Method for forming nanoparticles having predetermined shapes
09598690 ยท 2017-03-21
Assignee
Inventors
Cpc classification
B22F1/07
PERFORMING OPERATIONS; TRANSPORTING
C12N9/98
CHEMISTRY; METALLURGY
B82B3/0033
PERFORMING OPERATIONS; TRANSPORTING
International classification
C12N9/98
CHEMISTRY; METALLURGY
Abstract
Articles and methods for forming nanostructures having unique and/or predetermined shapes are provided. The methods and articles may involve the use of nucleic acid containers as structural molds. For instance, a pre-designed nucleic acid container including a cavity may be used to control the shape-specific growth of nanoparticles. Growth of the nanoparticles within the cavities may be confined by the specific shape of the nucleic acid container. In some embodiments, the resulting nucleic acid-nanoparticle structures can be used to control the orientation and numbers of surface ligands on the surface of nanoparticles. The addressability of the surface ligands can be used to form higher ordered assemblies of the structures.
Claims
1. A method comprising: growing a nanoparticle from a nanoparticle precursor inside a nucleic acid container by applying a stimulus to the nanoparticle precursor positioned inside of the nucleic acid container, wherein the nucleic acid container is a template for formation of the nanoparticle, wherein the nanoparticle has a different shape than the nanoparticle precursor, wherein the nanoparticle comprises at least one surface portion having a shape that is complementary to a shape of an inner surface portion of the nucleic acid container having a predetermined three-dimensional structure at the sub-nanometer level, and wherein the nanoparticle and the nucleic acid container have a three-dimensional shape that includes at least 4 different sides.
2. A method as in claim 1, wherein the nanoparticle comprises an inorganic nanoparticle.
3. A method as in claim 1, wherein the nanoparticle precursor comprises a monomer of an organic polymer, an enzyme, or a peptide.
4. A method as in claim 1, wherein the nanoparticle precursor has a cross-sectional dimension of less than or equal to 50 nm.
5. A method as in claim 1, wherein the nanoparticle has a shape that is complementary to a shape of the inner surfaces of the nucleic acid container.
6. A method as in claim 1, wherein the nanoparticle is an inorganic nanoparticle.
7. A method as in claim 1, wherein the nanoparticle comprises a polymer.
8. A method as in claim 1, wherein the nanoparticle has at least one cross-sectional dimension that is less than or equal to 1 micron.
9. A method as in claim 1, wherein the nanoparticle has an aspect ratio of at least 2:1.
10. A method as in claim 1, further comprising attaching an isolated nucleic acid strand comprising DNA and/or RNA to a surface of the nanoparticle.
11. A method as in claim 1, wherein the nucleic acid container comprises a cavity having a volume, and at least 60% -of the volume is filled with the nanoparticle.
12. A method as in claim 1, wherein the nucleic acid container comprises a cavity in the shape of a polyhedron.
13. A method as in claim 1, wherein the nucleic acid container comprises at least one lid that can be open or closed.
14. A method as in claim 1, wherein the nucleic acid container comprises a cavity, and a cross-sectional dimension of the cavity is less than or equal to 1 micron.
15. A method as in claim 1, wherein the nucleic acid container comprises a nucleic acid having a molecular weight of at least 640 kDa.
16. A method as in claim 1, wherein the nucleic acid container comprises a cavity having a pre-designed three-dimensional structure, and the shape of the nanoparticle is formed, at least in part, by molding against the cavity.
17. A method as in claim 1, wherein the growing step comprises controlling ion diffusion kinetics to control the growth kinetics and/or composition of the nanoparticle.
18. A method as in claim 1, further comprising attaching a protein, a peptide, a marker, or a second nanoparticle to a surface of the nanoparticle.
19. A method as in claim 1, wherein the nanoparticle is formed using a nanoparticle precursor solution.
20. A method as in claim 1, wherein the stimulus is an external force, a chemical component.
21. A method as in claim 20, wherein the stimulus is selected from the group consisting of heat, light, pressure, electrical potential, magnetic force, electromagnetic force, a chemical component.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the invention shown where illustration is not necessary to allow those of ordinary skill in the art to understand the invention. In the figures:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) Articles and methods for forming nanostructures having unique and/or predetermined shapes are provided. In some embodiments, the methods and articles involve the use of nucleic acid containers as structural molds. For instance, a pre-designed nucleic acid container including a cavity may be used to control the shape-specific growth of nanoparticles. Growth of the nanoparticles within the cavities may be confined by the specific shape of the nucleic acid container. Using such a method, nanoparticles having complex and predetermined shapes and sizes can be formed. The resulting nanoparticle that is coated with a nucleic-acid container may be used as is, or the nucleic acid coating may be removed partially or completely if desired.
(24) Additionally, the methods described herein allow the material composition of the grown nanoparticles to be controlled by using different nanoparticle precursors and/or by controlling the thickness of the walls of the nucleic acid containers. In some embodiments, controlling such parameters can allow the formation of nanoparticle alloys having predetermined and controlled ratios of material components. In some embodiments, the resulting nucleic acid-nanoparticle structures can be used to control the orientation, numbers, types, and positioning of components such as binding sites, markers, and surface ligands on the surface of the nanoparticles or the surface of the nucleic acid containers. Advantageously, nanoparticles having a predetermined number and orientation of unique components attached to the nanoparticle or nucleic acid container surface may allow addressability of the structures for applications such as multiplexed detection of target molecules. Moreover, the addressability of the structures can be used to form higher ordered assemblies of the structures in some embodiments.
(25) The articles and methods provided herein have applications in a number of different fields, including the areas of bio-sensing, electronics, environment sciences, and energy. Other advantages of the articles and methods described herein are provided in more detail below.
(26) An example of a method for forming nanoparticles having unique and/or predetermined shapes in shown in
(27) The walls of the nucleic acid container may also allow nanoparticle precursor solutions to flow through it in order to facilitate the formation of a nanoparticle. Generally, the walls of the nucleic acid container are porous and may allow penetration and/or transport of certain molecules and components into or out of the container, but may prevent penetration and/or transport of other molecules and components into or out of the container. The ability of certain molecules to penetrate and/or be transported into and/or across a wall of the container may depend on, for example, the packing density of the nucleic acids forming the wall, the thickness of the walls, and the chemical and physical properties of the wall, as described in more detail below. Accordingly, a nucleic acid container need not be open, and in some embodiments may be substantially closed, while still allowing certain nanoparticle precursors to enter into the cavity via the pores and facilitating the formation of a nanoparticle in the container.
(28) Once one or more nanoparticle precursor are positioned in the cavity, they can facilitate the formation of a nanoparticle 38 that may fill all portions of the cavity. The shape of nanoparticle 38 may be determined, at least in part, by the shape of the cavity of the nucleic acid container. The shape of the cavity of the nucleic acid container, in turn, may be varied by controlling the configuration and orientation of the nucleic acid strands that form the inner surfaces of the container, as described in more detail below.
(29) In certain embodiments, growth of a nanoparticle in a cavity of the container continues until the nanoparticle encounters an inner surface or wall of the container. Chemical and/or physical interactions between the growing nanoparticle and the inner surface of the container may stop or significantly slow down the growth of nanoparticle. In certain embodiments involving nucleic acid containers that are substantially closed, the entire size and/or shape of nanoparticle 38 may be controlled by the size and/or shape of the cavity of the container, as described in more detail below. In other embodiments, the growth of all or portions of a nanoparticle stops before it is in contact with an inner surface portion of the container.
(30) Growing the nanoparticle inside a cavity of a nucleic acid container generally involves more than simply the addition of surface ligands to the surface of the nanoparticle precursor. For example, in some embodiments in which a nanoparticle precursor is used to grow a nanoparticle, the nanoparticle precursor may have a shape that is substantially different from the shape of the resulting nanoparticle that is grown from the nanoparticle precursor. In some instances, the resulting nanoparticle has a more complex shape than that of the nanoparticle precursor. In addition, as described in more detail below, the volume of the resulting nanoparticle may be substantially different (e.g., substantially greater) than that of the nanoparticle precursor.
(31) The combined nucleic acid container 20 and nanoparticle 38 shown in
(32) Although
(33) As shown illustratively in
(34) In some embodiments, nanoparticles can be formed by a method other than a seed-mediated process. For example, one or more nanoparticle precursors may fill all or portions of the cavity of a nucleic acid container and optionally an external force such as heat, light, pressure, electrical potential, magnetic force, and/or electromagnetic force can be applied to facilitate the growth or formation of the nanoparticle. In some cases, a chemical component can be added to facilitate the growth of the nanoparticle. In one particular embodiment, a nanoparticle precursor such as a monomer (e.g., a monomer of an organic polymer, such as a synthetic organic polymer), and optionally one or more catalysts to trigger the growth of the monomer, can be introduced in solution form into the cavity of a nucleic acid container. Polymerization of the monomers can take place in the cavity of the nucleic acid container by, for example, applying heat, light or other stimulus to allow formation of a polymeric nanoparticle. Monomers such as nucleotides and amino acids can be used.
(35) The resulting nanoparticle may have a physical state that is different from that of the nanoparticle precursor. For example, the formation of a nanoparticle may involve applying a stimulus to cause transformation of a nanoparticle precursor into a different form so as to form the resulting nanoparticle. For example, a nanoparticle precursor may be in the form of a liquid, and the resulting nanoparticle may be in the form of a solid or solid-like substance (e.g., a gel). In other embodiments, the resulting nanoparticle has the same physical state as that of the nanoparticle precursor. For example, both the nanoparticle and the nanoparticle precursor may be in the form of solids.
(36) As described herein, in some embodiments the formation of a nanoparticle in a cavity of a nucleic acid container is stopped or significantly slowed down by confinement of the nanoparticle in the container. For example, the formation of the nanoparticle may be stopped by chemical interaction between a surface of the nanoparticle and an inner surface of the nucleic acid container. It should be appreciated, however, that in some embodiments, synthesis of the nanoparticle can be stopped or significantly slowed down before the nanoparticle fills the entire volume of the nucleic acid container. For example, where an external force such as those described herein are used to facilitate formation of the nanoparticle, application of an external force may be stopped prior to the nanoparticle filling the entire volume of a nucleic acid container.
(37) Accordingly, in some embodiments, the nucleic acid container comprises a cavity having a volume, and only a portion of the volume is filled with the nanoparticle. For example, less than 100%, less than 80%, less than 60%, less than 40%, less than 20%, or less that 10% of the volume of a cavity may be filled with the nanoparticle. In certain embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 40%, at least 60%, or at least 80%, at least 90%, at least 95%, or at least 99% of the volume of cavity is filled with a nanoparticle. Combinations of the above-noted ranges are also possible (e.g., less than 100% but at least of 20% of the volume of the container may be filled with the nanoparticle). In yet other embodiments, substantially all of the volume of a nucleic acid container is filled with a nanoparticle.
(38) Methods described herein may be used to form a population of nanoparticles having relatively high uniformity in size, shape, and/or mass. For example, in some embodiments, a composition includes nanoparticles wherein at least 60%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the nanoparticles vary in dimension (e.g., a cross-sectional dimension, a maximum cross-sectional dimension, a width, a height, or a length) or mass by less than three standard deviations, less than two standard deviations, less than one standard deviation, less than 0.5 standard deviation, or less than 0.2 standard deviation of the median or average dimension or mass of all the nanoparticles in the composition. In certain embodiments, a composition may include nanoparticles that have a distribution of dimensions (e.g., cross-sectional dimension, width, height or length) or mass such that no more than 20%, no more 15%, no more than 10%, no more than 5%, no more than 3%, no more than 2%, or no more than 1% of the nanoparticles have a dimension or mass that differs by more than 20%, by more than 15%, by more than 10%, by more than 5%, by more than 3%, by more than 2%, or by more than 1% of the median or average value of the corresponding dimension or mass of all the nanoparticles in the composition.
(39) The methods described herein may also be used to control and tune the material composition of the nanoparticle at different regions of the nanoparticle. For example, in a gold/silver nanoparticle alloy formed by the methods described herein, the ratio of gold to silver may be 8:1 (wt:wt) at a first region and a ratio of 1:8 (wt:wt) at a second region. Generally, an alloy including a first and second component may have a ratio of the first to the second component of, for example, between 1:20 and 20:1 (wt:wt). In some embodiments, the ratio of the first to the second component of an nanoparticle alloy may be at least 1:20, at least 1:15, at least 1:10, at least 1:8, at least 1:6, at least 1:4, at least 1:2, at least 1:1, at least 2:1, at least 4:1, at least 6:1, at least 8:1, at least 10:1, at least 15:1, or at least 20:1 at a first region of the nanoparticle, and a ratio of the first to the second component of at least 1:20, at least 1:15, at least 1:10, at least 1:8, at least 1:6, at least 1:4, at least 1:2, at least 1:1, at least 2:1, at least 4:1, at least 6:1, at least 8:1, at least 10:1, at least 15:1, or at least 20:1 at a second region, wherein the ratios are different between the first and second regions. Alloys including a third component may also be possible. In some cases, the ratio between the first to third components, or the second to third components, have one of the above-noted ratios.
(40) Methods described herein may also be used to form nanoparticles having relatively high uniformity in material composition. For example, in some embodiments, a composition includes nanoparticles wherein at least 60%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the nanoparticles vary in material composition by less than three standard deviations, less than two standard deviations, less than one standard deviation, less than 0.5 standard deviation or less than 0.2 standard deviation of the median or average material composition of all the nanoparticles in the composition. In some embodiments, such compositions having a relatively high uniformity in material composition include nanoparticle alloys having the above-noted ratios between first and second components.
(41) In other embodiments in which a mixture of different nanoparticles having different shapes is desired, a method may include using different nucleic acid containers to form a variety of different nanoparticles in parallel. For example, in some instances between 2 and 1,000 nanoparticles (e.g., between 2 and 500, between 2 and 200, or between 2 and 100 nanoparticles), each having different predetermined shapes, may be formed in parallel. In some embodiments, a method may include using different nucleic acid containers to form, in parallel, at least 10, at least 15, at least 20, at least 30, at least 50, or at least 100 nanoparticles (e.g., inorganic nanoparticles) each having different shapes. A composition may include such numbers of differently shaped nanoparticles and/or nanostructures.
(42) In some embodiments, the methods described herein can be used to form nanoparticles in the absence of certain materials such as surfactants (e.g., cetyltrimethylammonium bromide). As such, a variety of different materials, including materials that are not compatible with surfactants, may be used in the methods described herein. In certain embodiments, the nanoparticle may be synthesized in the absence of an oxide template.
(43) In certain embodiments, the methods described herein can be performed ex-vivo (e.g., in test tubes). In other embodiments, the methods can be performed under in-vitro or in-vivo conditions, such as in bacteria and cells.
(44) Other features of nucleic acid containers, nanoparticles, and combinations thereof are described in more detail below.
(45) As described herein, nucleic acid containers can be used as a template to form nanoparticles within one or more cavities of the container. The nucleic acid container may have a predetermined three-dimensional shape or structure (e.g., a non-random three-dimensional shape or structure).
(46) The nucleic acid containers described herein can be formed using any suitable method. In some embodiments, a nucleic acid container may be constructed using a non-random process, such as process that involves deliberate folding and/or bending of nucleic acid strands to form the shape of the nucleic acid container. In some embodiments, a DNA origami method may be used. Using such a method, 3-dimensional (3D) nucleic acid containers with arbitrary user specified shapes can be formed. In some embodiments, the nucleic acid container is formed primarily of a single strand of nucleic acid, with optional multiple shorter strands that may help define the resulting shape of the container. For example, in some embodiments involving the use of a DNA origami method, a long scaffold DNA strand rasterizes a target structure shape, while many short staple strands hybridize to the scaffold and hold it in the target shape. Other methods of constructing nucleic acid containers using similar polymers are also possible. For example, in the field known as structural DNA nanotechnology (e.g., DNA origami and designs involving single-stranded tiles), self-assembled nucleic acids (particularly, DNA) have been used to construct diverse synthetic molecular structures and devices such as ribbons, tubes, lattices, and arbitrary 2D and 3D shapes. Moreover, channels can be introduced into hollow DNA nanostructures, e.g., DNA nanotubes and 3D barrels. These synthetic molecular structures and hollow DNA nanostructures may include cavities for nanoparticle growth according to the present invention and as described herein.
(47) Nucleic acid containers can be designed with or without software packages such as caDNAno and other software known in the art. In some embodiments, the scaffold strand may be naturally occurring such as that of the M13 virus. In other embodiments, the scaffold strand may be non-naturally occurring. In either instance, the sequence of the scaffold strand should be known. Software packages such as NUPACK can also be used to design dynamic sequence components. Those of ordinary skill in the art are familiar with these methods as evidenced by the disclosures in U.S. Pat. Nos. 7,745,594 and 7,842,793; U.S. Patent Publication No. 2010/00696621; and Goodman et al. Nature Nanotechnology, doi 10.1038/nnano.2008.3, the entire contents of which including the methods for generating nucleic acid based structures are incorporated by reference herein.
(48) As described herein, in some embodiments, a nucleic acid container is formed primarily of a single strand of nucleic acid (i.e., a scaffold). For example, in some embodiments, a single strand of nucleic acid used to form the nucleic acid container makes up at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the total molecular weight of the overall nucleic acid container. In certain embodiments, the molecular weight of a single strand of nucleic acid that forms the primary structure of the nucleic acid container may have a molecular weight of, for example, between 100 kDa and 10,000 kDa. In some embodiments, the molecular weight of a single strand of nucleic acid that forms the primary structure of the nucleic acid container may be, for example, at least 300 kDa, at least 600 kDa, at least 640 kDa, at least 800 kDa, at least 1,000 kDa, at least 2,000 kDa, at least 4,000 kDa, or at least 6,000 kDa. In some cases, the molecular weight of a single strand of nucleic acid that forms the primary structure of the nucleic acid container may be, for example, less than 6,000 kDa, less than 4,000 kDa, less than 2,000 kDa, less than 1,000 kDa, less than 800 kDa, less than 600 kDa, or less than 300 kDa. Other molecular weight values are also possible. Combinations of the above-referenced ranges are also possible (e.g., a molecular weight of at least 300 kDa and less than 1,000 kDa).
(49) In some cases, a single strand of a nucleic acid used to form a nucleic acid container has a length of, for example, between 1000 bases (1 kb) and 300 kilobases (300 kb). The single strand of nucleic acid may have a length of, for example, at least 1,000 bases long (1 kb), at least 2 kb, at least 5 kb, at least 10 kb, at least 15 kb, at least 20 kb, at least 25 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 100 kb, at least 150 kb, or at least 200 kb. In certain embodiments, the single strand of nucleic acid may have a length of, for example, less than 200 kb, less than 150 kb, less than 100 kb, less than 70 kb, less than 60 kb, less than 50 kb, less than 40 kb, less than 30 kb, less than 20 kb, less than 10 kb, less than 5 kb, or less than 3 kb. Combinations of the above-referenced ranges are also possible.
(50) Furthermore, it should be appreciated that the formation of a nucleic acid container using two or more (e.g., 2, 3, 4, 5, 6, etc.) single strands of nucleic acids that act as scaffolds is also contemplated. The two or more single strands of nucleic acids may have molecular weights and/or lengths in the ranges noted above, or they may have different ranges of molecular weights and/or lengths.
(51) A nucleic acid container may include, in some embodiments, one or more portions that are open relative to other portions of the structure. For example, in one particular embodiment, a nucleic acid container includes two opposite ends that are open such that fluid and certain molecules can flow through its interior. An example of such a structure is shown in
(52) A nucleic acid container, and a cavity within a nucleic acid container, may have any suitable shape. Advantageously, nucleic acid containers can be designed to include a cavity having particular shapes that may act as a template for forming all the portions of the nanoparticle. As described herein, the shape of the cavity of a nucleic acid container may be used, in some embodiments, for forming a nanoparticle having a complementary shape. Non-limiting examples of shapes of nucleic acid container cavities include tubes, boxes, barrels, rectangles, rods, Ts, Ls branched structures, diamonds, stars, squares, parallelograms, rhomboids, triangles, pentagons, hexagons, and polyhedrons, including shapes substantially similar thereto. Portions of the cavity may be linear in some cases, and curved in other cases. In some instances, one or more channels are present in the nanostructure. In some cases, the cavity of a nucleic acid container has a non-spherical shape. In other cases, the cavity of a nucleic acid container has an arbitrary or irregular shape. In some embodiments, the cavity of a nucleic acid container has a symmetric shape. In some embodiments, the cavity of a nucleic acid container has an asymmetric shape (e.g., no axis of symmetry). It is to be understood that a nucleic acid container may have a variety of shapes and forms provided its structure is suitable for the application contemplated.
(53) It should be appreciated that the cavity of the nucleic acid container may have the same shape, or a different shape, compared to the shape of the outer surface of the nucleic acid container. For instance, while the cavity of the nucleic acid container may be designed so that it has no axis of symmetry, the outer surface of the container may have a shape that does have an axis of symmetry.
(54) A cross-section of a cavity of a nucleic acid container may have any suitable shape. For example, a cross-section may be in the shape of a rectangle, rod, T, L, branched structure, diamond, star, square, parallelogram, triangle, pentagon, or hexagon, including shapes substantially similar thereto. Other shapes are also possible. In some cases, a cross-section of a cavity has a non-spherical shape. In some embodiments, each cross-section of a cavity of a nucleic acid container has a non-spherical shape. In other cases, a cross-section of a cavity has an arbitrary or irregular shape, a symmetric shape, or an asymmetric shape. In certain embodiments, each cross-section of a cavity has a symmetric shape. In other embodiments, each cross-section of a cavity has an asymmetric shape.
(55) A nucleic acid container may, in some embodiments, have a 3-dimensional shape that includes various numbers of different sides. For example, a nucleic acid container may have a cavity that is in the shape of a prism that includes five sides in its overall shape, and a cross-section that includes 3 sides. In certain embodiments, a cavity of a nucleic acid container may include, for example, between 3 and 10.sup.6 sides (e.g., between 3 and 100, between 3 and 70, between 3 and 50, or between 3 and 30, between 3 and 25, between 3 and 20, between 3 and 15, between 6 and 15, between 3 and 10, between 6 and 10, between 3 and 9, between 3 and 5, between 100 and 10.sup.3, between 10.sup.3 and 10.sup.4, between 10.sup.4 and 10.sup.5, or between 10.sup.5 and 10.sup.6 sides) in its overall shape. In some embodiments, a cavity of a nucleic acid container may include, for example, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 15, at least 20, at least 25, or at least 50 different sides. In certain embodiments, a cavity of a nucleic acid container may have a cross-section that includes, for example, between 3 and 10.sup.6 sides (e.g., between 3 and 100, between 3 and 70, between 3 and 50, or between 3 and 30, between 3 and 25, between 3 and 20, between 3 and 15, between 6 and 15, between 3 and 10, between 6 and 10, between 3 and 9, between 3 and 5, between 100 and 10.sup.3, between 10.sup.3 and 10.sup.4, between 10.sup.4 and 10.sup.5, or between 10.sup.5 and 10.sup.6 sides) in its overall shape. In some embodiments, a cavity of a nucleic acid container may have a cross-section that includes at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 15, at least 20, at least 25, or at least 50 different sides. Combinations of the above-noted ranges are also possible. In some cases, a side may be non-curved (e.g., linear), although curved sides or faces may also be possible. Advantageously, nucleic acid containers including cavities having complex shapes can be formed using the methods described herein, and can be used to form nanoparticles having arbitrary complex shapes.
(56) The angle between two sides may be, for example, between 1 and 180 (e.g., between 1 and 120, between 1 and 90, or between 1 and 45). In some cases, the angle between two sides may be, for example, greater than 1, greater than 10, greater than 30, greater than 45, greater than 60, greater than 90, greater than 120, or greater than 150. In certain cases, the angle between two sides may be, for example, less than 180, less than 150, less than 120, less than 90, less than 60, less than 45, less than 30, or less than 10. Other angles are also possible. A combination of the above-noted ranges are also possible.
(57) A nucleic acid container may comprise any suitable number of open sides. For example, a nucleic acid container may include at least one open side, at least two open sides, at least three open sides, or at least four open sides. In some cases, the nucleic acid container includes two opposing sides that are open.
(58) In some embodiments, a nucleic acid container comprises one or more lids that can be open or closed (e.g., reversibly or irreversibly). For example, as shown in the embodiments illustrated in
(59) In certain embodiments, nucleic acid containers may have suitable configurations for forming nanoparticles that are at least partially hollow. For example, as shown illustratively in
(60) Different methods may be used to fabricate the nucleic acid containers shown in
(61) In some embodiments, a lid may include at least 1 binding site for binding to a complementary binding site positioned on at least a portion (e.g., a surface) of a container. The binding sites may allow secure attachment of the lid to the container, as described in more detail herein. In some cases, a lid or a surface of the container to be closed by a lid comprises at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, or at least 20 binding sites. The binding sites may be isolated from one another in some embodiments. The binding sites may include, for example, nucleic acid strands, although other binding units may be used.
(62) Although many of the figures show nucleic acid containers having a single cavity, it should be appreciated that in some embodiments a nucleic acid container may include more than one cavity (and, therefore, multiple positions for the formation of multiple nanoparticles). For example, a nucleic acid container may have, in some cases, between 2 and 200 cavities (e.g., between 2 and 100, between 2 and 50, between 2 and 20, between 2 and 10, or between 2 and 5 cavities). In some embodiments, a nucleic acid container includes at least 2, at least 5, at least 10, or at least 15 cavities. In certain embodiments, a nucleic acid container includes less than 20, less than 15, less than 10, less than 5, or less than 3 cavities. Other numbers of cavities are also possible. Combinations of the above-noted ranges are also possible.
(63) The size of a cavity of a nucleic acid container can be varied as desired. In some embodiments, a cross-sectional dimension of a cavity (e.g., as measured by the distance between two inner surface portions of the container that surround a cavity), is between 2 nm and 1 micron (e.g., between 2 nm and 500 nm, or between 2 nm and 250 nm). In some embodiments, a cross-sectional dimension of a cavity may be, for example, less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 250 nm, less than or equal to 100 nm, less than or equal to 75 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 10 nm, or less than or equal to 2 nm. In certain embodiments, a cross-sectional dimension of a cavity is greater than or equal to 1 nm, greater than or equal to 2 nm, greater than or equal to 5 nm, greater than or equal to 10 nm, greater than or equal to 20 nm, greater than or equal to 30 nm, greater than or equal to 40 nm, greater than or equal to 50 nm, greater than or equal to 100 nm, greater than or equal to 500 nm, or greater than or equal to 1 micron. Other values are also possible. Combinations of the above-noted ranges are also possible. In some embodiments, the above-noted cross-sectional dimension of the cavity is a maximum cross-sectional dimension of the cavity.
(64) Although nucleic acid containers and cavities of nucleic acid containers having sizes generally on the order of nanometers are primarily described, in some embodiments, a variety of nucleic acid containers may be used that have significantly different sizes. For example, in some embodiments, the a plurality of containers is used with some containers being small enough to be positioned partially or fully within other containers.
(65) The thickness of the walls of the nucleic acid container can also vary as desired. In some embodiments, the nucleic acid container comprises walls that surround a cavity, and the average thickness of the walls may be between 1 nm and 1 micron (e.g., between 1 nm and 500 nm, or between 1 nm and 250 nm). The average thickness of the walls may be, for example, less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 250 nm, less than or equal to 100 nm, less than or equal to 75 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 10 nm, or less than or equal to 1 nm. In certain embodiments, the average thickness of the walls of a nucleic acid container is greater than or equal to 1 nm, greater than or equal to 10 nm, greater than or equal to 25 nm, greater than or equal to 50 nm, greater than or equal to 100 nm, greater than or equal to 500 nm, or greater than or equal to 1 micron. Other values are also possible. Combinations of the above-noted ranges are also possible.
(66) In some embodiments, the walls of a nucleic acid container may be formed of more than one layer of nucleic acids. Increasing the number of layers of nucleic acids may increase the rigidity (and thickness) of the wall. In some embodiments, increased wall rigidity may result in the container walls maintaining their shape during growth of a nanostructure inside the container. For instance, increased wall rigidity may confine the expansion of a nanostructure grown inside the container (e.g., by compressing the nanostructure during growth) such that the nanostructure does not grow beyond the size of the cavity of the container prior to expansion. In other embodiments, fewer number of layers may allow a nanostructure to grow beyond the size of the cavity of the container prior to expansion, and may cause the walls of the container to expand (e.g., bend) during nanostructure growth. In some embodiments, a wall of a nucleic acid container may have at least 2, at least 3, at least 4, at least 5, at least 6, at least 8, or at least 10 layers. In some cases, a wall of a nucleic acid container may have less than or equal to 20, less than or equal to 15, less than or equal to 10, less than or equal to 8, or less than or equal to 5 layers. Other values are also possible. Combinations of the above-noted ranges are also possible. The layers of the walls may have any suitable design such as a square-lattice design or a honeycomb design.
(67) Advantageously, by controlling the thickness of walls of the nucleic acid container, diffusion kinetics, such as the diffusion kinetics of ions or molecules, across the wall of the container can be controlled. Such control may allow the tuning of the growth kinetics of the nanoparticle and/or the material composition of nanoparticle alloys. For example, in some cases, a first portion of a wall of the nucleic acid container has a first thickness, and a second portion of the wall has a second thickness, wherein the first and second thicknesses are defined by one of the above-noted ranges. A first, thicker wall portion may, for example, impede a first nanoparticle precursor solution from entering into the cavity to a greater extent than a second nanoparticle precursor solution, thereby allowing more of the second nanoparticle precursor solution to enter into the cavity at the first wall portion. As a result, the nanoparticle may have a higher amount of a material formed from the second nanoparticle precursor at the first wall portion.
(68) Those of ordinary skill in the art are familiar with techniques to determine sizes of structures and particles. Examples of suitable techniques include dynamic light scattering (DLS), transmission electron microscopy (TEM), scanning electron microscopy, electroresistance counting, and laser diffraction. Other suitable techniques are known to those or ordinary skill in the art. Although many methods for determining sizes of nanostructures are known, the sizes described herein (e.g., cross-sectional dimensions, thicknesses) refer to ones measured by transmission electron microscopy.
(69) The nucleic acid containers may also include other components such as those described herein (e.g., markers, binding sites, quantum dots, nanoparticles, nucleic acids, proteins, etc.). For example, in some embodiments, a nucleic acid container includes one or more inorganic structures (e.g., inorganic nanostructures), such as an inorganic nanoparticle or a quantum dot. The one or more components may fill a portion of the cavity in some embodiments, e.g., such that a nanoparticle formed by templated synthesis inside the cavity forms around the component or is combined with the component. In some cases, the component is incorporated into the nanoparticle being formed. In other embodiments, the inorganic structure is embedded in the nucleic acid container walls and does not fill a portion of the cavity.
(70) Any suitable nanoparticle precursor can be used to form a nanoparticle as described herein. A nanoparticle precursory may be used to initiate, catalyze and/or grow a nanoparticle. In some cases, all or portions of the material of the nanoparticle precursor may be incorporated into the resulting nanoparticle. In some embodiments, a nanoparticle precursor may be used for forming a nanoparticle using a seed-mediated growth process. In some such embodiments, a nanoparticle precursor may be in a solid form. For example, the nanoparticle precursor may be in the form of a nanoparticle, such as an inorganic nanoparticle. In some cases, a nanoparticle precursor comprises a crystal. In certain cases, a nanoparticle precursor comprises a metal. Non-limiting examples of metals include Au, Ag, Cd, Cr, Co, Ti, Zn, Cu, Pb, Mn, Ni, Mg, Fe, Pd, and Pt. In other embodiments, a nanoparticle precursor comprises a semiconductor (e.g., Rh, Ge, silicon, silicon compounds and alloys, cadmium selenide, cadmium sulfide, indium arsenide, and indium phosphide). In some cases, the nanoparticle precursor may comprise a Group II-VI (e.g., IV-VI) element. In certain embodiments, the nanoparticle precursor comprises a metal oxide or a metal fluoride. In some cases, the nanoparticle precursor comprises an alloy. In some cases, the nanoparticle precursor comprises a doped compound. Combinations of such and other materials are also possible.
(71) Non-limiting examples of nanoparticle precursors include the following. For the formation of Au, Ag, Pt and Pd nanoparticles, gold nanoparticles can be used as a precursor. Alternatively, Ag, Pt and Pd nanoparticles can be used as a precursor. For the formation of semiconductors and metal oxide nanoparticles (e.g., nanoparticles including one or more of Cd, Cr, Co, Ti, Zn, Mn, Ni, Mg, Fe, or a different material described herein), clusters or small-sized nanoparticles of corresponding materials can be used as seeds. In other embodiments, enzymes or peptides can be used as nucleation sites if they can trigger the growth of nanoparticles (e.g., organic nanoparticles). Some catalysts can also be used to trigger the growth of polymers or nanoparticles, such as Pt(PPh.sub.3).sub.2Cl.sub.2.
(72) As described herein, nanoparticle precursors can also be in the form of solutions. The material composition of the resulting nanoparticle can be controlled by varying the types of precursor solutions used. Any suitable solution can be used to form a nanoparticle, and can be chosen using the description provided herein in combination with general knowledge in the art. For instance, a HAuCl.sub.4 precursor solution may be used to form gold nanoparticles and a AgNO.sub.3 precursor solution may be used to form silver nanoparticles (optionally in combination with other solutions such as ascorbic acid). Combinations of nanoparticle precursors and precursor solutions can also be determined by those of ordinary skill in the art in combination with the description provided herein.
(73) In other embodiments, a nanoparticle precursor may be used for forming a nanoparticle using a non-seed-mediated growth process. For example, in some embodiments, nanoparticle precursors may be in the form of a monomer or a polymer, and the formation of a nanoparticle may comprise polymerizing and/or cross-linking of monomer and/or polymer units.
(74) In some cases, a nanoparticle precursor may comprise an amino acid, a peptide, a nucleotide, or a nucleic acid (e.g., to form a nanoparticle that is formed substantially of amino acids, peptides, or nucleic acids).
(75) In other cases, a nanoparticle precursor may include other functionalities such as binding sites, or may be imparted with certain surface functionalities. For example, the nanoparticle precursor may comprise a self-assembled monolayer to impart a particular surface chemistry to the precursor. In certain embodiments, the nanoparticle precursor may include a binding site or other suitable component to allow it to be attached to a portion of the nucleic acid container. In other embodiments, the nanoparticle precursor may be suspended in the cavity of the container and not attached to a surface of the container.
(76) A nanoparticle precursor may have any suitable size. In some embodiments, a nanoparticle precursor has at least one cross-sectional dimension that is between 0.5 nm and 1 micron (e.g., between 0.5 nm and 500 nm, or between 0.5 nm and 250 nm). In some embodiments, a nanoparticle precursor has at least one cross-sectional dimension that is, for example, less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 250 nm, less than or equal to 100 nm, less than or equal to 75 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 10 nm, less than or equal to 5 nm, less than or equal to 1 nm, or less than or equal to 0.5 nm. In some embodiments, a nanoparticle precursor has at least one cross-sectional dimension that is greater than or equal to 0.5 nm, greater than or equal to 1 nm, greater than or equal to 2 nm, greater than or equal to 5 nm, greater than or equal to 10 nm, greater than or equal to 20 nm, or greater than or equal to 50 nm. Other sizes are also possible. Combinations of the above-noted ranges are also possible.
(77) In some cases, the size (e.g., volume) of a nanoparticle precursor is at least 500 times, at least 300 times, at least 200 times, at least 100 times, at least 50 times, at least 20 times, at least 10 times, at least 5 times, or at least 2 times smaller than the nanoparticle that is formed from the precursor or than the cavity of the container. Other sizes are also possible.
(78) In certain embodiments, a nanoparticle precursor has an average molecular weight of, for example, between 20 Da and 10 kDa (e.g., between 20 Da and 5 kDa, or between 20 Da and 1 kDa). A nanoparticle precursor has an average molecular weight of, for example, less than or equal to 10 kDa, less than or equal to 5 kDa, less than or equal to 1 kDa, less than or equal to 500 Da, less than or equal to 200 Da, less than or equal to 100 Da, less than or equal to 50 Da, or less than or equal to 20 Da. In some embodiments, a nanoparticle precursor has an average molecular weight of greater than or equal to 10 Da, greater than or equal to 20 Da, greater than or equal to 50 Da, greater than or equal to 100 Da, greater than or equal to 200 Da, greater than or equal to 500 Da, greater than or equal to 1 kDa, or greater than or equal to 10 kDa. Other molecular weights are also possible. Combinations of the above-noted ranges are also possible.
(79) As described herein, a nanoparticle having a unique and/or predetermined shape can be formed using the methods described herein. For instance, a nanoparticle having a specific shape (and/or size) can be formed by designing a cavity of a nucleic acid container to have the complement of the desired shape (and/or size) of the nanoparticle. The cavity may then act as a template for forming all the portions of the nanoparticle. Non-limiting examples of shapes of nanoparticles include tubes, boxes, barrels, rectangles, rods, Ts, Ls branched structures, diamonds, stars, squares, parallelograms, triangles, pentagons, hexagons, polyhedrons, and rings, including shapes substantially similar thereto. In some cases, a nanoparticle has a non-spherical shape. In other cases, a nanoparticle has an arbitrary or irregular shape. In some embodiments, a nanoparticle has a symmetric shape. A symmetric shape may include, in some embodiments, at least 1, at least 2, at least 3, or at least 4 axes of symmetry. In some embodiments, a nanoparticle has an asymmetric shape (e.g., no axis of symmetry).
(80) In some embodiments, the nanoparticles formed by the methods described herein are solid or solid-like (e.g., with solid cores), and are not hollow structures. In other embodiments, portions of the nanoparticle may be hollow, e.g., as described herein with respect to
(81) A cross-section of a nanoparticle may have any suitable shape. For example, a cross-section may be in the shape of a rectangle, rod, T, L, branched structure, diamond, star, square, parallelogram, triangle, pentagon, hexagon, or ring, including shapes substantially similar thereto. Other shapes are also possible. In some cases, a cross-section of a nanoparticle has a non-spherical shape. In some embodiments, each cross-section of a nanoparticle has a non-spherical shape. In other cases, a cross-section of a nanoparticle has an arbitrary or irregular shape, a symmetric shape, or an asymmetric shape. In certain embodiments, each cross-section of a nanoparticle has a symmetric shape. In other embodiments, each cross-section of a nanoparticle has an asymmetric shape.
(82) A nanoparticle may, in some embodiments, have a 3-dimensional shape that includes various numbers of different sides. For example, a nanoparticle may be in the shape of a prism that includes four sides. In certain embodiments, a nanoparticle may include, for example, between 3 and 10.sup.6 sides (e.g., between 3 and 100, between 3 and 70, between 3 and 50, or between 3 and 30, between 3 and 25, between 3 and 20, between 3 and 15, between 6 and 15, between 3 and 10, between 6 and 10, between 3 and 9, between 3 and 5, between 3 and 8, between 20 and 50, between 50 and 100, between 100 and 10.sup.3, between 10.sup.3 and 10.sup.4, between 10.sup.4 and 10.sup.5, or between 10.sup.5 and 10.sup.6 sides). In some cases, a nanoparticle includes at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 15, at least 20, at least 25, at least 50, at least 100, at least 10.sup.3, at least 10.sup.4, or at least 10.sup.5 different sides.
(83) As described herein, in some embodiments, a nanoparticle comprises at least one surface portion having a shape that is complimentary to a shape of an inner surface portion of a nucleic acid container. A surface portion generally refers to a portion of a surface that has a surface area that is greater than the surface area of a single atom. In some instances, a surface portion may have a surface area of at least 1 nm.sup.2, at least 2 nm.sup.2, at least 5 nm.sup.2, at least 10 nm.sup.2, at least 15 nm.sup.2, at least 20 nm.sup.2, at least 25 nm.sup.2, at least 30 nm.sup.2, at least 50 nm.sup.2, at least 200 nm.sup.2, at least 200 nm.sup.2, at least 500 nm.sup.2, or at least 1000 nm.sup.2 (where the largest surface portion is the surface area of the entire nanoparticle).
(84) In some cases, a nanoparticle has at least one surface portion that is complimentary to a shape of an inner surface portion of a nucleic acid container at the sub-nanometer (e.g., 0.5 nm) level. For example, growth of a nanoparticle inside a container may stop or significantly slow down upon reaching the confines of the inner surface portion of the container. In some such embodiments, the surface chemistry and/or physical interactions between the nanoparticle and the inner surface of the container prevents further growth of the nanoparticle. For example, electrostatic interactions between the negatively charged phosphate groups of the nucleic acid container and the positively charged groups of the nanoparticle or nanoparticle precursor may prevent further growth of the nanoparticle. The particular orientation of the atoms of the inner surface portion of the nucleic acid container may determine the final shape of the resulting nanoparticle, where the inner surface portion and the shape of a surface portion of the resulting nanoparticle are complementary, e.g., at the sub-nanometer level.
(85) In some embodiments, a relatively high percentage of the surface area of a nanoparticle is complementary to a shape of an inner surface (e.g., cavity) of a nucleic acid container at the sub-nanometer (e.g., 0.5 nm) level. For example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the surface area of the nanoparticle may be complementary to a shape of an inner surface of a nucleic acid container at the sub-nanometer level. In other embodiments, 100% of the surface area of the nanoparticle is complementary to a shape of an inner surface of the nucleic acid container at the sub-nanometer level.
(86) In other embodiments, the resulting nanoparticle has at least one surface portion that is complementary to a shape of an inner surface portion of a nucleic acid container at the nanoscale level (e.g., 1 nm or greater). For example, growth of a nanoparticle inside a container may stop or significantly slow down before reaching the confines of the inner surface of the container such that the resulting nanoparticle has a volume less than the volume of the cavity. In some such embodiments, the nanoparticle has a substantially similar shape as that of the cavity, and is complementary with the inner walls of the container at the nanoscale level, but is not complementary with the inner walls of the container at the sub-nanometer level.
(87) In some embodiments, a relatively high percentage of the surface area of a nanoparticle is complementary to a shape of an inner surface portion of a nucleic acid container at the nanoscale level (e.g., 1 nm or greater) level. For example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the surface area of the nanoparticle is complementary to a shape of an inner surface portion of the a nucleic acid container at the nanoscale level. In other embodiments, 100% of the surface area of the nanoparticle is complementary to a shape of an inner surface portion of the nucleic acid container at the nanoscale level.
(88) A nanoparticle having complementarity at both the molecular (e.g., Angstrom) and nanoscale level for different portions of the nanoparticle is also possible.
(89) In yet other embodiments, the resulting nanoparticle includes one or more surface portions that are not complementary to the inner surface portions of a nucleic acid container. For example, fabrication of a nanoparticle in a nucleic acid container that includes two open ends may result in a nanoparticle that has a middle portion that is complementary (e.g., at the molecular level or at a nanoscale level) with inner surface portions of the nucleic acid container, but having ends that are not complementary to any portions of the nucleic acid container. In some such embodiments, the nanoparticle may grow outside of the cavity of the nucleic acid container and may be shaped by other factors.
(90) In certain embodiments, a nanoparticle comprises at least two opposing surface portions, each of the at least two opposing surface portions having a shape that is complementary to a shape of an inner surface portion of the nucleic acid container. The complementarity may be at the molecular level or at the nanoscale level as described above. For example, as shown in the embodiment illustrated in
(91) In other embodiments, the nanoparticle comprises at least two adjacent surface portions, each of the at least two adjacent surface portions having a shape that is complementary to a shape of an inner surface portion of the nucleic acid container. For example, as shown in the embodiment illustrated in
(92) A nanoparticle can be formed of any suitable material. A nanoparticle formed by the methods described herein may be an inorganic nanoparticle in some embodiments. In some cases, a nanoparticle comprises a metal. Non-limiting examples of metals include Au, Ag, Cd, Cr, Co, Ti, Zn, Cu, Pb, Mn, Ni, Mg, Fe, Pd, and Pt. In other embodiments, a nanoparticle comprises a semiconductor (e.g., Rh, Ge, silicon, silicon compounds and alloys, cadmium selenide, cadmium sulfide, indium arsenide, and indium phosphide). In some cases, the nanoparticle may comprise a Group II-VI (e.g., IV-VI) element. In certain embodiments, the nanoparticle comprises a metal oxide or a metal fluoride. In some cases, the nanoparticle a comprises an alloy. In some cases, the nanoparticle a comprises a doped compound. Combinations of such and other materials are also possible. The nanoparticle may be electronically and/or thermally conductive in some embodiments, or non-electronically and/or non-thermally conductive in other embodiments.
(93) In other embodiments, a nanoparticle formed by the methods described herein may be an organic nanoparticle. In some cases, a nanoparticle may comprise a polymer, which may be cross-linked or non-crosslinked. The polymer may be, for example, a synthetic polymer and/or a natural polymer. Examples of synthetic polymers include non-degradable polymers such as polymethacrylate and degradable polymers such as polylactic acid, polyglycolic acid and copolymers thereof. Examples of natural polymers include hyaluronic acid, chitosan, and collagen. Conductive polymers may be used in some embodiments. In certain embodiments, the nanoparticle does not include a polymeric material (e.g., it is non-polymeric). In some cases, a nanoparticle may comprise a protein, an enzyme, or a peptide.
(94) The surface of the nanoparticle may include the material used to form the interior portions of nanoparticle, or may otherwise be imparted with certain surface functionalities such as binding sites or other components. For example, the nanoparticle may comprise a self-assembled monolayer to impart a particular surface chemistry to the nanoparticle. In some cases, a nanoparticle surface may be passivated by one or more chemicals to facilitate attachment of components.
(95) A nanoparticle may have any suitable size. In some embodiments, a nanoparticle has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are between 2 nm and 1 micron (e.g., between 2 nm and 500 nm, or between 2 nm and 250 nm). In some embodiments, a nanoparticle has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 250 nm, less than or equal to 100 nm, less than or equal to 75 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 10 nm, or less than or equal to 5 nm. In certain embodiments, the nanoparticle has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are greater than or equal to 2 nm, greater than or equal to 5 nm, greater than or equal to 10 nm, greater than or equal to 50 nm, or greater than or equal to 100 nm. Combinations of the above-noted ranges are also possible. In some cases, the above-noted cross-sectional dimension is a maximum cross-sectional dimension.
(96) In some cases, a nanoparticle has a volume of, for example, between 8 nm.sup.3 and 1 m.sup.3 (1*10.sup.9 nm.sup.3). In certain embodiments, a nanoparticle has a volume of, for example, at least 20 nm.sup.3, at least 50 nm.sup.3, at least 100 nm.sup.3, at least 500 nm.sup.3, at least 110.sup.3 nm.sup.3, at least 510.sup.3 nm.sup.3, at least 110.sup.4 nm.sup.3, at least 510.sup.4 nm.sup.3, at least 110.sup.5 nm.sup.4, at least 510.sup.5 nm.sup.3, at least 110.sup.6 nm.sup.3, at least 510.sup.6 nm.sup.3, at least 110.sup.7 nm.sup.3, at least 510.sup.7 nm.sup.3, at least 110.sup.8 nm.sup.3, or at least 510.sup.8 nm.sup.3. In some embodiments, a nanoparticle has a volume of, for example, less than 110.sup.9 nm.sup.3, less than 510.sup.8 nm.sup.3, less than 110.sup.8 nm.sup.3, less than 510.sup.7 nm.sup.3, less than 110.sup.7 nm.sup.3, less than 510.sup.6 nm.sup.3, less than 110.sup.6 nm.sup.3, less than 510.sup.5 nm.sup.3, less than 110.sup.5 nm.sup.3, less than 510.sup.4 nm.sup.3, less than 110.sup.4 nm.sup.3, less than 510.sup.3 nm.sup.3, less than 110.sup.3 nm.sup.3, less than 500 nm.sup.3, less than 100 nm.sup.3, less than 50 nm.sup.3, or less than 20 nm.sup.3. Other ranges are also possible. A combination of the above-noted ranges are also possible. In certain embodiments, such volumes are based on the use of a single nucleic acid scaffold. Larger volumes may be possible using multiple nucleic acids scaffolds.
(97) As described herein, a nanoparticle may have a size, dimension (e.g., length, width, height), cross-sectional dimension, and/or volume that is substantially similar to that of a cavity of a container in which the nanoparticle is grown. In other embodiments, a nanostructure may have a size, dimension (e.g., length, width, height), cross-sectional dimension, and/or volume that is less than that of a cavity of a container in which the nanoparticle is grown. For example, growth of the nanoparticle may be stopped prior to the nanoparticle reaching one or more sides of the container. In other embodiments, a nanostructure may have a size, dimension (e.g., length, width, height), cross-sectional dimension, and/or volume that is greater than that of a cavity of a container in which the nanoparticle is grown. For example, the walls of the container may be designed to be flexible such that the nanoparticle grown within causes the walls of the container to expand during growth. Other configurations of the nanoparticle and/or container are also possible.
(98) In some cases, the volume of the nanoparticle may be at least two times, at least five times, at least 10 times, at least 20 times, at least 30 times, at least 50 times, at least 100 times, at least 200 times, at least 500 times, or at least 1,000 times the volume of a nanoparticle precursor used to form the nanoparticle. The resulting volume of the nanoparticle may depend, at least in part, on the size of the cavity of a nucleic acid container, which may be varied as described herein. It should be appreciated that nanoparticles having sizes smaller or larger than the volume of the cavity of the nucleic acid container are also possible. For example, portions of a nanoparticle may be fabricated inside a container, and other portions of the nanoparticle may grow outside of the container.
(99) In some cases, a nanoparticle has an aspect ratio of at least 2:1, at least 3:1, at least 5:1, at least 10:1, or at least 20:1. Other values of aspect ratio are also possible. As used herein, aspect ratio refers to the ratio of a length to a width, where length and width measured perpendicular to one another, and the length refers to the longest linearly measured dimension.
(100) As described herein, in some cases all or portions of a nanoparticle may be encapsulated or coated by a nucleic acid nanostructure. For example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the surface area of a nanoparticle may be encapsulated or coated by a nucleic acid nanostructure. In some instances, the entire surface area of a nanoparticle is encapsulated or coated by a nucleic acid nanostructure. In some such embodiments, all or portions of the nanoparticle may be attached to the nucleic acid nanostructure. For example, all or portions of the nanoparticle may be physisorbed onto the nucleic acid nanostructure. In other embodiments, all or portions of the nanoparticle are not attached to the nucleic acid nanostructure but are merely adjacent to the nucleic nanostructure. The nanoparticle may be in contact with, or not in contact with, the nucleic acid nanostructure during encapsulation.
(101) Compositions including nanoparticles that have one or more of the features described herein are also provided. For example, in some cases, a composition includes nanoparticles such that at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the nanoparticles in the composition are non-spherical, have no axis of symmetry, are complementary to an inner surface portion of a nucleic acid container (at a molecular level or at an atomic level), or are encapsulated/coated by a nucleic acid container.
(102) In another set of embodiments, one or more surfaces of a nanoparticle can be patterned (e.g., in two dimensions and/or in three dimensions) with one or more components. This can be done by, for example, fabricating a pattern of one or more components onto the interior surface of the nucleic acid container used to form the nanoparticle, and then triggering the growth of the nanoparticle within the container. The growth of the nanoparticle within the container can result in the incorporation of the pattern of the one or more components onto the surface of the nanoparticle. With this method, nano-scaled structures with details at the nanometer or sub-nanometer level can be fabricated. Examples of such structures include metallic coins and arbitrary shaped nano-scaled electronic devices. Other structures such as core-shell type structures in the form of alloys or polymer/metal hybrid structures can also be formed. In some such embodiments, the shape of the shell layer may be different from the general shape of the core. For example, a hexagonal shell may surround a pentagon core. The methods described herein are a more rational way of fabricating arbitrary pre-designed structures compared to certain existing methods.
(103) In some embodiments, a fabricated nanoparticle may be used as a template to fabricate other materials that cannot be directly prepared by DNA-directed synthesis (e.g., those requiring high temperatures or pressures, and/or those formed in organic solutions). In some embodiments, nanoparticles formed by the methods described herein that are at least partially hollow may be used as a template to form a secondary nanostructure within the hollow portion (e.g., cavity) of the nanoparticle. In other embodiments, the outer surface of the nanoparticle can be used as a template to form a larger secondary nanostructure. The nanoparticle that is used as a template may be optionally removed after forming the secondary nanostructure. Nanoparticles formed of or comprising, for example, gold, silver, or platinum may be suitable for use as templates. Other materials for use as templates may also be possible. A secondary nanostructure formed using a nanoparticle as a template may be made of any suitable material, including those materials described herein for nanoparticles in general. The material of the secondary nanostructure may be the same as, or different from, the material of the nanoparticle used as the template.
(104) The hollow portion (e.g., cavity) of a nanoparticle and/or a secondary nano structure formed using a nanoparticle may have any suitable size. In some embodiments, a hollow portion (e.g., cavity) of a nanoparticle and/or a secondary nanostructure has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are between 1 nm and 1 micron (e.g., between 1 nm and 500 nm, or between 1 nm and 250 nm). In some embodiments, a hollow portion (e.g., cavity) of a nanoparticle and/or a secondary nanostructure has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 250 nm, less than or equal to 100 nm, less than or equal to 75 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 10 nm, or less than or equal to 5 nm. In certain embodiments, a hollow portion (e.g., cavity) of a nanoparticle and/or a secondary nanostructure has at least one cross-sectional dimension (or at least two cross-sectional dimensions) that is/are greater than or equal to 2 nm, greater than or equal to 5 nm, greater than or equal to 10 nm, greater than or equal to 50 nm, or greater than or equal to 100 nm. Combinations of the above-noted ranges are also possible. In some cases, the above-noted cross-sectional dimension is a maximum cross-sectional dimension.
(105) In some cases, a hollow portion of a nanoparticle and/or a secondary nanostructure has a volume of, for example, between 1 nm.sup.3 and 1 m.sup.3 (1*10.sup.9 nm.sup.3). In certain embodiments, a hollow portion of a nanoparticle and/or a secondary nanostructure has a volume of, for example, at least 20 nm.sup.3, at least 50 nm.sup.3, at least 100 nm.sup.3, at least 500 nm.sup.3, at least 110.sup.3 nm.sup.3, at least 510.sup.3 nm.sup.3, at least 110.sup.4 nm.sup.3, at least 510.sup.4 nm.sup.3, at least 110.sup.5 nm.sup.4, at least 510.sup.5 nm.sup.3, at least 110.sup.6 nm.sup.3, at least 510.sup.6 nm.sup.3, at least 110.sup.7 nm.sup.3, at least 510.sup.7 nm.sup.3, at least 110.sup.8 nm.sup.3, or at least 510.sup.8 nm.sup.3. In some embodiments, a hollow portion of a nanoparticle and/or a secondary nanostructure has a volume of, for example, less than 110.sup.9 nm.sup.3, less than 510.sup.8 nm.sup.3, less than 110.sup.8 nm.sup.3, less than 510.sup.7 nm.sup.3, less than 110.sup.7 nm.sup.3, less than 510.sup.6 nm.sup.3, less than 110.sup.6 nm.sup.3, less than 510.sup.5 nm.sup.3, less than 110.sup.5 nm.sup.3, less than 510.sup.4 nm.sup.3, less than 110.sup.4 nm.sup.3, less than 510.sup.3 nm.sup.3, less than 110.sup.3 nm.sup.3, less than 500 nm.sup.3, less than 100 nm.sup.3, less than 50 nm.sup.3, or less than 20 nm.sup.3. Other ranges are also possible. A combination of the above-noted ranges are also possible.
(106) As described herein, nanoparticles, which may be optionally coated or encapsulated by a nucleic acid container or nanostructure, may have a variety of different shapes. In some embodiments, the unique shapes of the nanoparticles can be used to position one or more components (e.g., binding sites, markers, ligands, etc.) on different portions of a nanoparticle surface and/or a surface of the nucleic acid container to allow the nanoparticle or nanostructure to be addressed in different ways. For example, a nanoparticle having eight different sides may be functionalized with one or more different components at each of the eight different sides. In some cases, the components are in the form of isolated components that can be added to unique positions on the nanoparticle or nanostructure. For instance, a single, isolated component may be positioned on a single side of the nanoparticle, with each of the different sides of the nanoparticle including a different single, isolated component. These and other embodiments may be useful for detecting a variety of different targets as described in more detail below.
(107) In some embodiments, the positioning of a component on precise locations of a nanoparticle and/or nanostructure may be controlled by the particular chemistry of the nucleic acid container. For example, a nanoparticle that has eight different sides may be surrounded (partially or fully) by a nucleic acid container that has an inner cavity having eight different sides, and walls with different chemistry at each of the different sides. A component may be designed such that it has an affinity for a certain portion of the nucleic acid container or nanostructure at one of the sides that coats or encapsulates a side of the nanoparticle. Thus, by designing the nucleic acid container to have specific sequences or chemistry at particular positions, the addition of a specific component to the surface of the nucleic acid container and/or the surface of the nanoparticle at one of those positions can be performed. Similarly, additional components can be specifically added to different positions of the surface of the nucleic acid container and/or the surface of the nanoparticle using this method.
(108) As described herein, the nucleic acid container is typically porous such that small pores or holes through the thickness of the walls of the container allow access to the outer surface of the nanoparticle. The outer surface of the nucleic acid container and/or the pores of the nucleic acid container can be designed to include a particular nucleic acid sequence, hydrophilicity, hydrophobicity, charge and/or size that favors positioning of a particular component into the pore or onto the surface of the container. Likewise, the component to be added may be designed to include a complementary nucleic acid sequence, hydrophilicity, hydrophobicity, charge, and/or size such that it has an affinity for a particular portion of the nucleic acid container. In some cases, upon the component being matched with a particular portion of the nucleic acid container, the component may be inserted all the way through the pore such that it contacts a portion of the surface of the nanoparticle.
(109) In some such embodiments, the end of the component may have a particular chemistry that allows it to be attached to the surface of the nanoparticle. For example, a component may be functionalized with a thiol that allows it to be physisorbed to a gold nanoparticle. In some embodiments in which the component is attached directly to the nanoparticle, all or portions of the nucleic acid container that surrounds the nanoparticle (partially or fully) may be optionally removed, while the component remains attached to the surface of the nanoparticle. In other embodiments, however, the nucleic acid container may remain surrounding the nanoparticle even after attachment of the component. In yet other embodiments, the component is not attached to the surface of the nanoparticle but is attached to a portion of the nucleic acid container. Attachment to both the surface of the nanoparticle and a portion of the nucleic acid container is also possible. Any suitable method of attachment, e.g., to the surface of the nanoparticle and/or to a portion of the nucleic acid container, may be used such as covalent bonding, physisorption, chemisorption, or attachment through ionic interactions, hydrophilic and/or hydrophobic interactions, electrostatic interactions, van der Waals interactions, or combinations thereof.
(110) A component may have any suitable orientation with respect to the nanoparticle or nucleic acid container. For instance, a component may be oriented substantially perpendicular to a wall of the nanoparticle or nucleic acid container. In some embodiments, a component may be oriented at a particular angle or range of angles with respect to a wall of the nanoparticle or nucleic acid container (e.g., between 0 and 90, between 0 and 15, between 15 and 45, between 45 and 60, or between 60 and 90).
(111) In certain embodiments, an inorganic nanoparticle comprising an isolated nucleic acid strand attached to a surface of the inorganic nanoparticle is provided, wherein the inorganic nanoparticle has a non-spherical shape. In certain embodiments, an inorganic nanoparticle coated with a nucleic acid container is provided, wherein the nucleic acid container comprises pores. A binding site, such as an isolated nucleic acid strand may be attached to a surface of the inorganic nanoparticle, and may extend from the surface of the inorganic nanoparticle, through a pore of the nucleic acid container. In some cases, the length of the binding site (e.g., isolated nucleic acid strand) is longer than the thickness of the nucleic acid container, such that the binding site extends outwards from the nucleic acid container.
(112) By using the unique chemistry of the nucleic acid container that surrounds all or portions of the nanoparticle to direct positioning of the components (either directly to the surface of the nanoparticle or to the nucleic acid container), control of many different parameters can be provided.
(113) As shown in the embodiments illustrated in
(114) As shown in the embodiments illustrated in
(115) As shown in the embodiments illustrated in
(116) Furthermore, as shown in the embodiments illustrated in
(117) It should be appreciated that the types of parameters that can be controlled as shown in
(118)
(119) In certain embodiments involving the positioning of isolated components on a nucleic acid container and/or nanoparticle, a component may be isolated in the sense that it is positioned a certain distance away from another component that is attached to the same nucleic acid container and/or nanoparticle such that the isolated component can be uniquely identified and distinguished from the other components (e.g., at the nanoscale level). In some cases, an isolated component may facilitate binding or attachment of other entities to the component, since it is isolated and avoids or reduces the amount of steric interactions with other nearby components attached to the same nucleic acid container and/or nanoparticle.
(120) In some cases, a first component (e.g., an isolated component) is positioned at a distance of least 2 nm, at least 5 nm, at least 10 nm, at least 15 nm, at least 20 nm, at least 30 nm, at least 40 nm, or at least 50 nm apart from the nearest second component attached to the same nucleic acid container and/or nanoparticle. In certain cases, a first component (e.g., an isolated component) is positioned at a distance of less than or equal to 500 nm, less than or equal to 200 nm, less than or equal to 100 nm, less than or equal to 50 nm, less than or equal to 40 nm, less than or equal to 30 nm, less than or equal to 20 nm, less than or equal to 15 nm, less than or equal to 10 nm, or less than or equal to 50 nm apart from the nearest second component. Other distances are also possible. Combinations of the above-noted ranges are also possible. In other embodiments, components may be positioned directly adjacent to one another (e.g., in the form of a self-assembled monolayer) such that the individual components are not isolated and/or not distinguishable from one another (e.g., at the nanoscale level).
(121) Any suitable number of components (whether isolated or not isolated) may be attached to a nucleic acid container and/or nanoparticle. In some embodiments, the nucleic acid nanostructure and/or a nanoparticle may include, for example, between 2 and 500 components (e.g., between 2 and 100, between 2 and 50, or between 2 and 20 components). In some embodiments, the nucleic acid nanostructure and/or a nanoparticle may include at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 100 different components. In other embodiments, the nucleic acid nanostructure and/or a nanoparticle includes less than 100, less than 70, less than 50, less than 40, less than 30, less than 20, less than 10, less than 7 different components. In some embodiments, each of the components are isolated from one another as described herein. Other numbers of components are also possible. Combinations of the above-noted ranges are also possible.
(122) As described herein, two or more components positioned on a surface of a nucleic acid container and/or a nanoparticle may be positioned at any suitable orientation with respect to one another. In some embodiments, at least two components are attached to opposite surface portions of the nucleic acid container and/or nanoparticle. In other embodiments, at least two components are positioned on adjacent surface portions of the nucleic acid container and/or nanoparticle. In some cases, a first component is positioned on a surface of a nanoparticle and a second component is attached to the surface of a nucleic acid container. Other configurations and orientations are also possible.
(123) The methods described herein may be used to print components such as proteins, organic molecules, and inorganic nanoparticles, onto surfaces of the nanoparticles that are formed by the methods described herein. Components may first be decorated onto the interior surface of nucleic acid container in a pre-designed pattern, and later transferred onto the exterior surface of the nanoparticle grown inside the nucleic acid container through the interactions described herein (e.g., physisorption, covalent bonding, van der Waal interactions, etc.), while retaining the pre-designed pattern. For example, nanoparticles that grow inside the container may reach the inner walls of the container where they contact the component and allow attachment of the component to the nanoparticle surface. In some embodiments, even after the removal of nucleic acid container, the component may remain on the surface of the nanoparticle. In other embodiments, components can be attached to staple strands (e.g., nucleic acids) that are hybridized to the container scaffold and hold the scaffold in the target shape. Since different staple strands may be used for holding together different parts of the container, the staple strands may be targeted individually for attaching different components.
(124) A variety of different components can be attached to a surface of a nucleic acid container and/or a nanoparticle as described herein. In some embodiments, the component comprises a binding site. Sometimes, a component can comprise two binding sitesone for the nanoparticle and one for a target separate from the nanoparticle. The term binding refers to the interaction between a corresponding pair of molecules that exhibit mutual affinity or binding capacity, typically specific or non-specific binding or interaction, including biochemical, physiological, and/or pharmaceutical interactions. Biological binding defines a type of interaction that occurs between pairs of biological molecules including proteins, peptides, nucleic acids, glycoproteins, carbohydrates, hormones and the like. Specific examples include antibody/antigen, antibody/hapten, enzyme/substrate, enzyme/inhibitor, enzyme/cofactor, binding protein/substrate, carrier protein/substrate, lectin/carbohydrate, receptor/hormone, receptor/effector, complementary strands of nucleic acid, protein/nucleic acid repressor/inducer, ligand/cell surface receptor, virus/ligand, aptamer/protein, etc. Such molecules are examples of components that can be used with the nanoparticles and nucleic acid containers described herein.
(125) In some embodiments, the binding site comprises a nucleic acid. For example, the nucleic acid may be in the form of DNA, RNA, other nucleic acids, or combinations thereof, as described in more detail herein. In some embodiments, the nucleic acid comprises a single stranded portion. In other embodiments, the nucleic acid comprises a double stranded portion. Combinations of single and double stranded portions are also possible. Examples of nucleic acids are provided in more detail below.
(126) In certain embodiments, a component comprises a marker. Examples of markers include readout (or detectable) markers such as luminescent probes, fluorophores or fluorophore labeled molecules or compounds, chromophores or chromophore labeled molecules or compounds, and the like. In some cases, the marker comprises a nanoparticle (e.g., a quantum dot). In certain embodiments, the marker comprises a reporter molecule, such as a surface-enhanced Raman scattering (SERS) reporter molecule.
(127) In some embodiments, a marker and a corresponding binding site are attached to the surface of the nanoparticle and/or nucleic acid container. The marker/binding site pair may be specific and unique for a target molecule, as described in more detail below. In some such embodiments, each marker may be used to represent a specific binding site. In some cases, the nanoparticle and/or nucleic acid container comprises a plurality of marker/binding site pairs, wherein each of the marker/binding site pairs is different from one another, thereby allowing multiplexing. Other combinations of marker and binding sites are also possible.
(128) In some embodiments, the positioning of components at particular orientations with respect to the nucleic acid container and/or nanoparticle surface allows controlled self-assembly of multiple nanostructures into higher-ordered assemblies. For example, as shown in the embodiment illustrated in
(129) As described herein, each nanostructure (including a nucleic acid container and/or nanoparticle) used in an assembly may have any suitable shape. For example, as shown illustratively in
(130) In some embodiments, an assembly such as the one shown in
(131) As described herein, any suitable component or binding site may be used for assembly, and the component or binding site may be associated with the nanoparticle and/or the nucleic acid portion of the nanostructure. In some embodiments, the nucleic acid-coated nanoparticles are attached to one another by components or binding sites that are attached to a nucleic acid portion of the nucleic acid-coated nanoparticles. In other embodiments, the nucleic acid-coated nanoparticles are attached to one another by components or binding sites that are attached to a nanoparticle portion of the nucleic acid-coated nanoparticles. In some cases, the nucleic acid-coated nanoparticles are attached to one another using a thermal process (e.g., using heat to cause attachment or binding between two nanoparticles, or two or more components associated with the nanoparticles). In other cases, the nucleic acid-coated nanoparticles are attached to one another using a photophysical process. In certain cases, the nucleic acid-coated nanoparticles are attached to one another using a binding process.
(132) After assembly, all or portions of the nucleic acid container may be optionally removed from the nucleic acid-coated nanoparticles. In some such embodiments, a surface of the nanoparticle may be passivated prior to, during, or after the removal step. The nanoparticles may remain attached to one another in the assembly after the removal step. In other embodiments, the nucleic acid container is not removed after assembly of multiple nanostructures.
(133) Different types of assemblies can be formed. In some cases, the assembly comprises an electronic circuit. In some embodiments, the assembly is in the form of a two-dimensional array. In other embodiments, the assembly is in the form of a three-dimensional array. In some cases, nanostructures can be assembled hierarchically based on surface-specific binding.
(134) An example of a process for forming a circuit is shown in the embodiments illustrated in
(135) An assembly may have any suitable size and may be on the nano-, micro-, meso- or macro-scale. In some cases, an assembly has a length and/or at least one cross-sectional dimension that is less than or equal to 1 mm, less than or equal to 100 microns, less than or equal to 50 microns, less than or equal to 10 microns, less than or equal to 1 micron, less than or equal to 500 nm, less than or equal to 100 nm, less than or equal to 50 nm, less than or equal to 10 nm, or less than or equal to 1 nm. In other cases, the assembly has a length and/or at least one cross-sectional dimension that is greater than or equal to 1 nm, greater than or equal to 10 nm, greater than or equal to 100 nm, greater than or equal to 1 micron, greater than or equal to 10 microns, greater than or equal to 50 microns, greater than or equal to 100 microns, or greater than or equal to 1 mm. Other values are also possible. Combinations of the above-noted ranges are also possible. A length may of the assembly may be determined by measuring the distance between two outermost portions of furthest-spaced apart nanostructures forming the assembly. Similarly, a cross-sectional dimension of the assembly may be determined by taking a cross-section between two outermost portions of nanostructures forming the assembly and measuring the distance between the outermost portions.
(136) An assembly of nanostructures may have any suitable configuration. For example, in some embodiments, an assembly may have a linear shape (e.g., AAAAAABBBBBBB, where A and B are different nanostructure building blocks, or an alternative chain such as ABABABAB). In other cases, an assembly may have a star shape (e.g., five B around one A). In other embodiments, an assembly may form a three-dimensional structure such as a tube, box, barrel, rectangle, rod, T, L, branched structure, diamond, square, parallelogram, rhomboid, triangle, pentagon, hexagon, or polyhedron, including shapes substantially similar thereto. Other configurations are also possible.
(137) In some embodiments, the nanostructures described herein (e.g., nanoparticles coated or uncoated by a nucleic acid container) can be used for multiplexed detection. Detection may involve, in some embodiments, introducing a composition suspected of comprising a target molecule (e.g., a biomolecule) to a plurality of nanostructures, and allowing the target molecule, if present, to bind to surfaces of at least two different nanostructures. An example of such a method is shown illustratively in
(138) In some embodiments, the introduction of a target molecule can trigger the recognition of two specific surfaces, and a unique signal as a result of the recognition event may be produced and/or enhanced. For example, in one set of embodiments, each of the components shown in
(139) In some embodiments, the number of different target molecules that can be recognized by nanostructures described herein may depend, at least in part, on the number of different components (e.g., binding sites) positioned on the nanostructure. As described herein, in some cases the components are in the form of isolated components. Generally, the number of different target molecules that can be recognized using the nanostructures described herein can be determined using the formula (n*x1)*n*x/2 (assuming detection of each target molecule involves binding with two nanostructures), where n is the number of nanostructures and x is the number of different binding sites (and/or sides) associated with each of the nanostructures. For example, 2 nanostructures having 5 binding sites on each nanostructure can result in the detection of (2*51)*2*5/2=45 different target molecules. The number of different target molecules that can be recognized using the nanostructures described herein, assuming detection of each target molecule involves binding with three nanostructures, can be determined using the formula (n*x2)*(n*x1)*n*x/3. In some embodiments two nanostructures (or 3, 4, 5, 6, etc. nanostructures) can be used to detect, for example, between 2 and 2,000 different target molecules (e.g., between 2 and 1,000, between 2 and 500, between 2 and 200, between 2 and 100, or between 2 and 50 different target molecules). For instance, in some embodiments two nanostructures (or 3, 4, 5, 6, etc. nanostructures) can be used to detect at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 70, at least one 100, at least 500, at least 1,000, or at least 1,500 different target molecules. In some cases, such numbers of target molecules can be detected in parallel. In some embodiments, a composition includes at least 2, at least 3, at least 5, at least 10, at least 20, at least 30, at least 50, or at least 100 different nanostructures, each of which can be used to detect different target molecules.
(140) It should be appreciated that other methods of detection other than SERS-based detection can be used using the nanostructures described herein. For example, other metal-surface-enhanced luminescent probes can be used, wherein the luminescent group is utilized to replace Raman signal reporters.
(141) Nucleic acids, in the context of the invention, include DNA and RNA, as well are various modifications thereof. Modifications include base modifications, sugar modifications, and backbone modifications. Non-limiting examples of these are provided herein. Non-limiting examples of DNA variants that may be used include L-DNA (the backbone enantiomer of DNA, known in the literature), peptide nucleic acids (PNA) bisPNA clamp, a pseudocomplementary PNA, a locked nucleic acid (LNA), or co-nucleic acids of the above such as DNA-LNA co-nucleic acids. It is to be understood that the nucleic acids used in the embodiments described herein may be homogeneous or heterogeneous in nature. As an example, they may be completely DNA in nature or they may be comprised of DNA and non-DNA (e.g., LNA) monomers or sequences. Thus, any combination of nucleic acid elements may be used. The nucleic acids described herein may be referred to as polymers or nucleic acid polymers. The modification may render the interactions of such polymers more or less stable under certain conditions.
(142) The nucleic acids described herein may be obtained from natural sources, and optionally subsequently modified. They may be synthesized in vitro, and optionally may mimic a naturally occurring nucleic acid or may represent a non-naturally occurring nucleic acid (e.g., due to the present of elements that are not found in naturally occurring nucleic acids). Methods for harvesting nucleic acids from in cells, tissues or organisms are known in the art. Methods for synthesizing nucleic acids, including automated nucleic acid synthesis, are also known in the art.
(143) The nucleic acids may have a homogenous backbone (e.g., entirely phosphodiester or entirely phosphorothioate) or a heterogeneous (or chimeric) backbone. Phosphorothioate backbone modifications render a nucleic acid less susceptible to nucleases and thus more stable (as compared to a native phosphodiester backbone nucleic acid) under certain conditions. Other linkages that may provide more stability to a nucleic acid include without limitation phosphorodithioate linkages, methylphosphonate linkages, methylphosphorothioate linkages, boranophosphonate linkages, peptide linkages, alkyl linkages, dephospho type linkages, and the like.
(144) Nucleic acids having modified backbones, such as backbones comprising phosphorothioate linkages, and including those comprising chimeric modified backbones may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. (F. E. Eckstein, Oligonucleotides and AnaloguesA Practical Approach IRL Press, Oxford, UK, 1991, and M. D. Matteucci and M. H. Caruthers, Tetrahedron Lett. 21, 719 (1980)) Aryl- and alkyl-phosphonate linkages can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriester linkages (in which the charged oxygen moiety is alkylated), e.g., as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574, can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1:165; Crooke S T et al. (1996) Annu Rev Pharmacol Toxicol 36:107-129; and Hunziker J et al. (1995) Mod Synth Methods 7:331-417.
(145) The nucleic acids described herein may additionally or alternatively comprise modifications in their sugars. For example, a -ribose unit or a -D-2-deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is for example selected from -D-ribose, -D-2-deoxyribose, L-2-deoxyribose, 2-F-2-deoxyribose, arabinose, 2-F-arabinose, 2-O(C.sub.1-C.sub.6)alkyl-ribose, preferably 2-O(C.sub.1-C.sub.6)alkyl-ribose is 2-O-methylribose, 2-O(C.sub.2-C.sub.6)alkenyl-ribose, 2-[O(C.sub.1-C.sub.6)alkyl-O(C.sub.1-C.sub.6)alkyl]-ribose, 2NH.sub.2-2-deoxyribose, -D-xylo-furanose, -arabinofuranose, 2,4-dideoxy--D-erythro-hexo-pyranose, and carbocyclic (described, for example, in Froehler J (1992) Am Chem Soc 114:8320) and/or open-chain sugar analogs (described, for example, in Vandendriessche et al. (1993) Tetrahedron 49:7223) and/or bicyclosugar analogs (described, for example, in Tarkov M et al. (1993) Helv Chim Acta 76:481).
(146) The nucleic acids may comprise modifications in their bases. Modified based include modified cytosines (such as 5-substituted cytosines (e.g., 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4-substituted cytosines (e.g., N4-ethyl-cytosine), 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g., N,N-propylene cytosine or phenoxazine), and uracil and its derivatives (e.g., 5-fluoro-uracil, 5-bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil), modified guanines such as 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, N2-substituted guanines (e.g. N2-methyl-guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenines (e.g. N6-methyl-adenine, 8-oxo-adenine) 8-substituted guanine (e.g. 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. The nucleic acids may comprise universal bases (e.g. 3-nitropyrrole, P-base, 4-methyl-indole, 5-nitro-indole, and K-base) and/or aromatic ring systems (e.g. fluorobenzene, difluorobenzene, benzimidazole or dichloro-benzimidazole, 1-methyl-1H-[1,2,4]triazole-3-carboxylic acid amide).
(147) As used herein, the terms bind or interact as they relate to nucleic acids typically refer to hybridization (e.g., base-specific binding) between two or more nucleic acid sequences or strands. The term annealing refers to the process of heating and slowly cooling a mixture of nucleic acids (e.g., in a typical thermal cycling machine) such that the thermodynamic steady state (or one relatively near it) of hybridized elements is formed. Interaction between nucleic acids, according to certain embodiments described herein, is specific and is typically governed by the sequence of the interacting strands. These interactions include Watson-Crick binding in which complementary nucleic acid sequences hybridize to each other. These interactions may also include other binding motifs including but not limited to Hoogsteen or quadruplex binding.
(148) It should be appreciated that other components such as small molecules, proteins, and markers may be attached to the nucleic acids described herein in some embodiments.
(149) The following examples are intended to illustrate certain embodiments of the present invention, but are not to be construed as limiting and do not exemplify the full scope of the invention.
EXAMPLE 1
(150) This example shows a method for forming gold nanoparticles in nucleic acid containers as described herein.
(151) Step 1: Formation of nucleic acid containers. A nucleic acid container was formed by folding DNA using a DNA origami method. The nucleic acid container was designed using caDNAno software. To fold the DNA strands into the designed shape, 16.7 uL 200 nM M13 nucleic acid scaffold (P8064 mutation) (SEQ. ID. NO. 1), 20 uL 500 nM staple strand (obtained following the procedure described in Dietz et al., Science, 325:725-730, 7 Aug. 2009 and Douglas et al., Nature, 459: 414-418, 21 May 2009), 11 uL folding buffer (50 mM Tris, 10 mM EDTA, and 120 mM MgCl.sub.2), and 44 uL water were mixed. The resulting solution was rapidly heat denatured, followed by slow cooling from 80 to 61 degrees Celsius over 100 min, then from 60 to 24 degrees Celsius over 72 h. The nucleic acid containers were purified on a 2% agarose gel (0.5TBE+10 mM MgCl.sub.2) at 70 V for 3 h in an ice-water bath. The gel was stained with Sybr Gold and the nucleic acid containers were extracted from the gel with crash-soak method.
(152) Step 2: Seed decoration. 5 nm mono-DNA functionalized gold nanoparticle precursors were used as seeds for the growth of a templated nanoparticle. To introduce a seed into the cavity of a nucleic acid container, the purified containers (2 nM in 0.5TBE+10 mM MgCl.sub.2 buffer) were mixed with 50 nM 5 nm mono-DNA functionalized gold nanoparticles. The solution was incubated at 37 degree for 16 hours, and then slowly annealed to 24 degree (1 degree/step, 20 min/step). In order to include a single gold nanoparticle into the cavity of the nucleic acid container, the mono-DNA from the gold nanoparticle was designed to hybridize with a single complementary DNA sequence attached to inner surface of the nucleic acid container.
(153) Excessive unbound gold nanoparticles were removed via spin centrifuge. 20 uL of the seed-decorated nucleic acid container solution was mixed with 180 uL water, and loaded into an Amicon centrifugal filter (MWCO=100 kDa, from Millipore) to be centrifuged at 14,000 g for 3 min. This step was repeated twice under the same conditions. The filter was then reversed, and spun at 1,000 g for 2 min. The residual solution was collected.
(154) Step 3: Growth of a gold nanoparticle within a nucleic acid container. To grow a gold nanoparticle having a cross-section in the shape of a hexagon, steps 1 and 2 above were first performed to synthesize nucleic acid container 20 including a cavity having a cross-section in the shape of a hexagon, as shown in
(155)
(156) This example shows that gold nanoparticles can be formed in nucleic acid containers that act as a template during the growth of the nanoparticles. The resulting nanoparticles have shapes that are complementary to the shapes of the cavities of the nucleic acid containers.
EXAMPLE 2
(157) This example shows a method for forming silver nanoparticles in nucleic acid containers as described herein.
(158) Steps 1 and 2 described in Example 1 were performed to synthesize a nucleic acid container having a cross-section in the shape of a rhomboid, as shown in
(159)
(160) This example shows that silver nanoparticles can be formed in nucleic acid containers that act as a template during the growth of the nanoparticles. The resulting nanoparticles have shapes that are complementary to the shapes of the cavities of the nucleic acid containers. This example also shows that nucleic acid containers can be attached to one another to form larger nanostructures.
EXAMPLE 3
(161) This example shows a method for forming silver nanoparticles in a nucleic acid container having quantum dots associated with the inner surface of the container. The quantum dots were used to block the openings of the nucleic acid container.
(162) Steps 1 and 2 as described in Example 2 were performed to synthesize a nucleic acid container having a cross-section in the shape of a rhomboid, as shown in
(163)
(164) This example shows that a silver nanoparticle can be formed in a nucleic acid container that acts as a template during the growth of the nanoparticle when both ends of the container are blocked by quantum dots. The resulting nanoparticle had a shape that was complementary to the shape of the cavity formed by the nucleic acid container and quantum dots. This example also shows that nucleic acid containers can be utilized to prepare heterogeneous structures, which are potentially applicable in solar cells and hydrogen production from water.
EXAMPLE 4
(165) This example shows a method for designing opened nucleic acid containers and the use of the containers to direct the shape of silver nanoparticles during their formation. In this example, the M13 nucleic acid scaffold (P8064 mutation) (SEQ. ID. NO. 1) was used.
(166) Hollow DNA containers used as molds were designed using a 3D DNA origami strategy as described herein (
(167) In this experiment, portions of a DNA container such as DNA barrels and lids were folded by slowly annealing the staple/scaffold mixtures from 80 C. to 24 C. over 72 h. Then, the crude products were subjected to agarose gel electrophoresis (1.5% agarose gel) with 0.5TBE/10 mM MgCl.sub.2 as running buffer. The purified structures were extracted from the gel and then recovered via centrifugation. Seed decoration was executed by the incubation of opened DNA containers (e.g., barrels) with excess of 5-nm gold particles (the stoichiometry ratio between gold and DNA containers ranged from 2:1 to 5:1) at 35 C for 16 h, and then annealed to 24 C over 3 h. Excessive gold nanoparticles were removed by using a size-exclusive spin columns. To form an enclosed cavity, DNA lids were mixed with the seed-decorated DNA barrels at 35 C for 16 h, and then annealed to 24 C over 3 h. Metal precursors, such as silver nitrate for silver nanoparticle and chloroauric acid for the formation of gold nanoparticles, were then added to the purified gold-DNA barrels conjugates, followed by a reducing agent, such as ascorbic acid (AA). After several minutes to hours of growth in the dark at 4 C or room temperature, the solution was dipped onto a copper grid, and stained with uranium salt for TEM imaging.
EXAMPLE 5
(168) This example shows a method for designing closed nucleic acid containers (e.g., boxes) and the use of the containers to direct the shape of silver nanoparticles during their formation. In this example, the M13 nucleic acid scaffold (P8064 mutation) (SEQ. ID. NO. 1) was used.
(169) The three-dimensional confined growth of silver nanoparticles was examined using a box-shaped DNA container. Each DNA box container 20 was designed with three independent components: one barrel 47 and two square shaped lids 50 and 52 (
(170) To connect the lids onto the barrels, 6 or 16 15-nt single-stranded binding sites were introduced at both ends of the 18-helix bundles in the rectangular DNA barrel; while in the square DNA box, 13 15-nt single-stranded binding sites 49 were immobilized at each end of the DNA sidewalls (
(171) For both rectangular barrels and lids, the formation yields were around 10-20%, while for the square barrel, the folding yield was much lower of 5%, owing to barrel dimerization by sticky-end stacking. TEM imaging indicated the formation of the designed shapes. For both rectangular barrels, the cross-sectional dimensions of the central cavity were 20 nm15 nm, consistent with 2.5 nm per double helix, and 15 nm15 nm for the square shaped cavity. However, due to partial dehydration and structural deformation during TEM sample preparation for imaging, small deviations of 2 or 3 nm were also observed, as well as corner angle deviations from 90 degrees and/or or rough inner surfaces. TEM imaging also revealed the seed decoration yields for different shaped DNA barrels were approximately 74-91% (N>100).
(172) The unpurified reaction solution after lid closure was then imaged with TEM to determine the formation yield (
(173) The growth of silver nanoparticles was triggered by the addition of silver nitrate (1.4 mM) and ascorbic acid (2 mM). After growth for 4 to 10 min at room temperature, silver nanoparticles 38 grown within the DNA boxes were imaged by TEM (
(174) In some cases, defective DNA structures were also observed during the silver growth processes. In the growth direction confined by two two-layered DNA sidewalls made from 16-helix bundle in a rectangular DNA box container, defective structures were observed with both sidewall bending and cavity expansion; whereas in the growth direction confined by two three-layered DNA sidewalls made from 18-helix bundle, defective structures were mainly observed with expanded dimension size, e.g., from 20 nm to around 25 nm. TEM images indicated that defect yields for two-layered sidewalls was 5 times higher than that in the three-layered sidewalls (N>50). In square shaped DNA box containers with three-layered DNA sidewalls, defective structures mainly resulted from the expansion of cavity dimensions, e.g., from 15 nm to around 20 nm. The defect ratio was also dependent on reaction time and reactant concentration. When the reaction time was 4 min with 0.3 mM AgNO3 and 0.5 mM AA as reactants, the defect ratio at for the square box was decreased by 2/3.
(175) Several other designs for lids and barrels were also tested to fabricate cavities with distinct shapes. 16-helix bundles of DNA with 10 or 15 nm lengths were introduced onto the top of 30-helix bundles. After purification, TEM images indicated the well formation of 30-helix bundles. However, in this particular experiment, both 16-helix bundles did not connect to the 30-helix bundles tightly, and could not be utilized for box formation. DNA barrels with triangular tops was also fabricated. After seed decoration and lid closure, clear spacing was observed at one vertex, which was composed of several 10-nm DNA helices. Although a triangular top was observed in the confined silver nanoparticles, the spacing between 10-nm DNA helices was expanded. This resulted from the unstable linkage of 1 or 2 staple crossovers in 10-nm DNA helices, compared to 4 to 5 staple crossovers linkage in 30-nm DNA helices. The distorted DNA barrels further evidenced that rigid and stable DNA sidewalls confined the metal growth.
(176) As described herein,
EXAMPLE 6
(177) This example shows a method for designing opened nucleic acid containers and the use of the containers to direct the shape of silver and gold nanoparticles during their formation. In this example, the M13 nucleic acid scaffold (P8064 mutation) (SEQ. ID. NO. 1) was used.
(178) The generality of the confined growth of metal nanostructures in DNA molds was tested in open nucleic acid containers 20 (e.g., barrels) to demonstrate the cross-section controllability (
(179) Gel purification indicated 5-10% folding yields of the DNA containers. TEM images showed that the equilateral triangle-shaped DNA channel exhibited an edge length of 25 nm with thickness of 15 nm (
(180) The silver nanoparticles grown within the DNA containers (for 4 to 8 min at room temperature) were imaged by TEM. Approximately 5-10% of the silver nanoparticles formed were found to have the shape of the designed cross-sections of the container in which the nanoparticles were grown (the remaining nanoparticles having the shape of spheres). In the equilateral triangle-shaped container, a fully confined silver nanoparticle exhibited an equilateral triangle-shaped cross-section, with each edge having a length of 25 nm and three round vertexes (
(181) In the open containers, only particles grown laterally rather than vertically were confined to the shape of the container, which resulted in the 5-10% confinement yields. Most of the unconfined particles exhibited sphere shapes.
(182) It was observed that four-layered DNA helices increased sidewall rigidity. In the case of the equilateral triangle-shaped DNA containers, the number of defective structures having bent sidewalls was lower than those in two- and three-layered rectangular DNA containers. It was also observed that right-angled triangular containers with 15-29-33 nm dimensions also confine the silver growth within. However, the nanoparticle grown in a container having a sharp vertex including a 30-degree angle was not well formed, compared with that formed in a container having angles of 60 degrees in an equilateral triangle, or in a container having an angle of 50 degree in a right-angled triangle.
(183) Several other open containers were also tested. Equilateral triangle-shaped DNA containers with 15-nm edge exhibited less rigid sidewalls compared with that having a 25-nm edge, owing to less staple crossovers to interconnect DNA double helices. The silver nanoparticle grown within produced triangle shaped silver nanoparticles (1%, N>100), but most of the nanostructures were sphere-like. A honeycomb lattice was employed to build hexagonal DNA containers; however, after silver growth, orientation transformation of double helices in the DNA sidewalls were observed, indicating less rigid structure of the honeycomb lattice compared with that of a square lattice.
(184) Gold nanoparticles were also grown within open rectangular DNA containers. Compared with that of silver nanoparticles, the growth kinetics of gold in 0.5TBE/10 mM Mg(NO3).sub.2 buffer was much slower. After reaction for thirty minutes, no obvious size increment had been observed for the nanoparticle within, which was ascribed to the chelating effect of EDTA to the gold precursor. Removing EDTA from the reaction buffer significantly promoted the growth kinetics. Thirty minutes reaction produced a 15 nm20 nm rectangular cross-shaped gold nanoparticle within the rectangular barrel (
EXAMPLE 7
(185) This example describes a method of performing directed self-assembly of nucleic acid (e.g., DNA) containers as described herein. In this example, the M13 nucleic acid scaffold (P8064 mutation) (SEQ. ID. NO. 1) was used.
(186) DNA containers, including DNA containers containing inorganic nanoparticles, provide not only structural confinement but also surface addressability information. For example, for DNA containers containing nanoparticles therein, due to the sequence specificity of 3D DNA origami, each staple strand (e.g., a DNA strand) that is located near a silver nanoparticle surface can be independently addressed and modulated, which enables a surface addressability resolution down to 2.5 nm3.4 nm on the nanoparticle surface. Each staple strand can be further modified with distinct binding features, including biotin or multiple different sequenced single-stranded regions, controlled orientations and stoichiometry ratio. Different from previous post-assembly strategies known in the art, surface addressability of DNA nanostructures enabled metal growth within a pre-assembled network of containers. Based on this feature, branched metallic trimers and quantum dot (QD)-silver heterogeneous structures were fabricated, as shown in
(187) To assemble a Y-shaped DNA container 51 from three individual DNA barrel containers 20, six single-stranded connectors were arranged into two parallel rows at one end of each rectangular barrel by the extension of specific staple strands at both 3 and 5 positions. Each row was composed of three different sequenced 15-nt single stranded DNAs, and hybridized to their complementary strands in another partner barrel. Incubation of separately prepared and purified DNA barrels (3 nM) in the presence of 10 nM gold seeds 34 produced seed-decorated Y-shaped barrels. TEM imaging indicated the 5% formation yield of seed-decorated Y-shaped barrels (
(188) To build a heterogeneous quantum dot (QD)-silver nanoparticle-quantum dot sandwiched structure 53 as shown in
(189) TABLE-US-00001 NUCLEICACIDSEQUENCES M13nucleicacidscaffold(P8064mutation) (SEQIDNO:1) GAATTCGAGCTCGGTACCCGGGGATCCTCAACTGTGAGGAGGCTCACGG ACGCGAAGAACAGGCACGCGTGCTGGCAGAAACCCCCGGTATGACCGTG AAAACGGCCCGCCGCATTCTGGCCGCAGCACCACAGAGTGCACAGGCGC GCAGTGACACTGCGCTGGATCGTCTGATGCAGGGGGCACCGGCACCGCT GGCTGCAGGTAACCCGGCATCTGATGCCGTTAACGATTTGCTGAACACA CCAGTGTAAGGGATGTTTATGACGAGCAAAGAAACCTTTACCCATTACC AGCCGCAGGGCAACAGTGACCCGGCTCATACCGCAACCGCGCCCGGCGG ATTGAGTGCGAAAGCGCCTGCAATGACCCCGCTGATGCTGGACACCTCC AGCCGTAAGCTGGTTGCGTGGGATGGCACCACCGACGGTGCTGCCGTTG GCATTCTTGCGGTTGCTGCTGACCAGACCAGCACCACGCTGACGTTCTA CAAGTCCGGCACGTTCCGTTATGAGGATGTGCTCTGGCCGGAGGCTGCC AGCGACGAGACGAAAAAACGGACCGCGTTTGCCGGAACGGCAATCAGCA TCGTTTAACTTTACCCTTCATCACTAAAGGCCGCCTGTGCGGCTTTTTT TACGGGATTTTTTTATGTCGATGTACACAACCGCCCAACTGCTGGCGGC AAATGAGCAGAAATTTAAGTTTGATCCGCTGTTTCTGCGTCTCTTTTTC CGTGAGAGCTATCCCTTCACCACGGAGAAAGTCTATCTCTCACAAATTC CGGGACTGGTAAACATGGCGCTGTACGTTTCGCCGATTGTTTCCGGTGA GGTTATCCGTTCCCGTGGCGGCTCCACCTCTGAAAGCTTGGCACTGGCC GTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTA ATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA GGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA TGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGC TGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTG GCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCC ATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTT ACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGAC GCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTT AACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTA AATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCA ACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCG ATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGT AGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGA ACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTC ACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAAT ATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCT CCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAG CTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTG CCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGAT GCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTA TTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTC GCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGT ACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGC AATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCA ATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTG GTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGC TTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAG TCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAA CTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCG CAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGG CAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGT CTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATT CCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATC TCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGT TTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGC CAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATT AAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGG GCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAA TGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCC TATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTC AGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTA ACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACA AATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAA AGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTG CCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCA TGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGT TCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCC TTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGG CGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAA GAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCC TTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTC GCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTG AAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTG GAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTG TGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTT ACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGG TGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGT ACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATA TCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGC TAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATG TTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATA CGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTA CACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAA TTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTT GTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGC TGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGC TCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCG GTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGC TAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCT GACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTA TCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGC TACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGAC GGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCC TCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACC ATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTC TTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGT TTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTG GGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGT TCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTAT TGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTT GTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTC AGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGT TATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAA ATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTA ACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTC AGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAG GCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTT CTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGC GCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGA TGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGA CAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATA TTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTC TGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACT TTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGC CTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATT AAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAAC GCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTT ATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATT AAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTT TCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATA GTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGAC CTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTA AGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCG ACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTAC TGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAA TTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATT GAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGC AATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTAC TGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATT TCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCA TTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCC ATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGT TTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATA ACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTC TAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTA TTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCC TTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGAT ATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGC TCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCT CTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGT TTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATA TTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCT CTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATC TGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGT ATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTC TGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAG TGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGT GATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTT CTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCT CCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTG CTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCG GCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCC TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGC CGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGA TTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATG GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGAC GTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACA ACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGC CGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACC AGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCA ATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCC CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAG CTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCA ATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTA TGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCA CACAGGAAACAGCTATGACCATGATTAC SequencesofstaplestrandsfortheDNA containerinFIG.8. oligo1 (SEQIDNO:2) TAACCACCCACTACGTGAACCACGTCAAAGGGCGAACCGCCT oligo2 (SEQIDNO:3) CGGGCGCAGGTGCCGTAAAGCCAGTTTGGAACAAGGTTTGCC oligo3 (SEQIDNO:4) CGGCGAACGATTTAGAGCTTGATAAATCAAAAGAAAAATCGG oligo4 (SEQIDNO:5) GTTTTTTTATTAAAGAACGTGTGCAGCAAGCGGTCTGGGCGC oligo5 (SEQIDNO:6) CTAAAGGAGATAGGGTTGAGTTCCTGTTTGATGGTTTAATGA oligo6 (SEQIDNO:7) AAAGTTGTTCACTAAATGAAAGCGTTAGAATCAGAGCGAATCAGT oligo7 (SEQIDNO:8) TTCAGAGAGTGACTCCAATCACCCGGTCACGACTATGG oligo8 (SEQIDNO:9) CAGGGTGAAAGTGTAAAGCCTTTTTCACGGTCATCGTGTGTT oligo9 (SEQIDNO:10) ATCGGCCATTAATTGCGTTGCCCTGTGCACTCTGTCTGCAGC oligo10 (SEQIDNO:11) CGAGCCGTTTCCTGTGTGAAATCATAAACATCCCTGCCCTGC oligo11 (SEQIDNO:12) TGCTGCGTATCACGCTGAGTCCACGGGGTCGTAGGGCGACGTATA oligo12 (SEQIDNO:13) GTGAGCTCGGCCAGAATGCGGCGGCATCAGATGCCCAATCCG oligo13 (SEQIDNO:14) ACTAGCTGCAGGTTCCGTAGCCCGGAGCCCCCGTGGCGAACAGGA oligo14 (SEQIDNO:15) CAGCAAAGGTATGAGCCGGGTGGTCTGGTCAGCAGGTCTCGT oligo15 (SEQIDNO:16) CAGCGGTCATTGCAGGCGCTTGTCGGTGGTGCCATACGATGC oligo16 (SEQIDNO:17) GGCTGGTGTAGAACGTCAGCGGGCCAGAGCACATCGCGGATCTCAC oligo17 (SEQIDNO:18) CCGGGCGAAGAATGCCAACGGGCAAACGCGGTCCGGGGCGGTATTT oligo18 (SEQIDNO:19) ACCTCGCACTGGGTTACGGTGCTGAACTCACAACGCGCGCGA oligo19 (SEQIDNO:20) TCCTGGTGCTCACTGTTTACACTGATAGCTGGAAGCATGTTT oligo20 (SEQIDNO:21) CGCTGGCGCTCATTTCCGTGGGTTTTCCCTTCGCTTGCC oligo21 (SEQIDNO:22) TGATTGCTAAAAAAGCCATGTGCTTTCATCAGGCTTCGC oligo22 (SEQIDNO:23) AGCAGTTTTTTTTCCAACCGCCGGTTGCTCGTTAACGGGCCGGGGG oligo23 (SEQIDNO:24) AAAAAAAAAGTTAACCCACGCGCGGGGTGCCGGTGCTGCGCGGCTC oligo24 (SEQIDNO:25) GGAATTAAGTCGAAAGGGGCGCATGGGATAGATTGTAAGAAGATTCAAT oligo25 (SEQIDNO:26) GTGTAAAACGAAGGGCGACAGTATCGTCGGATGTTAAACATATGTAGAG oligo26 (SEQIDNO:27) TCGACGGGAAAGGCAAAGGCACCGTAGCCAGAAATAATAAGAGAACATT oligo27 (SEQIDNO:28) CGCCAGGTGAAGGGATAGCTCAAACTTAAATTTCTAGCC oligo28 (SEQIDNO:29) GTGCCAATTACCAGTCCCGGATGTGTACATCGACACGTTCCGCAGC oligo29 (SEQIDNO:30) AGTAAACGGCTTAAAATTCAGAAATAGCTGAAAAGATTTAAA oligo30 (SEQIDNO:31) ACTAAATGTGAACCAATTCGTAAAGATCTACCCCTCATATTA oligo31 (SEQIDNO:32) GCTTTCCGCGCCATTCGCCATGAGGTGG oligo32 (SEQIDNO:33) CCGTAATCGTAACCGTGCATCATTACGCCAGCTGGTGGGTAA oligo33 (SEQIDNO:34) TGGGAACTTGAGGGGACGACGATCGGTGCGGGCCTCAGTCAC oligo34 (SEQIDNO:35) AACAACCCGGCCTCAGGAAGAGCGCAACTGTTGGGACGGCCA oligo35 (SEQIDNO:36) ACGGTAAAGGAACGCCATCAACTTTCATCAACATTCCAGCCA oligo36 (SEQIDNO:37) ATGCCGGACCCCGGTTGATAATCGCATTAAATTTTTTCTCCG oligo37 (SEQIDNO:38) TAAGCAACAAAAGGGTGAGAAATATTCAACCGTTCAGCCCCA oligo38 (SEQIDNO:39) GCCAAAGGTGGCATCAAACATGTTTTAAATACCTTTAA oligo39 (SEQIDNO:40) CAAAAACATATTTTAAATGCAAGCTATTTTTGAGAACTAGCA oligo40 (SEQIDNO:41) TGAAATAACCTGTTTAGTCATTCCATATAACCCAGACC oligo41 (SEQIDNO:42) ATACTTTAAAAATTTTTAGAAAAAGGCTATCAGGTTCGATGA oligo42 (SEQIDNO:43) GTAGCATTGAATATAATGCTGAAGAGGTCATTTTTAGAAAAC oligo43 (SEQIDNO:44) TGATCAGAGCATAAAGCAGTAATGTGTAGGTTAAATTA oligo44 (SEQIDNO:45) GGGGCGCAAAGTACGGTGTCTACAGGTCAGGATTACTGACTA oligo45 (SEQIDNO:46) TTTCGCATCCCAATTCTGCGATAATTCGAGCTTCAATTAAGA oligo46 (SEQIDNO:47) TTGCTCCATCAAAAATCAGGTAATACTGCGGAATCATGCAGA oligo47 (SEQIDNO:48) GGAAGCAAAAGCGGATTGCATCCAGAGGGGGTAATGAGCAAC oligo48 (SEQIDNO:49) TTGCAAAAAGAAGCGAAAGTTGATAATGGTCCCCTGTA oligo49 (SEQIDNO:50) ACCACATAACATTATTACAGGCAAATCAACGTAACTCAAGAG oligo50 (SEQIDNO:51) CTAGTCATAAACCATAATTTTGATTAGCTCATTCTACTGCAAAAT oligo51 (SEQIDNO:52) TACATAAAATAAAACGAACTACTCATTCAGTGAATGCATAGG oligo52 (SEQIDNO:53) ACGAGGCTTGGGAAGAAAAATGCCCTGACGAGAAATGAACGG oligo53 (SEQIDNO:54) TAAAGTAAAACAGAAGCAACTCCAGGAAGTTCTATATTGTTGTAC oligo54 (SEQIDNO:55) ACTATCACTCATTATACCAGTACGAGTAGTAAATTCCAACTT oligo55 (SEQIDNO:56) CAGACGATTATGCGATTTTAAAGATGGTTTAATTTATCATAA oligo56 (SEQIDNO:57) AAAGCGAGAGCGAAAGACGCGTTTACGAGTAGACCATTGAAGCCT oligo57 (SEQIDNO:58) GTTCGCCAAAAGCGTCCCTTTACCGAGAGTATGCAACTGAGC oligo58 (SEQIDNO:59) TAATCTTCCCAGCGATTATACAGAGGCAAAAGAATATAACCGCAAT oligo59 (SEQIDNO:60) CTGGCTGGAAACAAAGTACAAAAGGCACCAACCTATGAG oligo60 (SEQIDNO:61) TGTACAGTTGTATCATCGCCTAAAATACGTAATGCGGCCGCTAGGT oligo61 (SEQIDNO:62) TGAAAGATGTGTCGAAATCCGGGAAGTTTCCATTAACCC oligo62 (SEQIDNO:63) GGGAACCCTCCATGTTACTTAGGACTAAAGACTTTCATCGGAAAAA oligo63 (SEQIDNO:64) TGACGACCTGGAACTGAGGGCTTGGAACTGGTAACCCTAGTT oligo64 (SEQIDNO:65) CGGTCGCAAACGAACAAGCGCACCTTCAAAAGCTGACGGAACTCAA oligo65 (SEQIDNO:66) GCTTGATACCTGCTAAATAGCGTAGTTTAGTGGATAAGTACT oligo66 (SEQIDNO:67) AGTTAAACACTACGCGGAGATACCAGGCAAGGCTTCTAC oligo67 (SEQIDNO:68) GATCGTCAACGGGTGATAAATGGACAGACACCAGACAGGACGATAG oligo68 (SEQIDNO:69) TCACGGTTTAAGGAACAAAACTACCACCCTCAGAGAAGGTGC oligo69 (SEQIDNO:70) TAGCAACGCTTTGAGCCGGAAACGGTCACAACTTTAATTACCCGAT oligo70 (SEQIDNO:71) GACTGAATTTTGTCGTCGTGTATCTTGATATGCTTTTGACCGTTCACCA oligo71 (SEQIDNO:72) GAATTCAGCGTCCACAGAACCGCCGGGTTTTGGGTCAGATCCTCACTCA oligo72 (SEQIDNO:73) GGAGAATAATACTGAGTCATTTTCTTAAGAGGCCCCCTAGGCAGGACCA oligo73 (SEQIDNO:74) GAATTGCGCCTTTAATTGTATGCAGCGAAAGACAGTTCA oligo74 (SEQIDNO:75) TCATAGTCAACTTTCAACAGTTTTCTTAAACAGCTTGCAGGG oligo75 (SEQIDNO:76) GAGAGGGACCGTACTCAGGAGACGATCTAAAGTTTTCTGTAT oligo76 (SEQIDNO:77) ATTAGCGACCCTCAGAACCGCAACGCCTGTAGCATGAGTGAG oligo77 (SEQIDNO:78) CTCCTCAAGAGCCACCACCCTTTCGTCACCAGTACACTAAAG oligo78 (SEQIDNO:79) GAAAGTAAGGGATAGCAAGCCCCATGTACCGTAACAATTTTT oligo79 (SEQIDNO:80) GGTGAAAGCGGCCTCCCCCCCCTTCCATTTGGGGAGGG oligo80 (SEQIDNO:81) TTTAACGGCTCAGTACCAGGCACCGCCACCCTCAGACAGCCC oligo81 (SEQIDNO:82) CCGTTGATATGCCACCACGTCAGATACCATTTTACCAG oligo82 (SEQIDNO:83) AGCCGCCTCAGACGATTGGCCTATAAACAGTTAATGCTGAGA oligo83 (SEQIDNO:84) GTCATAGTCAGAGCCGCCACCTTAAAGCCAGAATGAATAAGT oligo84 (SEQIDNO:85) ACTTGAGATTAGCGTTTGCCACCACCACCGGAACCCAGTCTC oligo85 (SEQIDNO:86) GCACCATCTGTAGCGCGTTTTCCGCCACCCTCAGATCACAAA oligo86 (SEQIDNO:87) CCATCGAGTAATCAGTAGCGACCACCACCAGAGCCTTGACAG oligo87 (SEQIDNO:88) TATTCATTAATAACGGAATACCCGAACAAAGTTACTCAAAAA oligo88 (SEQIDNO:89) AAGGTAAAACTGGCATGATTATTAAGAAAAGTAAGTTTACAG oligo89 (SEQIDNO:90) ATTCAACTTATTACGCAGTATGCTATCTTACCGAAAAACAGG oligo90 (SEQIDNO:91) CGCCAAAAACGTAGAAAATACAGAAACAATGAAATGGGAGAA oligo91 (SEQIDNO:92) GGTAGCAAGGCCGGAAAAAGTTTGCCTTTAGCCCTCAG oligo92 (SEQIDNO:93) AAAATTCAAGGTGGCAACATATTAAGCCCAATAATTGAACAA oligo93 (SEQIDNO:94) TTTAGACTCCCGATTGAGGAATTAGAGCCAGATTTTCG oligo94 (SEQIDNO:95) AGAGAATAAAATAAACAGCCACAAATCAGATATAGAACCAAG oligo95 (SEQIDNO:96) TTAACTGAACGCTAACGAGCGAGGCGTTTTAGCGAATAATCG oligo96 (SEQIDNO:97) CGCCCAAAGAACAAGCAAGCCAGAGAATATAAAGTCATGTAA oligo97 (SEQIDNO:98) AAGTATTATTAGCAGCCCAGATAGCCAAAAGATATTGAGTCACCG oligo98 (SEQIDNO:99) ATTCTAATCATTCCAAGAACGAGACGACGACAATACAGTAGG oligo99 (SEQIDNO:100) GCGTCTTTCCATTAGACAGCAATAGTTAGCAGACAAAAACCAGTA oligo100 (SEQIDNO:101) GGGAGGTCGAGCATGTAGAAAGCCTGTTTATCAACATGCGTT oligo101 (SEQIDNO:102) AAGCAGCTACGGGTAATAATTGAGTAAAAGAGTCACAAAATGAAA oligo102 (SEQIDNO:103) TACCGCAAAAGGTAAAGTAATCGCCATATTTAACATAGTTAA oligo103 (SEQIDNO:104) GCTGTCTTGTTCAGCTAATGCCAGTATAAAGCCAAACCGACC oligo104 (SEQIDNO:105) TCAACCTCCCTCTTACCAACACCCAAGAGCAATACATAATAT oligo105 (SEQIDNO:106) TTTAGGCAAAACTTTTTCAAATGCTGATGCAAATCATTA oligo106 (SEQIDNO:107) AATTCTGTCCGGTATTAAAGGCTTCAGTTACAACATAAGCCC oligo107 (SEQIDNO:108) GCTTAATCTAAATTTAATGGTTTTAACCTCCGGCTGAGTGAAAGCA oligo108 (SEQIDNO:109) ATACAAAGCGTTAAATAAGAAAATAGTGAATTTATTTTTCCCTACA oligo109 (SEQIDNO:110) TTTCATCGGTTATATAACTATAGTACATAAACATCTTGC oligo110 (SEQIDNO:111) GTGTGATATAGGTCTGAGAGATAAATCGATTATTCGTTT oligo111 (SEQIDNO:112) CCTAATTACAAACCTACTACTTCTTAATAGAAAATATCCGAA oligo112 (SEQIDNO:113) TGGAAACATGTAAATATATTTACGCCAAACCGACACTCATCGTAGC oligo113 (SEQIDNO:114) GCTTCTGCTACCTTTTGAAATCGCTCAAAACAACATTCCTTAGAAC oligo114 (SEQIDNO:115) TAATTAACAAAATCAAATAAGTTCTTACAGAACGCCCAA oligo115 (SEQIDNO:116) CCTTGAAAAGAGTCTAAACACGTATCATAATAGATTAATTTATTTG oligo116 (SEQIDNO:117) ATGAAACAAATCAATATATGTTAGGTTGTTCTGACTGAG oligo117 (SEQIDNO:118) AAAAGAAATTGATGATGAGAAGTATTGGCAAGAACCACCTGA oligo118 (SEQIDNO:119) AAACAGTAACCCACCAGATCCTTTGCTGAACTTAACACAGTA oligo119 (SEQIDNO:120) ACGTAATCCTAGATAATGGAATTGTCGCCATACGTGGCTGGT oligo120 (SEQIDNO:121) AACTCATCATCAATTCGCCTCAATACAGAGGGCCAACAGAAA oligo121 (SEQIDNO:122) AGATCATTTTAATTTTAAAAAATCCCACGCTAGATTCATCTG oligo122 (SEQIDNO:123) GGAATTAGTCAGATGAATATATCGCGCAGAGGCGATCGCTAT oligo123 (SEQIDNO:124) AGGATTTGCAATTCATCAATATAAAACAGAAATAAGAAGATG oligo124 (SEQIDNO:125) TTATCTATTAGAGCCGTCAATGATTGTTTGGATTACATATCA oligo125 (SEQIDNO:126) TGGTCAGTTAGACTTTACAAAATTCCTGATTATCAGCGTAGA oligo126 (SEQIDNO:127) TCACCTTGCCCGAACGTTATTGCGGAACAAAGAAAAGTACCT oligo127 (SEQIDNO:128) CTGTGAATGGAACTCAAATAACATGCGCTTAATGCGCC oligo128 (SEQIDNO:129) GTCAGTACTCAAATATCAAACACAACTCGTATTAAAAGGAGC oligo129 (SEQIDNO:130) TAAGAATTAAAAATACCGAACATCAACAGTTGAAAACATTTG oligo130 (SEQIDNO:131) CCTTACCGCCTCACGCAGACGAGCCTGGCAAGTGTAGCAAATCAA oligo131 (SEQIDNO:132) ATACTACATTTTTTTATGGAGCTAAGAAAGGAAGGGAACGGAACC oligo132 (SEQIDNO:133) GAGGCCAGCTCATGGAAATACAAAGGGACATTCTGTGAGGCG oligo133 (SEQIDNO:134) GCTACAGTTCTTTGATTAGTAACTATCGGCCTTGCACAGACA oligo134 (SEQIDNO:135) TTGCTTTAATTAACCGTTGTAATCCAGAACAATATGAAAGCG oligo135 (SEQIDNO:136) ACGTGCTAAAGAGTCTGTCCAAGCCATTGCAACAGGAGATAG oligo136 (SEQIDNO:137) GGCCGATAATCCTGAGAAGTGTTGACGCTCAATCGCCAGTCA oligo137 (SEQIDNO:138) CCGAGCTCGAATTCGTAATCA oligo138 (SEQIDNO:139) GGCCCTGTTTTCACCAGTGAGCAACATA oligo139 (SEQIDNO:140) AAAACAGACGTTAATATTTTGGGATTGA oligo140 (SEQIDNO:141) ATGAGGCCGGAGAATTAAATAGTA oligo141 (SEQIDNO:142) GAGAATGATATTCATTGAATCTAGGAAT oligo142 (SEQIDNO:143) GGGATTTGATAGTTGCGCCGAATATATT oligo143 (SEQIDNO:144) TGAATTTATGATACAGGAGTGTGCCGTC oligo144 (SEQIDNO:145) GAGTCTTTTCTATCACCCGGAAAT oligo145 (SEQIDNO:146) TGAAAATTATCCCAATCCAAAATTACCG oligo146 (SEQIDNO:147) AAATTATAAGAAAACAAAATTTTTTTAA oligo147 (SEQIDNO:148) ATATTTTATAGCCCTAAAACAAGGAAGG oligo148 (SEQIDNO:149) AATGCAATACGGCGCGTCTGCGCG oligo149 (SEQIDNO:150) GGCCCTGTTTTCACCAGTGAGCAACATATTCCTCTACCACCTACATCAC oligo150 (SEQIDNO:151) AAAACAGACGTTAATATTTTGGGATTGATTCCTCTACCACCTACATCAC oligo151 (SEQIDNO:152) ATGAGGCCGGAGAATTAAATAGTATTCCTCTACCACCTACATCAC oligo152 (SEQIDNO:153) GAGAATGATATTCATTGAATCTAGGAATTTCCTCTACCACCTACATCAC oligo153 (SEQIDNO:154) GGGATTTGATAGTTGCGCCGAATATATTTTCCTCTACCACCTACATCAC oligo154 (SEQIDNO:155) TGAATTTATGATACAGGAGTGTGCCGTCTTCCTCTACCACCTACATCAC oligo155 (SEQIDNO:156) GAGTCTTTTCTATCACCCGGAAATTTCCTCTACCACCTACATCAC oligo156 (SEQIDNO:157) TGAAAATTATCCCAATCCAAAATTACCGTTCCTCTACCACCTACATCAC oligo157 (SEQIDNO:158) AAATTATAAGAAAACAAAATTTTTTTAATTCCTCTACCACCTACATCAC oligo158 (SEQIDNO:159) ATATTTTATAGCCCTAAAACAAGGAAGGTTCCTCTACCACCTACATCAC oligo159 (SEQIDNO:160) AATGCAATACGGCGCGTCTGCGCGTTCCTCTACCACCTACATCAC oligo160 (SEQIDNO:161) CAAAATCAAACCTGTCGTGCCGCCCGCT oligo161 (SEQIDNO:162) AGCCGCCGCGAAACGTACAGCATCCCGT oligo162 (SEQIDNO:163) GCCCAAGGATTGCGGGAAGATACA oligo163 (SEQIDNO:164) GGAAGCCGCTTTTGCAAAAGACGTTTAC oligo164 (SEQIDNO:165) TCACGTTAAAAAAAAGGCTCCACGAGGG oligo165 (SEQIDNO:166) GAGGTTGGCCTATTTCGGAACGAAACAT oligo166 (SEQIDNO:167) GAACAGAATCCGTCACCTCAATAG oligo167 (SEQIDNO:168) AGTCAGAAATTTTATCCTGAAGACTTGC oligo168 (SEQIDNO:169) TTTACATTTTGAATACCAAGTTTAGAAT oligo169 (SEQIDNO:170) CACGACCCGCCTGCAACAGTGTAAAGCA oligo170 (SEQIDNO:171) AAAACGCCAGTAAAGGGGGAAAGC oligo171 (SEQIDNO:172) CAAAATCAAACCTGTCGTGCCGCCCGCTTATCTTCCTCACACTCCCAAA oligo172 (SEQIDNO:173) AGCCGCCGCGAAACGTACAGCATCCCGTTATCTTCCTCACACTCCCAAA oligo173 (SEQIDNO:174) GCCCAAGGATTGCGGGAAGATACATATCTTCCTCACACTCCCAAA oligo174 (SEQIDNO:175) GGAAGCCGCTTTTGCAAAAGACGTTTACTATCTTCCTCACACTCCCAAA oligo175 (SEQIDNO:176) TCACGTTAAAAAAAAGGCTCCACGAGGGTATCTTCCTCACACTCCCAAA oligo176 (SEQIDNO:177) GAGGTTGGCCTATTTCGGAACGAAACATTATCTTCCTCACACTCCCAAA oligo177 (SEQIDNO:178) GAACAGAATCCGTCACCTCAATAGTATCTTCCTCACACTCCCAAA oligo178 (SEQIDNO:179) AGTCAGAAATTTTATCCTGAAGACTTGCTATCTTCCTCACACTCCCAAA oligo179 (SEQIDNO:180) TTTACATTTTGAATACCAAGTTTAGAATTATCTTCCTCACACTCCCAAA oligo180 (SEQIDNO:181) CACGACCCGCCTGCAACAGTGTAAAGCATATCTTCCTCACACTCCCAAA oligo181 (SEQIDNO:182) AAAACGCCAGTAAAGGGGGAAAGCTATCTTCCTCACACTCCCAAA oligo182 (SEQIDNO:183) CCAGCAGGGGGAGAGGCGGTTCTAATGA oligo183 (SEQIDNO:184) GACGTTGAGAGATAGACTTTCTGCCGCC oligo184 (SEQIDNO:185) TGTCAATTCAGCTCATTTTTTAGCGAGT oligo185 (SEQIDNO:186) GGTATGCCTGTAAATCGTTCATTT oligo186 (SEQIDNO:187) TTATAGTTGTTTAGACTGGATAGGAATT oligo187 (SEQIDNO:188) AATAGAATCAGCTTGCTTTCGTTTGCGG oligo188 (SEQIDNO:189) CAAATAATGCCTTGAGTAACAGATTAGG oligo189 (SEQIDNO:190) GAACATCGGCCAAAATCGGGCGAC oligo190 (SEQIDNO:191) GAAGCGCAGAGCCTAATTTGCATCCGGT oligo191 (SEQIDNO:192) TTTTCAGATTTCAATTACCTGTAACCTT oligo192 (SEQIDNO:193) AACCCTTCAGCAGAAGATAAACAATATC oligo193 (SEQIDNO:194) AACCCGAGTATTCCTCGAAAGGAG oligo194 (SEQIDNO:195) CCAGCAGGGGGAGAGGCGGTTCTAATGATAACATTCCTAACTTCTCATA oligo195 (SEQIDNO:196) GACGTTGAGAGATAGACTTTCTGCCGCCTAACATTCCTAACTTCTCATA oligo196 (SEQIDNO:197) TGTCAATTCAGCTCATTTTTTAGCGAGTTAACATTCCTAACTTCTCATA oligo197 (SEQIDNO:198) GGTATGCCTGTAAATCGTTCATTTTAACATTCCTAACTTCTCATA oligo198 (SEQIDNO:199) TTATAGTTGTTTAGACTGGATAGGAATTTAACATTCCTAACTTCTCATA oligo199 (SEQIDNO:200) AATAGAATCAGCTTGCTTTCGTTTGCGGTAACATTCCTAACTTCTCATA oligo200 (SEQIDNO:201) CAAATAATGCCTTGAGTAACAGATTAGGTAACATTCCTAACTTCTCATA oligo201 (SEQIDNO:202) GAACATCGGCCAAAATCGGGCGACTAACATTCCTAACTTCTCATA oligo202 (SEQIDNO:203) GAAGCGCAGAGCCTAATTTGCATCCGGTTAACATTCCTAACTTCTCATA oligo203 (SEQIDNO:204) TTTTCAGATTTCAATTACCTGTAACCTTTAACATTCCTAACTTCTCATA oligo204 (SEQIDNO:205) AACCCTTCAGCAGAAGATAAACAATATCTAACATTCCTAACTTCTCATA oligo205 (SEQIDNO:206) AACCCGAGTATTCCTCGAAAGGAGTAACATTCCTAACTTCTCATA SequencesofstaplestrandsfortheDNA containerinFIG.9. oligo1 (SEQIDNO:207) ACATCGTGAATACATTAGCGACCAGAG oligo2 (SEQIDNO:208) TTAGAAGGTCAATACCGAACACTTTTTA oligo3 (SEQIDNO:209) CCGTACTAGTATAGCCTAAATTATGTAA oligo4 (SEQIDNO:210) CGACGTTTTTTGCAATGTTTAGAAGAGAA oligo5 (SEQIDNO:211) CGAGCATCCCGTCGGGAGTTAGGCGCATA oligo6 (SEQIDNO:212) CCATATGCACTCCAACTAAAAAATTGGGCTTGAG oligo7 (SEQIDNO:213) GCGTGCCATTAAAGGCCGTTCATATTACGGTAATC oligo8 (SEQIDNO:214) AGGTGAGTTAACACTAACGTCATAGCAGCCTTTAC oligo9 (SEQIDNO:215) AGCCAGCAAATCTAAACAGGGGACGGGAGAATTAA oligo10 (SEQIDNO:216) GTTATCTTAGGAGCAATAAGAATGAAATAGCAATA oligo11 (SEQIDNO:217) AAAAGCCTGAGCAATACCTTTCCACCCTCAGAGCC oligo12 (SEQIDNO:218) CGCCATGTTTACCAAACATAGATCAAAAGCGTCAT oligo13 (SEQIDNO:219) AAACGTATGCAAATATTTCATGTTAAATAACACTG oligo14 (SEQIDNO:220) ACGCCGAATAAACAAATTCTTGTAACGAATTTTGC oligo15 (SEQIDNO:221) TTTGAGGGGACGACAACAAGATGCCCTGAACCGAT oligo16 (SEQIDNO:222) TCGGCTAATTCTGTATCAACAGCTTGCTCAACAAC oligo17 (SEQIDNO:223) GCGAGGTTTTTGTTAAATCAGATTGTATCGCCTGT oligo18 (SEQIDNO:224) GACACCACGGAATAACATACAACAAAGATGAGGAT oligo19 (SEQIDNO:225) TCCAACAGGTCTGAAGCCAGTTTTGATCAGAATGA oligo20 (SEQIDNO:226) AAAACCAGGATTAGCGGGGTTAAGTATTATCGGCG oligo21 (SEQIDNO:227) AAAGAGCTCCTGTACGTGGGACACATCCTAATTTA oligo22 (SEQIDNO:228) GCAGTGTTCAATCAAAGGCTAAATTGAGCGATGCCG oligo23 (SEQIDNO:229) AACAATTCTCGTCAAAACCGATCAAAAGGGCTTACC oligo24 (SEQIDNO:230) ATCATAGCATCAGCAGTTTGAACCCTGTGACTCCTT oligo25 (SEQIDNO:231) CAGTAGTGCCGGACAAACAGATCTACTAGGAAGGTA oligo26 (SEQIDNO:232) CCCTTAGACGCAGATGCCGCCGAAGCCCCTTCAAAG oligo27 (SEQIDNO:233) GAGAGATCGGAAAACTGACTAAAGATTAAGCCGTTC oligo28 (SEQIDNO:234) GGTGCGGGCCTCTTAACGCTCAATCTACCAGTTTCA oligo29 (SEQIDNO:235) ATAATCGATCGAGAGGGATCGAGGCTTTGAGTGTAC oligo30 (SEQIDNO:236) GATAGGTACAAACGCCGGATATCATCAAGAGTAATCT oligo31 (SEQIDNO:237) AGTCATAAGTTGCCACATTATTCATCAGTTGAGTTATACC oligo32 (SEQIDNO:238) TCTTCGCCTCCTCTCAAAAACTGGCCTAGACGGTGGAACCG oligo33 (SEQIDNO:239) CCCTCACTTTACCAGAGAATCCTTGAAGTCCCGGCCTCACC oligo34 (SEQIDNO:240) CGCCTGTGCACTCTTGAACCTGAGAGTCCCCTGAACAAAGTC oligo35 (SEQIDNO:241) AATCAACAGTTGAACATCCCTAAGAATTAGAAAGGCCGGAGA oligo36 (SEQIDNO:242) CGGTAGCGCACTCAGCCATCCACCCAACGAATGCACTGGTCT oligo37 (SEQIDNO:243) CTTCTGAGAGGTGTTATGGTTAAAACATTAAAGAAACGCAAA oligo38 (SEQIDNO:244) CGGCCTTTAGTGATTCCGGCAATAAGAGCTGAATATACCCTC oligo39 (SEQIDNO:245) GCTCATTAACAGCGGCTCTCAAGACTTTAGCCGCCGCCAGTG oligo40 (SEQIDNO:246) TGAGAAGGAATAACCTTGCTTTTTTAATCTCATTAAGGCAGG oligo4l (SEQIDNO:247) CCAATCGCAAGACAGGAAACAAAGAGGCTAAACAGTTCAGAA oligo42 (SEQIDNO:248) ATGCTGACCTTTTTATTCTGAGCCCGTATAAACAGAGTGCCT oligo43 (SEQIDNO:249) TGGGAAGTTCGCCAAGTCAGGATTTTAAGAACTGGTGTGAAT oligo44 (SEQIDNO:250) GCAAAGCCACCGCTTACCTTAAATTTCAACTTTAACAAAGCT oligo45 (SEQIDNO:251) CGTGCATTTGGTGTGCTCATTTTACCCAAATCAACACAAGAA oligo46 (SEQIDNO:252) TCATTCCATTAAACGAAAGACCGAGGGTAGCAACGCATGAGG oligo47 (SEQIDNO:253) TTCATCAACCAACCGAAAGAGGACAGATGAACGGGGCCACTA oligo48 (SEQIDNO:254) CTATTTTGCACCATTTGCGGGTGTATCACCCCCAGCGATTAT oligo49 (SEQIDNO:255) AACCCACTACACTGTTCTTTGCGACAACTTTTAAAGGGGTCA oligo50 (SEQIDNO:256) ATCACCATCAATATAATGCCTTAGAACCTTTTACCTTTATTT oligo51 (SEQIDNO:257) GAGTAATGTGTAGGCAGTCAAGAGAGATAGAGGGTTCAGGTC oligo52 (SEQIDNO:258) TAAAGATGGAAACGTGATTAAAATACTTTGTACCATACCAGC oligo53 (SEQIDNO:259) CAAAAGAACTGGCACAATAATTAAAGGTGTGTGTTGTTGGCA oligo54 (SEQIDNO:260) AGAGCATGGGCAAAAATTACGAATAAATATTTTCAGCTGGTC oligo55 (SEQIDNO:261) CAATAGAGACGGAACGACTTGAGCCAATAATAAAGGATTATA oligo56 (SEQIDNO:262) ACTGTAGCGCGTTTTAGCACCCAATAACCGTCAGATGAATAT oligo57 (SEQIDNO:263) CCACCACACCACCCGTAGGATTAGAGAGAAGAAGACAAAATC oligo58 (SEQIDNO:264) AGAACCGAATTGCTAGACCGGTCTCTGAATTTAAGAGCAGTT oligo59 (SEQIDNO:265) GATACAGGAGTGTAATAAATCGGAAACATTTCATTTGAATTA oligo60 (SEQIDNO:266) AACGAGTAACATGATTGCTCATACAGACGACGATATTAGTTA oligo61 (SEQIDNO:267) TTACAGGGAAGAAAAACAGTAGGGCTCAGGCGATCAGGCGAT oligo62 (SEQIDNO:268) GTAGCATTCCACAGTTTTGTCATATGCGGAGGCATTTTCGAG oligo63 (SEQIDNO:269) AAACGGCACCAGTACGCCAACATGTAATAAGGTAATAATTTT oligo64 (SEQIDNO:270) TCGGTTTATAGAACGAGTAGTGGAATTGCTTTCAAGTTAATA oligo65 (SEQIDNO:271) CACTAAAACACTCACGAAGGCACATTAAATGTGAACAAATCA oligo66 (SEQIDNO:272) TCTTTGATCGCCTGATAAATTGCGAACCGATATAGCCGAGCT oligo67 (SEQIDNO:273) ATCAAAATGGCTTAGATAACTATTAATGGCGACCGTTACAAAC oligo68 (SEQIDNO:274) AAGAACGCGAGAAAAACGACGACGGGAAGGATAGCTTGAATCC oligo69 (SEQIDNO:275) TCCCGACTTTGTTAAAATTCGAATTGTACGAACTGAACGAACC oligo70 (SEQIDNO:276) ATTCGCCTGAACAAAATTAACAAGTACATATGTGAGTAGTCAAT oligo7l (SEQIDNO:277) ACCAGCTGCTGCGAATAAGAGCAAACAAGAGAATATTGCCTCAAATAT oligo72 (SEQIDNO:278) GAGAGGTTGAGAGCTAGCATTGTACCCCGGTTGCTTCACGGATCCAGC oligo73 (SEQIDNO:279) GAAGCCAAGTTACCAGTATGGGCAACATATAATGGTAACATCTTTACA oligo74 (SEQIDNO:280) ATTACGCAGAAGGTATAGATTAGAGCCTATTAGATATCATTAATTATC oligo75 (SEQIDNO:281) ATCGGTTTGCGGGTTATTAATCGTATTAAATCCTTAATGGGAACGGAA oligo76 (SEQIDNO:282) AATATTAAATTCACCATTCCTGATTATTTGTTTGAAATTGCACAGTAA oligo77 (SEQIDNO:283) CGAACCCCTTTTGAAATTTCAATTACCGCACAGGGGGCGGTTAATTTT oligo78 (SEQIDNO:284) CAGTAAATCAGGTAATGCTTTGAGACTCCTCACTCGGATAAAATTTGT oligo79 (SEQIDNO:285) GGATTAAAATAGCGCAACACCCACCACCCTCATTTTCAGACGAGGCAT oligo80 (SEQIDNO:286) CGGATAACCTATTAACCTCCCATAGGTCTGAGAGAAGACGCTGAGTAA oligo81 (SEQIDNO:287) GCGGAGTGAGACGACGTTGGTAGAAAGCAGGATAGCAAGCCTGCTGCA oligo82 (SEQIDNO:288) AGACCAAAGGCCGCACGCATACGAGAAACACCCAATAGATACCAATCA oligo83 (SEQIDNO:289) CGAATTCTAATGCGAACGTTAGAGCCTAATTTGCCCAATCCAGCCAGAA oligo84 (SEQIDNO:290) CGTGGCATTTTGAATATCCTGACGCTAACGAGCGTTTTTGTTCGCCTGC oligo85 (SEQIDNO:291) AACAGGGAGAAGATTAGTCTTAAAGCGTTAGCAAGGCAAGCCACGTAAT oligo86 (SEQIDNO:292) CAAACCCCACTGCGTGCGGCGAATACCGATAGCCCCCGGGTAAAGGCTT oligo87 (SEQIDNO:293) TGCCCTGCGGCATCTTACCTGCAGCCATCTGGTCACAGCAAAAATATCA oligo88 (SEQIDNO:294) GGAGCGGTTGCGGATAAAGGTTTAGCAAACGTAGACAGATAGGATAATA oligo89 (SEQIDNO:295) ACGGCTGATAATGGGCACGTATTGTAGAATCCTCAGCGCAGAGGAAGTT oligo90 (SEQIDNO:296) GTAGATTCCGTCACATTATTCATTAAAGTATTTTGTGGCAATACCAGAA oligo91 (SEQIDNO:297) GGCAGCCCGGTCCGTGCAACTGCTGTAGCTCAACATTAATTGGTCATTT oligo92 (SEQIDNO:298) TAACGGAAACGTCAGTGGCATCATTTGGGAATTAGTTAGCAAGCGTCAG oligo93 (SEQIDNO:299) ACAAACAACAGGAGTCAGAGCCGCCACCCACCGGATTTGCCATTCGGTC oligo94 (SEQIDNO:300) TAGGCATTATACACCGGAATATAAGGCCTTCTGACCCGGAAGTACCAGG oligo95 (SEQIDNO:301) GAGAATACTCCAAACAAAAGGAGCCTTTTGAATTTGAACGCGTTCCTTA oligo96 (SEQIDNO:302) ATTCTCAACAGTTGAGGATCCTAAAACATAAGCAAAAATAAACAGATAA oligo97 (SEQIDNO:303) TCAGAAAACAGGAAGCTCATTTAGGAACTCCATGTGAACGAGGCGGCAA oligo98 (SEQIDNO:304) GTAAAAATCTACAATAGCGGTGCCGGTTCAGACGTCATACCGCCAGCAC oligo99 (SEQIDNO:305) CGATGAATTTATCCAGTTACAATATTTACATTAAACGTTTTAGTGTCGA oligo100 (SEQIDNO:306) AGAGAGAAACGATTCTTTCCAATCAGCTACAATTTTGGCTATAAAACAG oligo101 (SEQIDNO:307) GCCCAATACTAACAACTAAAAAGGAATTACCTTGCGTTGCCACGCTGAG oligo102 (SEQIDNO:308) GCTATTGGAGTTAACTGAACATGGAATAACATAAAAAGCATCGAGGAAG oligo103 (SEQIDNO:309) TTTAAATGCGATATTCGCTGATAAATTACTTCGTTAACGGCTGGTTTGA oligo104 (SEQIDNO:310) ACCGATTGCCAAAGCCAGCTTTTGCAGGCGCTTTCCCGAACGAGAAGCC oligo105 (SEQIDNO:311) GAGGGAGATAGTAGTGAAAAGCCAATGAACAGAATCAATTCTGCGAACG oligo106 (SEQIDNO:312) AGCATTATTATTTAAGGGTTAGAACCTCACGCAAACAAAAGAAAGCTAA oligo107 (SEQIDNO:313) AAAATCAATTATCATTCAGGTCAATATAATCCTGACAGATGATCACAAT oligo108 (SEQIDNO:314) AACCATCAGAGCACACGTCAGCGTGGTGTATCAAAAACATCCACATTCA oligo109 (SEQIDNO:315) GCAAAACTTAGTTTGACCATTTTAAATATTTTTTCTTGCCGTGAAGGGT oligo110 (SEQIDNO:316) TAGCCCCCACAGTTGATTCCCAAGTTTGCCTTTAGGCCGGAACCCTTTT oligo111 (SEQIDNO:317) GGTGTCTGGCGAATTATTCCGTCCGGCCGATAGCATTTGGGGCGCGAGC oligo112 (SEQIDNO:318) GCCTCCCTCAGAGCCGCCAATAAAGTACAGTAGATCGTAATCAGTAGCG oligo113 (SEQIDNO:319) CGGAACCTCATTCCATATATTCAAGTTATGATGAACCAAATCCCGTAAA oligo114 (SEQIDNO:320) TCAAAATAGAACCACGCCGCCATTGGCCCAAACAACTGGTAACGGGGTC oligo115 (SEQIDNO:321) ATTCGAGGAAAGACCATCAAATTATAGTATATTCAGTCCAATTAGTAAA oligo116 (SEQIDNO:322) TCAGACGAGCATTGTCAAGAAATTGCTTGGAGAAAATTACCAAGCCAGC oligo117 (SEQIDNO:323) ACATGGCAATGGAAATCGACATAAAATTCTGTAAATTAGATTACTACAG oligo118 (SEQIDNO:324) CCATAACGATAGCTCGTCGCTATTAATTGTGTACAGCGCAGAAGCAAAC oligo119 (SEQIDNO:325) TTAATGCTTTCGGAAGTGCCGTGATATACAGGAGGCCACCCTCAGAACC oligo120 (SEQIDNO:326) AAAGAAGGAATTACTAATGCAGATACATAGGAATAGGTAACGCAACTGT oligo121 (SEQIDNO:327) AGTAAGAGAGAGGCGTAAACTTTTTCAAGGGGATGCAATAGGAACATTA oligo122 (SEQIDNO:328) TTTACGGTCAGAACCGCCACCGTACCGTAAAGCTGGCGAAAGATATATT oligo123 (SEQIDNO:329) TCACCAGGTGATAACATAATTACTAGAATAGTATCGTCTTTCTAAATGA oligo124 (SEQIDNO:330) TCATAGTTAAACTAACGGAACAACCCATCTCAGAGTATCATAACCCTCG oligo125 (SEQIDNO:331) TAAACAACGAATAAAGCTCAGGAAGATCTTAACAATAAAGCCCGCTATT oligo126 (SEQIDNO:332) ATTTTCTTGAAAATTAAAGTAACGACAATAAACAATAATGCACTTAAAC oligo127 (SEQIDNO:333) TTCACGTGTATGGGTCTAAAGACAGCCCAGTTTCGGCCACCCTGTATCA oligo128 (SEQIDNO:334) AAGGCTAAAATAATATCCCGCTGCCAGTTTCCGGGCTAATTGAGAATCG oligo129 (SEQIDNO:335) ATATTCGGTCGCCACAGTGAAATGGTTTTGATAGAAAGGAACAGCCAGC oligo130 (SEQIDNO:336) CATCGCCCTTTTGCACAGCGAGTAACAAGTAGAAAAGTCCTGGACAGTA oligo131 (SEQIDNO:337) TGCGCCGCAGCAGCCAAGTACTTTTCATATTACCGGAAGCCTTTAGTTG oligo132 (SEQIDNO:338) GGCTGGCAACTTTTAAAACGAAGAATAAATCCGCGACCTGCGCAAGAAC oligo133 (SEQIDNO:339) AACTGACCTGACCTTTTGAGGCTTGCAGGATTCTCGCCAGCTATCCGGT oligo134 (SEQIDNO:340) ACTAAAGACTTTTTGCTACAGTCACCCTACAATGATTCGAGGAATTGTA oligo135 (SEQIDNO:341) GTAAAATGTTTTTACGCACTCGCTGTCTCCTGTTTCCAGACGCCGACAA oligo136 (SEQIDNO:342) TAAACGGACCAAGCGTACAACGGAGATTAGGTTTTCGCCCAAAAGAATA
EQUIVALENTS
(190) While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
(191) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
(192) The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
(193) It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
(194) In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.