP), 0.4 U KlenTaq1 polymerase (ABPeptides), 88 ng TaqStart antibody (ClonTech), 3 mM MgCl2, 50 mM Tris (pH 8.3), 500 ng/L bovine serum albumin, 0.5 M primers located upstream and downstream of the SNP and 1-10 M LCGreen, in order to amplify an polynucleotide of around 40-300 nucleotides in length. Melting analysis was performed on the LightCycler. After amplification, the samples are heated momentarily in the LightCycler to 94 C. and cooled to 40 C. The LightCycler capillary is then transferred to the high-resolution melting instrument and heated at 0.3 C./s. Sample temperature and fluorescence signals are converted to 16-bit digital signals, which are then analysed to detect the SNP.
Example 6
Method for Inducing and Selecting Wheat Germplasm Comprising the HighPhy SNP and Grain with High Levels of the Enzyme Phytase
[0118] HighPhy wheat can be generated by mutagenesis and subsequent screening for individuals where the polynucleotide TGAGTCATGCATG, corresponding to the wild type (NormPhy) element, in the wheat genome has been converted into the mutant (HighPhy) element CGAGTCATGCATG. The mutagenesis is carried out with sodium azide which preferentially generates A:T to G:C substitutions in barley (8). Screening mutagenized populations for the desired mutation could be done by allele specific polymerase chain reaction (AS-PCR).
[0119] Procedure: Wheat grains are presoaked for 15 hours in demineralised water at 5 C. and then treated with an oxygenated solution of 1 mM sodium azide at pH 3 for 2 hours. The grains are washed and sown out, and grown to mature plants. Genomic DNA is isolated from leaves of each individual plant before the plant begins to senesce, using a standard DNA extraction procedure [9], whereas grains are harvested at maturity. Grains from individual plants are kept apart and labelled so they can be matched with the corresponding DNA isolates. The DNA isolates are screened by AS-PCR using the following primer pair:
TABLE-US-00012 [SEQ ID NO: 37] HighPhy Fw: 5CAAGCTACACTTTGTAGAACAC 3 [SEQ ID NO: 38] PAPhy Rv: 5CGCTGCACCCGGGGGTCCGT 3
[0120] The first 21 nucleotides of the HighPhy Fw primer anneal 5 to the HighPhy enhancer polynucleotide, whereas the 3C nucleotide anneals to the actual SNP, this SNP being the distinguishing nucleotide between the HighPhy and NormPhy element polynucleotides. The PAPhy Rv primer anneals to a highly conserved part of the coding sequence of the PAPhy phytase gene, and can thus be expected to anneal to all known loci in the genome containing the wheat PAPhy phytase gene. The AS-PCR is performed using a non-proofreading polymerase to ensure specificity, and detection of the SNP. A series of replicate AS-PCR, using the HighPhy Fw primer and PAPhy Rv primer pair, are performed under conditions of increasing stringency (e.g. increasing PCR annealing temperature), on control genomic DNA samples isolated from HIGHPHY01 wheat grain of the invention and a wildtype NormPhy wheat plant. Under selected conditions of stringency, AS-PCR is then performed on DNA isolated from HighPhy mutation positive plants to amplify an amplicon of 300 to 700 bp in length, which can be identified by agarose gel electrophoresis, whereas plants lacking the HighPhy mutation will not produce an amplicon. The amplified product is then cloned and sequenced to confirm that the presence of the mutant (HighPhy) element CGAGTCATGCATG in the genomic DNA isolate. AS-PCR conditions that are sufficiently stringent to selectively amplify HighPhy mutation positive plants, are then employed to screen genomic DNA isolated from each individual mutagenized plant. Grain from HighPhy mutation positive plants can then be cultivated further to generate sufficient grain for subsequence breeding and crop production.
Example 7
Phytase Activity of Different Secale cereale Cultivars
[0121] 7.1 Comparative Levels of Total Phytase Enzymatic Activity in Mature Secale cereale (Rye) Grain
[0122] The phytase activity was measured in mature seeds of 5 individual cultivars rye, as described for seeds of Triticum aestivum, detailed in Example 1.1. Phytase activity ranged from 1600 to 6000 FTU/kg in grain from the 5 rye line (
Example 8
Amplification and Characterization of Phytase Gene Promotors from Different Secale cereale and Hordeum vulgare Cultivars
[0123] 8.1 Isolation of Phytase Gene Promoters by PCR
[0124] Genomic DNA was isolated from Secale cereale and Hordeum vulgare cultivars and the phytase gene promoter was amplified by PCR as described in Example 3.1.
Example 9
Structural Characterisation of Cereal Phytase Enzymes and the Coding Sequence of their Cognate Genes
[0125] The promoter of the invention comprising an enhancer polynucleotide having SEQ ID NO: 1 or 2, is structurally and operably linked to a polynucleotide molecule comprising a coding sequence encoding a phytase enzyme. The polynucleotide molecule in the genome of a cereal plant encoding a phytase enzyme comprises a coding sequence (comprising one or more exon) and a non-coding sequence (comprising one or more intron). The amino sequence and the nucleotide sequence of the coding sequence encoding a phytase enzyme derived from the Triticum aestivum cv., (Ta); Secale cereale cv (Sc); and Hordeum vulgare cv., (Hv) are as follows: [0126] TaPAPhy_a1 phytase (SEQ ID NO: 18) encoded by TaPAPhy_a1 cDNA (SEQ ID NO: 17); [0127] TaPAPhy_a2 phytase (SEQ ID NO: 20) encoded by TaPAPhy_a2 cDNA (SEQ ID NO: 19); [0128] TaPAPhy_a3 phytase (SEQ ID NO: 22) encoded by TaPAPhy_a3 cDNA (SEQ ID NO: 21); [0129] TmPAPhy_a4 phytase (SEQ ID NO: 24) encoded by TmPAPhy_a4 cDNA (SEQ ID NO: 23); [0130] ScPAPhy_a1 phytase (SEQ ID NO: 26) encoded by ScPAPhy_a1 cDNA (SEQ ID NO: 25); [0131] ScPAPhy_a2 phytase (SEQ ID NO: 28) encoded by ScPAPhy_a1 cDNA (SEQ ID NO: 26); [0132] HvPAPhy_a1 phytase (SEQ ID NO: 30) encoded by HvPAPhy_a1 cDNA (SEQ ID NO: 29);
[0133] The phytase enzyme in mutant HighPhy Triticum aestivum has an amino acid sequence similar to the phytase enzyme in wild type Triticum aestivum cv's Bobwhite and Skagen. Their amino acid sequences differ by the deletion of three amino acid residues and the substitution of three residues in the HighPhy cultivar when compared to cv's Bobwhite and Skagen, these differences being located within the 120 residue long signal peptide region at the amino-terminus. The substitutions are conservative, G.fwdarw.A and S.fwdarw.T.
Example 10
Stability of Phytase Activity in Wheat Flour Subjected to Steam Treatment
[0134] Animal feed comprising milled cereal grain, is commonly subjected to steam pelleting, which is a two-step process of conditioning followed by pelleting. During conditioning the milled feed is mixed and simultaneously heated to about 80 C. and its moisture content is increased by exposure to steam. The experimental set up used in this example simulates the combination of heat and moisture used during conditioning.
[0135] The experimental setup consisted of a GFL 1083 water bath with a plastic tray floating on the surface of the water and occupying approximately half of the surface area of the water. A thermometer, placed inside the tray, was used to monitor the headspace temperature before and after incubation. The water bath was equipped with a thermostat and a lid so a constant temperature and steam-filled headspace with 100% relative humidity could be maintained. The water bath was set to 80 C., and once this temperature was reached, it was allowed to equilibrate for one hour. The headspace temperature was found to be 80 C. at this point.
[0136] Eight to nine grams of sample wheat grains were milled on a Retsch RM100 mortar grinder mill, and the resulting flour was distributed in weighing boats, 500 mg in each. The steam treatment consisted of incubating the weighing boats with samples on the plastic tray for various periods of time. The lid of the water bath remained closed for the duration of the incubation and the temperature of 80 C. in the headspace was verified before and after each incubation. Following steam treatment, the wheat flour samples were dessicated overnight in an exicator with silica gel.
[0137] Once dried, the phytase activity of the wheat flour samples was assayed using the assay described by (Engelen, Vanderheeft, Randerheeft & Smidt, 1994 [1])
[0138] Two measurements, (A) and (B), of phytase activities of wild type wheat (T. aestivum cv. Bobwhite (BW)) and HighPhy (HIGHPHY) wheat, after 0, 10, 20 and 40 min of incubation at 80 C. at 100% relative humidity, are shown in
[0139] The experimental conditions used to test phytate stability were more extreme than those of commercial steam-pelleting, where the duration of steam treatment of normally around 1 minute. It is thus expected that the residual phytase activity in pelleted feed made from HighPhy cereal grains of the invention will lie above the level at which supplementary phytase is required (circa 2500 FTU/kg).
Example 11
Stability of Phytase Activity in HighPhy Secale cereale (Rye) Subjected to Steam Treatment
[0140] Grain of HighPhy rye were milled and the resulting flour was subjected to simulated conditioning, using the same experimental set up as used for wheat flour in example 10. A single measurement of phytase activity of HighPhy rye, after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of incubation at 80 C. at 100% relative humidity, are shown in
Example 12
Enhanced Phytate Degradation in High-Phy Wheat Flour
[0141] Phytase degradation during fermentation of dough improves its nutritional and bread-making quality, since phytase degradation enhances inorganic phosphate levels and mineral content in bread, and is known to improve dough mixing quality. Dough made from HighPhy wheat is shown to provide these advantages.
[0142] Wild type wheat (T. aestivum cv Bobwhite (BW)) and HighPhy wheat (HP) grains were milled on a Retsch RM100 mortar grinder mill. The phytate content in the resulting flour was determined using the procedure described by (Vaintraub & Lapteva, 1988). Flour (250 mg) was mixed with 0.1 ml of bakers yeast water stock (dry yeast in 3 mg/ml water). An additional 0.2 ml of water was added to form a dough. The dough was fermented at 25 C. for 0.5, 1, 3 and 3 hrs. After fermentation, the phytate content was determined again, using the same procedure (Vaintraub and Lapteva, 1988).
[0143] The initial phytate content of HP wheat flour was a little higher than that of BW wheat (
TABLE-US-00013 TABLE 2 Percent residual phytate (IP6) in dough of wild-type (BW) and HighPhy (HP) wheat flour BW HP Time residual IP6 (%) residual IP6 (%) 0 100 100 0.5 97.8 85.9 1.0 91.9 82.7 1.5 86.2 66.9 2.0 73.8 53.6 3.0 68.3 43.8
Example 13
The HighPhy Enhancer in the Barley Phytase Gene Confers Both Aleurone and Endosperm-Specific Expression in Developing Barley Grain
[0144] 13.1 Cloning of Promoter-GUS Constructs for Examination of the HighPhy Mutation:
[0145] The HighPhy mutation was introduced in the pCLEAN-G185-PAPhy_a construct with the mutagenic primers:
TABLE-US-00014 (SEQ ID No. 46) HvPAPhy_a SDmut Fw 5GTAGAACACGAGCCATGCATGAGAC3 (SEQ ID No. 47) HvPAPhy_a SDmut Rv 5TGGCTCGTGTTCTACAAAATGTAGC3
[0146] This yielded the pCLEAN-G185-HP-PAPhy_a construct.
[0147] The two constructs pCLEAN-G185-PAPhy_a and pCLEAN-G185-HP-PAPhy_a were further modified to serve as promoter-reporter gene constructs. To achieve this, the PAPhy_a coding open reading frame and terminator was replaced by the UidA open reading frame followed by the NOS terminator. The cloning was performed with the In-Fusion technology as described in (Zhu, Cai, Hall and Freeman, 2007). This approach ensured seamless joining of the promoter and reporter gene so the start codon context was preserved.
[0148] The vector backbone and promoter of both constructs were amplified using the primers:
TABLE-US-00015 (SEQ ID No. 48) Cis to GUS Fw 5TCGAGTCGACGTTCCTTGAC3 (SEQ ID No. 49) Cis to GUS Rv 5GTTGATGTTGTTGCTTGGCATTG3
[0149] The UidA and NOS terminator were amplified from pGUSN which is a pUC18 plasmid comprising an UidA gene and a downstream NOS terminator, using the primers:
TABLE-US-00016 GUS Fw m. overhang (SEQ ID No. 50) 5AGCAACAACATCAACATGTTACGTCCTGTAGAAACC3 GUS Rv m. overhang (SEQ ID No. 52) 5GGAACGTCGACTCGACTATGACCATGATTACGAATTCC3
[0150] Performing the In-Fusion with the resulting amplicons gave the two GUS reporter constructs, pCLEAN-G185-wt-proGUS (SEQ ID No. 52) and pCLEAN-G185-HP-proGUS (SEQ ID No. 54).
[0151] 13.2: Constructing Randomized Phytase Gene Enhancer Element Sequences to Confirm the Criticality of the Promoter Enhancer Element Comprising the HighPhy Mutation.
[0152] The enhancer element motifs surrounding the HighPhy mutation were removed by sequence randomization by taking the 20 bp corresponding to SEQ ID 4 in the pCLEAN-G185-PAPhy_a construct and subjecting the sequence to a nucleotide randomizer (http://molbiol.ru/eng/scripts/(01_16.html) using settings designed to preserve the nucleotide ratios of the original sequence. The resulting sequence, 5 gcatacgaagcatagtacga3, was only identical to the original in three nucleotide positions and did not contain any regulatory elements known by PlantCARE*. The original 20 bp in pCLEAN-G185-wt-proGUS was replaced by the randomized sequence as described by Zhu and co-workers using the primers:
TABLE-US-00017 Kill triad Fw (SEQ ID No. 56) 5gcatacgaagcatagtacgaCGTAGGCGTCCAAACTTTG3; Kill triad Rv (SEQ ID No. 57) 5tcgtactatgcttcgtatgcCTACAAAATGTAGCTTGAAATTAAAG AG3
[0153] The resulting construct was pCLEAN-G185-KOtriad-proGUS (SEQ ID No. 58).
[0154] 13.3 Transient Expression in Developing Barley Endosperm and Aleurone:
[0155] The three constructs were individually introduced into developing (from 14 to 35 days after pollination) barley endosperm and aleurone cells by particle gun bombardment. Immature barley seeds were sterilized, and cultured on media and bombarded in a DuPont PDS 1100 helium biolistic delivery system using the procedures described in (BrinchPedersen, Galili, Knudsen, & Holm, 1996). Expression of the uidA gene was assayed in the plant tissues two days after bombardment, using the gus reaction buffer, as described in Jefferson, Kavanagh, & Bevan, 1987. Gus expression was scored by localizing blue spots on the bombarded tissues.
[0156] In tissues bombarded with the pCLEAN-G185-wt-proGUS plasmid, blue spots were mainly identified in the aleurone layers, with very limited expression in the endosperm. In pCLEAN-G185-HP-proGUS bombarded tissues more expression could be observed in the endosperm tissue. No expression was detected in grain bombarded with the pCLEAN-G185-KOtriad-proGUS. These data confirm that the HighPhy mutation in the context of the barley phytase gene enhancer confers both aleurone and endosperm-specific expression
Example 14
Identification of the Wild Type Locus in the Wheat Genome Corresponding to the HighPhy Phytase Gene
[0157] The mutant gene was aligned to the three homeologous PAPhy_a genes from the wild type cultivar Chinese spring. The alignment was adjusted to include only the exons and introns of the gene. An UPGMA tree was generated with 1000 bootstrap replications (
[0158] 14.1 Chromosomal Mapping of the TaPAPhy_a1 Gene:
[0159] Wheat chromosomal mapping was performed using the Chinese Spring nullisomic-tetrasomic lines described by (Kimber & Sears, 1979. There are 42 possible nullisomic-tetrasomic lines, of which two were missing in the present set of lines (the nullisomic (N) 2A tetrasomic (T) 2B and the N4BT4D lines), but their absence did not compromise the mapping. The following primers where designed to specifically amplify a 522 basepair segment of the TaPAPhy_a1 gene:
TABLE-US-00018 Forward 5GAGATTCCGAGACCAACGAA3 Reverse 5TTTGCCTCCACTCTGCCTAC3
[0160] The amplicon was exclusively absent from two lines nulisomic for chromosome 5D and tetrasomic for chromosome 5A and 5B respectively (N5DT5A and N5DT5B). Thus, TaPAPhy_a1 maps to chromosome 5D.
LITERATURE CITED
[0161] [1] Engelen A J, Heeft F C yen der, Randsdorp P H G, Smit E L C (1994) Simple and rapid determination of phytase activity. J AOAC Internat 77: 760-764. [0162] [2] Eeckhout W, Depaepe M (1994) Total phosphorus, phytate-phosphorus and phytase activity in plant feedstuffs. Anim Feed Sci Tech 47: 19-29. [0163] [3] Depater S, Katagiri F, Kijne J, Chua N H (1994) Bzip Proteins Bind to A Palindromic Sequence Without An Acgt Core Located in A Seed-Specific Element of the Pea Lectin Promoter. Plant Journal 6: 133-140 [0164] [4] Wu C Y, Suzuki A, Washida H, Takaiwa F (1998) The GCN4 motif in a rice glutelin gene is essential for endosperm-specific gene expression and is activated by Opaque-2 in transgenic rice plants. Plant Journal 14: 673-683 [0165] [5] Blackwell T K, Bowerman B, Priess J R, Weintraub H (1994) Formation of A Monomeric Dna-Binding Domain by Skn-1 Bzip and Homeodomain Elements. Science 266: 621-628 [0166] [6) Baumlein H, Nagy I, Villarroel R, Inze D, Wobus U (1992) Cis-Analysis of A Seed Protein Gene Promoterthe Conservative Ry Repeat Catgcatg Within the Legumin Box Is Essential for Tissue-Specific Expression of A Legumin Gene. Plant Journal 2: 233-239 [0167] [7] Fujiwaraa, T., Nambara, E., Yamagishi, K., Goto, D. B., Naito, S. (2002) Storage Proteins. The Arabidopsis Book, 2002 American Society of Plant Biologists. [0168] [8] Olsen, O., et al. Proc. Natl. Acad. Sci. USA (1993) Vol. 90, pp. 8043-8047. [0169] [9] Sambrook, Fritsch and Maniatis (2001) Molecular Cloning: A Laboratory Manual (2nd Edition) Cold Spring Harbor Laboratory Press. [0170] [10] Wittwer, C. T., et al., (2003) High resolution genotyping by amplicon melting analysis using LCgreen Clinical Chemistry: 49:6 853-860. [0171] BrinchPedersen, H., Galili, G., Knudsen, S., & Holm, P. B. (1996). Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase. Plant Molecular Biology, 32(4), 611-620. [0172] Engelen, A. J., Vanderheeft, F. C., Randsdorp, P. H. G., & Smit, E. L. C. (1994). Simple and Rapid-Determination of Phytase Activity. Journal of Aoac International, 77(3), 760-764. [0173] Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). GUS FUSIONSBETA-GLUCURONIDASE AS A SENSITIVE AND VERSATILE GENE FUSION MARKER IN HIGHER-PLANTS. Embo Journal, 6(13), 3901-3907. [0174] Kimber, G., & Sears, E. G. (1979). Use of wheat aneuploids. Basic Life Sciences, 13, 427. Vaintraub, I. A., & Lapteva, N. A. (1988). COLORIMETRIC DETERMINATION OF PHYTATE IN UNPURIFIED EXTRACTS OF SEEDS AND THE PRODUCTS OF THEIR PROCESSING. Analytical Biochemistry, 175(1), 227-230. doi: 10.1016/0003-2697(88)90382-x [0175] Zhu, B. G., Cai, G. F., Hall, E. O., & Freeman, G. J. (2007). In-Fusion (TM) assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations. Biotechniques, 43(3), 356-359. doi: 10.2144/000112536 [0176] PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences: [0177] Magali Lescot, Patrice Dhais, Gert Thijs, Kathleen Marchal, Yves Moreau, Yves Van de Peer, Pierre Rouz and Stephane Rombauts Nucleic Acids Res. 2002 Jan. 1; 30(1): 325-327