SYNTHETIC CHLOROPLAST TRANSIT PEPTIDES
20170073696 ยท 2017-03-16
Inventors
- Justin M. Lira (Zionsville, IN)
- Robert Cicchillo (Zionsville, IN)
- Carla N. Yerkes (Crawfordsville, IN)
- Andrew E. Robinson (Brownsburg, IN)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C07K2319/08
CHEMISTRY; METALLURGY
C12N15/8247
CHEMISTRY; METALLURGY
C12N15/8241
CHEMISTRY; METALLURGY
C12N9/1092
CHEMISTRY; METALLURGY
C12N15/8245
CHEMISTRY; METALLURGY
C12Y113/00
CHEMISTRY; METALLURGY
C12Y114/11
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/0069
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12Y205/01019
CHEMISTRY; METALLURGY
C12N15/8209
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
This disclosure concerns compositions and methods for targeting peptides, polypeptides, and proteins to plastids of plastid-containing cells. In some embodiments, the disclosure concerns chloroplast transit peptides that may direct a polypeptide to a plastid, and nucleic acid molecules encoding the same. In some embodiments, the disclosure concerns methods for producing a transgenic plant material (e.g., a transgenic plant) comprising a chloroplast transit peptide, as well as plant materials produced by such methods, and plant commodity products produced therefrom.
Claims
1. An isolated nucleic acid molecule comprising: a nucleotide sequence that encodes a synthetic chloroplast transit peptide (CTP) consisting of an amino acid sequence that is derived from an alignment of the amino acid residues of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzymes, wherein each of the amino acid residues of the CTP correspond to the amino acid residue at the corresponding position in an alignment of polypeptides selected from the group consisting of SEQ ID NOs:1-10, wherein the synthetic CTP is at least 80% identical to the chloroplast transit peptide of SEQ ID NO:11; and a heterologous nucleotide sequence encoding a peptide of interest operably linked to the synthetic CTP-encoding nucleotide sequence, wherein the nucleic acid molecule encodes a chimeric polypeptide comprising the peptide of interest and the synthetic CTP.
2. The isolated nucleic acid molecule of claim 1, wherein the synthetic CTP consists of an amino acid sequence that is derived from an alignment of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzymes isolated from species selected from the group consisting of: a Brassica sp., a Glycine sp., an Arabidopsis sp., and a Duneila sp.
3. The isolated nucleic acid molecule of claim 1, wherein the synthetic CTP consists of the C-terminal 61 amino acids of the CTP of SEQ ID NO: 11.
4. The isolated nucleic acid molecule of claim 3, wherein the synthetic CTP is at least 90% identical to the CTP of SEQ ID NO: 11.
5. The isolated nucleic acid molecule of claim 4, wherein the synthetic CTP is at least 95% identical to the CTP of SEQ ID NO: 11.
6. The isolated nucleic acid molecule of claim 5, wherein the synthetic CTP is at least 98% identical to the CTP of SEQ ID NO: 11.
7. The isolated nucleic acid molecule of claim 1, wherein the nucleotide sequence that encodes the synthetic CTP remains bound to the nucleic acid of SEQ ID NO:12 after hybridization in 5-6SSC buffer at 65-70 C. for 16-20 hours, two washes in 2SSC buffer at room temperature for 5-20 minutes each, and two washes in 1SSC buffer at 55-70 C. for 30 minutes each.
8. The isolated nucleic acid molecule of claim 1, further comprising at least one additional nucleotide sequence(s), each encoding a CTP, wherein the additional nucleotide sequence(s) are operably linked to the nucleotide sequence encoding the peptide of interest.
9. The isolated nucleic acid molecule of claim 8, wherein the additional nucleotide sequence is from an organism selected from the group consisting of prokaryotes, photosynthetic algae, and Chlorophytes.
10. The isolated nucleic acid molecule of claim 1, wherein the synthetic CTP-encoding sequence and nucleotide sequence encoding the peptide of interest are operably linked to one or more regulatory sequences.
11. The nucleic acid molecule of claim 1, wherein the molecule is a plant expression vector.
12. A chimeric polypeptide encoded by the nucleic acid molecule of claim 1.
13. The chimeric polypeptide of claim 12, wherein the peptide of interest is targeted to a plastid in a plastid-containing cell.
14. The chimeric polypeptide of claim 13, wherein the synthetic CTP is removed when the peptide of interest is targeted to the plastid.
15. The chimeric polypeptide of claim 12, wherein the peptide of interest is a fluorescent peptide.
16. The chimeric polypeptide of claim 12, wherein the peptide of interest is an herbicide resistance marker selected from the group consisting of: acetolactase synthase (ALS), mutated ALS, precursors of ALS, 3-enolpyruvylshikimate-5-phosphate synthetase (EPSPS), CP4 EPSPS, and a class III EPSPS.
17. The chimeric polypeptide of claim 12, wherein peptide of interest is DGT-28 or Cry2Aa.
18. A transgenic plant material comprising the nucleic acid molecule of claim 1.
19. The transgenic plant material of claim 18, wherein the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture, and a plant part.
20. The transgenic plant material of claim 18, wherein the plant material is a whole plant.
21. The transgenic plant material of claim 18, wherein the nucleic acid molecule is stably integrated into the genome of a cell from the plant material.
22. A method for producing a transgenic plant material, the method comprising transforming a plant material with the nucleic acid molecule of claim 1.
23. A method for producing a transgenic plant, the method comprising regenerating a transgenic plant from the transgenic plant material of claim 18.
24. An isolated nucleic acid molecule comprising an EPSPS-derived means for targeting a polypeptide to a chloroplast, and a nucleotide sequence encoding a peptide of interest operably linked to the EPSPS-derived means for targeting a polypeptide to a chloroplast, wherein the nucleic acid molecule encodes a chimeric polypeptide comprising the peptide of interest and a peptide encoded by the EPSPS-derived means for targeting a polypeptide to a chloroplast.
25. The isolated nucleic acid molecule of claim 24, wherein the EPSPS-derived means for targeting a polypeptide to a chloroplast encodes a peptide consisting of an amino acid sequence that is at least 90% identical to SEQ ID NO: 11.
26. The isolated nucleic acid molecule of claim 24, wherein the EPSPS-derived means for targeting a polypeptide to a chloroplast encodes a peptide consisting of an amino acid sequence that is at least 95% identical to SEQ ID NO: 11.
27. The nucleic acid molecule of claim 24, wherein the molecule is a plant expression vector.
28. A chimeric polypeptide encoded by the nucleic acid molecule of claim 24.
29. The chimeric polypeptide of claim 28, wherein peptide of interest is DGT-28 or Cry2Aa.
30. A transgenic plant material comprising the nucleic acid molecule of claim 24.
31. The transgenic plant material of claim 30, wherein the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture, and a plant part.
32. The transgenic plant material of claim 30, wherein the plant material is a whole plant.
33. The transgenic plant material of claim 30, wherein the nucleic acid molecule is stably integrated into the genome of a cell from the plant material.
34. A method for producing a transgenic plant material, the method comprising transforming a plant material with the nucleic acid molecule of claim 24.
35. A method for producing a transgenic plant, the method comprising regenerating a transgenic plant from the transgenic plant material of claim 31.
36. The method according to claim 35, wherein the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture, a plant part, and a whole plant.
37. A transgenic plant material produced by the method according to claim 35.
38. A transgenic plant regenerated from the transgenic plant material of claim 37.
39. The plant material of claim 26, wherein the plant material is a plant cell that cannot be regenerated to produce a plant.
40. The method of claim 28, wherein the plant material is a plant cell that cannot be regenerated to produce a plant.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DETAILED DESCRIPTION
I. Overview of Several Embodiments
[0027] A chloroplast transit peptide (CTP) (or plastid transit peptide) functions co-translationally or post-translationally to direct a polypeptide comprising the CTP to a plastid (e.g., a chloroplast). In some embodiments of the invention, either endogenous chloroplast proteins or heterologous proteins may be directed to a chloroplast by expression of such a protein as a larger precursor polypeptide comprising a CTP. In particular embodiments, the CTP may be derived from a nucleotide sequence obtained from an alignment of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzymes, for example and without limitation, by incorporating at least one contiguous sequence from a orthologous gene obtained from a different organism, or a functional variant thereof.
[0028] In an exemplary embodiment, nucleic acid sequences, each encoding a CTP, were isolated from an alignment of EPSPS protein sequences (
[0029] In a further exemplary embodiment, nucleic acid sequences, each encoding a synthetic TraP peptide of the invention, were synthesized independently and operably linked to a nucleic acid sequence encoding a green fluorescent protein (GFP) to produce synthetic nucleic acid molecules, each encoding a chimeric TraP:GFP fusion polypeptide. Such nucleic acid molecules, each encoding a chimeric TraP:GFP polypeptide, were each introduced into a binary vector, such that each TraP:GFP-encoding nucleic acid sequence was operably linked to an AtUbi 10 promoter.
[0030] In yet a further exemplary embodiment, binary vectors comprising a TraP:GFP-encoding nucleic acid sequence operably linked to an AtUbi 10 promoter each were independently, transiently transformed into tobacco (Nicotiana benthamiana) via Agrobacterium-mediated transformation. Confocal microscopy and Western blot analysis confirmed that each TraP successfully targeted GFP to tobacco chloroplasts.
[0031] In a further exemplary embodiment, a nucleic acid sequence, encoding a synthetic TraP peptide of the invention, was synthesized independently and operably linked to a nucleic acid sequence encoding an agronomically important gene sequence. The TraP sequence was fused to an herbicide tolerant trait (e.g. dgt-28) to produce a synthetic nucleic acid molecule, encoding a chimeric TraP:DGT-28 fusion polypeptide. Such a nucleic acid molecules, encoding a chimeric TraP:DGT-28 polypeptide, was introduced into a binary vector, such that each TraP:dgt-28-encoding nucleic acid sequence was operably linked to a promoter and other gene regulatory elements. The binary containing the TraP:dgt-28-encoding nucleic acid sequence was used to transform various plant species. The transgenic plants were assayed for herbicide tolerance as a result of the expression and translocation of the DGT-28 enzyme to the chloroplast.
[0032] In a further exemplary embodiment, a nucleic acid sequence, encoding a synthetic TraP peptide of the invention, was synthesized independently and operably linked to a nucleic acid sequence encoding an agronomically important gene sequence. The TraP sequence was fused to an insect tolerant trait (e.g. cry2Aa) to produce a synthetic nucleic acid molecule, encoding a chimeric TraP:Cry2Aa fusion polypeptide. Such a nucleic acid molecule, encoding a chimeric TraP:Cry2Aa polypeptide, was introduced into a binary vector, such that each TraP:cry2aa-encoding nucleic acid sequence was operably linked to a promoter and other gene regulatory elements. The binary containing the TraP:cry2aa-encoding nucleic acid sequence was used to transform various plant species. The transgenic plants were bioassayed for insect resistance as a result of the expression and translocation of the Cry2Aa enzyme to the chloroplast.
[0033] In view of the aforementioned detailed working examples, synthetic CTP sequences of the invention, and nucleic acids encoding the same, may be used to direct any polypeptide to a plastid in a broad range of plastid-containing cells. For example, by methods made available to those of skill in the art by the present disclosure, a chimeric polypeptide comprising a synthetic CTP sequence fused to the N-terminus of any second peptide sequence may be introduced into (or expressed in) a plastid-containing host cell for plastid targeting of the second peptide sequence. Thus, in particular embodiments, a TraP peptide of the invention may provide increased efficiency of import and processing of a peptide for which plastid expression is desired, when compared to a native CTP.
II. Abbreviations
[0034] CTP chloroplast transit peptide [0035] EPSPS 3-enolpyruvylshikimate-5-phosphate synthetase [0036] YFP yellow fluorescent protein [0037] T.sub.i tumor-inducing (plasmids derived from A. tumefaciens) [0038] T-DNA transfer DNA
III. Terms
[0039] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
[0040] Chloroplast transit peptide: As used herein, the term chloroplast transit peptide (CTP) (or plastid transit peptide) may refer to an amino acid sequence that, when present at the N-terminus of a polypeptide, directs the import of the polypeptide into a plastid of a plastid-containing cell (e.g., a plant cell, such as in a whole plant or plant cell culture). A CTP is generally necessary and sufficient to direct the import of a protein into a plastid (e.g., a primary, secondary, or tertiary plastid, such as a chloroplast) of a host cell. A putative chloroplast transit peptide may be identified by one of several available algorithms (e.g., PSORT, and ChloroP (available at cbs.dtu.dk/services/ChloroP)). ChloroP may provide particularly good prediction of CTPs. Emanuelsson et al. (1999) Protein Science 8:978-84. However, prediction of functional CTPs is not achieved at 100% efficiency by any existing algorithm. Therefore, it is important to verify that an identified putative CTP does indeed function as intended in, e.g., an in vitro, or in vivo methodology.
[0041] Chloroplast transit peptides may be located at the N-terminus of a polypeptide that is imported into a plastid. The CTP may facilitate co- or post-translational transport of a polypeptide comprising the CTP into the plastid. Chloroplast transit peptides typically comprise between about 40 and about 100 amino acids, and such CTPs have been observed to contain certain common characteristics. For example: CTPs contain very few, if any, negatively charged amino acids (such as aspartic acid, glutamic acid, asparagines, or glutamine); the N-terminal regions of CTPs lack charged amino acids, glycine, and proline; the central region of a CTP also is likely to contain a very high proportion of basic or hydroxylated amino acids (such as serine and threonine); and the C-terminal region of a CTP is likely to be rich in arginine, and have the ability to comprise an amphipathic beta-sheet structure. Plastid proteases may cleave the CTP from the remainder of a polypeptide comprising the CTP after importation of the polypeptide into the plastid.
[0042] Contact: As used herein, the term contact with or uptake by a cell, tissue, or organism (e.g., a plant cell; plant tissue; and plant), with regard to a nucleic acid molecule, includes internalization of the nucleic acid molecule into the organism, for example and without limitation: contacting the organism with a composition comprising the nucleic acid molecule; and soaking of organisms with a solution comprising the nucleic acid molecule.
[0043] Endogenous: As used herein, the term endogenous refers to substances (e.g., nucleic acid molecules and polypeptides) that originate from within a particular organism, tissue, or cell. For example, an endogenous polypeptide expressed in a plant cell may refer to a polypeptide that is normally expressed in cells of the same type from non-genetically engineered plants of the same species. In some examples, an endogenous gene (e.g., an EPSPS gene) may be used to obtain a reference CTP sequence.
[0044] Expression: As used herein, expression of a coding sequence (for example, a gene or a transgene) refers to the process by which the coded information of a nucleic acid transcriptional unit (including, e.g., genomic DNA or cDNA) is converted into an operational, non-operational, or structural part of a cell, often including the synthesis of a protein. Gene expression can be influenced by external signals; for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Expression of a gene can also be regulated anywhere in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression can be measured at the RNA level or the protein level by any method known in the art, for example and without limitation: Northern blot; RT-PCR; Western blot; or in vitro; in situ; and in vivo protein activity assay(s).
[0045] Genetic material: As used herein, the term genetic material includes all genes, and nucleic acid molecules, such as DNA and RNA.
[0046] Heterologous: As used herein, the term heterologous refers to substances (e.g., nucleic acid molecules and polypeptides) that do not originate from within a particular organism, tissue, or cell. For example, a heterologous polypeptide expressed in a plant cell may refer to a polypeptide that is not normally expressed in cells of the same type from non-genetically engineered plants of the same species (e.g., a polypeptide that is expressed in different cells of the same organism or cells of a different organism).
[0047] Isolated: As used herein, the term isolated refers to molecules (e.g., nucleic acid molecules and polypeptides) that are substantially separated or purified away from other molecules of the same type (e.g., other nucleic acid molecules and other polypeptides) with which the molecule is normally associated in the cell of the organism in which the molecule naturally occurs. For example, an isolated nucleic acid molecule may be substantially separated or purified away from chromosomal DNA or extrachromosomal DNA in the cell of the organism in which the nucleic acid molecule naturally occurs. Thus, the term includes recombinant nucleic acid molecules and polypeptides that are biochemically purified such that other nucleic acid molecules, polypeptides, and cellular components are removed. The term also includes recombinant nucleic acid molecules, chemically-synthesized nucleic acid molecules, and recombinantly produced polypeptides.
[0048] The term substantially purified, as used herein, refers to a molecule that is separated from other molecules normally associated with it in its native state. A substantially purified molecule may be the predominant species present in a composition. A substantially purified molecule may be, for example, at least 60% free, at least 75% free, or at least 90% free from other molecules besides a solvent present in a natural mixture. The term substantially purified does not refer to molecules present in their native state.
[0049] Nucleic acid molecule: As used herein, the term nucleic acid molecule refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide. A nucleic acid molecule as used herein is synonymous with nucleic acid and polynucleotide. A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single- and double-stranded forms of DNA. Nucleic acid molecules include dimeric (so-called in tandem) forms, and the transcription products of nucleic acid molecules. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
[0050] Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications (e.g., uncharged linkages: for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.; charged linkages: for example, phosphorothioates, phosphorodithioates, etc.; pendent moieties: for example, peptides; intercalators: for example, acridine, psoralen, etc.; chelators; alkylators; and modified linkages: for example, alpha anomeric nucleic acids, etc.). The term nucleic acid molecule also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations.
[0051] As used herein with respect to DNA, the term coding sequence, structural nucleotide sequence, or structural nucleic acid molecule refers to a nucleotide sequence that is ultimately translated into a polypeptide, via transcription and mRNA, when placed under the control of appropriate regulatory sequences. With respect to RNA, the term coding sequence refers to a nucleotide sequence that is translated into a peptide, polypeptide, or protein. The boundaries of a coding sequence are determined by a translation start codon at the 5-terminus and a translation stop codon at the 3-terminus. Coding sequences include, but are not limited to: genomic DNA; cDNA; ESTs; and recombinant nucleotide sequences.
[0052] In some embodiments, the invention includes nucleotide sequences that may be isolated, purified, or partially purified, for example, using separation methods such as, for example, ion-exchange chromatography; by exclusion based on molecular size or by affinity; by fractionation techniques based on solubility in different solvents; and methods of genetic engineering such as amplification, cloning, and subcloning.
[0053] Sequence identity: The term sequence identity or identity, as used herein in the context of two nucleic acid or polypeptide sequences, may refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
[0054] As used herein, the term percentage of sequence identity may refer to the value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences, and amino acid sequences) over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity.
[0055] Methods for aligning sequences for comparison are well-known in the art. Various programs and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. A detailed consideration of sequence alignment methods and homology calculations can be found in, e.g., Altschul et al. (1990) J. Mol. Biol. 215:403-10.
[0056] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST; Altschul et al. (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, Md.), and on the internet, for use in connection with several sequence analysis programs. A description of how to determine sequence identity using this program is available on the internet under the help section for BLAST. For comparisons of nucleic acid sequences, the Blast 2 sequences function of the BLAST (Blastn) program may be employed using the default BLOSUM62 matrix set to default parameters. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identity when assessed by this method.
[0057] Specifically hybridizable/Specifically complementary: As used herein, the terms Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity, such that stable and specific binding occurs between the nucleic acid molecule and a target nucleic acid molecule. Hybridization between two nucleic acid molecules involves the formation of an anti-parallel alignment between the nucleic acid sequences of the two nucleic acid molecules. The two molecules are then able to form hydrogen bonds with corresponding bases on the opposite strand to form a duplex molecule that, if it is sufficiently stable, is detectable using methods well known in the art. A nucleic acid molecule need not be 100% complementary to its target sequence to be specifically hybridizable. However, the amount of sequence complementarity that must exist for hybridization to be specific is a function of the hybridization conditions used.
[0058] Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na.sup.+ and/or Mg.sup.++ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are known to those of ordinary skill in the art, and are discussed, for example, in Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2 ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9 and 11; and Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Further detailed instruction and guidance with regard to the hybridization of nucleic acids may be found, for example, in Tij ssen, Overview of principles of hybridization and the strategy of nucleic acid probe assays, in Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, N Y, 1993; and Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, N Y, 1995.
[0059] As used herein, stringent conditions encompass conditions under which hybridization will only occur if there is less than 20% mismatch between the hybridization molecule and a homologous sequence within the target nucleic acid molecule. Stringent conditions include further particular levels of stringency. Thus, as used herein, moderate stringency conditions are those under which molecules with more than 20% sequence mismatch will not hybridize; conditions of high stringency are those under which sequences with more than 10% mismatch will not hybridize; and conditions of very high stringency are those under which sequences with more than 5% mismatch will not hybridize.
[0060] The following are representative, non-limiting hybridization conditions. [0061] High Stringency condition (detects sequences that share at least 90% sequence identity): Hybridization in 5SSC buffer at 65 C. for 16 hours; wash twice in 2SSC buffer at room temperature for 15 minutes each; and wash twice in 0.5SSC buffer at 65 C. for 20 minutes each. [0062] Moderate Stringency condition (detects sequences that share at least 80% sequence identity): Hybridization in 5-6SSC buffer at 65-70 C. for 16-20 hours; wash twice in 2SSC buffer at room temperature for 5-20 minutes each; and wash twice in 1SSC buffer at 55-70 C. for 30 minutes each. [0063] Non-stringent control condition (sequences that share at least 50% sequence identity will hybridize): Hybridization in 6SSC buffer at room temperature to 55 C. for 16-20 hours; wash at least twice in 2-3SSC buffer at room temperature to 55 C. for 20-30 minutes each.
[0064] As used herein, the term substantially homologous or substantial homology, with regard to a contiguous nucleic acid sequence, refers to contiguous nucleotide sequences that hybridize under stringent conditions to the reference nucleic acid sequence. For example, nucleic acid sequences that are substantially homologous to a reference nucleic acid sequence (e.g., SEQ ID NO:12) are those nucleic acid sequences that hybridize under stringent conditions (e.g., the Moderate Stringency conditions set forth, supra) to the reference nucleic acid sequence. Substantially homologous sequences may have at least 80% sequence identity. For example, substantially homologous sequences may have from about 80% to 100% sequence identity, such as about 81%; about 82%; about 83%; about 84%; about 85%; about 86%; about 87%; about 88%; about 89%; about 90%; about 91%; about 92%; about 93%; about 94% about 95%; about 96%; about 97%; about 98%; about 98.5%; about 99%; about 99.5%; and about 100%. The property of substantial homology is closely related to specific hybridization. For example, a nucleic acid molecule is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the nucleic acid to non-target sequences under conditions where specific binding is desired, for example, under stringent hybridization conditions.
[0065] As used herein, the term ortholog (or orthologous) refers to a gene in two or more species that has evolved from a common ancestral nucleotide sequence, and may retain the same function in the two or more species.
[0066] As used herein, two nucleic acid sequence molecules are said to exhibit complete complementarity when every nucleotide of a sequence read in the 5 to 3 direction is complementary to every nucleotide of the other sequence when read in the 3 to 5 direction. A nucleotide sequence that is complementary to a reference nucleotide sequence will exhibit a sequence identical to the reverse complement sequence of the reference nucleotide sequence. These terms and descriptions are well defined in the art and are easily understood by those of ordinary skill in the art.
[0067] When determining the percentage of sequence identity between amino acid sequences, it is well-known by those of skill in the art that the identity of the amino acid in a given position provided by an alignment may differ without affecting desired properties of the polypeptides comprising the aligned sequences. In these instances, the percent sequence identity may be adjusted to account for similarity between conservatively substituted amino acids. These adjustments are well-known and commonly used by those of skill in the art. See, e.g., Myers and Miller (1988) Computer Applications in Biosciences 4:11-7.
[0068] Embodiments of the invention include functional variants of exemplary plastid transit peptide amino acid sequences, and nucleic acid sequences encoding the same. A functional variant of an exemplary transit peptide sequence may be, for example, a fragment of an exemplary transit peptide amino acid sequence (such as an N-terminal or C-terminal fragment), or a modified sequence of a full-length exemplary transit peptide amino acid sequence or fragment of an exemplary transit peptide amino acid sequence. An exemplary transit peptide amino acid sequence may be modified in some embodiments be introducing one or more conservative amino acid substitutions. A conservative amino acid substitution is one in which the amino acid residue is replaced by an amino acid residue having a similar functional side chain, similar size, and/or similar hydrophobicity. Families of amino acids that may be used to replace another amino acid of the same family in order to introduce a conservative substitution are known in the art. For example, these amino acid families include: Basic amino acids (e.g., lysine, arginine, and histidine); acidic amino acids (e.g., aspartic acid and glutamic acid); uncharged (at physiological pH) polar amino acids (e.g., glycine, asparagines, glutamine, serine, threonine, tyrosine, and cytosine); non-polar amino acids (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan); beta-branched amino acids (e.g., threonine, valine, and isoleucine); and aromatic amino acids (e.g., tyrosine, phenylalanine, tryptophan, and histidine). See, e.g., Sambrook et al. (Eds.), supra; and Innis et al., PCR Protocols: A Guide to Methods and Applications, 1990, Academic Press, NY, USA.
[0069] Operably linked: A first nucleotide sequence is operably linked with a second nucleotide sequence when the first nucleotide sequence is in a functional relationship with the second nucleotide sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, operably linked nucleotide sequences are generally contiguous and, where necessary to join two protein-coding regions, in the same reading frame. However, nucleotide sequences need not be contiguous to be operably linked.
[0070] The term, operably linked, when used in reference to a regulatory sequence and a coding sequence, means that the regulatory sequence affects the expression of the linked coding sequence. Regulatory sequences, or control elements, refer to nucleotide sequences that influence the timing and level/amount of transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters; translation leader sequences; introns; enhancers; stem-loop structures; repressor binding sequences; termination sequences; polyadenylation recognition sequences; etc. Particular regulatory sequences may be located upstream and/or downstream of a coding sequence operably linked thereto. Also, particular regulatory sequences operably linked to a coding sequence may be located on the associated complementary strand of a double-stranded nucleic acid molecule.
[0071] When used in reference to two or more amino acid sequences, the term operably linked means that the first amino acid sequence is in a functional relationship with at least one of the additional amino acid sequences. For instance, a transit peptide (e.g., a CTP) is operably linked to a second amino acid sequence within a polypeptide comprising both sequences if the transit peptide affects expression or trafficking of the polypeptide or second amino acid sequence.
[0072] Promoter: As used herein, the term promoter refers to a region of DNA that may be upstream from the start of transcription, and that may be involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A promoter may be operably linked to a coding sequence for expression in a cell, or a promoter may be operably linked to a nucleotide sequence encoding a signal sequence which may be operably linked to a coding sequence for expression in a cell. A plant promoter may be a promoter capable of initiating transcription in plant cells. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as tissue-preferred. Promoters which initiate transcription only in certain tissues are referred to as tissue-specific. A cell type-specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An inducible promoter may be a promoter which may be under environmental control. Examples of environmental conditions that may initiate transcription by inducible promoters include anaerobic conditions and the presence of light. Tissue-specific, tissue-preferred, cell type specific, and inducible promoters constitute the class of non-constitutive promoters. A constitutive promoter is a promoter which may be active under most environmental conditions.
[0073] Any inducible promoter can be used in some embodiments of the invention. See Ward et al. (1993) Plant Mol. Biol. 22:361-366. With an inducible promoter, the rate of transcription increases in response to an inducing agent. Exemplary inducible promoters include, but are not limited to: Promoters from the ACEI system that responds to copper; 1n2 gene from maize that responds to benzenesulfonamide herbicide safeners; Tet repressor from Tn10; and the inducible promoter from a steroid hormone gene, the transcriptional activity of which may be induced by a glucocorticosteroid hormone (Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:0421).
[0074] Exemplary constitutive promoters include, but are not limited to: Promoters from plant viruses, such as the 35S promoter from CaMV; promoters from rice actin genes; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter; and the ALS promoter, Xbal/NcoI fragment 5 to the Brassica napus ALS3 structural gene (or a nucleotide sequence similarity to said Xbal/NcoI fragment) (International PCT Publication No. WO 96/30530).
[0075] Additionally, any tissue-specific or tissue-preferred promoter may be utilized in some embodiments of the invention. Plants transformed with a nucleic acid molecule comprising a coding sequence operably linked to a tissue-specific promoter may produce the product of the coding sequence exclusively, or preferentially, in a specific tissue. Exemplary tissue-specific or tissue-preferred promoters include, but are not limited to: A root-preferred promoter, such as that from the phaseolin gene; a leaf-specific and light-induced promoter such as that from cab or rubisco; an anther-specific promoter such as that from LAT52; a pollen-specific promoter such as that from Zm13; and a microspore-preferred promoter such as that from apg.
[0076] Transformation: As used herein, the term transformation or transduction refers to the transfer of one or more nucleic acid molecule(s) into a cell. A cell is transformed by a nucleic acid molecule transduced into the cell when the nucleic acid molecule becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al. (1986) Nature 319:791-3); lipofection (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; and microprojectile bombardment (Klein et al. (1987) Nature 327:70).
[0077] Transgene: An exogenous nucleic acid sequence. In some examples, a transgene may be a sequence that encodes a polypeptide comprising at least one synthetic CTP. In particular examples, a transgene may encode a polypeptide comprising at least one synthetic CTP and at least an additional peptide sequence (e.g., a peptide sequence that confers herbicide-resistance), for which plastid expression is desirable. In these and other examples, a transgene may contain regulatory sequences operably linked to a coding sequence of the transgene (e.g., a promoter). For the purposes of this disclosure, the term transgenic. when used to refer to an organism (e.g., a plant), refers to an organism that comprises the exogenous nucleic acid sequence. In some examples, the organism comprising the exogenous nucleic acid sequence may be an organism into which the nucleic acid sequence was introduced via molecular transformation techniques. In other examples, the organism comprising the exogenous nucleic acid sequence may be an organism into which the nucleic acid sequence was introduced by, for example, introgression or cross-pollination in a plant.
[0078] Transport: As used herein, the terms transport(s), target(s), and transfer(s) refers to the property of certain amino acid sequences of the invention that facilitates the movement of a polypeptide comprising the amino acid sequence from the nucleus of a host cell into a plastid of the host cell. In particular embodiments, such an amino acid sequence (i.e., a synthetic CTP sequence) may be capable of transporting about 100%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 70%, at least about 60%, and/or at least about 50% of a polypeptide comprising the amino acid sequence into plastids of a host cell.
[0079] Vector: A nucleic acid molecule as introduced into a cell, for example, to produce a transformed cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. Examples of vectors include, but are not limited to: a plasmid; cosmid; bacteriophage; or virus that carries exogenous DNA into a cell. A vector may also include one or more genes, antisense molecules, and/or selectable marker genes and other genetic elements known in the art. A vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and/or proteins encoded by the vector. A vector optionally includes materials to aid in achieving entry of the nucleic acid molecule into the cell (e.g., a liposome, protein coating, etc.).
[0080] Unless specifically indicated or implied, the terms a, an, and the signify at least one, as used herein.
[0081] Unless otherwise specifically explained, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology can be found in, for example, Lewin B., Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers R. A. (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. All temperatures are in degrees Celsius.
IV. Nucleic Acid Molecules Comprising a Synthetic CTP-Encoding Sequence
[0082] In some embodiments, this disclosure provides a nucleic acid molecule comprising at least one nucleotide sequence encoding a synthetic CTP operably linked to a nucleotide sequence of interest. In particular embodiments, the nucleotide sequence of interest may be a nucleotide sequence that encodes a polypeptide of interest. In particular examples, a single nucleic acid molecule is provided that encodes a polypeptide wherein a TraP23 sequence is fused to the N-terminus of a polypeptide of interest.
[0083] In some embodiments, a synthetic chloroplast transit peptide may be a chimeric CTP. A synthetic CTP may be derived from randomly selecting amino acids from an alignment of EPSPS enzymes.
[0084] One of ordinary skill in the art will understand that, following the selection of a first contiguous amino acid sequence within a synthetic CTP sequence, the identification and selection of the contiguous amino acid sequence from the remainder of a homologous CTP sequence according to the foregoing derivation process is unambiguous and automatic. In some examples, the first contiguous amino acid sequence may be between about 25 and about 41 amino acids in length (e.g., 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, and 42 amino acids in length).
[0085] Examples of synthetic CTP protein sequences according to the foregoing process are represented by SEQ ID NO: 11. In view of the degeneracy of the genetic code, the genus of nucleotide sequences encoding these peptides will be immediately envisioned by one of ordinary skill in the art. These particular examples illustrate the structural features of synthetic CTPs by incorporating contiguous sequences from an alignment of homologous CTP from one of several ESPSP orthologs from different plant species.
[0086] Some embodiments include functional variants of a synthetic chloroplast transit peptide, and/or nucleic acids encoding the same. Such functional variants include, for example and without limitation: a synthetic CTP-encoding sequence set forth as SEQ ID NOs:11, and/or a CTP encoded thereby; a nucleic acid that encodes a synthetic CTP that comprises a contiguous amino acid sequence within SEQ ID NO:11, and/or a CTP encoded thereby; a truncated synthetic CTP-encoding sequence that comprises a contiguous nucleic acid sequence of SEQ ID NO:12; a truncated synthetic CTP-encoding sequence that comprises a contiguous nucleic acid sequence that is substantially homologous to SEQ ID NO:12; a truncated synthetic CTP that comprises a contiguous amino acid sequence of SEQ ID NO:11; a nucleic acid that encodes a synthetic CTP comprising a contiguous amino acid sequence of SEQ ID NO:11, and/or a CTP encoded thereby; a nucleic acid that encodes a synthetic CTP comprising a contiguous amino acid sequence within SEQ ID NO:11 that has one or more conservative amino acid substitutions, and/or a CTP encoded thereby; and a nucleic acid that encodes a synthetic CTP comprising a contiguous amino acid sequence within SEQ ID NO:11 that has one or more non-conservative amino acid substitutions that are demonstrated to direct an operably linked peptide to a plastid in a plastid-containing cell, and/or a CTP encoded thereby.
[0087] Thus, some embodiments of the invention include a nucleic acid molecule comprising a nucleotide sequence encoding a synthetic CTP comprising one or more conservative amino acid substitutions. Such a nucleic acid molecule may be useful, for example, in facilitating manipulation of a CTP-encoding sequence of the invention in molecular biology techniques. For example, in some embodiments, a CTP-encoding sequence of the invention may be introduced into a suitable vector for sub-cloning of the sequence into an expression vector, or a CTP-encoding sequence of the invention may be introduced into a nucleic acid molecule that facilitates the production of a further nucleic acid molecule comprising the CTP-encoding sequence operably linked to a nucleotide sequence of interest. In these and further embodiments, one or more amino acid positions in the sequence of a synthetic CTP may be deleted. For example, the sequence of a synthetic CTP may be modified such that the amino acid(s) at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions in the sequence are deleted. An alignment of homologous CTP sequences may be used to provide guidance as to which amino acids may be deleted without affecting the function of the synthetic CTP.
[0088] In particular examples, a synthetic chloroplast transit peptide is less than 80 amino acids in length. For example, a synthetic CTP may be 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, or fewer amino acids in length. In certain examples, a synthetic CTP may be about 65, about 68, about 72, or about 74 amino acids in length. In these and further examples, a synthetic CTP may comprise an amino acid sequence set forth as SEQ ID NO:11 or a functional variant of the foregoing. Thus, a synthetic CTP may comprise an amino acid sequence of SEQ ID NO:11 or a functional variant thereof, wherein the length of the synthetic CTP is less than 80 amino acids in length. In certain examples, a synthetic CTP may comprise an amino acid sequence that is, e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to one of SEQ ID NO:11.
[0089] All of the nucleotide sequences that encode a particular synthetic CTP protein, for example, the TraP23 peptide of SEQ ID NO:11, or functional variants of any of the foregoing including any specific deletions and/or conservative amino acid substitutions, will be recognizable by those of skill in the art in view of the present disclosure. The degeneracy of the genetic code provides a finite number of coding sequences for a particular amino acid sequence. The selection of a particular sequence to encode a synthetic CTP is within the discretion of the practitioner. Different coding sequences may be desirable in different applications. For example, to increase expression of the synthetic CTP in a particular host, a coding sequence may be selected that reflects the codon usage bias of the host. By way of example, a synthetic CTP may be encoded by a nucleotide sequence set forth as SEQ ID NO:12.
[0090] In nucleic acid molecules provided in some embodiments of the invention, the last codon of a nucleotide sequence encoding a synthetic CTP and the first codon of a nucleotide sequence of interest may be separated by any number of nucleotide triplets, e.g., without coding for an intron or a STOP. In some examples, a sequence encoding the first amino acids of a mature protein normally associated with a chloroplast transit peptide in a natural precursor polypeptide may be present between the last codon of a nucleotide sequence encoding a synthetic CTP and the first codon of a nucleotide sequence of interest. A sequence separating a nucleotide sequence encoding a synthetic CTP and the first codon of a nucleotide sequence of interest may, for example, consist of any sequence, such that the amino acid sequence encoded is not likely to significantly alter the translation of the chimeric polypeptide and its translocation to a plastid. In these and further embodiments, the last codon of a nucleotide sequence encoding a synthetic chloroplast transit peptide may be fused in phase-register with the first codon of the nucleotide sequence of interest directly contiguous thereto, or separated therefrom by no more than a short peptide sequence, such as that encoded by a synthetic nucleotide linker (e.g., a nucleotide linker that may have been used to achieve the fusion).
[0091] In some embodiments, it may be desirable to modify the nucleotides of a nucleotide sequence of interest and/or a synthetic CTP-encoding sequence fused thereto in a single coding sequence, for example, to enhance expression of the coding sequence in a particular host. The genetic code is redundant with 64 possible codons, but most organism preferentially use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Zhang et al. (1991) Gene 105:61-72. Codons may be substituted to reflect the preferred codon usage of a particular host in a process sometimes referred to as codon optimization. Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host may be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties (e.g., a longer half-life, as compared with transcripts produced from a non-optimized sequence).
[0092] Any polypeptide may be targeted to a plastid of a plastid-containing cell by incorporation of a synthetic CTP sequence. For example, a polypeptide may be linked to a synthetic CTP sequence in some embodiments, so as to direct the polypeptide to a plastid in a cell wherein the linked polypeptide-CTP molecule is expressed. In particular embodiments, a polypeptide targeted to a plastid by incorporation of a synthetic CTP sequence may be, for example, a polypeptide that is normally expressed in a plastid of a cell wherein the polypeptide is natively expressed. For example and without limitation, a polypeptide targeted to a plastid by incorporation of a synthetic CTP sequence may be a polypeptide involved in herbicide resistance, virus resistance, bacterial pathogen resistance, insect resistance, nematode resistance, or fungal resistance. See, e.g., U.S. Pat. Nos. 5,569,823; 5,304,730; 5,495,071; 6,329,504; and 6,337,431. A polypeptide targeted to a plastid by incorporation of a synthetic CTP sequence may alternatively be, for example and without limitation, a polypeptide involved in plant vigor or yield (including polypeptides involved in tolerance for extreme temperatures, soil conditions, light levels, water levels, and chemical environment), or a polypeptide that may be used as a marker to identify a plant comprising a trait of interest (e.g., a selectable marker gene product, a polypeptide involved in seed color, etc.).
[0093] Non-limiting examples of polypeptides involved in herbicide resistance that may be linked to a synthetic CTP sequence in some embodiments of the invention include: acetolactase synthase (ALS), mutated ALS, and precursors of ALS (see, e.g., U.S. Pat. No. 5,013,659); EPSPS (see, e.g., U.S. Pat. Nos. 4,971,908 and 6,225,114), such as a CP4 EPSPS or a class III EPSPS; enzymes that modify a physiological process that occurs in a plastid, including photosynthesis, and synthesis of fatty acids, amino acids, oils, arotenoids, terpenoids, starch, etc. Other non-limiting examples of polypeptides that may be linked to a synthetic chloroplast transit peptide in particular embodiments include: zeaxanthin epoxidase, choline monooxygenase, ferrochelatase, omega-3 fatty acid desaturase, glutamine synthetase, starch modifying enzymes, polypeptides involved in synthesis of essential amino acids, provitamin A, hormones, Bt toxin proteins, etc. Nucleotide sequences encoding the aforementioned peptides are known in the art, and such nucleotide sequences may be operably linked to a nucleotide sequence encoding a synthetic CTP to be expressed into a polypeptide comprising the polypeptide of interest linked to the synthetic CTP. Furthermore, additional nucleotide sequences encoding any of the aforementioned polypeptides may be identified by those of skill in the art (for example, by cloning of genes with high homology to other genes encoding the particular polypeptide). Once such a nucleotide sequence has been identified, it is a straightforward process to design a nucleotide sequence comprising a synthetic CTP-encoding sequence operably linked to the identified nucleotide sequence, or a sequence encoding an equivalent polypeptide.
V. Expression of Polypeptides Comprising a Synthetic Chloroplast Transit Peptide
[0094] In some embodiments, at least one nucleic acid molecule(s) comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP, or functional equivalent thereof, may be introduced into a cell, tissue, or organism for expression of the polypeptide therein. In particular embodiments, a nucleic acid molecule may comprise a nucleotide sequence of interest operably linked to a nucleotide sequence encoding a synthetic CTP. For example, a nucleic acid molecule may comprise a coding sequence encoding a polypeptide comprising at least one synthetic CTP and at least an additional peptide sequence encoded by a nucleotide sequence of interest. In some embodiments, a nucleic acid molecule of the invention may be introduced into a plastid-containing host cell, tissue, or organism (e.g., a plant cell, plant tissue, and plant), such that a polypeptide may be expressed from the nucleic acid molecule in the plastid-containing host cell, tissue, or organism, wherein the expressed polypeptide comprises at least one synthetic CTP and at least an additional peptide sequence encoded by a nucleotide sequence of interest. In certain examples, the synthetic CTP of such an expressed polypeptide may facilitate targeting of a portion of the polypeptide comprising at least the additional peptide sequence to a plastid of the host cell, tissue, or organism.
[0095] In some embodiments, a nucleic acid molecule of the invention may be introduced into a plastid-containing cell by one of any of the methodologies known to those of skill in the art. In particular embodiments, a host cell, tissue, or organism may be contacted with a nucleic acid molecule of the invention in order to introduce the nucleic acid molecule into the cell, tissue, or organism. In particular embodiments, a cell may be transformed with a nucleic acid molecule of the invention such that the nucleic acid molecule is introduced into the cell, and the nucleic acid molecule is stably integrated into the genome of the cell. In some embodiments, a nucleic acid molecule comprising at least one nucleotide sequence encoding a synthetic CTP operably linked to a nucleotide sequence of interest may be used for transformation of a cell, for example, a plastid-containing cell (e.g., a plant cell). In order to initiate or enhance expression, a nucleic acid molecule may comprise one or more regulatory sequences, which regulatory sequences may be operably linked to the nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP.
[0096] A nucleic acid molecule may, for example, be a vector system including, for example, a linear or a closed circular plasmid. In particular embodiments, the vector may be an expression vector. Nucleic acid sequences of the invention may, for example, be inserted into a vector, such that the nucleic acid sequence is operably linked to one or more regulatory sequences. Many vectors are available for this purpose, and selection of the particular vector may depend, for example, on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector. A vector typically contains various components, the identity of which depend on a function of the vector (e.g., amplification of DNA and expression of DNA), and the particular host cell(s) with which the vector is compatible.
[0097] Some embodiments may include a plant transformation vector that comprises a nucleotide sequence comprising at least one of the above-described regulatory sequences operatively linked to one or more nucleotide sequence(s) encoding a polypeptide comprising at least one synthetic CTP. The one or more nucleotide sequences may be expressed, under the control of the regulatory sequence(s), in a plant cell, tissue, or organism to produce a polypeptide comprising a synthetic CTP that targets at least a portion of the polypeptide to a plastid of the plant cell, tissue, or organism.
[0098] In some embodiments, a regulatory sequence operably linked to a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP, may be a promoter sequence that functions in a host cell, such as a bacterial cell wherein the nucleic acid molecule is to be amplified, or a plant cell wherein the nucleic acid molecule is to be expressed. Promoters suitable for use in nucleic acid molecules of the invention include those that are inducible, viral, synthetic, or constitutive, all of which are well known in the art. Non-limiting examples of promoters that may be useful in embodiments of the invention are provided by: U.S. Pat. No. 6,437,217 (maize RS81 promoter); 5,641,876 (rice actin promoter); 6,426,446 (maize RS324 promoter); 6,429,362 (maize PR-1 promoter); 6,232,526 (maize A3 promoter); 6,177,611 (constitutive maize promoters); U.S. Pat. Nos. 5,322,938, 5,352,605, 5,359,142, and 5,530,196 (35S promoter); 6,433,252 (maize L3 oleosin promoter); 6,429,357 (rice actin 2 promoter, and rice actin 2 intron); 6,294,714 (light-inducible promoters); 6,140,078 (salt-inducible promoters); 6,252,138 (pathogen-inducible promoters); 6,175,060 (phosphorous deficiency-inducible promoters); U.S. Pat. No. 6,388,170 (bidirectional promoters); 6,635,806 (gamma-coixin promoter); and U.S. patent application Ser. No. 09/757,089 (maize chloroplast aldolase promoter).
[0099] Additional exemplary promoters include the nopaline synthase (NOS) promoter (Ebert et al. (1987) Proc. Natl. Acad. Sci. USA 84(16):5745-9); the octopine synthase (OCS) promoter (which is carried on tumor-inducing plasmids of Agrobacterium tumefaciens); the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-24); the CaMV 35S promoter (Odell et al. (1985) Nature 313:810-2; the figwort mosaic virus 35S-promoter (Walker et al. (1987) Proc. Natl. Acad. Sci. USA 84(19):6624-8); the sucrose synthase promoter (Yang and Russell (1990) Proc. Natl. Acad. Sci. USA 87:4144-8); the R gene complex promoter (Chandler et al. (1989) Plant Cell 1:1175-83); the chlorophyll a/b binding protein gene promoter; CaMV35S (U.S. Pat. Nos. 5,322,938, 5,352,605, 5,359,142, and 5,530,196); FMV35S (U.S. Pat. Nos. 6,051,753, and 5,378,619); a PC1SV promoter (U.S. Pat. No. 5,850,019); the SCP1 promoter (U.S. Pat. No. 6,677,503); and AGRtu.nos promoters (GenBank Accession No. V00087; Depicker et al. (1982) J. Mol. Appl. Genet. 1:561-73; Bevan et al. (1983) Nature 304:184-7).
[0100] In particular embodiments, nucleic acid molecules of the invention may comprise a tissue-specific promoter. A tissue-specific promoter is a nucleotide sequence that directs a higher level of transcription of an operably linked nucleotide sequence in the tissue for which the promoter is specific, relative to the other tissues of the organism. Examples of tissue-specific promoters include, without limitation: tapetum-specific promoters; anther-specific promoters; pollen-specific promoters (See, e.g., U.S. Pat. No. 7,141,424, and International PCT Publication No. WO 99/042587); ovule-specific promoters; (See, e.g., U.S. Patent Application No. 2001/047525 A1); fruit-specific promoters (See, e.g., U.S. Pat. Nos. 4,943,674, and 5,753,475); and seed-specific promoters (See, e.g., U.S. Pat. Nos. 5,420,034, and 5,608,152). In some embodiments, a developmental stage-specific promoter (e.g., a promoter active at a later stage in development) may be used in a composition or method of the invention.
[0101] Additional regulatory sequences that may in some embodiments be operably linked to a nucleic acid molecule include 5 UTRs located between a promoter sequence and a coding sequence that function as a translation leader sequence. The translation leader sequence is present in the fully-processed mRNA, and it may affect processing of the primary transcript, and/or RNA stability. Examples of translation leader sequences include maize and petunia heat shock protein leaders (U.S. Pat. No. 5,362,865), plant virus coat protein leaders, plant rubisco leaders, and others. See, e.g., Turner and Foster (1995) Molecular Biotech. 3(3):225-36. Non-limiting examples of 5 UTRs are provided by: GmHsp (U.S. Pat. No. 5,659,122); PhDnaK (U.S. Pat. No. 5,362,865); AtAntl; TEV (Carrington and Freed (1990) J. Virol. 64:1590-7); and AGRtunos (GenBank Accession No. V00087; and Bevan et al. (1983) Nature 304:184-7).
[0102] Additional regulatory sequences that may in some embodiments be operably linked to a nucleic acid molecule also include 3 non-translated sequences, 3 transcription termination regions, or poly-adenylation regions. These are genetic elements located downstream of a nucleotide sequence, and include polynucleotides that provide polyadenylation signal, and/or other regulatory signals capable of affecting transcription or mRNA processing. The polyadenylation signal functions in plants to cause the addition of polyadenylate nucleotides to the 3 end of the mRNA precursor. The polyadenylation sequence can be derived from a variety of plant genes, or from T-DNA genes. A non-limiting example of a 3 transcription termination region is the nopaline synthase 3 region (nos 3; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7). An example of the use of different 3 nontranslated regions is provided in Ingelbrecht et al., (1989) Plant Cell 1:671-80. Non-limiting examples of polyadenylation signals include one from a Pisum sativum RbcS2 gene (Ps.RbcS2-E9; Coruzzi et al. (1984) EMBO J. 3:1671-9) and AGRtu.nos (GenBank Accession No. E01312).
[0103] A recombinant nucleic acid molecule or vector of the present invention may comprise a selectable marker that confers a selectable phenotype on a transformed cell, such as a plant cell. Selectable markers may also be used to select for plants or plant cells that comprise recombinant nucleic acid molecule of the invention. The marker may encode biocide resistance, antibiotic resistance (e.g., kanamycin, Geneticin (G418), bleomycin, hygromycin, etc.), or herbicide resistance (e.g., glyphosate, etc.). Examples of selectable markers include, but are not limited to: a neo gene which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc.; a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil; a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulfonylurea resistance; and a methotrexate resistant DHFR gene. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, streptomycin and tetracycline, and the like. Examples of such selectable markers are illustrated in, e.g., U.S. Pat. Nos. 5,550,318; 5,633,435; 5,780,708 and 6,118,047.
[0104] A recombinant nucleic acid molecule or vector of the present invention may also or alternatively include a screenable marker. Screenable markers may be used to monitor expression. Exemplary screenable markers include a -glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known (Jefferson et al. (1987) Plant Mol. Biol. Rep. 5:387-405); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al. (1988) Molecular cloning of the maize R-nj allele by transposon tagging with Ac. In 18.sup.th Stadler Genetics Symposium, P. Gustafson and R. Appels, eds. (New York: Plenum), pp. 263-82); a -lactamase gene (Sutcliffe et al. (1978) Proc. Natl. Acad. Sci. USA 75:3737-41); a gene which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al. (1986) Science 234:856-9); a xylE gene that encodes a catechol dioxygenase that can convert chromogenic catechols (Zukowski et al. (1983) Gene 46(2-3):247-55); an amylase gene (Ikatu et al. (1990) Bio/Technol. 8:241-2); a tyrosinase gene which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to melanin (Katz et al. (1983) J. Gen. Microbiol. 129:2703-14); and an -galactosidase.
[0105] Suitable methods for transformation of host cells include any method by which DNA can be introduced into a cell, for example and without limitation: by transformation of protoplasts (See, e.g., U.S. Pat. No. 5,508,184); by desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); by electroporation (See, e.g., U.S. Pat. No. 5,384,253); by agitation with silicon carbide fibers (See, e.g., U.S. Pat. Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (See, e.g., U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840, and 6,384,301); and by acceleration of DNA-coated particles (See, e.g., U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865); etc. Through the application of techniques such as these, the cells of virtually any species may be stably transformed. In some embodiments, transforming DNA is integrated into the genome of the host cell. In the case of multicellular species, transgenic cells may be regenerated into a transgenic organism. Any of these techniques may be used to produce a transgenic plant, for example, comprising one or more nucleic acid sequences of the invention in the genome of the transgenic plant.
[0106] The most widely utilized method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria which genetically transform plant cells. The T.sub.i and R.sub.i plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant. The T.sub.i (tumor-inducing)-plasmids contain a large segment, known as T-DNA, which is transferred to transformed plants. Another segment of the T.sub.i plasmid, the vir region, is responsible for T-DNA transfer. The T-DNA region is bordered by terminal repeats. In some modified binary vectors, the tumor-inducing genes have been deleted, and the functions of the vir region are utilized to transfer foreign DNA bordered by the T-DNA border sequences. The T-region may also contain, for example, a selectable marker for efficient recovery of transgenic plants and cells, and a multiple cloning site for inserting sequences for transfer such as a synthetic CTP-encoding nucleic acid.
[0107] Thus, in some embodiments, a plant transformation vector may be derived from a plasmid of A. tumefaciens (See, e.g., U.S. Pat. Nos. 4,536,475, 4,693,977, 4,886,937, and 5,501,967; and European Patent EP 0 122 791) or a Ri plasmid of A. rhizogenes. Additional plant transformation vectors include, for example and without limitation, those described by Herrera-Estrella et al. (1983) Nature 303:209-13; Bevan et al. (1983) Nature 304:184-7; Klee et al. (1985) Bio/Technol. 3:637-42; and in European Patent EP 0 120 516, and those derived from any of the foregoing. Other bacteria such as Sinorhizobium, Rhizobium, and Mesorhizobium that interact with plants naturally can be modified to mediate gene transfer to a number of diverse plants. These plant-associated symbiotic bacteria can be made competent for gene transfer by acquisition of both a disarmed T.sub.i plasmid and a suitable binary vector.
[0108] After providing exogenous DNA to recipient cells, transformed cells are generally identified for further culturing and plant regeneration. In order to improve the ability to identify transformed cells, one may desire to employ a selectable or screenable marker gene, as previously set forth, with the vector used to generate the transformant. In the case where a selectable marker is used, transformed cells are identified within the potentially transformed cell population by exposing the cells to a selective agent or agents. In the case where a screenable marker is used, cells may be screened for the desired marker gene trait.
[0109] Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In some embodiments, any suitable plant tissue culture media (e.g., MS and N6 media) may be modified by including further substances, such as growth regulators. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks), then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturity.
[0110] To confirm the presence of a nucleic acid molecule of interest (for example, a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP) in a regenerating plant, a variety of assays may be performed. Such assays include, for example: molecular biological assays, such as Southern and Northern blotting, PCR, and nucleic acid sequencing; biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISA and/or Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and analysis of the phenotype of the whole regenerated plant.
[0111] By way of example, integration events may be analyzed by PCR amplification using, e.g., oligonucleotide primers specific for a nucleotide sequence of interest. PCR genotyping is understood to include, but not be limited to, polymerase-chain reaction (PCR) amplification of genomic DNA derived from isolated host plant tissue predicted to contain a nucleic acid molecule of interest integrated into the genome, followed by standard cloning and sequence analysis of PCR amplification products. Methods of PCR genotyping have been well described (see, e.g., Rios, G. et al. (2002) Plant J. 32:243-53), and may be applied to genomic DNA derived from any plant species (e.g., Z. mays or G. max) or tissue type, including cell cultures.
[0112] A transgenic plant formed using Agrobacterium-dependent transformation methods typically contains a single recombinant DNA sequence inserted into one chromosome. The single recombinant DNA sequence is referred to as a transgenic event or integration event. Such transgenic plants are heterozygous for the inserted DNA sequence. In some embodiments, a transgenic plant homozygous with respect to a transgene may be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single exogenous gene sequence to itself, for example, an F.sub.0 plant, to produce F.sub.1 seed. One fourth of the F.sub.1 seed produced will be homozygous with respect to the transgene. Germinating F.sub.1 seed results in plants that can be tested for heterozygosity, typically using a SNP assay or a thermal amplification assay that allows for the distinction between heterozygotes and homozygotes (i.e., a zygosity assay).
[0113] In particular embodiments, copies of at least one polypeptide comprising at least one synthetic CTP are produced in a plastid-containing cell, into which has been introduced at least one nucleic acid molecule(s) comprising a nucleotide sequence encoding the at least one polypeptide comprising at least one synthetic CTP. Each polypeptide comprising at least one synthetic CTP may be expressed from multiple nucleic acid sequences introduced in different transformation events, or from a single nucleic acid sequence introduced in a single transformation event. In some embodiments, a plurality of such polypeptides is expressed under the control of a single promoter. In other embodiments, a plurality of such polypeptides is expressed under the control of multiple promoters. Single polypeptides may be expressed that comprise multiple peptide sequences, each of which peptide sequences is to be targeted to a plastid.
[0114] In addition to direct transformation of a plant with a recombinant nucleic acid molecule, transgenic plants can be prepared by crossing a first plant having at least one transgenic event with a second plant lacking such an event. For example, a recombinant nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP may be introduced into a first plant line that is amenable to transformation, to produce a transgenic plant, which transgenic plant may be crossed with a second plant line to introgress the nucleotide sequence that encodes the polypeptide into the second plant line.
VI. Plant Materials Comprising a Synthetic Chloroplast Transit Peptide-Directed Polypeptide
[0115] In some embodiments, a plant is provided, wherein the plant comprises a plant cell comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP. In particular embodiments, such a plant may be produced by transformation of a plant tissue or plant cell, and regeneration of a whole plant. In further embodiments, such a plant may be obtained from a commercial source, or through introgression of a nucleic acid comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP into a germplasm. Plant materials comprising a plant cell comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP are also provided. Such a plant material may be obtained from a plant comprising the plant cell.
[0116] A transgenic plant or plant material comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP may in some embodiments exhibit one or more of the following characteristics: expression of the polypeptide in a cell of the plant; expression of a portion of the polypeptide in a plastid of a cell of the plant; import of the polypeptide from the cytosol of a cell of the plant into a plastid of the cell; plastid-specific expression of the polypeptide in a cell of the plant; and/or localization of the polypeptide in a cell of the plant. Such a plant may additionally have one or more desirable traits other than expression of the encoded polypeptide. Such traits may include, for example: resistance to insects, other pests, and disease-causing agents; tolerances to herbicides; enhanced stability, yield, or shelf-life; environmental tolerances; pharmaceutical production; industrial product production; and nutritional enhancements.
[0117] A transgenic plant according to the invention may be any plant capable of being transformed with a nucleic acid molecule of the invention. Accordingly, the plant may be a dicot or monocot. Non-limiting examples of dicotyledonous plants usable in the present methods include Arabidopsis, alfalfa, beans, broccoli, cabbage, carrot, cauliflower, celery, Chinese cabbage, cotton, cucumber, eggplant, lettuce, melon, pea, pepper, peanut, potato, pumpkin, radish, rapeseed, spinach, soybean, squash, sugarbeet, sunflower, tobacco, tomato, and watermelon. Non-limiting examples of monocotyledonous plants usable in the present methods include corn, Brassica, onion, rice, sorghum, wheat, rye, millet, sugarcane, oat, triticale, switchgrass, and turfgrass. Transgenic plants according to the invention may be used or cultivated in any manner.
[0118] Some embodiments also provide commodity products containing one or more nucleotide sequences encoding a polypeptide comprising at least one synthetic CTP, for example, a commodity product produced from a recombinant plant or seed containing one or more of such nucleotide sequences. Commodity products containing one or more nucleotide sequences encoding a polypeptide comprising at least one synthetic CTP include, for example and without limitation: food products, meals, oils, or crushed or whole grains or seeds of a plant comprising one or more nucleotide sequences encoding a polypeptide comprising at least one synthetic CTP. The detection of one or more nucleotide sequences encoding a polypeptide comprising at least one synthetic CTP in one or more commodity or commodity products is de facto evidence that the commodity or commodity product was at least in part produced from a plant comprising one or more nucleotide sequences encoding a polypeptide comprising at least one synthetic CTP. In particular embodiments, a commodity product of the invention comprise a detectable amount of a nucleic acid sequence encoding a polypeptide comprising at least one synthetic CTP. In some embodiments, such commodity products may be produced, for example, by obtaining transgenic plants and preparing food or feed from them.
[0119] In some embodiments, a transgenic plant or seed comprising a transgene comprising a nucleotide sequence encoding a polypeptide comprising at least one synthetic CTP also may comprise at least one other transgenic event in its genome, including without limitation: a transgenic event from which is transcribed an iRNA molecule; a gene encoding an insecticidal protein (e.g., an Bacillus thuringiensis insecticidal protein); an herbicide tolerance gene (e.g., a gene providing tolerance to glyphosate); and a gene contributing to a desirable phenotype in the transgenic plant (e.g., increased yield, altered fatty acid metabolism, or restoration of cytoplasmic male sterility).
VII. Synthetic Chloroplast Transit Peptide-Mediated Localization of Gene Products to Plastids
[0120] Some embodiments of the present invention provide a method for expression and/or localization of a gene product to a plastid (e.g., a chloroplast). In particular embodiments, the gene product may be a marker gene product, for example, a fluorescent molecule. Expression of the gene product as part of a polypeptide also comprising a synthetic CTP may provide a system to evaluate the plastid-localizing capabilities of a particular synthetic CTP sequence. In some embodiments, expression of a marker gene product as part of a synthetic CTP-containing polypeptide is utilized to target expression of the marker gene product to a plastid of a cell wherein the polypeptide is expressed. In certain embodiments, such a marker gene product is localized in plastid(s) of the host cell. For example, the marker gene product may be expressed at higher levels in the plastid(s) than in the cytosol or other organelles of the host cell; the marker gene product may be expressed at much higher levels in the plastid(s); the marker gene product may be expressed essentially only in the plastid(s); or the marker gene product may be expressed entirely in the plastid(s), such that expression in the cytosol or non-plastid organelles cannot be detected.
[0121] In some embodiments, a polypeptide comprising a functional variant of a synthetic CTP, wherein the polypeptide is operably linked to a marker gene product is used to evaluate the characteristics of the functional variant peptide. For example, the sequence of a synthetic CTP may be varied, e.g., by introducing at least one conservative mutation(s) into the synthetic CTP, and the resulting variant peptide may be linked to a marker gene product. After expression in a suitable host cell (for example, a cell wherein one or more regulatory elements in the expression construct are operable), expression of the marker gene product may be determined. By comparing the subcellular localization of the marker gene product between the reference synthetic CTP-marker construct and the variant peptide-marker construct, it may be determined whether the variant peptide provides, for example, greater plastid localization, or substantially identical plastid localization. Such a variant may be considered a functional variant. By identifying functional variants of synthetic CTP that provide greater plastic localization, the mutations in such variants may be incorporated into further variants of synthetic CTPs. Performing multiple rounds of this evaluation process, and subsequently incorporating identified favorable mutations in a synthetic CTP sequence, may yield an iterative process for optimization of a synthetic CTP sequence. Such optimized synthetic CTP sequences, and nucleotide sequences encoding the same, are considered part of the present invention, whether or not such optimized synthetic CTP sequences may be further optimized by additional mutation.
[0122] All references, including publications, patents, and patent applications, cited herein are hereby incorporated by reference to the extent they are not inconsistent with the explicit details of this disclosure, and are so incorporated to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. The references discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.
[0123] The following Examples are provided to illustrate certain particular features and/or aspects. These Examples should not be construed to limit the disclosure to the particular features or aspects described.
EXAMPLES
Example 1
Design and Production of a Synthetic Chloroplast Transit Peptide (TraP) Sequence
[0124] Plastids are cytoplasmic organelles found in higher plant species and are present in all plant tissues. Chloroplasts are a specific type of plastid found in green photosynthetic tissues which are responsible for essential physiological functions. For example, one such primary physiological function is the synthesis of aromatic amino acids required by the plant. Nuclear encoded enzymes are required in this biosynthetic pathway and are transported from the cytoplasm to the interior of the chloroplast. These nuclear encoded enzymes usually possess an N-terminal transit peptide that interacts with the chloroplast membrane to facilitate transport of the peptide to the stroma of the chloroplast. Bruce B. (2000) Chloroplast transit peptides: structure, function, and evolution. Trends Cell Bio. 10:440-447. Upon import, stromal peptidases cleave the transit peptide, leaving the mature functional protein imported within the chloroplast. Richter S, Lamppa GK. (1999) Stromal processing peptidase binds transit peptides and initiates their ATP-dependent turnover in chloroplasts. Journ. Cell Bio. 147:33-43. The chloroplast transit peptides are variable sequences which are highly divergent in length, composition and organization. Bruce B. (2000) Chloroplast transit peptides: structure, function, and evolution. Trends Cell Bio. 10:440-447. The sequence similarities of chloroplast transit peptides diverge significantly amongst homologous proteins from different plant species. The amount of divergence between chloroplast transit peptides is unexpected given that the homologous proteins obtained from different plant species typically share relatively high levels of sequence similarity when comparing the processed mature functional protein.
[0125] A novel synthetic chloroplast transit peptide sequence was designed, produced and tested in planta. The novel synthetic chloroplast transit peptide was shown to possess efficacious translocation and processing properties for the import of agronomic important proteins within the chloroplast. Initially, native 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein sequences from different plant species were analyzed via the ChloroP computer program to identify putative chloroplast transit peptide sequences (Emanuelsson O, Nielsen H, von Heijne G, (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites, Protein Science 8; 978-984), available at http://www.cbs.dtu.dk/services/ChloroP/. Utilizing the chloroplast transit peptide sequence alignment, a novel synthetic chloroplast transit peptides was designed by randomly selecting amino acids to produce a novel synthetic putative chloroplast transit peptide sequence. An exemplary sequence of the newly designed synthetic chloroplast transit peptide is TraP23 (SEQ ID NO:11). The novel synthetic chloroplast transit peptide was tested via multiple assays which included a transient in planta expression system and transgenically as a stable transformation event comprising a gene expression element fused to an agronomic important transgene sequence.
Example 2
Transient In Planta Testing of Synthetic Chloroplast Transit Peptide (TraP) Sequences
Tobacco Transient Assay:
[0126] The Trap23 synthetic chloroplast transit peptide sequence were initially tested via a transient in planta assay. A polynucleotide sequence which encodes the Trap23v2 (SEQ ID NO:12) synthetic chloroplast transit peptide sequences was synthesized. The resulting construct contained two plant transcription units (PTU). The first PTU was comprised of the Arabidopsis thaliana Ubiquitin 10 promoter (AtUbi10 promoter; Callis, et al., (1990) J. Biol. Chem., 265: 12486-12493), TraP-green fluorescent protein fusion gene (TraP-GFP; U.S. Pat. No. 7,678,893), and Agrobacterium tumefaciens ORF 23 3 untranslated region (AtuORF23 3UTR; U.S. Pat. No. 5,428,147). The second PTU was comprised of the Cassava Vein Mosaic Virus promoter (CsVMV promoter; Verdaguer et al., (1996) Plant Molecular Biology, 31:1129-1139), dsm-2 (DSM2; U.S. Patent App. No. 2011/0107455), and Agrobacterium tumefaciens ORF 1 3 untranslated region (AtuORF1 3UTR; Huang et al., (1990) J. Bacteriol., 172:1814-1822). Construct pDAB107640 contains the TraP23 v2 synthetic chloroplast transit peptide (
[0127] From an Agrobacterium glycerol stock, a loop full of frozen culture was inoculated into 2 ml of YPD (100 g/ml spectinomycin) in a 14 ml sterile tube. The inoculated media was incubated at 28 C. overnight with shaking at 200 rpm. The following day about 100 l of the culture was used to inoculate 25 ml of YPD (100 g/ml spectinomycin) in a 125 ml sterile tri-baffled flask, and incubated overnight at 28 C. overnight with shaking at 200 rpm. The following day the cultures were diluted to an OD.sub.600 of 0.5 in sterile ddH.sub.2O (pH 8.0). The diluted Agrobacterium strain was mixed with a second Agrobacterium strain containing the P19 helper protein at a ratio of 1:1. The culture were used for tobacco leaf infiltration via the method of Voinnet O, Rivas S, Mestre P, and Baulcombe D., (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus, The Plant Journal, 33:949-956. Infiltrated tobacco plants were placed in a Conviron set at 16 hr of light at 24 C. for at least three days until being assayed.
Microscopy Results:
[0128] Agrobacterium-infiltrated tobacco leaves were severed from the plant, and placed into a petri-dish with water to prevent dehydration. The infiltrated tobacco leaves were observed under blue light excitation with long-pass filter glasses held in place using a Dark Reader Hand Lamp (Clare Chemical Research Co.; Dolores, Colo.) to identify undamaged areas of the leaf that were successfully expressing the GFP reporter proteins. Specifically identified leaf areas were dissected from the leaf and mounted in water for imaging by confocal microscopy (Leica TCS-SP5 AOBS; Buffalo Grove, Ill.). The GFP reporter protein was excited by a 514 nm laser line, using a multi-line argon-ion laser. The width of the detection slits was adjusted using a non-expressing (dark) control leaf sample to exclude background leaf autofluoresence. Chlorophyll autofluorescence was simultaneously collected in a second channel for direct comparison to the fluorescent reporter protein signal for determination of chloroplastic localization.
[0129] The microscopy imaging results indicated that the GFP fluorescent protein comprising a TraP23 chloroplast transit peptide did not accumulate detectable amounts of GFP protein within the chloroplasts located in the cytoplasm of the tobacco cells (
Western Blot Results:
[0130] Samples of the infiltrated tobacco plants were assayed via Western blotting. Leaf punches were collected and subjected to bead-milling. About 100-200 mg of leaf material was mixed with 2 BBs (steel balls; Daisy; Rogers, Ark.) and 500 ml of PBST for 3 minutes in a Kleco bead mill. The samples were then spun down in a centrifuge at 14,000g at 4 C. The supernatant was removed and either analyzed directly via Western blot or immunoprecipitated. The immunoprecipitations were performed using the Pierce Direct IP kit (Thermo Scientific; Rockford, Ill.) following the manufacturer's protocol. Approximately, 50 g of anti-GFP was bound to the resin. The samples were incubated with the resin overnight at 4 C. Next, the samples were washed and eluted the following morning and prepped for analysis by combining equal volumes of 28M Urea sample buffer and then boiling the samples for 5 minutes. The boiled samples were run on a 4-12% SDS-Bis Tris gel in MOPS buffer for 40 minutes. The gel was then blotted using the Invitrogen iBlot (Life Technologies; Carlsbad, Calif.) following the manufacturer's protocol. The blotted membrane was blocked for 10 minutes using 5% non-fat dry milk in PBS-Tween solution. The membrane was probed with the primary antibody (monoclonal anti-GFP in rabbit) used at a 1:1000 dilution in the 5% non-fat dry milk in PBS-Tween solution for 1 hour. Next, the membrane was rinsed three times for five minutes with PBS-Tween to remove all unbound primary antibody. The membrane was probed with a secondary monoclonal anti-rabbit in goat antibody (Life Technologies) used at a 1:1000 dilution, for 60 minutes. The membrane was washed as previously described and developed by adding Themo BCIP/NBT substrate. The colormetric substrate was allowed to develop for 5-10 minutes and then the blots were rinsed with water before being dried.
[0131] The Western blot results indicated that the GFP protein was expressed in the infiltrated tobacco cells. The pDAB107640 infiltrated tobacco plant leaf tissues expressed the GFP protein as indicated by the presence of a protein band which reacted to the GFP antibodies and was equivalent in size to the GFP protein band obtained from a GFP control which did not contain a chloroplast transit peptide. Moreover, these results indicated that the TraP synthetic chloroplast transit peptide was processed and cleaved from the GFP protein. The TraP23-GFP construct expresses a pre-processed protein band that is larger in molecular weight than the control GFP protein. The presence of bands on the Western blot which are equivalent in size to the control GFP indicate that the TraP23 chloroplast transit peptide sequences were processed, thereby reducing the size of the GFP to a molecular weight size which is equivalent to the GFP control.
Maize Protoplast Transient Assay:
[0132] The Trap23 v2 synthetic chloroplast transit peptide-encoding polynucleotide sequence (SEQ ID NO:12) was cloned upstream of the green fluorescent protein gene and incorporated into the pDAB106598 construct (
[0133] Seed of Zea mays var. B104 were surface sterilized by shaking vigorously in 50% Clorox (3% sodium hypochlorite), containing 2-3 drops of Tween 20, for about 20 minutes. The seeds were rinsed thoroughly with sterile distilled water. The sterile seeds were plated onto 1/2 MS medium in Phytatrays or similar type boxes, and allowed to grow in the dark (28 C.) for 12 to 20 days. A maize protoplast transient assay was used to obtain and transfect maize protoplasts from leaves of B 104-maize. This maize protoplast assay is a modification of the system described by Yoo, S.-D., Cho, Y.-H., and Sheen, J., (2007), Arabidopsis Mesophyll Protoplasts: A Versitile Cell System for Transient Gene Expression Analysis, Nature Protocols, 2:1565-1572. The solutions were prepared as described by Yoo et. al., (2007), with the exception that the mannitol concentration used for the following experiments was change to 0.6 M.
[0134] Transfection of 100 to 500 l of protoplasts (1-510.sup.5) was completed by adding the protoplasts to a 2 ml microfuge tube containing about 40 g of plasmid DNA (pDAB106598), at room temperature. The volume of DNA was preferably kept to about 10% of the protoplast volume. The protoplasts and DNA were occasionally mixed during a 5 minute incubation period. An equal volume of PEG solution was slowly added to the protoplasts and DNA, 2 drops at a time with mixing inbetween the addition of the drops of PEG solution. The tubes were allowed to incubate for about 10 minutes with occasional gentle mixing. Next, 1 ml of W5+ solution was added and mixed by inverting the tube several times. The tube(s) were centrifuged for 5 minutes at 75g at a temperature of 4 C. Finally, the supernatant was removed and the pellet was resuspended in 1 ml of WI solution and the protoplasts were placed into a small Petri plate (3510 mm) or into 6-well multiwell plates and incubated overnight in the dark at room temperature. Fluorescence of GFP was viewed by microscopy after 12 hours of incubation. The microscopy conditions previously described were used for the imaging.
[0135] The microscopy imaging results indicated that the GFP fluorescent protein comprising a TraP23 synthetic chloroplast transit peptide accumulated within the chloroplasts located in the cytoplasm of the maize cells as compared to the control GFP fluorescent proteins which did not translocate into the chloroplasts of the cytoplasm of the maize cells (
Example 3
Synthetic Chloroplast Transit Peptide (TraP) Sequences for Expression of Agronomically Important Transgenes in Arabidopsis
[0136] A single amino acid mutation (G96A) in the Escherichia coli 5-enolpyruvylshikimate 3-phosphate synthase enzyme (EPSP synthase) can result in glyphosate insensitivity (Padgette et al., (1991); Eschenburg et al., (2002); Priestman et al., (2005); Haghani et al., (2008)). While this mutation confers tolerance to glyphosate, it is also known to adversely affect binding of EPSP synthase with its natural substrate, phosphoenolpyruvate (PEP). The resulting change in substrate binding efficiency can render a mutated enzyme unsuitable for providing in planta tolerance to glyphosate.
[0137] The NCBI Genbank database was screened in silico for EPSP synthase protein and polynucleotide sequences that naturally contain an alanine at an analogous position within the EPSP synthase enzyme as that of the G96A mutation which was introduced into the E. coli version of the enzyme (Padgette et al., (1991); Eschenburg et al., (2002); Priestman et al., (2005); Haghani et al., (2008)).
[0138] One enzyme that was identified to contain a natural alanine at this position was DGT-28 (GENBANK ACC NO: ZP_06917240.1) from Streptomyces sviceus ATCC29083. Further in silico data mining revealed three other unique Streptomyces enzymes with greater homology to DGT-28; DGT-31 (GENBANK ACC NO: YP_004922608.1); DGT-32 (GENBANK ACC NO: ZP_04696613); and DGT-33 (GENBANK ACC NO: NC_010572). Each of these enzymes contains a natural alanine at an analogous position within the EPSP synthase enzyme as that of the G96A mutation that was introduced into the E. coli version of the enzyme.
[0139] Because EPSP synthase proteins from different organisms are of different lengths, the numbering of the mutation for the E. coli version of the EPSP synthase enzyme does not necessarily correspond with the numbering of the mutation for the EPSP synthase enzymes from the other organisms. These identified EPSP synthase enzymes were not previously characterized in regard to glyphosate tolerance or PEP substrate affinity. Furthermore, these EPSP synthase enzymes represent a new class of EPSP synthase enzymes and do not contain any sequence motifs that have been used to characterize previously described Class I (plant derived sequences further described in U.S. Pat. No. RE39247), II (bacterially derived sequences further described in U.S. Pat. No. RE39247), and III (bacterially derived sequences further described in International Patent Application WO 2006/110586) EPSP synthase enzymes.
[0140] The novel DGT-28, DGT-31, DGT-32, and DGT-33 enzymes were characterized for glyphosate tolerance and PEP substrate affinity by comparison to Class I EPSP synthase enzymes. The following Class I enzymes; DGT-1 from Glycine max, DGT-3 from Brassica napus (GENBANK ACC NO: P17688), and DGT-7 from Triticum aestivum (GENBANK ACC NO: EU977181) were for comparison. The Class I EPSP synthase enzymes and mutant variants thereof were synthesized and evaluated. A mutation introduced into the plant EPSP synthase enzymes consisted of the Glycine to Alanine mutation made within the EPSP synthase enzyme at a similar location as that of the G96A mutation from the E. coli version of the enzyme. In addition, Threonine to Isoleucine and Proline to Serine mutations were introduced within these Class I EPSP synthase enzymes at analogous positions as that of amino acid 97 (T to I) and amino acid 101 (P to S) in the EPSP synthase of E. coli as described in Funke et al., (2009).
DGT-28, DGT-31, DGT-32, and DGT-33:
[0141] The newly-designed, dicotyledonous plant optimized dgt-28 v5 polynucleotide sequence is listed in SEQ ID NO:14. The newly-designed, monocotyledonous plant optimized dgt-28 v6 polynucleotide sequence is listed in SEQ ID NO:15; this sequence was slightly modified by including an alanine at the second amino acid position to introduce a restriction enzyme site. The resulting DNA sequences have a higher degree of codon diversity, a desirable base composition, contains strategically placed restriction enzyme recognition sites, and lacks sequences that might interfere with transcription of the gene, or translation of the product mRNA.
[0142] Synthesis of DNA fragments comprising SEQ ID NO:14 and SEQ ID NO:15 containing additional sequences, such as 6-frame stops (stop codons located in all six reading frames that are added to the 3 end of the coding sequence), and a 5 restriction site for cloning were performed by commercial suppliers (DNA2.0, Menlo Park, Calif.). The synthetic nucleic acid molecule was then cloned into expression vectors and transformed into plants or bacteria as described in the Examples below.
[0143] Similar codon optimization strategies were used to design dgt-1, dgt-3 v2 (G173A), dgt-3 v3 (G173A; P178S), dgt-3 v4 (T1741; P178S), dgt-7 v4 (T1681; P172S), dgt-32 v3, dgt-33 v3, and dgt-31 v3. The codon optimized version of these genes are listed as SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, and SEQ ID NO:23, respectively.
[0144] Plant Binary Vector Construction.
[0145] Standard cloning methods were used in the construction of entry vectors containing a chloroplast transit peptide polynucleotide sequence joined to dgt-28 as an in-frame fusion. The entry vectors containing a transit peptide (TraP) fused to dgt-28 were assembled using the IN-FUSION Advantage Technology (Clontech, Mountain View, Calif.). As a result of the fusion, the first amino acid, methionine, was removed from dgt-28. Transit peptide-encoding polynucleotide sequences TraP4 v2 (SEQ ID NO:24), TraPS v2 (SEQ ID NO:25), TraP8 v2 (SEQ ID NO:26), TraP9 v2 (SEQ ID NO:27), TraP12 v2 (SEQ ID NO:28), and TraP13 v2 (SEQ ID NO:29) were each synthesized by DNA2.0 (Menlo Park, Calif.) and fused to the 5 end fragment of dgt-28, up to and including a unique AccI restriction endonuclease recognition site.
[0146] Binary plasmids which contained the various TraP and dgt-28 expression cassettes were driven by the Arabidopsis thaliana Ubiquitin 10 promoter (AtUbil0 v2; Callis, et al., (1990) J. Biol. Chem., 265: 12486-12493) and flanked by the Agrobacterium tumefaciens open reading frame twenty-three 3 untranslated region (AtuORF23 3 UTR v1; U.S. Pat. No. 5,428,147).
[0147] The assembled TraP and dgt-28 expression cassettes were engineered using GATEWAY Technology (Invitrogen, Carlsbad, Calif.) and transformed into plants via Agrobacterium-mediated plant transformation. Restriction endonucleases were obtained from New England BioLabs (NEB; Ipswich, Mass.) and T4 DNA Ligase (Invitrogen) was used for DNA ligation. Gateway reactions were performed using GATEWAY LR CLONASE enzyme mix (Invitrogen) for assembling one entry vector into a single destination vector which contained the selectable marker cassette Cassava Vein Mosaic Virus promoter (CsVMV v2; Verdaguer et al., (1996) Plant Mol. Biol., 31: 1129-1139)DSM-2 (U.S. Pat. App. No. 2007/086813)-Agrobacterium tumefaciens open reading frame one 3 untranslated region (AtuORF 1 3 UTR v6; Huang et al., (1990) J. Bacteriol. 172:1814-1822). Plasmid preparations were performed using NUCLEOSPIN Plasmid Kit (Macherey-Nagel Inc., Bethlehem, Pa.) or the Plasmid Midi Kit (Qiagen) following the instructions of the suppliers. DNA fragments were isolated using QIAquick Gel Extraction Kit (Qiagen) after agarose Tris-acetate gel electrophoresis.
[0148] Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA. Plasmid DNA of selected clones was sequenced by a commercial sequencing vendor (Eurofins MWG Operon, Huntsville, Ala.). Sequence data were assembled and analyzed using the SEQUENCHER software (Gene Codes Corp., Ann Arbor, Mich.).
[0149] The following binary constructs express the various TraP:dgt-28 fusion gene sequences: pDAB107527 contains TraP4 v2:dgt-28 v5 (SEQ ID NO:30); pDAB105530 contains TraPS v2: dgt-28 v5 (SEQ ID NO:31); pDAB105531 contains TraP8 v2: dgt-28 v5 (SEQ ID NO:32); PDAB 105532 contains TraP9 v2: dgt-28 v5 (SEQ ID NO:33); pDAB105533 contains TraP12 v2: dgt-28 v5 (SEQ ID NO:34); and pDAB105534 contains TraP13 v2:dgt-28 v5 (SEQ ID NO:35). The dgt-28 v5 sequence of pDAB105534 was modified wherein the first codon (GCA) was changed to (GCT).
[0150] Additional Plant Binary Vector Construction.
[0151] Cloning strategies similar to those described above were used to construct binary plasmids which contain dgt-31, dgt-32, dgt-33, dgt-1, dgt-3, and dgt-7.
[0152] The microbially derived genes; dgt-31, dgt-32, and dgt-33, were fused with different chloroplast transit peptides than previously described. The following chloroplast transit peptides were used; TraP14 v2 (SEQ ID NO:36), TraP23 v2 (SEQ ID NO:37), TraP24 v2 (SEQ ID NO:38). pDAB107532 contains dgt-32 v3 fused to TraP14 v2 (SEQ ID NO:39), pDAB107534 contains dgt-33 v3 fused to TraP24 v2 (SEQ ID NO:40), and pDAB107533 contains dgt-31 v3 fused to TraP23 v2 (SEQ ID NO:41). The dgt expression cassettes were driven by the Arabidopsis thaliana Ubiquitin 10 promoter (AtUbi10 promoter v2) and flanked by the Agrobacterium tumefaciens open reading frame twenty-three 3 untranslated region (AtuORF23 3 UTR v1). A DSM-2 selectable marker cassette containing Cassava Vein Mosaic Virus promoter (CsVMV v2) DSM-2Agrobacterium tumefaciens open reading frame one 3 untranslated region (AtuORF 1 3 UTR v6) was also present in the binary vector.
[0153] Additional binaries are constructed wherein dgt-31 v3, dgt-32 v3, and dgt-33 v3 are fused to the previously described chloroplast transit peptide sequences. For example, the TraP8 v2 sequence is fused to dgt-31 v3, dgt-32 v3, and dgt-33 v3, and cloned into binary vectors as described above.
[0154] Binary vectors containing the Class I genes (dgt-1, dgt-3, and dgt-7) were constructed. The following binary vectors were constructed and transformed into plants: pDAB4104, which contains the dgt-1 v4 sequence as described in U.S. Patent Application Publication No. 2011/0124503, which is flanked by the Nicotiana tabacum Osmotin sequences as described in U.S. Patent Application Publication No. 2009/0064376; pDAB102715; pDAB102716; pDAB102717; and pDAB102785. The various TraP chloroplast transit peptides that were fused to dgt-28, dgt-31, dgt-32, and dgt-33 were not added to the Class I genes, as these plant derived sequences possess native plant chloroplast transit peptides. These vectors are described in further detail in Table 1.
TABLE-US-00001 TABLE 1 Description of the binary vectors which contain a Class I EPSP synthase gene (i.e., dgt-1, dgt-3, or dgt-7). EPSPS Name Description mutation pDAB4104 RB7 MAR v2 :: CsVMV promoter v2/NtOsm 5 UTR v2/ TI PS dgt-1 v4/NtOsm 3 UTR v2/AtuORF24 3 UTR v2 :: AtUbi10 promoter v4/pat v3/AtuORF1 3UTR v3 binary vector pDAB102715 AtUbi10 promoter v2/dgt-3 v2/AtuORF23 3UTR v1 :: GA CsVMV promoter v2/pat v9/AtuORF1 3UTR v6 binary vector pDAB102716 AtUbi10 promoter v2/dgt-3 v3/AtuORF23 3UTR v1 :: GA PS CsVMV promoter v2/pat v9/AtuORF1 3UTR v6 binary vector pDAB102717 AtUbi10 promoter v2/dgt-3 v4/AtuORF23 3UTR v1 :: TI PS CsVMV promoter v2/pat v9/AtuORF1 3UTR v6 binary vector pDAB102785 AtUbi10 promoter v2/dgt-7 v4/AtuORF23 3UTR :: CsVMV TI PS promoter v2/DSM-2 v2/AtuORF1 3UTR v6 binary vector
[0155] Arabidopsis thaliana Transformation.
[0156] Arabidopsis was transformed using the floral dip method from Clough and Bent (1998). A selected Agrobacterium colony containing one of the binary plasmids described above was used to inoculate one or more 100 mL pre-cultures of YEP broth containing spectinomycin (100 mg/L) and kanamycin (50 mg/L). The culture was incubated overnight at 28 C. with constant agitation at 225 rpm. The cells were pelleted at approximately 5000g for 10 minutes at room temperature, and the resulting supernatant discarded. The cell pellet was gently resuspended in 400 mL dunking media containing: 5% (w/v) sucrose, 10 g/L 6-benzylaminopurine, and 0.04% Silwet L-77. Plants approximately 1 month old were dipped into the media for 5-10 minutes with gentle agitation. The plants were laid down on their sides and covered with transparent or opaque plastic bags for 2-3 hours, and then placed upright. The plants were grown at 22 C., with a 16-hour light/8-hour dark photoperiod. Approximately 4 weeks after dipping, the seeds were harvested.
[0157] Selection of Transformed Plants.
[0158] Freshly harvested T.sub.1 seed [containing the dgt and DSM-2 expression cassettes] was allowed to dry for 7 days at room temperature. T.sub.1 seed was sown in 26.551-cm germination trays, each receiving a 200 mg aliquot of stratified T.sub.1 seed (10,000 seed) that had previously been suspended in 40 mL of 0.1% agarose solution and stored at 4 C. for 2 days to complete dormancy requirements and ensure synchronous seed germination.
[0159] Sunshine Mix LP5 was covered with fine vermiculite and subirrigated with Hoagland's solution until wet, then allowed to gravity drain. Each 40 mL aliquot of stratified seed was sown evenly onto the vermiculite with a pipette and covered with humidity domes for 4-5 days. Domes were removed 1 day prior to initial transformant selection using glufosinate postemergence spray (selecting for the co-transformed DSM-2 gene).
[0160] Seven days after planting (DAP) and again 11 DAP, T.sub.1 plants (cotyledon and 2-4-1f stage, respectively) were sprayed with a 0.2% solution of Liberty herbicide (200 g ai/L glufosinate, Bayer Crop Sciences, Kansas City, Mo.) at a spray volume of 10 mL/tray (703 L/ha) using a DeVilbiss compressed air spray tip to deliver an effective rate of 280 g ai/ha glufosinate per application. Survivors (plants actively growing) were identified 4-7 days after the final spraying and transplanted individually into 3-inch pots prepared with potting media (Metro Mix 360). Transplanted plants were reared in the greenhouse (225 C., 5030% RH, 14 h light:10 dark, minimum 500 E/m.sup.2s.sup.1 natural+supplemental light). Molecular confirmation analysis was completed on the surviving T.sub.1 plants to confirm that the glyphosate tolerance gene had stably integrated into the genome of the plants.
[0161] Molecular Confirmation.
[0162] The presence of the dgt-28 and DSM-2 transgenes within the genome of Arabidopsis plants that were transformed with pDAB107527, pDAB105530, pDAB105531, pDAB105532, pDAB105533, or pDAB105534 was confirmed. The presence of these polynucleotide sequences was confirmed via hydrolysis probe assays, gene expression cassette PCR (also described as plant transcription unit PCR PTU PCR), Southern blot analysis, and Quantitative Reverse Transcription PCR analyses.
[0163] The T.sub.1 Arabidopsis plants were initially screened via a hydrolysis probe assay, analogous to TAQMAN, to confirm the presence of the DSM-2 and dgt-28 transgenes. Events were screened via gene expression cassette PCR to determine whether the dgt expression cassette completely integrated into the plant genomes without rearrangement. The data generated from these studies were used to determine the transgene copy number and identify select Arabidopsis events for self fertilization and advancement to the T.sub.2 generation. The advanced T.sub.2 Arabidopsis plants were also screened via hydrolysis probe assays to confirm the presence and to estimate the copy number of the DSM-2 and dgt genes within the plant chromosome. Finally, a Southern blot assay was used to confirm the estimated copy number on a subset of the T.sub.1 Arabidopsis plants.
[0164] Similar assays were used to confirm the presence of the dgt-1 transgene from plants transformed with pDAB4104, the presence of the dgt-32 transgene from plants transformed with pDAB107532, the presence of the dgt-33 transgene from plants transformed with pDAB107534, the presence of the dgt-31 transgene from plants transformed with pDAB107533, the presence of the dgt-3 transgene from plants transformed with pDAB102715, the presence of the dgt-3 transgene from plants transformed with pDAB102716, the presence of the dgt-3 transgene from plants transformed with pDAB102717, and the presence of the dgt-7 transgene from plants transformed with pDAB102785.
[0165] Hydrolysis Probe Assay.
[0166] Copy number was determined in the T.sub.1 and T.sub.2 Arabidopsis plants using the hydrolysis probe assay described below. Plants with varying numbers of transgenes were identified and advanced for subsequent glyphosate tolerance studies.
[0167] Tissue samples were collected in 96-well plates and lyophilized for 2 days. Tissue maceration was performed with a KLECO tissue pulverizer and tungsten beads (Environ Metal INC., Sweet Home, Oreg.). Following tissue maceration, the genomic DNA was isolated in high-throughput format using the Biosprint 96 Plant kit (Qiagen, Germantown, Md.) according to the manufacturer's suggested protocol. Genomic DNA was quantified by QUANT-IT PICO GREEN DNA ASSAY KIT (Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified genomic DNA was adjusted to around 2 ng/L for the hydrolysis probe assay using a BIOROBOT3000 automated liquid handler (Qiagen, Germantown, Md.). Transgene copy number determination by hydrolysis probe assay was performed by real-time PCR using the LIGHTCYCLER480 system (Roche Applied Science, Indianapolis, Ind.). Assays were designed for DSM-2, dgt-28 and the internal reference gene, TAFIIJ5 (Genbank ID: NC 003075; Duarte et al., (201) BMC Evol. Biol., 10:61).\
[0168] For amplification, LIGHTCYCLER480 Probes Master mix (Roche Applied Science, Indianapolis, Ind.) was prepared at a 1 final concentration in a 10 L volume multiplex reaction containing 0.1 M of each primer for DSM-2 and dgt-28, 0.4 M of each primer for TAFIIJ5 and 0.2 M of each probe. Table 2. A two-step amplification reaction was performed with an extension at 60 C. for 40 seconds with fluorescence acquisition. All samples were run and the averaged Cycle threshold (Ct) values were used for analysis of each sample. Analysis of real time PCR data was performed using LightCycler software release 1.5 using the relative quant module and is based on the Ct method. For this, a sample of genomic DNA from a single copy calibrator and known 2 copy check were included in each run. The copy number results of the hydrolysis probe screen were determined for the T.sub.1 and T.sub.2 transgenic Arabidopsis plants.
TABLE-US-00002 TABLE2 PrimerandprobeInformationforhydrolysisprobe assayofDSM-2,dgt-28andinternalreference gene(TAFII15). PrimerName Sequence DSM2A 5 AGCCACATCCCAGTAACGA3 (SEQIDNO:42) DSM2S 5 CCTCCCTCTTTGACGCC3 (SEQIDNO:43) DSM2Cy5probe 5 CAGCCCAATGAGGCATCAGC3 (SEQIDNO:44) DGT28F 5 CTTCAAGGAGATTTGGGATTTGT3 (SEQIDNO:45) DGT28R 5 GAGGGTCGGCATCGTAT3 (SEQIDNO:46) UPL154probe Cat# 04694406001 (Roche,Indianapolis,IN) TAFFY-HEXprobe 5 AGAGAAGTTTCGACGGATTTCGGGC3 (SEQIDNO:47) TAFII15-F 5 GAGGATTAGGGTTTCAACGGAG3 (SEQIDNO:48) TAFII15-R 5 GAGAATTGAGCTGAGACGAGG3 (SEQIDNO:49)
[0169] Dgt-28 Integration Confirmation Via Southern Blot Analysis.
[0170] Southern blot analysis was used to establish the integration pattern of the inserted T-strand DNA fragment and identify events which contained dgt-28. Data were generated to demonstrate the integration and integrity of the transgene inserts within the Arabidopsis genome. Southern blot data were used to identify simple integration of an intact copy of the T-strand DNA. Detailed Southern blot analysis was conducted using a PCR amplified probe specific to the dgt-28 gene expression cassette. The hybridization of the probe with genomic DNA that had been digested with specific restriction enzymes identified genomic DNA fragments of specific molecular weights, the patterns of which were used to identify full length, simple insertion T.sub.1 transgenic events for advancement to the next generation.
[0171] Tissue samples were collected in 2 mL conical tubes (Eppendorf) and lyophilized for 2 days. Tissue maceration was performed with a KLECKO tissue pulverizer and tungsten beads. Following tissue maceration, the genomic DNA was isolated using a CTAB isolation procedure. The genomic DNA was further purified using the Qiagen Genomic Tips kit. Genomic DNA was quantified by Quant-IT Pico Green DNA assay kit (Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified genomic DNA was adjusted to 4 g for a consistent concentration.
[0172] For each sample, 4 g of genomic DNA was thoroughly digested with the restriction enzyme SwaI (New England Biolabs, Beverley, Mass.) and incubated at 25 C. overnight, then NsiI was added to the reaction and incubated at 37 C. for 6 hours. The digested DNA was concentrated by precipitation with Quick Precipitation Solution (Edge Biosystems, Gaithersburg, Md.) according to the manufacturer's suggested protocol. The genomic DNA was then resuspended in 25 L of water at 65 C. for 1 hour. Resuspended samples were loaded onto a 0.8% agarose gel prepared in 1TAE and electrophoresed overnight at 1.1 V/cm in 1TAE buffer. The gel was sequentially subjected to denaturation (0.2 M NaOH/0.6 M NaCl) for 30 minutes, and neutralization (0.5 M Tris-HCl (pH 7.5)/1.5 M NaCl) for 30 minutes.
[0173] Transfer of DNA fragments to nylon membranes was performed by passively wicking 20SSC solution overnight through the gel onto treated IMMOBILON NY+ transfer membrane (Millipore, Billerica, Mass.) by using a chromatography paper wick and paper towels. Following transfer, the membrane was briefly washed with 2SSC, cross-linked with the STRATALINKER 1800 (Stratagene, LaJolla, Calif.), and vacuum baked at 80 C. for 3 hours.
[0174] Blots were incubated with pre-hybridization solution (Perfect Hyb plus, Sigma, St. Louis, Mo.) for 1 hour at 65 C. in glass roller bottles using a model 400 hybridization incubator (Robbins Scientific, Sunnyvale, Calif.). Probes were prepared from a PCR fragment containing the entire coding sequence. The PCR amplicon was purified using QIAEX II gel extraction kit and labeled with .sup.32P-dCTP via the Random RT Prime IT labeling kit (Stratagene, La Jolla, Calif.). Blots were hybridized overnight at 65 C. with denatured probe added directly to hybridization buffer to approximately 2 million counts per blot per mL. Following hybridization, blots were sequentially washed at 65 C. with 0.1SSC/0.1% SDS for 40 minutes. Finally, the blots were exposed to storage phosphor imaging screens and imaged using a Molecular Dynamics Storm 860 imaging system.
[0175] The Southern blot analyses completed in this study were used to determine the copy number and confirm that selected events contained the dgt-28 transgene within the genome of Arabidopsis.
[0176] Dgt-28 Gene Expression Cassette Confirmation Via PCR Analysis.
[0177] The presence of the dgt-28 gene expression cassette contained in the T.sub.1 plant events was detected by an end point PCR reaction. Primers (Table 3) specific to the AtUbi 10 promoter v2 and AtuORF23 3UTR v1 regions of the dgt-28 gene expression cassette were used for detection.
TABLE-US-00003 TABLE3 Oligonucleotideprimersusedfordgt-28gene expressioncassetteconfirmation. PrimerName Sequence Forwardoligo 5 CTGCAGGTCAACGGATCAGGATAT3 (SEQIDNO:50) Reverseoligo 5 TGGGCTGAATTGAAGACATGCTCC3 (SEQIDNO:51)
[0178] The PCR reactions required a standard three step PCR cycling protocol to amplify the gene expression cassette. All of the PCR reactions were completed using the following PCR conditions: 94 C. for three minutes followed by 35 cycles of 94 C. for thirty seconds, 60 C. for thirty seconds, and 72 C. for three minutes. The reactions were completed using the EX-TAQ PCR kit (TaKaRa Biotechnology Inc. Otsu, Shiga, Japan) per manufacturer's instructions. Following the final cycle, the reaction was incubated at 72 C. for 10 minutes. TAE agarose gel electrophoresis was used to determine the PCR amplicon size. PCR amplicons of an expected size indicated the presence of a full length gene expression cassette was present in the genome of the transgenic Arabidopsis events.
[0179] Dgt-28 Relative Transcription Confirmation Via Quantitative Reverse Transcription PCR Analysis.
[0180] Tissue samples of dgt-28 transgenic plants were collected in 96-well plates and frozen at 80 C. Tissue maceration was performed with a KLECO tissue pulverizer and tungsten beads (Environ Metal INC., Sweet Home, Oreg.). Following tissue maceration, the Total RNA was isolated in high-throughput format using the Qiagen Rneasy 96 kit (Qiagen Germantown, Md.) according to the manufacturer's suggested protocol which included the optional Dnasel treatment on the column. This step was subsequently followed by an additional Dnasel (Ambion, Austin, Tex.) treatment of the eluted total RNA. cDNA synthesis was carried out using the total RNA as template with the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Austin, Tex.) following the manufacturer's suggested procedure with the addition of the oligonucleotide, TVN. Quantification of expression was completed by hydrolysis probe assay and was performed by real-time PCR using the LIGHTCYCLER480 system (Roche Applied Science, Indianapolis, Ind.). Assays were designed for dgt-28 and the internal reference gene unknown protein (Genbank Accession Number: AT4G24610) using the LIGHTCYCLER Probe Design Software 2.0. For amplification, LIGHTCYCLER480 Probes Master mix (Roche Applied Science, Indianapolis, Ind.) was prepared at 1final concentration in a 10 L volume singleplex reaction containing 0.4 M of each primer, and 0.2 M of each probe. Table 4.
TABLE-US-00004 TABLE4 PCRprimersusedforquantitativereverse transcriptionPCRanalysisofdgt-28. PrimerName Sequence AT26410LP 5 CGTCCACAAAGCTGAATGTG3 (SEQIDNO:52) AT26410RP 5 CGAAGTCATGGAAGCCACTT3 (SEQIDNO:53) UPL146 Cat# 04694325001 (Roche,Indianapolis,IN) DGT28F 5 CTTCAAGGAGATTTGGGATTTGT3 (SEQIDNO:54) DGT28R 5 GAGGGTCGGCATCGTAT3 SEQ(IDNO:55) UPL154probe Cat# 04694406001 (Roche,Indianapolis,IN)
[0181] A two-step amplification reaction was performed with an extension at 60 C. for 40 seconds with fluorescence acquisition. All samples were run in triplicate and the averaged Cycle threshold (Ct) values were used for analysis of each sample. A minus reverse transcription reaction was run for each sample to ensure that no gDNA contamination was present. Analysis of real time PCR data was performed based on the Ct method. This assay was used to determine the relative expression of dgt-28 in transgenic Arabidopsis events which were determined to be hemizygous and homozygous. The relative transcription levels of the dgt-28 mRNA ranged from 2.5 fold to 207.5 fold higher than the internal control. These data indicate that dgt-28 transgenic plants contained a functional dgt-28 gene expression cassette, and the plants were capable of transcribing the dgt-28 transgene.
[0182] Western Blotting Analysis.
[0183] DGT-28 was detected in leaf samples obtained from transgenic Arabidopsis thaliana plants. Plant extracts from dgt-28 transgenic plants and DGT-28 protein standards were incubated with NUPAGE LDS sample buffer (Invitrogen, Carlsbad, Calif.) containing DTT at 90 C. for 10 minutes and electrophoretically separated in an acrylamide precast gel. Proteins were then electro-transferred onto nitrocellulose membrane using the manufacturer's protocol. After blocking with the WESTERNBREEZE Blocking Mix (Invitrogen) the DGT-28 protein was detected by anti-DGT-28 antiserum followed by goat anti-rabbit phosphatase. The detected protein was visualized by chemiluminescence substrate BCIP/NBT Western Analysis Reagent (KPL, Gaithersburg, Md.). Production of an intact DGT-28 protein via Western blot indicated that the dgt-28 transgenic plants which were assayed expressed the DGT-28 protein.
[0184] Transgenic T.sub.1 Arabidopsis plants containing the dgt-28 transgene were sprayed with differing rates of glyphosate. Elevated rates were applied in this study to determine the relative levels of resistance (105, 420, 1,680 or 3,360 g ae/ha). A typical 1usage rate of glyphosate that will control non-transformed Arabidopsis is 420 g ae/ha. Glyphosate formulations with the addition of ammonium sulfate were applied to the T.sub.1 plants with a track sprayer calibrated at 187 L/ha. The T.sub.1 Arabidopsis plants that were used in this study were variable copy number for the dgt-28 transgene. The low copy dgt-28 T.sub.1 Arabidopsis plants were self-pollinated and used to produce T.sub.2 plants. Table 5 shows the comparison of dgt-28 transgenic plants, drawn to a glyphosate herbicide resistance gene, dgt-1, and wildtype controls. Table 6 shows the comparison of dgt-32, and dgt-33 drawn to a glyphosate herbicide resistance gene, dgt-1, and wildtype controls. Table 7 shows the comparison of the novel bacterial EPSP synthase enzymes to the Class I EPSP synthase enzymes and the controls at a glyphosate rate of 1,680 g ae/ha.
[0185] Results of Glyphosate Selection of Transformed Dgt-28 Arabidopsis Plants.
[0186] The Arabidopsis T.sub.1 transformants were first selected from the background of untransformed seed using a glufosinate selection scheme. Three flats or 30,000 seed were analyzed for each T.sub.1 construct. The T.sub.1 plants selected above were molecularly characterized and representative plants with variable copy number were subsequently transplanted to individual pots and sprayed with various rates of commercial glyphosate as previously described. The response of these plants is presented in terms of % visual injury 2 weeks after treatment (WAT). Data are presented in a table which shows individual plants exhibiting little or no injury (<20%), moderate injury (20-40%), or severe injury (>40%). An arithmetic mean and standard deviation is presented for each construct used for Arabidopsis transformation. The range in individual response is also indicated in the last column for each rate and transformation. Wild-type, non-transformed Arabidopsis (c.v.. Columbia) served as a glyphosate sensitive control.
[0187] The level of plant response varied. This variance can be attributed to the fact each plant represents an independent transformation event and thus the copy number of the gene of interest varies from plant to plant. It was noted that some plants which contained the transgene were not tolerant to glyphosate; a thorough analysis to determine whether these plants expressed the transgene was not completed. It is likely that the presence of high copy numbers of the transgene within the T.sub.1 Arabidopsis plants resulted in transgene silencing or other epigenetic effects which resulted in sensitivity to glyphosate, despite the presence of the dgt-28 transgene.
[0188] An overall population injury average by rate is presented in Table 7 for rates of glyphosate at 1,680 g ae/ha to demonstrate the significant difference between the plants transformed with dgt-3, dgt-7, dgt-28, dgt-32, and dgt-33 versus the dgt-1 and wild-type controls.
[0189] The tolerance provided by the novel bacterial EPSP synthases varied depending upon the specific enzyme. DGT-28, DGT-32, and DGT-33 unexpectedly provided significant tolerance to glyphosate. The dgt genes imparted herbicide resistance to individual T.sub.1 Arabidopsis plants across all transit peptides tested. As such, the use of additional chloroplast transit peptides (i.e., TraP8-dgt-32 or TraP8-dgt-33) would provide protection to glyphosate with similar injury levels as reported within a given treatment.
TABLE-US-00005 TABLE 5 dgt-28 transformed T.sub.1 Arabidopsis response to a range of glyphosate rates applied postemergence, compared to a dgt-1 (T.sub.4) homozygous resistant population, and a non- transformed control. Visual % injury 14 days after application. % Injury % Injury Std Range Averages <20% 20-40% >40% Ave dev (%) pDAB107527: TraP4 v2 -dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 4 0 0 3.8 7.5 0-15 420 g ae/ha glyphosate 2 1 1 28.8 28.1 0-65 1680 g ae/ha glyphosate 0 2 2 55.0 26.8 35-85 3360 g ae/ha glyphosate 0 2 2 43.8 18.0 30-70 pDAB105530: TraP5 v2 -dgt-28 v5 0 g ae/ha glyphosate 6 0 0 0.0 0.0 0 105 g ae/ha glyphosate 2 2 2 39.3 37.4 8-100 420 g ae/ha glyphosate 1 4 1 33.0 26.6 8-85 1680 g ae/ha glyphosate 0 4 2 47.5 27.5 25-85 3360 g ae/ha glyphosate 0 0 6 76.7 13.7 50-85 pDAB105531: TraP8 v2 -dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 3 1 0 10.8 10.4 0-25 420 g ae/ha glyphosate 3 0 1 22.8 18.6 8-50 1680 g ae/ha glyphosate 4 0 0 5.3 3.8 0-8 3360 g ae/ha glyphosate 0 4 0 29.3 6.8 22-35 pDAB105532: TraP9 v2 -dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 3 0 1 17.5 28.7 0-60 420 g ae/ha glyphosate 1 1 2 39.5 25.1 18-70 1680 g ae/ha glyphosate 3 0 1 26.3 36.1 5-80 3360 g ae/ha glyphosate 3 0 1 25.8 32.9 8-75 pDAB105533: TraP12 v2 -dgt-28 v5 0 g ae/ha glyphosate 5 0 0 0.0 0.0 0 105 g ae/ha glyphosate 4 1 0 10.0 10.0 0-25 420 g ae/ha glyphosate 1 1 3 53.6 34.6 8-85 1680 g ae/ha glyphosate 4 1 0 11.0 8.2 0-20 3360 g ae/ha glyphosate 0 2 3 55.0 25.5 25-80 pDAB105534: TraP13 v2 -dgt-28 v5 0 g ae/ha glyphosate 5 0 0 0.0 0.0 0 105 g ae/ha glyphosate 4 0 1 14.0 20.6 0-50 420 g ae/ha glyphosate 3 1 1 17.6 19.5 0-50 1680 g ae/ha glyphosate 3 0 2 39.0 47.1 5-100 3360 g ae/ha glyphosate 2 2 1 31.2 22.3 18-70 pDAB4104: dgt-1 (transformed control) 0 g ae/ha glyphosate 5 0 0 0.0 0.0 0 105 g ae/ha glyphosate 0 0 4 80.0 0.0 80 420 g ae/ha glyphosate 0 0 4 80.0 0.0 80 1680 g ae/ha glyphosate 0 0 4 80.0 0.0 80 3360 g ae/ha glyphosate 0 0 4 81.3 2.5 80-85 WT (non-transformed control) 0 g ae/ha glyphosate 5 0 0 0.0 0.0 0 105 g ae/ha glyphosate 0 0 4 100.0 0.0 100 420 g ae/ha glyphosate 0 0 4 100.0 0.0 100 1680 g ae/ha glyphosate 0 0 4 100.0 0.0 100 3360 g ae/ha glyphosate 0 0 4 100.0 0.0 100
TABLE-US-00006 TABLE 6 dgt-32, and dgt-33 transformed T.sub.1 Arabidopsis response to a range of glyphosate rates applied postemergence, compared to a dgt-1 (T.sub.4) homozygous resistant population, and a non- transformed control. Visual % injury 14 days after application. % Injury % Injury Averages <20% 20-40% >40% Ave Std dev Range (%) pDAB107532: TraP14 v2 - dgt-32 v3 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha glyphosate 2 0 2 30.0 29.4 0-60 1680 g ae/ha glyphosate 3 0 1 17.5 21.8 5-50 3360 g ae/ha glyphosate 0 3 1 35.0 30.0 20-80 pDAB107534: TraP24 v2 - dgt-33 v3 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 2 2 0 21.3 14.9 5-40 420 g ae/ha glyphosate 1 1 2 46.3 30.9 5-70 1680 g ae/ha glyphosate 1 0 3 62.5 38.8 5-90 3360 g ae/ha glyphosate 1 0 3 62.0 36.0 8-80 pDAB4104: dgt-1 (transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 0 2 3 42.5 15.0 20-50 420 g ae/ha glyphosate 0 1 2 38.8 11.1 25-50 1680 g ae/ha glyphosate 0 0 4 79.0 19.4 50-90 3360 g ae/ha glyphosate 0 0 4 50.0 0.0 50 WT (non-transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha glyphosate 0 0 4 85.0 0.0 85 420 g ae/ha glyphosate 0 0 4 100.0 0.0 100 1680 g ae/ha glyphosate 0 0 4 100.0 0.0 100 3360 g ae/ha glyphosate 0 0 4 100.0 0.0 100
TABLE-US-00007 TABLE 7 dgt-28, dgt-32, dgt-33, dgt-3, and dgt-7 transformed T.sub.1 Arabidopsis response to glyphosate applied postemergence at 1,680 g ae/ha, compared to a dgt-1 (T.sub.4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. % Injury % Injury <20% 20-40% >40% Ave Std dev Range (%) Bacterial pDAB107527 TraP4 v2 - 0 2 2 55.0 26.8 35-85 Enzymes dgt-28 v5 pDAB105530 TraP5 v2 - dgt- 0 4 2 47.5 27.5 25-85 28 v5 pDAB105531 TraP8 v2 - dgt- 4 0 0 5.3 3.8 0-8 28 v5 pDAB105532 TraP9 v2 - dgt- 3 0 1 26.3 36.1 5-80 28 v5 pDAB105533 Trap12 v2 - 4 1 0 11.0 8.2 0-20 dgt-28 v5 pDAB105534 TraP13 v2 - 3 0 2 39.0 47.1 5-100 dgt-28 v5 pDAB107532 TraP14 v2 - 3 0 1 17.5 21.8 5-50 dgt-32 v3 pDAB107534 TraP24 v2 - 1 0 3 62.5 38.8 5-90 dgt-33 v3 Class I pDAB102715 dgt-3 v2 4 0 3 42 48 0-100 Enzymes pDAB102716 dgt-3 v3 2 1 0 14 23 0-40 pDAB102717 dgt-3 v4 3 2 1 28 35 10-100 pDAB102785 dgt-7 v4 0 1 1 45 21 30-60 pDAB4104 dgt-1 0 0 4 80.0 0.0 80 (transformed control) WT (non- 0 0 4 100.0 0.0 100 transformed control)
[0190] Dgt-28 as a Selectable Marker.
[0191] The use of dgt-28 as a selectable marker for glyphosate selection agent is tested with the Arabidopsis transformed plants described above. Approximately 50 T4 generation Arabidopsis seed (homozygous for dgt-28) are spiked into approximately 5,000 wildtype (sensitive to glyphosate) seed. The seeds are germinated and plantlets are sprayed with a selecting dose of glyphosate. Several treatments of glyphosate are compared; each tray of plants receives either one or two application timings of glyphosate in one of the following treatment schemes: 7 DAP (days after planting), 11 DAP, or 7 followed by 11 DAP. Since all plants also contain a glufosinate resistance gene in the same transformation vector, dgt-28 containing plants selected with glyphosate can be directly compared to DSM-2 or pat containing plants selected with glufosinate.
[0192] Glyphosate treatments are applied with a DeVilbiss spray tip as previously described. Transgenic plants containing dgt-28 are identified as resistant or sensitive 17 DAP. Treatments of 26.25-1680 g ae/ha glyphosate applied 7 and 11 days after planting (DAP), show effective selection for transgenic Arabidopsis plants that contain dgt-28. Sensitive and resistant plants are counted and the number of glyphosate tolerant plants is found to correlate with the original number of transgenic seed containing the dgt-28 transgene which are planted. These results indicate that dgt-28 can be effectively used as an alternative selectable marker for a population of transformed Arabidopsis.
[0193] Heritability.
[0194] Confirmed transgenic T.sub.1 Arabidopsis events were self-pollinated to produce T.sub.2 seed. These seed were progeny tested by applying Ignite herbicide containing glufosinate (200 g ae/ha) to 100 random T.sub.2 siblings. Each individual T.sub.2 plant was transplanted to 7.5-cm square pots prior to spray application (track sprayer at 187 L/ha applications rate). The T.sub.1 families (T.sub.2 plants) segregated in the anticipated 3 Resistant: 1 Sensitive model for a dominantly inherited single locus with Mendelian inheritance as determined by Chi square analysis (P>0.05). The percentage of T.sub.1 families that segregated with the expected Mendelian inheritance are illustrated in Table 8, and demonstrate that the dgt-28 trait is passed via Mendelian inheritance to the T.sub.2 generation. Seed were collected from 5 to 15 T.sub.2 individuals (T3 seed). Twenty-five T3 siblings from each of 3-4 randomly-selected T.sub.2 families were progeny tested as previously described. Data showed no segregation and thus demonstrated that dgt-28 and dgt-3 are stably integrated within the chromosome and inherited in a Mendelian fashion to at least three generations.
TABLE-US-00008 TABLE 8 Percentage of T.sub.1 families (T.sub.2 plants) segregating as single Mendelian inheritance for a progeny test of 100 plants. T1 Families Tested Gene of Interest Segregating at 1 Locus (%) dgt-3 v2 64% dgt-3 v3 60% dgt-3 v4 80% dgt-7 v4 63% TraP5 v2 - dgt-28 v5 100% TraP8 v2 - dgt-28 v5 100% TraP9 v2 - dgt-28 v5 100% TraP12 v2 - dgt-28 v5 50% TraP13 v2 - dgt-28 v5 75% yfp Transgenic Control 100% Plants
[0195] T.sub.2 Arabidopsis Data.
[0196] The second generation plants (T.sub.2) of selected T.sub.1 Arabidopsis events which contained low copy numbers of the dgt-28 transgene were further characterized for glyphosate tolerance. Glyphosate was applied as described previously. The response of the plants is presented in terms of % visual injury 2 weeks after treatment (WAT). Data are presented as a histogram of individuals exhibiting little or no injury (<20%), moderate injury (20-40%), or severe injury (>40%). An arithmetic mean and standard deviation are presented for each construct used for Arabidopsis transformation. The range in individual response is also indicated in the last column for each rate and transformation. Wild-type, non-transformed Arabidopsis (cv. Columbia) served as a glyphosate sensitive control. In the T.sub.2 generation hemizygous and homozygous plants were available for testing for each event and therefore were included for each rate of glyphosate tested. Hemizygous plants contain two different alleles at a locus as compared to homozygous plants which contain the same two alleles at a locus. Variability of response to glyphosate is expected in the T.sub.2 generation as a result of the difference in gene dosage for hemizygous as compared to homozygous plants. The variability in response to glyphosate is reflected in the standard deviation and range of response.
[0197] In the T.sub.2 generation both single copy and multi-copy dgt-28 events were characterized for glyphosate tolerance. Within an event, single copy plants showed similar levels of tolerance to glyphosate. Characteristic data for a single copy T.sub.2 event are presented in Table 9. Events containing dgt-28 linked with TraP5 v2 did not provide robust tolerance to glyphosate as compared with the dgt-28 constructs which contained other TraP transit peptides. However, the dgt-28 TraP5 constructs did provide a low level of glyphosate tolerance as compared to the non-transformed Columbia control. There were instances when events that were shown to contain two or more copies of dgt-28 were more susceptible to elevated rates of glyphosate (data not shown). This increase in sensitivity to glyphosate is similar to the data previously described for the T.sub.1 plants which also contained high copy numbers of the dgt-28 transgene. It is likely that the presence of high copy numbers of the transgene within the Arabidopsis plants result in transgene silencing or other epigenetic effects which resulted in sensitivity to glyphosate, despite the presence of the dgt-28 transgene.
[0198] These events contained dgt-28 linked with TraP5 v2 (pDAB105530), TraP12 v2 (pDAB105533) and TraP13 v2 (pDAB105534).
[0199] In addition to dgt-28, T.sub.2 Arabidopsis events transformed with dgt-3 are presented in Table 10. As described for the dgt-28 events in Table 9, the data table contains a representative event that is characteristic of the response to glyphosate for each construct. For the dgt-3 characterization, constructs containing a single PTU (plant transformation unit) with the dgt-3 gene being driven by the AtUbi 10 promoter (pDAB102716 and pDAB102715) were compared to constructs with the same gene containing 2 PTUs of the gene (pDAB102719, pDAB102718). The constructs which contained 2 PTU used the AtUbi 10 promoter to drive one copy of the gene and the CsVMV promoter to drive the other copy. The use of the double PTU was incorporated to compare the dgt-3 transgenic plants with dgt-28 transgenic plants which contained two copies of the transgene. Data demonstrated that single copy T.sub.2 dgt-3 events with only a single PTU were more susceptible to glyphosate than single copy dgt-28 events tested, but were more tolerant than the non-transformed control. T.sub.1 families containing 2 PTUs of the dgt-3 gene provided a higher level of visual tolerance to glyphosate compared to the 1 PTU constructs. In both instances the T.sub.1 families were compared to the dgt-1 and wildtype controls. T.sub.2 data demonstrate that dgt-28 provides robust tolerance as single copy events.
TABLE-US-00009 TABLE 9 Response of selected individual T.sub.2 Arabidopsis events containing dgt-28 to glyphosate applied postemergence at varying rates, compared to a dgt-1 (T.sub.4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. % Injury % Injury Range 1 copy <20% 20-40% >40% Ave Std dev (%) pDAB105530: TraP5 v2 - dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 0 0 4 75.0 17.8 50-90 glyphosate 840 g ae/ha 0 0 4 80.0 20.0 50-90 glyphosate 1680 g ae/ha 0 0 4 75.0 10.8 60-85 glyphosate 3360 g ae/ha 0 0 4 76.3 4.8 70-80 glyphosate pDAB105531: TraP8 v2 - dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 4 0 0 0.5 1.0 0-2 glyphosate 840 g ae/ha 4 0 0 1.3 2.5 0-5 glyphosate 1680 g ae/ha 4 0 0 7.5 5.0 5-15 glyphosate 3360 g ae/ha 4 0 0 7.5 6.5 0-15 glyphosate pDAB105532: TraP9 v2 - dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 4 0 0 2.0 4.0 0-8 glyphosate 840 g ae/ha 4 0 0 9.0 2.0 8-12 glyphosate 1680 g ae/ha 4 0 0 7.3 4.6 2-12 glyphosate 3360 g ae/ha 4 0 0 11.0 1.2 10-12 glyphosate pDAB105533: TraP12 v2 - dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 840 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 1680 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 3360 g ae/ha 3 1 0 13.3 7.9 8-25 glyphosate pDAB105534: TraP13 v2 - dgt-28 v5 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 3 1 0 5.0 10.0 0-20 glyphosate 840 g ae/ha 3 1 0 5.0 10.0 0-20 glyphosate 1680 g ae/ha 2 2 0 10.0 11.5 0-20 glyphosate 3360 g ae/ha 2 2 0 15.0 12.2 5-30 glyphosate WT (non-transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 840 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 1680 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 3360 g ae/ha 0 0 4 100.0 0.0 100 glyphosate pDAB4104: dgt-1 (transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 0 4 0 37.5 2.9 35-40 glyphosate 840 g ae/ha 0 0 4 45.0 0.0 45 glyphosate 1680 g ae/ha 0 0 4 47.5 2.9 45-50 glyphosate 3360 g ae/ha 0 0 4 50.0 0.0 50 glyphosate
TABLE-US-00010 TABLE 10 Response of selected T.sub.2 Arabidopsis events transformed with dgt-3 to glyphosate applied postemergence at varying rates. Visual % injury 14 days after application. % Injury % Injury 1 copy seg <20% 20-40% >40% Ave Std dev Range (%) pDAB102716: dgt-3 v3 (1 PTU) 0 g ae/ha glyphosate 4 0 0 0 0 0 420 g ae/ha 1 1 2 39 25 15-65 glyphosate 840 g ae/ha 0 2 2 50 23 30-70 glyphosate 1680 g ae/ha 0 1 3 69 19 40-80 glyphosate 3360 g ae/ha 0 0 4 79 6 70-85 glyphosate pDAB102719: dgt-3 v3 (2 PTU) 0 g ae/ha glyphosate 4 0 0 0 0 0 420 g ae/ha 0 4 0 20 0 20 glyphosate 840 g ae/ha 0 3 1 38 5 35-45 glyphosate 1680 g ae/ha 3 1 0 15 7 10-25 glyphosate 3360 g ae/ha 2 2 0 21 8 15-30 glyphosate pDAB102715: dgt-3 v2 (1 PTU) 0 g ae/ha glyphosate 4 0 0 0 0 0 420 g ae/ha 2 2 0 26 16 10-40 glyphosate 840 g ae/ha 0 2 2 55 17 40-70 glyphosate 1680 g ae/ha 0 2 2 56 22 35-75 glyphosate 3360 g ae/ha 0 0 4 65 17 50-80 glyphosate pDAB102718: dgt-3 v2 (2 PTU) 0 g ae/ha glyphosate 4 0 0 0 0 0 420 g ae/ha 4 0 0 5 7 0-15 glyphosate 840 g ae/ha 2 2 0 23 10 15-35 glyphosate 1680 g ae/ha 3 0 1 20 20 5-50 glyphosate 3360 g ae/ha 1 1 2 36 22 15-60 glyphosate
[0200] T.sub.3 Arabidopsis Data.
[0201] The third generation plants (T3) of selected T.sub.2 Arabidopsis events which contained low copy numbers of the dgt-28 transgene were further characterized for glyphosate tolerance. Twenty-five plants per line were selected with glufosinate as previously described and lines from every construct tested did not segregate for the selectable marker gene. Glyphosate was applied as described previously. The response of the plants is presented in terms of % visual injury 2 weeks after treatment (WAT). Data are presented as a histogram of individuals exhibiting little or no injury (<20%), moderate injury (20-40%), or severe injury (>40%). An arithmetic mean and standard deviation are presented for each construct used for Arabidopsis transformation. The range in individual response is also indicated in the last column for each rate and transformation. Wild-type, non-transformed Arabidopsis (cv. Columbia) served as a glyphosate sensitive control.
TABLE-US-00011 TABLE 11 Response of selected individual T.sub.3 Arabidopsis events containing dgt-28 to glyphosate applied postemergence at varying rates, compared to a dgt-1 (T.sub.4) homozygous resistant population, and a non-transformed control. Visual % injury 14 days after application. % Injury Range % Injury (No. Replicates) Analysis <20% 20-40% >40% Ave Std dev Range (%) dgt-28 (pDAB107602) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 0 0 4 73.8 2.5 70-75 glyphosate 840 g ae/ha 0 0 4 71.3 7.5 60-75 glyphosate 1680 g ae/ha 0 0 4 77.5 2.9 75-80 glyphosate 3360 g ae/ha 0 0 4 77.5 2.9 75-80 glyphosate TraP4::dgt-28 (pDAB107527) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 840 g ae/ha 4 0 0 5.0 0.0 5 glyphosate 1680 g ae/ha 4 0 0 10.0 0.0 10 glyphosate 3360 g ae/ha 1 3 0 18.8 2.5 15-20 glyphosate TraP5 v1::dgt-28 (pDAB102792) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 3 0 0 0.0 0.0 0 glyphosate 840 g ae/ha 3 0 0 0.0 0.0 0 glyphosate 1680 g ae/ha 3 0 0 6.0 1.7 5-8 glyphosate 3360 g ae/ha 2 0 0 6.5 2.1 5-8 glyphosate TraP5 v2::dgt-28 (pDAB105530) Averages 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 6.0 1.7 5-8 glyphosate 840 g ae/ha 4 0 0 8.0 0.0 8 glyphosate 1680 g ae/ha 4 0 0 14.3 1.5 12-15 glyphosate 3360 g ae/ha 1 3 0 18.7 2.5 15-20 glyphosate TraP8 v2::dgt-28 (pDAB105531) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 2.5 5.0 0-10 glyphosate 840 g ae/ha 4 0 0 3.3 3.9 0-8 glyphosate 1680 g ae/ha 4 0 0 2.5 2.9 0-5 glyphosate 3360 g ae/ha 4 0 0 7.3 6.4 2-15 glyphosate TraP9 v2::dgt-28 (pDAB105532) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 1.3 2.5 0-5 glyphosate 840 g ae/ha 4 0 0 1.8 2.4 0-5 glyphosate 1680 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 3360 g ae/ha 4 0 0 10.0 4.4 5-15 glyphosate TraP12 v2::dgt-28 (pDAB105533) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 840 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 1680 g ae/ha 4 0 0 3.8 7.5 0-15 glyphosate 3360 g ae/ha 4 0 0 6.3 4.8 0-10 glyphosate TraP13 v2::dgt-28 (pDAB105534) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 2 2 0 10.0 11.5 0-20 glyphosate 840 g ae/ha 4 0 0 1.3 2.5 0-5 glyphosate 1680 g ae/ha 4 0 0 2.8 1.5 2-5 glyphosate 3360 g ae/ha 4 0 0 8.0 0.0 8 glyphosate TraP23::dgt-28 (pDAB107553) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 840 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 1680 g ae/ha 4 0 0 7.8 2.1 5-10 glyphosate 3360 g ae/ha 4 0 0 10.8 3.0 8-15 glyphosate WT (non- transformed control) Application Rate 0 g ae/ha 4 0 0 0.0 0.0 0 glyphosate 420 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 840 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 1680 g ae/ha 0 0 4 100.0 0.0 100 glyphosate 3360 g ae/ha 0 0 4 100.0 0.0 100 glyphosate
[0202] Selection of Transformed Plants.
[0203] Freshly harvested T.sub.1 seed [dgt-31, dgt-32, and dgt-33 v1 gene] were allowed to dry at room temperature and shipped to Indianapolis for testing. T.sub.1 seed was sown in 26.551-cm germination trays (T.O. Plastics Inc., Clearwater, Minn.), each receiving a 200 mg aliquots of stratified T.sub.1 seed (10,000 seed) that had previously been suspended in 40 mL of 0.1% agarose solution and stored at 4 C. for 2 days to complete dormancy requirements and ensure synchronous seed germination.
[0204] Sunshine Mix LP5 (Sun Gro Horticulture Inc., Bellevue, Wash.) was covered with fine vermiculite and subirrigated with Hoagland's solution until wet, then allowed to gravity drain. Each 40 mL aliquot of stratified seed was sown evenly onto the vermiculite with a pipette and covered with humidity domes (KORD Products, Bramalea, Ontario, Canada) for 4-5 days. Domes were removed once plants had germinated prior to initial transformant selection using glufosinate postemergence spray (selecting for the co-transformed dsm-2 gene).
[0205] Six days after planting (DAP) and again 10 DAP, T.sub.1 plants (cotyledon and 2-4-1f stage, respectively) were sprayed with a 0.1% solution of IGNITE herbicide (280 g ai/L glufosinate, Bayer Crop Sciences, Kansas City, Mo.) at a spray volume of 10 mL/tray (703 L/ha) using a DeVilbiss compressed air spray tip to deliver an effective rate of 200 g ae/ha glufosinate per application. Survivors (plants actively growing) were identified 4-7 days after the final spraying. Surviving plants were transplanted individually into 3-inch pots prepared with potting media (Metro Mix 360). Plants reared in the greenhouse at least 1 day prior to tissue sampling for copy number analyses.
[0206] T.sub.1 plants were sampled and copy number analysis for the dgt-31, dgt-32, and dgt-33 v1 gene were completed. T.sub.1 plants were then assigned to various rates of glyphosate so that a range of copies were among each rate. For Arabidopsis, 26.25 g ae/ha glyphosate is an effective dose to distinguish sensitive plants from ones with meaningful levels of resistance. Elevated rates were applied to determine relative levels of resistance (105, 420, 1680, or 3360 g ae/ha). Table 13 shows the comparisons drawn to dgt-1.
[0207] All glyphosate herbicide applications were made by track sprayer in a 187 L/ha spray volume. Glyphosate used was of the commercial Durango dimethylamine salt formulation (480 g ae/L, Dow AgroSciences, LLC). Low copy T.sub.1 plants that exhibited tolerance to either glufosinate or glyphosate were further accessed in the T.sub.2 generation.
[0208] The first Arabidopsis transformations were conducted using dgt-31, dgt-32, and dgt-33 v1. T.sub.1 transformants were first selected from the background of untransformed seed using a glufosinate selection scheme. Three flats or 30,000 seed were analyzed for each T.sub.1 construct. Transformation frequency was calculated and results of T.sub.1 dgt-31, dgt-32, and dgt-33 constructs are listed in Table 12.
TABLE-US-00012 TABLE 12 Transformation frequency of T1 dgt-31, dgt-32, and dgt-33 Arabidopsis constructs selected with glufosinate for selection of the selectable marker gene DSM-2. Transformation Construct Cassette Frequency (%) pDAB107532 AtUbi10/TraP14 dgt-32 v1 0.47 pDAB107533 AtUbi10/TraP23 dgt-31 v1 0.36 pDAB107534 AtUbi10/TraP24 dgt-33 v1 0.68
[0209] T.sub.1 plants selected above were subsequently transplanted to individual pots and sprayed with various rates of commercial glyphosate. Table 13 compares the response of dgt-31, dgt-32, and dgt-33 v1 and control genes to impart glyphosate resistance to Arabidopsis T.sub.1 transformants. Response is presented in terms of % visual injury 2 WAT. Data are presented as a histogram of individuals exhibiting little or no injury (<20%), moderate injury (20-40%), or severe injury (>40%). An arithmetic mean and standard deviation is presented for each treatment. The range in individual response is also indicated in the last column for each rate and transformation. Wild-type non-transformed Arabidopsis (cv. Columbia) served as a glyphosate sensitive control. The DGT-31 (v1) gene with transit peptide TraP23 imparted slight herbicide tolerance to individual T.sub.1 Arabidopsis plants compared to the negative control, but the gene exhibited improved tolerance with transit peptide TraP8. Both DGT-32 and DGT-33 demonstrated robust tolerance to glyphosate at the rates tested with TraP8 and with their respective differing chloroplast transit peptide (TraP14 and TraP24 respectively). Within a given treatment, the level of plant response varied greatly, which can be attributed to the fact each plant represents an independent transformation event and thus the copy number of the gene of interest varies from plant to plant. Of important note, at each glyphosate rate tested, there were individuals that were more tolerant than others. An overall population injury average by rate is presented in Table 13 to demonstrate the significant difference between the plants transformed with dgt-31, dgt-32, and dgt-33 v1 versus the dgt-1 v1 or Wild-type controls.
TABLE-US-00013 TABLE 13 dgt-31, dgt-32, and dgt-33 v1 transformed T.sub.1 Arabidopsis response to a range of glyphosate rates applied postemergence, compared to a dgt-1 (T4) homozygous resistant population, or a non-transformed control. Visual % injury 2 weeks after treatment. % Injury % Injury Std. Range Averages <20% 20-40% >40% Ave Dev. (%) TraP23 dgt-31 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha 0 0 4 81.3 2.5 80-85 420 g ae/ha 0 0 4 97.3 4.9 90-100 1680 g ae/ha 0 0 4 90.0 7.1 85-100 3360 g ae/ha 0 0 4 91.3 6.3 85-100 TraP14 dgt-32 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha 4 0 0 0.0 0.0 0 420 g ae/ha 2 0 2 30.0 29.4 0-60 1680 g ae/ha 3 0 1 17.5 21.8 5-50 3360 g ae/ha 0 3 1 35.0 30.0 20-80 TraP24 dgt-33 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha 2 2 0 21.3 14.9 5-40 420 g ae/ha 1 1 2 46.3 30.9 5-70 1680 g ae/ha 1 0 3 62.5 38.8 5-90 3360 g ae/ha 1 0 3 62.0 36.0 8-80 TraP8 dgt-31 0 g ae/ha glyphosate 4 0 0 0.0 0.0 105 g ae/ha glyphosate 0 1 3 43.8 17.0 420 g ae/ha glyphosate 1 2 1 43.8 32.5 1680 g ae/ha glyphosate 0 1 3 71.3 27.8 3360 g ae/ha glyphosate 0 0 4 81.3 8.5 TraP8 dgt-32 0 g ae/ha glyphosate 4 0 0 0.0 0.0 105 g ae/ha glyphosate 4 0 0 0.0 0.0 420 g ae/ha glyphosate 4 0 0 7.5 5.0 1680 g ae/ha glyphosate 3 1 0 10.8 9.6 3360 g ae/ha glyphosate 4 0 0 12.8 3.2 TraP8 dgt-33 0 g ae/ha glyphosate 4 0 0 0.0 0.0 105 g ae/ha glyphosate 4 0 0 0.0 0.0 420 g ae/ha glyphosate 4 0 0 2.5 3.8 1680 g ae/ha glyphosate 4 0 0 6.3 2.5 3360 g ae/ha glyphosate 3 1 0 20.0 13.5 dgt-1 (transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha 0 1 3 42.5 15.0 20-50 420 g ae/ha 0 2 2 38.8 11.1 25-50 1680 g ae/ha 0 0 4 79.0 19.4 50-90 3360 g ae/ha 0 0 4 50.0 0.0 50 WT (non-transformed control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 105 g ae/ha 0 0 4 100.0 0.0 100s 420 g ae/ha 0 0 4 100.0 0.0 100 1680 g ae/ha 0 0 4 100.0 0.0 100 3360 g ae/ha 0 0 4 100.0 0.0 100
[0210] Maize Transformation.
[0211] Standard cloning methods, as described above, were used in the construction of binary vectors for use in Agrobacterium tumefaciens-mediated transformation of maize. Table 14 lists the vectors which were constructed for maize transformation. The following gene elements were used in the vectors which contained dgt-28; the Zea mays Ubiquitin 1 promoter (ZmUbi1; U.S. Pat. No. 5,510,474) was used to drive the dgt-28 coding sequence which is flanked by a Zea mays Lipase 3 untranslated region (ZmLip 3UTR; U.S. Pat. No. 7,179,902), the selectable marker cassette consists of the Zea mays Ubiquitin 1 promoter which was used to drive the aad-1 coding sequence (U.S. Pat. No. 7,838,733) which is flanked by a Zea mays Lipase 3 untranslated region. The aad-1 coding sequence confers tolerance to the phenoxy auxin herbicides, such as, 2,4-dichlorophenoxyacetic acid (2,4-D) and to aryloxyphenoxypropionate (AOPP) herbicides.
[0212] The dgt-28 constructs were built as standard binary vectors and Agrobacterium superbinary system vectors (Japan Tobacco, Tokyo, JP). The standard binary vectors include; pDAB107663, pDAB107664, pDAB107665, and pDAB107665. The Agrobacterium superbinary system vectors include pDAB108384, pDAB108385, pDAB108386, and pDAB108387.
[0213] Additional constructs were completed which contain a yellow fluorescent protein (yfp; US Patent Application 2007/0298412) reporter gene. pDAB109812 contains a yfp reporter gene cassette which is driven by the Zea mays Ubiquitin 1 promoter and flanked by the Zea mays per 5 3 untranslated region (Zm per5 3UTR; U.S. Pat. No. 7,179,902), the selectable marker cassette consists of the sugar cane bacilliform virus promoter (SCBV; U.S. Pat. No. 5,994,123) which is used to drive the expression of aad-1 and is flanked by the Zea mays Lipase 3 untranslated region. pDAB101556 contains a yfp cassette which is driven by the Zea mays Ubiquitin 1 promoter and flanked by the Zea mays per 5 3 untranslated region, the selectable marker cassette consists of the Zea mays Ubiquitin 1 promoter which is used to drive the expression of aad-1 and is flanked by the Zea mays Lipase 3 untranslated region. pDAB107698 contains a dgt-28 cassette which is driven by the Zea mays Ubiquitin 1 promoter and is flanked by a Zea mays Lipase 3 untranslated region, an yfp cassette which is driven by the Zea mays Ubiquitin 1 promoter and flanked by the Zea mays per 5 3 untranslated region, the selectable marker cassette consists of the sugar cane bacilliform virus promoter which is used to drive the expression of aad-1 and is flanked by the Zea mays Lipase 3 untranslated region. All three of these constructs are standard binary vectors.
TABLE-US-00014 TABLE 14 Maize Transformation Vectors Plasmid No. Description of Gene Elements pDAB107663 ZmUbi1/TraP4 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR binary vector pDAB107664 ZmUbi1/TraP8 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR binary vector pDAB107665 ZmUbi1/TraP23 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR binary vector pDAB107666 ZmUbi1/TraP5 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR binary vector pDAB109812 ZmUbi1/yfp/ZmPer5 3UTR :: SCBV/aad-1/ ZmLip 3UTR binary vector pDAB101556 ZmUbi1/yfp/ZmPer5 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR binary vector pDAB107698 ZmUbi1/TraP8 dgt-28/ZmLip 3UTR :: ZmUbi1/ yfp/ZmLip 3UTR::SCBV/aad-1/ZmLip 3UTR pDAB108384 ZmUbi1/TraP4 dgt-28/ZmLip 3UTR:: ZmUbi1/aad-1/ ZmLip 3UTR superbinary vector pDAB108385 ZmUbi1/TraP8 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR superbinary precursor pDAB108386 ZmUbi1/TraP23 dgt-28/ZmLip 3UTR :: ZmUbi1/aad-1/ ZmLip 3UTR superbinary precursor pDAB108387 ZmUbi1/TraP5 dgt-28/ZmLip 3UTR::ZmUbi1/aad-1/ ZmLip 3UTR superbinary precursor
[0214] Ear Sterilization and Embryo Isolation.
[0215] To obtain maize immature embryos, plants of the Zea mays inbred line B 104 were grown in the greenhouse and were self or sib-pollinated to produce ears. The ears were harvested approximately 9-12 days post-pollination. On the experimental day, ears were surface-sterilized by immersion in a 20% solution of sodium hypochlorite (5%) and shaken for 20-30 minutes, followed by three rinses in sterile water. After sterilization, immature zygotic embryos (1.5-2.4 mm) were aseptically dissected from each ear and randomly distributed into micro-centrifuge tubes containing liquid infection media (LS Basal Medium, 4.43 gm/L; N6 Vitamin Solution [1000], 1.00 mL/L; L-proline, 700.0 mg/L; Sucrose, 68.5 gm/L; D(+) Glucose, 36.0 gm/L; 10 mg/ml of 2,4-D, 150 L/L). For a given set of experiments, pooled embryos from three ears were used for each transformation.
Agrobacterium Culture Initiation:
[0216] Glycerol stocks of Agrobacterium containing the binary transformation vectors described above were streaked on AB minimal medium plates containing appropriate antibiotics and were grown at 20 C. for 3-4 days. A single colony was picked and streaked onto YEP plates containing the same antibiotics and was incubated at 28 C. for 1-2 days.
[0217] Agrobacterium Culture and Co-Cultivation.
[0218] Agrobacterium colonies were taken from the YEP plate, suspended in 10 mL of infection medium in a 50 mL disposable tube, and the cell density was adjusted to OD.sub.600 nm of 0.2-0.4 using a spectrophotometer. The Agrobacterium cultures were placed on a rotary shaker at 125 rpm, room temperature, while embryo dissection was performed. Immature zygotic embryos between 1.5-2.4 mm in size were isolated from the sterilized maize kernels and placed in 1 mL of the infection medium) and washed once in the same medium. The Agrobacterium suspension (2 mL) was added to each tube and the tubes were placed on a shaker platform for 10-15 minutes. The embryos were transferred onto co-cultivation media (MS Salts, 4.33 gm/L; L-proline, 700.0 mg/L; Myo-inositol, 100.0 mg/L; Casein enzymatic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 mg/L; Sucrose, 30.0 gm/L; Gelzan, 3.00 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 8.5 mg/ml AgNo.sub.3, 15.0 mg/L; DMSO, 100 M), oriented with the scutellum facing up and incubated at 25 C., under 24-hour light at 50 mole m.sup.2 sec.sup.1 light intensity for 3 days.
[0219] Callus Selection and Regeneration of Putative Events.
[0220] Following the co-cultivation period, embryos were transferred to resting media (MS Salts, 4.33 gm/L; L-proline, 700.0 mg/L; 1,2,3,5/4,6-Hexahydroxycyclohexane, 100 mg/L; MES [(2-(n-morpholino)-ethanesulfonic acid), free acid] 0.500 gm/L; Casein enzymatic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 mg/L; Sucrose, 30.0 gm/L; Gelzan 2.30 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 8.5 mg/ml AgNo.sub.3, 15.0 mg/L; Carbenicillin, 250.0 mg/L) without selective agent and incubated under 24-hour light at 50 mole m.sup.2 sec.sup.1 light intensity and at 25 C. for 3 days.
[0221] Growth inhibition dosage response experiments suggested that glyphosate concentrations of 0.25 mM and higher were sufficient to inhibit cell growth in the untransformed B104 maize line. Embryos were transferred onto Selection 1 media containing 0.5 mM glyphosate (MS Salts, 4.33 gm/L; L-proline, 700.0 mg/L; Myo-inositol, 100.0 mg/L; MES [(2-(n-morpholino)-ethanesulfonic acid), free acid] 0.500 gm/L; Casein enzymatic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 mg/L; Sucrose, 30.0 gm/L; Gelzan 2.30 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 8.5 mg/ml AgNo3, 15.0 mg/L; Carbenicillin, 250.0 mg/L) and incubated in either dark and/or under 24-hour light at 50 mole m.sup.2 sec.sup.1 light intensity for 7-14 days at 28 C.
[0222] Proliferating embryogenic calli were transferred onto Selection 2 media containing 1.0 mM glyphosate (MS Salts, 4.33 gm/L; 1,2,3,5/4,6-Hexahydroxycyclohexane, 100 mg/L; L-proline, 700.0 mg/L; MES [(2-(n-morpholino)-ethanesulfonic acid), free acid] 0.500 gm/L; Casein enzymatic hydrolysate 100.0 mg/L; 30 mM Dicamba-KOH, 3.3 mg/L; Sucrose, 30.0 gm/L; Gelzan 2.30 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 8.5 mg/mL AgNo3, 15.0 mg/L; Carbenicillin, 250.0 mg/L; R-Haloxyfop acid 0.1810 mg/L), and were incubated in either dark and/or under 24-hour light at 50 m.sup.2 sec.sup.1 light intensity for 14 days at 28 C. This selection step allowed transgenic callus to further proliferate and differentiate. The callus selection period lasted for three to four weeks.
[0223] Proliferating, embryogenic calli were transferred onto PreReg media containing 0.5 mM glyphosate (MS Salts, 4.33 gm/L; 1,2,3,5/4,6-Hexahydroxycyclohexane, 100 mg/L; L-proline, 350.0 mg/L; IVIES [(2-(n-morpholino)-ethanesulfonic acid), free acid] 0.250 gm/L; Casein enzymatic hydrolysate 50.0 mg/L; NAA-NaOH 0.500 mg/L; ABA-EtOH 2.50 mg/L; BA 1.00 mg/L; Sucrose, 45.0 gm/L; Gelzan 2.50 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 8.5 mg/ml AgNo3, 1.00 mg/L; Carbenicillin, 250.0 mg/L) and cultured under 24-hour light at 50 mole m.sup.2 sec.sup.1 light intensity for 7 days at 28 C.
[0224] Embryogenic calli with shoot-like buds were transferred onto Regeneration media containing 0.5 mM glyphosate (MS Salts, 4.33 gm/L; 1,2,3,5/4,6-Hexahydroxycyclohexane, 100.0 mg/L; Sucrose, 60.0 gm/L; Gellan Gum G434 3.00 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; Carbenicillin, 125.0 mg/L) and cultured under 24-hour light at 50 mole m.sup.2 sec.sup.1 light intensity for 7 days.
[0225] Small shoots with primary roots were transferred to rooting media (MS Salts, 4.33 gm/L; Modified MS-Vitamin [1000], 1.00 ml/L; 1,2,3,5/4,6-Hexahydroxycyclohexane, 100 mg/L; Sucrose, 60.0 gm/L; Gellan Gum G434 3.00 gm/L; Carbenicillin, 250.0 mg/L) in phytotrays and were incubated under 16/8 hr. light/dark at 140-190 mole m.sup.2 sec.sup.1 light intensity for 7 days at 27 C. Putative transgenic plantlets were analyzed for transgene copy number using the protocols described above and transferred to soil.
[0226] Molecular Confirmation of the Presence of the Dgt-28 and Aad-1 Transgenes within Maize Plants.
[0227] The presence of the dgt-28 and aad-1 polynucleotide sequences were confirmed via hydrolysis probe assays. Isolated To Maize plants were initially screened via a hydrolysis probe assay, analogous to TAQMAN, to confirm the presence of a aad-1 and dgt-28 transgenes. The data generated from these studies were used to determine the transgene copy number and used to select transgenic maize events for back crossing and advancement to the T.sub.1 generation.
[0228] Tissue samples were collected in 96-well plates, tissue maceration was performed with a KLECO tissue pulverizer and stainless steel beads (Hoover Precision Products, Cumming, Ga.), in Qiagen RLT buffer. Following tissue maceration, the genomic DNA was isolated in high-throughput format using the Biosprint .sup.96Plant kit (Qiagen, Germantown, Md.) according to the manufacturer's suggested protocol. Genomic DNA was quantified by Quant-IT Pico Green DNA assay kit (Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified genomic DNA was adjusted to around 2ng/L for the hydrolysis probe assay using a BIOROBOT3000 automated liquid handler (Qiagen, Germantown, Md.). Transgene copy number determination by hydrolysis probe assay, analogous to TAQMAN assay, was performed by real-time PCR using the LIGHTCYCLER480 system (Roche Applied Science, Indianapolis, Ind.). Assays were designed for aad-1, dgt-28 and an internal reference gene Invertase (Genbank Accession No: U16123.1) using the LIGHTCYCLER Probe Design Software 2.0. For amplification, LIGHTCYCLER480 Probes Master mix (Roche Applied Science, Indianapolis, Ind.) was prepared at 1 final concentration in a 10 L it volume multiplex reaction containing 0.4 M of each primer for aad-1 and dgt-28 and 0.2 M of each probe (Table 15).
[0229] A two-step amplification reaction was performed with an extension at 60 C. for 40 seconds with fluorescence acquisition. All samples were run and the averaged Cycle threshold (Ct) values were used for analysis of each sample. Analysis of real time PCR data was performed using LightCycler software release 1.5 using the relative quant module and is based on the Ct method. Controls included a sample of genomic DNA from a single copy calibrator and known two copy check that were included in each run. Table 16 lists the results of the hydrolysis probe assays.
TABLE-US-00015 TABLE15 Primerandprobesequencesusedforhydrolysisprobeassayof aad-1,dgt-28andinternalreference(Invertase). Oligonucleotide Gene SEQID Name Detected NO: OligoSequence GAAD1F aad-1 56 TGTTCGGTTCCCTCTACCAA forward primer GAAD1P aad-1 57 CACAGAACCGTCGCTTCAGCAACA probe GAAD1R aad-1 58 CAACATCCATCACCTTGACTGA reverse primer IV-Probe Invertase 59 CGAGCAGACCGCCGTGTACTTCTACC probe IVF-Taq Invertase 60 TGGCGGACGACGACTTGT forward primer IVR-Taq Invertase 61 AAAGTTTGGAGGCTGCCGT reverse primer zmDGT28F dgt-28 62 TTCAGCACCCGTCAGAAT forward primer zmDGT28FAM dgt-28 63 TGCCGAGAACTTGAGGAGGT probe zmDGT28R dgt-28 64 TGGTCGCCATAGCTTGT reverse primer
TABLE-US-00016 TABLE 16 T.sub.0 copy amount results for dgt-28 events. Low copy events consisted of 1-2 transgene copies, single copy numbers are listed in parenthesis. High copy events contained 3 or more transgene copies. Plasmid used # of Low Copy for Events (single # of High Copy Transformation copy) Events pDAB107663 43 (31) 10 pDAB107664 30 (24) 5 pDAB107665 40 (27) 10 pDAB107666 24 (12) 12 pDAB109812 2 (1) 0 pDAB101556 25 (15) 10 pDAB107698 3 (1) 2
[0230] Herbicide Tolerance in Dgt-28 Transformed Corn.
[0231] Zea mays dgt-28 transformation events (T.sub.0) were allowed to acclimate in the greenhouse and were grown until plants had transitioned from tissue culture to greenhouse growing conditions (i.e., 2-4 new, normal looking leaves had emerged from the whorl). Plants were grown at 27 C. under 16 hour light:8 hour dark conditions in the greenhouse. The plants were then treated with commercial formulations of DURANGO DMA (containing the herbicide glyphosate) with the addition of 2% w/v ammonium-sulfate. Herbicide applications were made with a track sprayer at a spray volume of 187 L/ha, 50-cm spray height. T.sub.0 plants were sprayed with a range of glyphosate from 280-4480 g ae/ha glyphosate, which is capable of significant injury to untransformed corn lines. A lethal dose is defined as the rate that causes >95% injury to the B104 inbred.
[0232] The results of the To dgt-28 corn plants demonstrated that tolerance to glyphosate was achieved at rates up to 4480 g ae/ha. A specific media type was used in the To generation. Minimal stunting and overall plant growth of transformed plants compared to the non-transformed controls demonstrated that dgt-28 provides robust tolerance to glyphosate when linked to the TraPS, TraP8, and TraP23 chloroplast transit peptides.
[0233] Selected T.sub.0 plants are selfed or backcrossed for further characterization in the next generation. 100 chosen dgt-28 lines containing the T.sub.1 plants are sprayed with 140-1120 g ae/ha glufosinate or 105-1680 g ae/ha glyphosate. Both the selectable marker and glyphosate resistant gene are constructed on the same plasmid. Therefore, if one herbicide tolerant gene is selected for by spraying with an herbicide, both genes are believed to be present. At 14 DAT, resistant and sensitive plants are counted to determine the percentage of lines that segregated as a single locus, dominant Mendelian trait (3R:1 S) as determined by Chi square analysis. These data demonstrate that dgt-28 is inheritable as a robust glyphosate resistance gene in a monocot species. Increased rates of glyphosate are applied to the T.sub.1 or F.sub.1 survivors to further characterize the tolerance and protection that is provided by the dgt-28 gene.
[0234] Post-Emergence Herbicide Tolerance in Dgt-28 Transformed to Corn.
[0235] T.sub.0 events of dgt-28 linked with TraP4, TraP5, TraP8 and TraP23 were generated by Agrobacterium transformation and were allowed to acclimate under controlled growth chamber conditions until 2-4 new, normal looking leaves had emerged from the whorl. Plants were assigned individual identification numbers and sampled for copy number analyses of both dgt-28 and aad-1. Based on copy number analyses, plants were selected for protein expression analyses. Plants were transplanted into larger pots with new growing media and grown at 27 C. under 16 hour light:8 hour dark conditions in the greenhouse. Remaining plants that were not sampled for protein expression were then treated with commercial formulations of DURANGO DMA (glyphosate) with the addition of 2% w/v ammonium-sulfate. Treatments were distributed so that each grouping of plants contained T.sub.0 events of varying copy number. Herbicide applications were made with a track sprayer at a spray volume of 187 L/ha, 50-cm spray height. T.sub.0 plants were sprayed with a range of glyphosate from 280-4480 g ae/ha glyphosate capable of significant injury to untransformed corn lines. A lethal dose is defined as the rate that causes >95% injury to the B104 inbred. B104 was the genetic background of the transformants.
[0236] Results of T.sub.0 dgt-28 corn plants demonstrate that tolerance to glyphosate was achieved up to 4480 g ae/ha. Table 17. Minimal stunting and overall plant growth of transformed plants compared to the non-transformed controls demonstrated that dgt-28 provides robust protection to glyphosate when linked to TraP5, TraP8, and TraP23.
TABLE-US-00017 TABLE 17 Response of T.sub.0 dgt-28 events of varying copy numbers to rates of glyphosate ranging from 280-4480 g ae/ha + 2.0% w/v ammonium sulfate 14 days after treatment. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) TraP4 dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 280 g ae/ha 5 0 0 1.0 2.2 0-5 560 g ae/ha 6 0 0 2.0 4.0 0-10 1120 g ae/ha 12 0 0 1.3 3.1 0-10 2240 g ae/ha 7 0 0 1.7 4.5 0-12 4480 g ae/ha 7 0 0 1.1 3.0 0-8 TraP8 dgt-28 0 g ae/ha glyphosate 6 0 0 0.0 0.0 0 280 g ae/ha 5 1 0 6.7 8.8 0-20 560 g ae/ha 0 2 0 20.0 0.0 20 1120 g ae/ha 7 0 0 1.4 2.4 0-5 2240 g ae/ha 3 1 0 7.5 15.0 0-30 4480 g ae/ha 6 0 0 1.7 4.1 0-10 TraP23 dgt-28 0 g ae/ha glyphosate 6 0 0 0.8 2.0 0-5 280 g ae/ha 7 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 1.3 2.5 0-5 1120 g ae/ha 10 2 0 3.3 7.8 0-20 2240 g ae/ha 6 0 0 1.3 3.3 0-8 4480 g ae/ha 6 1 0 4.3 7.9 0-20 TraP5 dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 280 g ae/ha 7 1 0 5.0 14.1 0-40 560 g ae/ha 8 0 0 0.6 1.8 0-5 1120 g ae/ha 7 1 0 5.0 14.1 0-40 2240 g ae/ha 8 0 0 0.0 0.0 0 4480 g ae/ha 8 0 0 0.0 0.0 0
[0237] Protein expression analyses by standard ELISA demonstrated a mean range of DGT-28 protein from 12.6-22.5 ng/cm.sup.2 across the constructs tested.
[0238] Confirmation of Glyphosate Tolerance in the F.sub.1 Generation Under Greenhouse Conditions.
[0239] Single copy T.sub.0 plants that were not sprayed were backcrossed to the non-transformed background B104 for further characterization in the next generation. In the T.sub.1 generation, glyphosate tolerance was assessed to confirm the inheritance of the dgt-28 gene. For T.sub.1 plants, the herbicide ASSURE II (35 g ae/ha quizalofop-methyl) was applied at the V1 growth stage to select for the AAD-1 protein. Both the selectable marker and glyphosate resistant gene are constructed on the same plasmid. Therefore if one gene is selected, both genes are believed to be present. After 7 DAT, resistant and sensitive plants were counted and null plants were removed from the population. These data demonstrate that dgt-28 (v1) is heritable as a robust glyphosate resistance gene in a monocot species. Plants were sampled for characterization of DGT-28 protein by standard ELISA and RNA transcript level. Resistant plants were sprayed with 560-4480 g ae/ha glyphosate as previously described. The data demonstrate robust tolerance of dgt-28 linked with the chloroplast transit peptides TraP4, TraP5, TraP8 and TraP23 up to 4480 g ae/ha glyphosate. Table 18.
TABLE-US-00018 TABLE 18 Response of F.sub.1 single copy dgt-28 events to rates of glyphosate ranging from 560-4480 g ae/ha + 2.0% w/v ammonium sulfate 14 days after treatment. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) B104/TraP4::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 9.0 1.2 8-10 2240 g ae/ha 4 0 0 2.5 2.9 0-5 4480 g ae/ha 4 0 0 0.0 0.0 0 B104/TraP8::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 1.3 2.5 0-5 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 5.0 4.1 0-10 4480 g ae/ha 4 0 0 6.3 2.5 5-10 B104/TraP23::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 3 1 0 10.0 10.0 5-25 1120 g ae/ha 2 2 0 18.8 11.8 10-35 2240 g ae/ha 4 0 0 12.5 2.9 10-15 4480 g ae/ha 3 1 0 10.0 7.1 5-20 B104/TraP5::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 8.0 0.0 8 1120 g ae/ha 4 0 0 11.3 3.0 8-15 2240 g ae/ha 4 0 0 12.5 2.9 10-15 4480 g ae/ha 4 0 0 10.0 2.5 10-15 Non-transformed B104 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 0 4 100.0 0.0 100 1120 g ae/ha 0 0 4 100.0 0.0 100 2240 g ae/ha 0 0 4 100.0 0.0 100 4480 g ae/ha 0 0 4 100.0 0.0 100
[0240] Protein expression data demonstrate a range of mean DGT-28 protein from 42.2-88.2 ng/cm.sup.2 across T.sub.1 events and constructs tested, establishing protein expression in the T.sub.1 generation.
[0241] Characterization of Dgt-28 Corn Under Field Conditions.
[0242] Single copy T.sub.1 events were sent to a field location to create both hybrid hemizygous and inbred homozygous seed for additional characterization. Hybrid seeds were created by crossing T.sub.1 events in the maize transformation line B 104 to the inbred line 4X811 generating hybrid populations segregating 1:1 (hemizygous:null) for the event. The resulting seeds were shipped to 2 separate locations. A total of five single copy events per construct were planted at each location in a randomized complete block design in triplicate. The fields were designed for glyphosate applications to occur at the V4 growth stage and a separate grouping of plants to be applied at the V8 growth stage. The 4XP811/B104 conventional hybrid was used as a negative control.
[0243] Experimental rows were treated with 184 g ae/ha ASSURE II (106 g ai/L quizalofop-methyl) to eliminate null segregants. All experimental entries segregated 1:1 (sensitive:resistant) (p=0.05) with respect to the ASSURE II application. Selected resistant plants were sampled from each event for quantification of the DGT-28 protein by standard ELISA.
[0244] Quizalofop-methyl resistant plants were treated with the commercial herbicide DURANGO DMA (480 g ae/L glyphosate) with the addition of 2.5% w/v ammonium-sulfate at either the V4 or V8 growth stages. Herbicide applications were made with a boom sprayer calibrated to deliver a volume of 187 L/ha, 50-cm spray height. Plants were sprayed with a range of glyphosate from 1120-4480 g ae/ha glyphosate, capable of significant injury to untransformed corn lines. A lethal dose is defined as the rate that causes >95% injury to the 4XP811 inbred. Visual injury assessments were taken for the percentage of visual chlorosis, percentage of necrosis, percentage of growth inhibition and total visual injury at 7, 14 and 21 DAT (days after treatment). Assessments were compared to the untreated checks for each line and the negative controls.
[0245] Visual injury data for all assessment timings demonstrated robust tolerance up to 4480 g ae/ha DURANGO DMA at both locations and application timings. Representative events for the V4 application are presented from one location and are consistent with other events, application timings and locations. Table 19. One event from the construct containing dgt-28 linked with TraP23 (pDAB107665) was tolerant to the ASSURE II selection for the AAD-1 protein, but was sensitive to all rates of glyphosate applied.
TABLE-US-00019 TABLE 19 Response of dgt-28 events applied with a range of glyphosate from 1120-4480 g ae/ha + 2.5% w/v ammonium sulfate at the V4 growth stage. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) 4XPB11//B104/ TraP4::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 4480 g ae/ha 4 0 0 0.0 0.0 0 4XPB11//B104/ TraP8::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 4480 g ae/ha 4 0 0 0.0 0.0 0 4XPB11//B104/ TraP23::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 4480 g ae/ha 4 0 0 0.0 0.0 0 4XPB11//B104/ TraP5::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 4480 g ae/ha 4 0 0 0.0 0.0 0 Non-transformed 4XPB11//B104 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 0 0 4 100.0 0.0 100 2240 g ae/ha 0 0 4 100.0 0.0 100 4480 g ae/ha 0 0 4 100.0 0.0 100
[0246] Additional assessments were made during the reproductive growth stage for the 4480 g ae/ha glyphosate rate. Visual assessments of tassels, pollination timing and ear fill were similar to the untreated checks of each line for all constructs, application timings and locations. Quantification results for the DGT-28 protein demonstrated a range of mean protein expression from 186.4-303.0 ng/cm.sup.2. Data demonstrates robust tolerance of dgt-28 transformed corn under field conditions through the reproductive growth stages up to 4480 g ae/ha glyphosate. Data also demonstrated DGT-28 protein detection and function based on spray tolerance results.
[0247] Confirmation of Heritability and Tolerance of Dgt-28 Corn in the Homozygous State.
[0248] Seed from the T.sub.1S2 were planted under greenhouse conditions as previously described. The same five single copy lines that were characterized under field conditions were characterized in the homogeneous state. Plants were grown until the V3 growth stage and separated into three rates of glyphosate ranging from 1120-4480 g ae/ha glyphosate (DURANGO DMA) and four replicates per treatment. Applications were made in a track sprayer as previously described and were formulated in 2.0% w/v ammonium sulfate. An application of ammonium sulfate served as an untreated check for each line. Visual assessments were taken 7 and 14 days after treatment as previously described. Data demonstrated robust tolerance up to 4480 g ae/ha glyphosate for all events tested. Table 20.
TABLE-US-00020 TABLE 20 Response of homozygous dgt-28 events applied with a range of glyphosate from 1120-4480 g ae/ha + 2.0% w/v ammonium sulfate. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) TraP4::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 3.8 2.5 0-5 4480 g ae/ha 4 0 0 14.3 1.5 12-15 TraP8::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 9.0 1.2 8-10 4480 g ae/ha 4 0 0 11.3 2.5 10-15 TraP23::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 4.5 3.3 0-8 2240 g ae/ha 4 0 0 7.5 2.9 5-10 4480 g ae/ha 4 0 0 15.0 0.0 15 TraP5::dgt-28 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 1.3 2.5 0-5 2240 g ae/ha 4 0 0 9.0 2.0 8-12 4480 g ae/ha 4 0 0 15.0 2.4 12-18 Non-transformed B104 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 1120 g ae/ha 0 0 4 100.0 0.0 100 2240 g ae/ha 0 0 4 100.0 0.0 100 4480 g ae/ha 0 0 4 100.0 0.0 100
[0249] The line from pDAB107665 that was not tolerant under field conditions demonstrated no tolerance to glyphosate and therefore consistent with field observations (data not shown). With the exception of the one line previously mentioned, all replicates that were treated with glyphosate from the lines were not sensitive to glyphosate. Therefore data demonstrates heritability to a homogeneous population of dgt-28 corn in a Mendelian fashion. Expression of the DGT-28 protein by standard ELISA demonstrated a range of mean protein expression from 27.5-65.8 ng/cm.sup.2 across single copy events that were tolerant to glyphosate. Data demonstrates functional protein and stability of the DGT-28 protein across generations.
[0250] Postemergence Herbicide Tolerance Use of Glyphosate as a Selectable Marker.
[0251] As previously described, To transformed plants were moved from tissue culture and acclimated in the greenhouse. The events tested contained dgt-28 linked to TraP5, TraP8, and TraP23 chloroplast transit peptides. It was demonstrated that these T.sub.0 plants provided robust tolerance up to 4480 g ae/ha glyphosate, and non-transformed plants were controlled with glyphosate at concentrations as low as 280 g ae/ha. These data demonstrate that dgt-28 can be utilized as a selectable marker using a concentration of glyphosate ranging from 280-4480 g ae/ha.
[0252] A number of seed from fixed lines of corn which contain the dgt-28 transgene are spiked into a number of non-transformed corn seed. The seed are planted and allowed to grow to the V1-V3 developmental stage, at which time the plantlets are sprayed with a selecting dose of glyphosate in the range of 280-4480 g ae/ha. Following 7-10 days, sensitive and resistant plants are counted, and the amount of glyphosate tolerant plants correlates with the original number of transgenic seed containing the dgt-28 transgene which are planted.
[0253] Stacking of Dgt-28 Corn.
[0254] The AAD-1 protein is used as the selectable marker in dgt-28 transformed corn for research purposes. The aad-1 gene can also be utilized as a herbicide tolerant trait in corn to provide robust 2,4-D tolerance up to a V8 application in a crop. Four events from the constructs pDAB107663 (TraP4::dgt-28), pDAB107664 (TraP8::dgt-28) and pDAB107666 (TraP5::dgt-28) were characterized for the tolerance of a tank mix application of glyphosate and 2,4-D. The characterization study was completed with F.sub.1 seed under greenhouse conditions. Applications were made in a track sprayer as previously described at the following rates: 1120-2240 g ae/ha glyphosate (selective for the dgt-28 gene), 1120-2240 g ae/ha 2,4-D (selective for the aad-1 gene), or a tank mixture of the two herbicides at the rates described. Plants were graded at 7 and 14 DAT. Spray results for applications of the herbicides at 2240 g ae/ha are shown in Table 21.
TABLE-US-00021 TABLE 21 Response of F.sub.1 aad-1 and dgt-28 corn sprayed with 2240 g ae/ha of 2,4-D, glyphosate and a tank mix combination of the two herbicides 14 days after treatment. 2240 g ae/ha 2,4-D + 2240 g 2240 g ae/ha 2240 g ae/ha ae/ha 2,4-D glyphosate glyphosate Mean % Std. Mean % Std. Mean % F.sub.1 Event injury Dev. injury Dev. injury Std. Dev. 107663[3]- 5.0 4.1 3.8 4.8 8.8 3.0 012.AJ001 107663[3]- 2.5 5.0 1.3 2.5 5.0 5.8 029.AJ001 107663[3]- 2.5 2.9 11.8 2.9 13.8 2.5 027.AJ001 107663[3]- 3.8 2.5 11.5 1.0 12.8 1.5 011.AJ001 B104 27.5 17.7 100.0 0.0 100.0 0.0
[0255] The results confirm that dgt-28 can be successfully stacked with aad-1, thus increasing the spectrum herbicides that may be applied to the crop of interest (glyphosate+phenoxyactetic acids for dgt-28 and aad-1, respectively). In crop production where hard to control broadleaf weeds or resistant weed biotypes exist the stack can be used as a means of weed control and protection of the crop of interest. Additional input or output traits can also be stacked with the dgt-28 gene in corn and other plants.
[0256] Soybean Transformation.
[0257] Transgenic soybean (Glycine max) containing a stably integrated dgt-28 transgene was generated through Agrobacterium-mediated transformation of soybean cotyledonary node explants. A disarmed Agrobacterium strain carrying a binary vector containing a functional dgt-28 was used to initiate transformation.
[0258] Agrobacterium-mediated transformation was carried out using a modified half-cotyledonary node procedure of Zeng et al. (Zeng P., Vadnais D. A., Zhang Z., Polacco J. C., (2004), Plant Cell Rep., 22(7): 478-482). Briefly, soybean seeds (cv. Maverick) were germinated on basal media and cotyledonary nodes are isolated and infected with Agrobacterium. Shoot initiation, shoot elongation, and rooting media are supplemented with cefotaxime, timentin and vancomycin for removal of Agrobacterium. Selection via a herbicide was employed to inhibit the growth of non-transformed shoots. Selected shoots are transferred to rooting medium for root development and then transferred to soil mix for acclimatization of plantlets.
[0259] Terminal leaflets of selected plantlets were treated topically (leaf paint technique) with a herbicide to screen for putative transformants. The screened plantlets were transferred to the greenhouse, allowed to acclimate and then leaf-painted with a herbicide to reconfirm tolerance. These putative transformed T.sub.0 plants were sampled and molecular analyses was used to confirm the presence of the herbicidal selectable marker, and the dgt-28 transgene. T.sub.0 plants were allowed to self fertilize in the greenhouse to produce T.sub.1 seed.
[0260] A second soybean transformation method can be used to produce additional transgenic soybean plants. A disarmed Agrobacterium strain carrying a binary vector containing a functional dgt-28 is used to initiate transformation.
[0261] Agrobacterium-mediated transformation was carried out using a modified half-seed procedure of Paz et al., (Paz M., Martinez J., Kalvig A., Fonger T., and Wang K., (2005) Plant Cell Rep., 25: 206-213). Briefly, mature soybean seeds were sterilized overnight with chlorine gas and imbibed with sterile H.sub.2O twenty hours before Agrobacterium-mediated plant transformation. Seeds were cut in half by a longitudinal cut along the hilum to separate the seed and remove the seed coat. The embryonic axis was excised and any axial shoots/buds were removed from the cotyledonary node. The resulting half seed explants were infected with Agrobacterium. Shoot initiation, shoot elongation, and rooting media were supplemented with cefotaxime, timentin and vancomycin for removal of Agrobacterium. Herbicidal selection was employed to inhibit the growth of non-transformed shoots. Selected shoots were transferred to rooting medium for root development and then transferred to soil mix for acclimatization of plantlets.
[0262] Putative transformed T.sub.0 plants were sampled and molecular analyses was used to confirm the presence of the selectable marker and the dgt-28 transgene. Several events are identified as containing the transgenes. These T.sub.0 plants were advanced for further analysis and allowed to self fertilize in the greenhouse to give rise to T.sub.1 seed.
[0263] Postemergence Herbicide Tolerance in Dgt-28 Transformed T.sub.1 Soybean.
[0264] Seeds from T.sub.1 events that were determined to be heritable by the previously described screening methods were planted in Metro-mix media under greenhouse conditions. Plants were grown until the 1s.sup.t trifoliate was fully expanded and treated with 411 g ae/ha IGNITE 280 SL for selection of the pat gene as previously described. Resistant plants from each event were given unique identifiers and sampled for zygosity analyses of the dgt-28 gene. Zygosity data were used to assign 2 hemizygous and 2 homozygous replicates to each rate of glyphosate applied allowing for a total of 4 replicates per treatment when enough plants existed. These plants were compared against wildtype Petite havana tobacco. All plants were sprayed with a track sprayer set at 187 L/ha. The plants were sprayed from a range of 560-4480 g ae/ha DURANGO dimethylamine salt (DMA). All applications were formulated in water with the addition of 2% w/v ammonium sulfate (AMS). Plants were evaluated at 7 and 14 days after treatment. Plants were assigned an injury rating with respect to overall visual stunting, chlorosis, and necrosis. The T.sub.1 generation is segregating, so some variable response is expected due to difference in zygosity.
TABLE-US-00022 TABLE 22 Spray results demonstrate at 14 DAT (days after treatment) robust tolerance up to 4480 g ae/ha glyphosate of at least one dgt-28 event per construct characterized. Representative single copy events of the constructs all provided tolerance up to 4480 g ae/ha compared to the Maverick negative control. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) pDAB107543 (TraP4::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 4 0 33.8 7.5 25-40 1120 g ae/ha 2 2 0 25.0 11.5 15-35 2240 g ae/ha 2 2 0 17.5 2.9 15-20 4480 g ae/ha 0 2 2 33.8 13.1 20-45 pDAB107545 (TraP8::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 1.5 1.0 0-2 1120 g ae/ha 4 0 0 2.8 1.5 2-5 2240 g ae/ha 4 0 0 5.0 2.4 2-8 4480 g ae/ha 4 0 0 9.5 1.9 8-12 pDAB107548 (TraP4::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 1.8 2.4 0-5 1120 g ae/ha 4 0 0 2.8 1.5 2-5 2240 g ae/ha 4 0 0 3.5 1.7 2-5 4480 g ae/ha 4 0 0 8.8 3.0 5-12 pDAB107553 (TraP23::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 5.0 0.0 5 1120 g ae/ha 4 0 0 9.0 1.2 8-10 2240 g ae/ha 4 0 0 10.5 1.0 10-12 4480 g ae/ha 4 0 0 16.5 1.7 15-18 Maverick (neg. control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 0 4 82.5 12.6 70-100 1120 g ae/ha 0 0 4 100.0 0.0 100 2240 g ae/ha 0 0 4 100.0 0.0 100 4480 g ae/ha 0 0 4 100.0 0.0 100
[0265] Dgt-28 Protection Against Elevated Glyphosate Rates in the T.sub.2 Generation.
[0266] A 45 plant progeny test was conducted on two to five T.sub.2 lines of dgt-28 per construct. Homozygous lines were chosen based on zygosity analyses completed in the previous generation. The seeds were planted as previously described. Plants were then sprayed with 411 g ae/ha IGNITE 280 SL for the selection of the pat selectable marker as previously described. After 3 DAT, resistant and sensitive plants were counted.
[0267] For constructs containing TraP4 linked with dgt-28 (pDAB107543 and pDAB107548), nine out of twelve lines tested did not segregate, thereby confirming homogeneous lines in the T.sub.2 generation. Lines containing TraP8 linked with dgt-28 (pDAB107545) demonstrated two out of the four lines with no segregants and demonstrating Mendelian inheritance through at least two generation of dgt-28 in soybean. Tissue samples were taken from resistant plants and the DGT-28 protein was quantified by standard ELISA methods. Data demonstrated a range of mean DGT-28 protein from 32.8-107.5 ng/cm.sup.2 for non-segregating T.sub.2 lines tested. Lines from the construct pDAB107553 (TraP23::dgt-28) were not previously selected with glufosinate, and the dose response of glyphosate was utilized as both to test homogenosity and tolerance to elevated rates of glyphosate. Replicates from the lines from construct pDAB107553 were tolerant to rates ranging from 560-4480 g ae/ha glyphosate, and were therefore confirmed to be a homogeneous population and heritable to at least two generations.
[0268] Rates of DURANGO DMA ranging from 560-4480 g ae/ha glyphosate were applied to 2-3 trifoliate soybean as previously described. Visual injury data 14 DAT confirmed the tolerance results that were demonstrated in the T.sub.1 generation.
TABLE-US-00023 TABLE 23 The data demonstrate robust tolerance of the dgt-28 tobacco up to 3360 g ae/ha glyphosate through two generations, compared to the non-transformed control. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) pDAB107543 (TraP4::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 8.0 0.0 8 1120 g ae/ha 4 0 0 14.3 1.5 12-15 2240 g ae/ha 4 0 0 18.0 0.0 18 4480 g ae/ha 0 4 0 24.5 3.3 20-28 pDAB107545 (TraP8::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 2.8 1.5 2-5 2240 g ae/ha 4 0 0 5.0 0.0 5 4480 g ae/ha 4 0 0 10.0 0.0 10 pDAB107548 (TraP4::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 4480 g ae/ha 4 0 0 10.0 0.0 10 pDAB107553 (TraP23::dgt-28) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 560 g ae/ha 4 0 0 10.0 0.0 1120 g ae/ha 4 0 0 10.0 4.4 2240 g ae/ha 4 0 0 13.0 2.4 4480 g ae/ha 3 1 0 15.5 4.1 Maverick (neg. control) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 0 4 77.5 15.0 70-100 1120 g ae/ha 0 0 4 97.5 2.9 95-100 2240 g ae/ha 0 0 4 100.0 0.0 100 4480 g ae/ha 0 0 4 100.0 0.0 100
[0269] Transformation of Rice with Dgt-28.
[0270] In an exemplary transformation method, transgenic rice (Oryza sativa) containing a stably integrated dgt-28 transgene is generated through Agrobacterium-mediated transformation of sterilized rice seed. A disarmed Agrobacterium strain carrying a binary vector containing a functional dgt-28 is used to initiate transformation.
[0271] Culture media are adjusted to pH 5.8 with 1 M KOH and solidified with 2.5 g/l Phytagel (Sigma-Aldrich, St. Louis, Mo.). Embryogenic calli are cultured in 10020 mm petri dishes containing 30 ml semi-solid medium. Rice plantlets are grown on 50 ml medium in MAGENTA boxes. Cell suspensions are maintained in 125 ml conical flasks containing 35 mL liquid medium and rotated at 125 rpm. Induction and maintenance of embryogenic cultures occur in the dark at 25-26 C., and plant regeneration and whole-plant culture occur in illuminated room with a 16-h photoperiod (Zhang et al. 1996).
[0272] Induction and maintenance of embryogenic callus is performed on a modified NB basal medium as described previously (Li et al. 1993), wherein the media is adapted to contain 500 mg/L glutamine. Suspension cultures are initiated and maintained in SZ liquid medium (Zhang et al. 1998) with the inclusion of 30 g/L sucrose in place of maltose. Osmotic medium (NBO) consisting of NB medium with the addition of 0.256 M each of mannitol and sorbitol. Herbicide resistant callus is selected on NB medium supplemented with the appropriate herbicide selective agent for 3-4 weeks. Pre-regeneration is performed on medium (PRHSO) consisting of NB medium with 2,4-dichlorophenoxyacetic acid (2,4-D), 1 mg/1 -naphthaleneacetic acid (NAA), 5 mg/l abscisic acid (ABA) and selective herbicide for 1 week. Regeneration of plantlets follow the culturing on regeneration medium (RNH50) comprising NB medium containing 2,4-D, 0.5 mg/l NAA, and selective herbicide until putatively transgenic shoots are regenerated. Shoots are transferred to rooting medium with half-strength Murashige and Skoog basal salts and Gamborg's B5 vitamins, supplemented with 1% sucrose and selective herbicide.
[0273] Mature desiccated seeds of Oryza sativa L. japonica cv. Taipei 309 are sterilized as described in Zhang et al. 1996. Embryogenic tissues are induced by culturing sterile mature rice seeds on NB medium in the dark. The primary callus approximately 1 mm in diameter, is removed from the scutellum and used to initiate cell suspension in SZ liquid medium. Suspensions are then maintained as described in Zhang 1996. Suspension-derived embryogenic tissues are removed from liquid culture 3-5 days after the previous subculture and placed on NBO osmotic medium to form a circle about 2.5 cm across in a petri dish and cultured for 4 h prior to bombardment. Sixteen to twenty hours after bombardment, tissues are transferred from NBO medium onto NBH50 selection medium, ensuring that the bombarded surface is facing upward, and incubated in the dark for 14-17 days. Newly formed callus is then separated from the original bombarded explants and placed nearby on the same medium. Following an additional 8-12 days, relatively compact, opaque callus is visually identified, and transferred to PRHSO pre-regeneration medium for 7 days in the dark. Growing callus, which become more compact and opaque is then subcultured onto RNH50 regeneration medium for a period of 14-21 days under a 16-h photoperiod. Regenerating shoots are transferred to MAGENTA boxes containing MSH50 medium. Multiple plants regenerated from a single explant are considered siblings and are treated as one independent plant line. A plant is scored as positive for the dgt-28 gene if it produces thick, white roots and grows vigorously on MSH50 medium. Once plantlets reach the top of the MAGENTA boxes, they are transferred to soil in a 6-cm pot under 100% humidity for a week, and then are moved to a growth chamber with a 14-h light period at 30 C. and in the dark at 21 C. for 2-3 weeks before transplanting into 13-cm pots in the greenhouse. Seeds are collected and dried at 37 C. for one week prior to storage at 4 C.
[0274] To Analysis of Dgt-28 Rice.
[0275] Transplanted rice transformants obtained via Agrobacterium transformation were transplanted into media and acclimated to greenhouse conditions. All plants were sampled for PCR detection of dgt-28 and results demonstrate twenty-two PCR positive events for pDAB110827 (TraP8::dgt-28) and a minimum of sixteen PCR positive events for pDAB110828 (TraP23::dgt-28). Southern analysis for dgt-28 of the PCR positive events demonstrated simple (1-2 copy) events for both constructs. Protein expression of selected T.sub.0 events demonstrated DGT-28 protein expression ranges from below levels of detection to 130 ng/cm.sup.2. Selected T.sub.0 events from construct pDAB110828 were treated with 2240 g ae/ha DURANGO DMA as previously described and assessed 7 and 14 days after treatment. Data demonstrated robust tolerance to the rate of glyphosate applied. All PCR positive plants were allowed to produced T.sub.1 seed for further characterization.
[0276] Dgt-28 Heritability in Rice.
[0277] A 100 plant progeny test was conducted on four T.sub.1 lines of dgt-28 from construct pDAB110827 containing the chloroplast transit peptide TraP8. The seeds were planted into pots filled with media. All plants were then sprayed with 560 g ae/ha DURANGO DMA for the selection of the dgt-28 gene as previously described. After 7 DAT, resistant and sensitive plants were counted. Two out of the four lines tested for each construct segregated as a single locus, dominant Mendelian trait (3R:1 S) as determined by Chi square analysis. Dgt-28 is a heritable glyphosate resistance gene in multiple species.
[0278] Postemergence Herbicide Tolerance in Dgt-28 Transformed T.sub.1 Rice.
[0279] T.sub.1 resistant plants from each event used in the progeny testing were given unique identifiers and sampled for zygosity analyses of the dgt-28 gene. Zygosity data were used to assign 2 hemizygous and 2 homozygous replicates to each rate of glyphosate applied allowing for a total of 4 replicates per treatment. These plants were compared against wildtype kitaake rice. All plants were sprayed with a track sprayer set at 187 L/ha. The plants were sprayed from a range of 560-2240 g ae/ha DURANGO DMA. All applications were formulated in water with the addition of 2% w/v ammonium sulfate (AMS). Plants were evaluated at 7 and 14 days after treatment. Plants were assigned an injury rating with respect to overall visual stunting, chlorosis, and necrosis. The T.sub.1 generation is segregating, so some variable response is expected due to difference in zygosity.
[0280] Spray results demonstrate at 7 DAT (days after treatment) minimal vegetative injury to elevated rates of glyphosate were detected (data not shown).
TABLE-US-00024 TABLE 24 Visual injury data at 14 DAT demonstrates less than 15% mean visual injury up to 2240 g ae/ha glyphosate. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) TraP8::dgt-28 Event 1 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 0.0 0.0 0 1120 g ae/ha 4 0 0 0.0 0.0 0 2240 g ae/ha 4 0 0 0.0 0.0 0 TraP8::dgt-28 Event 2 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 3.8 4.8 0-10 1120 g ae/ha 4 0 0 12.0 3.6 8-15 2240 g ae/ha 4 0 0 15.0 6.0 8-20 Non-transformed control 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 0 4 81.3 2.5 80-85 1120 g ae/ha 0 0 4 95.0 5.8 90-100 2240 g ae/ha 0 0 4 96.3 4.8 90-100
[0281] Protein detection of DGT-28 was assessed for replicates from all four T.sub.1 lines tested from pDAB110827. Data demonstrated DGT-28 mean protein ranges from 20-82 ng/cm.sup.2 and 21-209 ng/cm.sup.2 for hemizygous and homozygous replicates respectively. These results demonstrated stable protein expression to the T.sub.1 generation and tolerance of dgt-28 rice up to 2240 g ae/ha glyphosate following an application of 560 g ae/ha glyphosate used for selection.
[0282] Transformation of Tobacco with Dgt-28.
[0283] Tobacco (cv. Petit Havana) leaf pieces were transformed using Agrobacterium tumefaciens containing the dgt-28 transgene. Single colonies containing the plasmid which contains the dgt-28 transgene were inoculated into 4 mL of YEP medium containing spectinomycin (50 g/mL) and streptomycin (125 g/mL) and incubated overnight at 28 C. on a shaker at 190 rpm. The 4 mL seed culture was subsequently used to inoculate a 25 mL culture of the same medium in a 125 mL baffled Erlenmeyer flask. This culture was incubated at 28 C. shaking at 190 rpm until it reached an OD.sub.600 of 1.2. Ten mL of Agrobacterium suspension were then placed into sterile 6020 mm Petri dishes.
[0284] Freshly cut leaf pieces (0.5 cm.sup.2) from plants aseptically grown on MS medium (Phytotechnology Labs, Shawnee Mission, Kans.,) with 30 g/L sucrose in PhytaTrays (Sigma, St. Louis, Mo.) were soaked in 10 mL of overnight culture of Agrobacterium for a few minutes, blotted dry on sterile filter paper and then placed onto the same medium with the addition of 1 mg/L indoleacetic acid and 1 mg/L 6-benzylamino purine. Three days later, leaf pieces co-cultivated with Agrobacterium harboring the dgt-28 transgene were transferred to the same medium with 5 mg/L Basta and 250 mg/L cephotaxime.
[0285] After 3 weeks, individual To plantlets were transferred to MS medium with 10 mg/L Basta and 250 mg/L cephotaxime an additional 3 weeks prior to transplanting to soil and transfer to the greenhouse. Selected T.sub.0 plants (as identified using molecular analysis protocols described above) were allowed to self-pollinate and seed was collected from capsules when they were completely dried down. T.sub.1 seedlings were screened for zygosity and reporter gene expression (as described below) and selected plants containing the dgt-28 transgene were identified.
[0286] Plants were moved into the greenhouse by washing the agar from the roots, transplanting into soil in 13.75 cm square pots, placing the pot into a Ziploc bag (SC Johnson & Son, Inc.), placing tap water into the bottom of the bag, and placing in indirect light in a 30 C. greenhouse for one week. After 3-7 days, the bag was opened; the plants were fertilized and allowed to grow in the open bag until the plants were greenhouse-acclimated, at which time the bag was removed. Plants were grown under ordinary warm greenhouse conditions (27 C. day, 24 C. night, 16 hour day, minimum natural+supplemental light=1200 E/m.sup.2s.sup.1).
[0287] Prior to propagation, T.sub.0 plants were sampled for DNA analysis to determine the insert dgt-28 copy number by real-time PCR. Fresh tissue was placed into tubes and lyophilized at 4 C. for 2 days. After the tissue was fully dried, a tungsten bead (Valenite) was placed in the tube and the samples were subjected to 1 minute of dry grinding using a Kelco bead mill. The standard DNeasy DNA isolation procedure was then followed (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and read in the fluorometer (BioTek) with known standards to obtain the concentration in ng/l. A total of 100 ng of total DNA was used as template. The PCR reaction was carried out in the 9700 Geneamp thermocycler (Applied Biosystems), by subjecting the samples to 94 C. for 3 minutes and 35 cycles of 94 C. for 30 seconds, 64 C. for 30 seconds, and 72 C. for 1 minute and 45 seconds followed by 72 C. for 10 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr and confirmed by Southern blots.
[0288] Five to nine PCR positive events with 1-3 copies of dgt-28 gene from 3 constructs containing a different chloroplast transit peptide sequence (TraP4, TraP8 and TraP23) were regenerated and moved to the greenhouse.
[0289] All PCR positive plants were sampled for quantification of the DGT-28 protein by standard ELISA. DGT-28 protein was detected in all PCR positive plants and a trend for an increase in protein concentration was noted with increasing copy number of dgt-28.
[0290] Aad-12 (v1) Heritability in Tobacco.
[0291] A 100 plant progeny test was conducted on five T.sub.1 lines of dgt-28 per construct. Constructs contained one of the following chloroplast transit peptide sequences: TraP4, TraP8 or TraP23. The seeds were stratified, sown, and transplanted with respect much like that of the Arabidopsis procedure exemplified above, with the exception that null plants were not removed by in initial selection prior to transplanting. All plants were then sprayed with 280 g ae/ha IGNITE 280 SL for the selection of the pat selectable marker as previously described. After 3 DAT, resistant and sensitive plants were counted.
[0292] Four out of the five lines tested for each construct segregated as a single locus, dominant Mendelian trait (3R:1 S) as determined by Chi square analysis. Dgt-28 is a heritable glyphosate resistance gene in multiple species.
[0293] Postemergence Herbicide Tolerance in Dgt-28 Transformed T.sub.1 Tobacco.
[0294] T.sub.1 resistant plants from each event used in the progeny testing were given unique identifiers and sampled for zygosity analyses of the dgt-28 gene. Zygosity data were used to assign 2 hemizygous and 2 homozygous replicates to each rate of glyphosate applied allowing for a total of 4 replicates per treatment. These plants were compared against wildtype Petite havana tobacco. All plants were sprayed with a track sprayer set at 187 L/ha. The plants were sprayed from a range of 560-4480 g ae/ha DURANGO DMA. All applications were formulated in water with the addition of 2% w/v ammonium sulfate (AMS). Plants were evaluated at 7 and 14 days after treatment. Plants were assigned an injury rating with respect to overall visual stunting, chlorosis, and necrosis. The T.sub.1 generation is segregating, so some variable response is expected due to difference in zygosity.
[0295] Spray results demonstrate at 7 DAT (days after treatment) minimal vegetative injury to elevated rates of glyphosate were detected (data not shown). Following 14 DAT, visual injury data demonstrates increased injury with single copy events of the construct containing TraP4 compared to single copy events from the constructs TraP8 and TraP23. Table 25.
TABLE-US-00025 TABLE 25 At a rate of 2240 g ae/ha glyphosate, an average injury of 37.5% was demonstrated with the event containing TraP4, where events containing TraP8 and TraP23 demonstrated an average injury of 9.3% and 9.5% respectively. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) TraP4::dgt-28 (pDAB107543) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 2 2 0 18.0 8.1 10-25 1120 g ae/ha 1 3 0 24.5 4.9 18-30 2240 g ae/ha 0 3 1 37.5 6.5 30-45 4480 g ae/ha 0 2 2 42.5 2.9 40-45 TraP8::dgt-28 (pDAB107545) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 3.3 3.9 0-8 1120 g ae/ha 4 0 0 6.5 1.7 5-8 2240 g ae/ha 4 0 0 9.3 3.0 5-12 4480 g ae/ha 2 2 0 17.5 6.5 10-25 TraP23::dgt-28 (pDAB107553) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 4 0 0 10.0 1.6 8-12 1120 g ae/ha 4 0 0 8.8 3.0 5-12 2240 g ae/ha 4 0 0 9.5 4.2 5-15 4480 g ae/ha 4 0 0 15.8 1.5 15-18 Petite havana 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 560 g ae/ha 0 0 4 85.0 4.1 80-90 1120 g ae/ha 0 0 4 91.3 2.5 90-95 2240 g ae/ha 0 0 4 94.5 3.3 90-98 4480 g ae/ha 0 0 4 98.3 2.4 95-100
[0296] These results demonstrated tolerance of dgt-28 up to 4480 g ae/ha glyphosate, as well as differences in tolerance provided by chloroplast transit peptide sequences linked to the dgt-28 gene.
[0297] Dgt-28 Protection Against Elevated Glyphosate Rates in the T.sub.2 Generation.
[0298] A 25 plant progeny test was conducted on two to three T.sub.2 lines of dgt-28 per construct. Homozygous lines were chosen based on zygosity analyses completed in the previous generation. The seeds were stratified, sown, and transplanted as previously described. All plants were then sprayed with 280 g ae/ha Ignite 280 SL for the selection of the pat selectable marker as previously described. After 3 DAT, resistant and sensitive plants were counted. All lines tested for each construct did not segregate thereby confirming homogeneous lines in the T.sub.2 generation and demonstrating Mendelian inheritance through at least two generation of dgt-28 in tobacco.
[0299] Rates of DURANGO DMA ranging from 420-3360 g ae/ha glyphosate were applied to 2-3 leaf tobacco as previously described. Visual injury data 14 DAT confirmed the tolerance results that were demonstrated in the T1 generation. Foliar results from a two copy lines from the construct containing TraP4 demonstrated similar tolerance to that of single copy TraP8 and TraP23 lines (data not shown).
TABLE-US-00026 TABLE 26 Single copy lines from the construct containing TraP4 with dgt-28 demonstrated increased injury compared to lines from constructs containing TraP8 and TraP23 with dgt-28. % Injury % Injury Std. Range Application Rate <20% 20-40% >40% Ave Dev. (%) TraP4::dgt-28 (pDAB107543) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 0 4 0 23.8 4.8 20-30 840 g ae/ha 0 4 0 30.0 4.1 25-35 1680 g ae/ha 0 4 0 35.0 5.8 30-40 3360 g ae/ha 0 4 0 31.3 2.5 30-35 TraP8::dgt-28 (pDAB107545) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 4 0 0 0.0 0.0 0 840 g ae/ha 4 0 0 2.5 2.9 0-5 1680 g ae/ha 4 0 0 9.3 3.4 5-12 3360 g ae/ha 4 0 0 10.5 1.0 10-12 TraP23::dgt-28 (pDAB107553) 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 4 0 0 0.0 0.0 0 840 g ae/ha 4 0 0 6.3 2.5 5-10 1680 g ae/ha 4 0 0 10.0 0.0 10 3360 g ae/ha 3 1 0 13.8 4.8 10-20 Petite havana 0 g ae/ha glyphosate 4 0 0 0.0 0.0 0 420 g ae/ha 0 0 4 95.0 0.0 95 840 g ae/ha 0 0 4 98.8 1.0 98-100 1680 g ae/ha 0 0 4 99.5 1.0 98-100 3360 g ae/ha 0 0 4 100 0.0 100
[0300] The data demonstrate robust tolerance of dgt-28 tobacco up to 3360 g ae/ha glyphosate through two generations compared to the non-transformed control.
[0301] Selected plants from each event were sampled prior to glyphosate applications for analyses of the DGT-28 protein by standard DGT-28 ELISA. Data demonstrated DGT-28 mean protein expression of the simple (1-2 copy) lines across constructs ranging from 72.8-114.5 ng/cm.sup.2. Data demonstrates dgt-28 is expressing protein in the T.sub.2 generation of transformed tobacco and tolerance data confirms functional DGT-28 protein.
[0302] Stacking of Dgt-28 to Increase Herbicide Spectrum in Tobacco (Cv. Petit Havana).
[0303] Homozygous dgt-28 (pDAB107543 and pDAB107545) and aad-12 v1 (pDAB3278) plants (see PCT/US2006/042133 for the latter, which is incorporated herein by this reference in its entirety) were both reciprocally crossed and F.sub.1 seed was collected. The F.sub.1 seed from two reciprocal crosses of each gene were stratified and treated 6 reps of each cross were treated with 1120 g ae/ha glyphosate (selective for the dgt-28 gene), 1120 g ae/ha 2,4-D (selective for the aad-12 gene), or a tank mixture of the two herbicides at the rates described. Plants were graded at 14 DAT. Spray results are shown in Table 27.
TABLE-US-00027 TABLE 27 Response of F.sub.1 aad-12 and dgt-28 aad-12 aad-12 TraP4::dgt-28 TraP8::dgt-28 Petite havana Application Rate Tolerance 1120 g ae/ha 2,4-D ++++ ++++ 1120 g ae/ha glyphosate ++ ++ 1120 g ae/ha 2,4-D + ++ ++ 1120 g ae/ha glyphosate
[0304] The results confirm that dgt-28 can be successfully stacked with aad-12 (v1), thus increasing the spectrum herbicides that may be applied to the crop of interest (glyphosate+phenoxyactetic acids for dgt-28 and aad-12, respectively). In crop production where hard to control broadleaf weeds or resistant weed biotypes exist the stack can be used as a means of weed control and protection of the crop of interest. Additional input or output traits could also be stacked with the dgt-28 gene.
[0305] Resistance to Glyphosate in Wheat.
[0306] Production of binary vectors encoding DGT-28. Binary vectors containing DGT-28 expression and PAT selection cassettes were designed and assembled using skills and techniques commonly known in the art. Each DGT-28 expression cassette contained the promoter, 5 untranslated region and intron from the Ubiquitin (Ubi) gene from Zea mays (Toki et al Plant Physiology 1992, 100 1503-07), followed by a coding sequence consisting of one of four transit peptides (TraP4, TraP8, TraP23 or TraP5) fused to the 5 end of a synthetic version of the 5-enolpyruvylshikimate-3-phosphate synthase gene (DGT-28), which had been codon optimized for expression in plants. The DGT-28 expression cassette terminated with a 3 untranslated region (UTR) comprising the transcriptional terminator and polyadenylation site of a lipase gene (Vp1) from Z. mays (Paek et al Mol Cells 1998 30; 8(3) 336-42). The PAT selection cassette comprised of the promoter, 5 untranslated region and intron from the Actin (Act1) gene from Oryza sativa (McElroy et al The Plant Cell 1990 2(2) 163-171), followed by a synthetic version of the phosphinothricin acetyl transferase (PAT) gene isolated from Streptomyces viridochromogenes, which had been codon optimized for expression in plants. The PAT gene encodes a protein that confers resistance to inhibitors of glutamine synthetase comprising phophinothricin, glufosinate, and bialaphos (Wohlleben et al Gene 1988, 70(1), 25-37). The selection cassette was terminated with the 3 UTR comprising the transcriptional terminator and polyadenylation sites from the 35s gene of cauliflower mosaic virus (CaMV) (Chenault et al Plant Physiology 1993 101 (4), 1395-1396).
[0307] The selection cassette was synthesized by a commercial gene synthesis vendor (GeneArt, Life Technologies) and cloned into a Gateway-enabled binary vector. The DGT-28 expression cassettes were sub-cloned into pDONR221. The resulting ENTRY clone was used in a LR Clonase II (Invitrogen, Life Technologies) reaction with the Gateway-enabled binary vector encoding the phosphinothricin acetyl transferase (PAT) expression cassette. Colonies of all assembled plasmids were initially screened by restriction digestion of purified DNA using restriction endonucleases obtained from New England BioLabs (NEB; Ipswich, Mass.) and Promega (Promega Corporation, WI). Plasmid DNA preparations were performed using the QlAprep Spin Miniprep Kit (Qiagen, Hilden) or the Pure Yield Plasmid Maxiprep System (Promega Corporation, WI), following the instructions of the suppliers. Plasmid DNA of selected clones was sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocol (Applied Biosystems, Life Technologies). Sequence data were assembled and analyzed using the SEQUENCHER software (Gene Codes Corporation, Ann Arbor, Mich.).
[0308] The resulting four binary expression clones: pDAS000122 (TraP4-DGT28), pDAS000123 (TraP8-DGT28), pDAS000124 (TraP23-DGT28) and pDAS000125 (TraP5-DGT28) were each transformed into Agrobacterium tumefaciens strain EHA105.
[0309] Production of Transgenic Wheat Events with Dgt-28 Expression Construct.
[0310] Transgenic wheat plants expressing one of the four DGT-28 expression constructs were generated by Agrobacterium-mediated transformation using the donor wheat line Bobwhite MPB26RH, following a protocol similar to Wu et al. Transgenic Research 2008, 17:425-436. Putative T0 transgenic events were selected for phosphinothricin (PPT) tolerance, the phenotype conferred by the PAT selectable marker, and transferred to soil. The T0 plants were grown under glasshouse containment conditions and T1 seed was produced. Overall, about 45 independent T0 events were generated for each DGT-28 expression construct.
[0311] Glyphosate Resistance in to Wheat Dgt-28 Wheat Events.
[0312] T.sub.0 events were allowed to acclimate in the greenhouse and were grown until 2-4 new, normal looking leaves had emerged from the whorl (i.e., plants had transitioned from tissue culture to greenhouse growing conditions). Plants were grown at 25 C. under 12 hour of supplemental lighting in the greenhouse until maturity. An initial screen of glyphosate tolerance and Taqman analyses was completed on T.sub.1 plants grown under the same conditions as previously described. Data allowed for determination of heritable T.sub.1 events to be further characterized. Six low copy (1-2 copy) and two multi-copy T.sub.1 events were replanted under greenhouse conditions and grown until the 3 leaf stage. T.sub.1 plants were sprayed with a commercial formulation of glyphosate (Durango DMA) from a range of 420-3360 g ae/ha, which are capable of significant injury to untransformed wheat lines. The addition of 2% w/v ammonium sulfate was included in the application. A lethal dose is defined as the rate that causes >75% injury to the Bob White MPB26RH non-transformed control. Herbicide was applied.
[0313] In this example, the glyphosate applications were utilized for both determining the segregation of the dgt-28 gene in the T.sub.1 generation as well as demonstrating tolerance to increasing levels of glyphosate. The response of the plants is presented in terms of a scale of visual injury 21 days after treatment (DAT). Data are presented as a histogram of individuals exhibiting less than 25% visual injury (4), 25%-50% visual injury (3), 50%-75% visual injury (2) and greater than 75% injury (1). An arithmetic mean and standard deviation is presented for each construct used for wheat transformation. The scoring range of individual response is also indicated in the last column for each rate and transformation. Wild-type, non-transformed wheat (c.v. Bob White MPB26RH) served as a glyphosate sensitive control. In the T.sub.1 generation hemizygous and homozygous plants were available for testing for each event and therefore were included for each rate of glyphosate tested. Hemizygous plants will contain half of the dose of the gene as homozygous plants, therefore variability of response to glyphosate may be expected in the T.sub.1 generation.
[0314] The results of the T.sub.1 dgt-28 wheat plants demonstrated that tolerance to glyphosate was achieved at rates up to 3360 g ae/ha with the chloroplast transit peptides TraP4, TraP5, TraP8 and TraP23. Table 28. Data are of a low copy T.sub.1 event but are representative of the population for each construct.
TABLE-US-00028 TABLE 28 Response of low copy T.sub.1 dgt-28 wheat events to glyphosate 21 days after treatment. % Injury Application % Injury Std. Range Rate <25% 25-50% 50-75% >75% Ave Dev. (%) TraP4::dgt-28 420 g ae/ha 5 0 0 0 4.00 0.00 4 840 g ae/ha 6 2 0 0 3.75 0.46 3-4 1680 g ae/ha 4 2 0 0 3.67 0.52 3-4 3360 g ae/ha 4 2 0 0 3.67 0.52 3-4 TraP8::dgt-28 420 g ae/ha 5 3 0 0 3.63 0.52 3-4 840 g ae/ha 3 5 0 0 3.38 0.52 3-4 1680 g ae/ha 4 3 0 0 3.57 0.53 3-4 3360 g ae/ha 5 5 0 0 3.50 0.53 3-4 TraP23::dgt-28 420 g ae/ha 9 2 0 0 3.82 0.40 3-4 840 g ae/ha 8 1 0 0 3.89 0.33 3-4 1680 g ae/ha 7 5 0 0 3.58 0.0 3-4 3360 g ae/ha 8 2 0 0 3.80 4.8 3-4 TraP5::dgt-28 420 g ae/ha 5 2 0 0 3.71 0.49 3-4 840 g ae/ha 4 2 0 0 3.67 0.52 3-4 1680 g ae/ha 7 3 0 0 3.70 0.48 3-4 3360 g ae/ha 6 0 0 0 4.00 0.00 3-4 Bobwhite MPB26RH 420 g ae/ha 0 1 1 10 1.25 0.62 1-3 840 g ae/ha 0 0 0 10 1.00 0.00 1 1680 g ae/ha 0 0 0 12 1.17 0.58 1-3 3360 g ae/ha 0 0 0 10 1.00 0.00 1
[0315] At 21 DAT, resistant and sensitive plants are counted to determine the percentage of lines that segregated as a single locus, dominant Mendelian trait (3R:1 S) as determined by Chi square analysis. Table 29. These data demonstrate that dgt-28 is inheritable as a robust glyphosate resistance gene in a monocot species.
TABLE-US-00029 TABLE 29 Percentage of T.sub.1 dgt-28 events by construct that demonstrated heritablity in a mendelian fashion based off of a glyphosate selection at rates ranging from 420-3360 g ae/ha. % T.sub.1 events % T.sub.1 events tested that tested that No. T.sub.1 segregated at a segregated events Construct ID CTP:GOI single locus as 2 loci tested pDAS000122 TraP4::dgt-28 62.5% 37.5% 8 pDAS000123 TraP8::dgt-28 87.5% 12.5% 8 pDAS000124 TraP23::dgt-28 12.5% 87.5% 8 pDAS000125 TraP5::dgt-28 62.5% 0.0% 8
Example 4
Synthetic Chloroplast Transit Peptide (TraP) Sequences for Expression of Agronomically Important Transgenes in Maize
Cry2Aa:
[0316] The Cry2Aa protein from Bacillus thuringiensis has demonstrated activity against Helicoverpa zea (CEW) and Ostrinia nubilalis (ECB). A single version of the cry2Aa gene (SEQ ID NO:13), codon biased for maize, was tested in maize. In this experiment, Cry2Aa was evaluated alone and in conjunction with the TraP23 synthetic chloroplast transit peptide in maize to determine the insect tolerance activity and to evaluate the effect the TraP23 synthetic chloroplast transit peptide sequence would have on the expression of the Cry2Aa protein in maize.
[0317] The Trap23 v2 synthetic chloroplast transit peptide-encoding polynucleotide sequence (SEQ ID NO:12) and a GCA codon linker were cloned upstream of the cry2Aa gene and incorporated into construct pDAB109808 (
[0318] Ears from Zea mays cultivar B104 were harvested 10-12 days post pollination. Harvested ears were de-husked and surface-sterilized by immersion in a 20% solution of commercial bleach (Ultra Clorox Germicidal Bleach, 6.15% sodium hypochlorite) and two drops of Tween 20, for 20 minutes, followed by three rinses in sterile, deionized water inside a laminar flow hood. Immature zygotic embryos (1.8-2.2 mm long) were aseptically excised from each ear and distributed into one or more micro-centrifuge tubes containing 2.0 ml of Agrobacterium suspension into which 2 l of 10% Break-Thru S233 surfactant had been added.
[0319] Upon completion of the embryo isolation activity the tube of embryos was closed and placed on a rocker platform for 5 minutes. The contents of the tube were then poured out onto a plate of co-cultivation medium and the liquid Agrobacterium suspension was removed with a sterile, disposable, transfer pipette. The co-cultivation plate containing embryos was placed at the back of the laminar flow hood with the lid ajar for 30 minutes; after which time the embryos were oriented with the scutellum facing up using a microscope. The co-cultivation plate with embryos was then returned to the back of the laminar flow hood with the lid ajar for a further 15 minutes. The plate was then closed, sealed with 3M Micropore tape, and placed in an incubator at 25 C. with 24 hours/day light at approximately 60 mol m-2 s-1 light intensity.
[0320] Following the co-cultivation period, embryos were transferred to Resting medium. No more than 36 embryos were moved to each plate. The plates were wrapped with 3M micropore tape and incubated at 27 C. with 24 hours/day light at approximately 50 mol m-2 s-1 light intensity for 7-10 days. Callused embryos were then transferred onto Selection I medium. No more than 18 callused embryos were moved to each plate of Selection I medium. The plates were wrapped with 3M micropore tape and incubated at 27 C. with 24 hours/day light at approximately 50 mol m-2 s-1 light intensity for 7 days. Callused embryos were then transferred to Selection II medium. No more than 12 callused embryos were moved to each plate of Selection II. The plates were wrapped with 3M micropore tape and incubated at 27 C. with 24 hours/day light at approximately 50 mol m-2 s-1 light intensity for 14 days.
[0321] At this stage resistant calli were moved to Pre-Regeneration medium. No more than nine calli were moved to each plate of Pre-Regeneration. The plates were wrapped with 3M micropore tape and incubated at 27 C. with 24 hours/day light at approximately 50 mol m-2 s-1 light intensity for 7 days. Regenerating calli were then transferred to Regeneration medium in Phytatrays and incubated at 28 C. with 16 hours light/8 hours dark per day at approximately 150 mol m-2 s-1 light intensity for 7-14 days or until shoots develop. No more than five calli were placed in each Phytatray. Small shoots with primary roots were then isolated and transferred to Shoot/Root medium. Rooted plantlets about 6 cm or taller were transplanted into soil and moved out to a growth chamber for hardening off.
[0322] Transgenic plants were assigned unique identifiers through and transferred on a regular basis to the greenhouse. Plants were transplanted from Phytatrays to small pots filled with growing media (Premier Tech Horticulture, ProMix BX, 0581P) and covered with humidomes to help acclimate the plants. Plants were placed in a Conviron growth chamber (28 C./24 C., 16-hour photoperiod, 50-70% RH, 200 mol light intensity) until reaching V3-V4 stage. This step aids in acclimating the plants to soil and harsher temperatures. Plants were then moved to the greenhouse (Light Exposure Type: Photo or Assimilation; High Light Limit: 1200 PAR; 16-hour day length; 27 C. Day/24 C. Night) and transplanted from the small pots to 5.5 inch pots. Approximately 1-2 weeks after transplanting to larger pots plants were sampled for bioassay. One plant per event was bioassayed.
[0323] Select events were identified for advancement to the next generation based on copy number of the genes, protein detection by Western blot and activity against the bioassay insects. Events that contained the spectinomycin resistance gene were noted, but not necessarily omitted from advancement. Events selected for advancement were transplanted into 5 gallon pots. Observations were taken periodically to track any abnormal phenotypes. Shoot bags were placed over the shoots prior to silk emergence to prevent cross-contamination by stray pollen. Any shoots producing silks prior to covering were noted and the shoot was removed. The second shoot was then covered and used for pollinations. Plants that produced abnormal or no shoots were recorded in the database. Silks were cut back the day prior to pollinations to provide an even brush to accept pollen and the plants were self pollinated.
[0324] Plants for T.sub.1 selection were sprayed at 7 days post sowing. They were grown in 4 pots of Metro 360 potting soil with 15 pots per flat. Seedling growth stage was V1-V1.5. Pots with poor germination or contain very small plants (whorl still closed) were marked so they were not included in the selection assessment. Whole flats of plants were then placed in secondary carrier trays for track sprayer application. Trays were placed two at a time in the Mandel track sprayer, calibrated to deliver a volume 187 L/ha to the target area using an 8002E flat fan nozzle (Tee Jet). A solution of 35 g ae/ha Assure II (quizalofop)+1% COC (crop oil concentrate) was formulated for the application. A volume of 15 mls./spray was used to calculate the total spray solution needed. Calculations; (35 g ae/ha)(1 ha/187L)(1 L/97.7 g ae Assure II)=0.192% solution or 28.74p1/15 ml H.sub.2O+1% v/v). After application, the plants were then allowed to dry for one hour in spray lab before returning to greenhouse. Approximately 1-2 weeks after transplanting to larger pots plants were sampled for bioassay. One plant per event was bioassayed.
[0325] All of the T.sub.0 events that passed the molecular analysis screen were analyzed for Cry2Aa protein expression levels. The Events from the control construct, pDAB107687, which comprised Cry2Aa without a TraP had significantly higher average expression level of Cry2Aa (15.0 ng/cm.sup.2) as compared to Events from pDAB109808 (0.2 ng/cm.sup.2) which contained TraP23. Despite the reduced levels of expression of the pDAB109808 Events, these Events still expressed the Cry2Aa protein.
[0326] Transgenic plants containing single copies of the T-strand comprising a cry2Aa gene were tested for insecticidal activity in bioassays conducted with neonate lepidopteran larvae on leaves from the transgenic plants. The lepidopteran species assayed were the European Corn Borer, Ostrinia nubilalis (Hubner) (ECB), and the Corn Earworm, Helicoverpa zea (CEW).
[0327] 32-well trays (C-D International, Pitman, N.J.) were partially filled with a 2% agar solution and agar was allowed to solidify. Leaf sections approximately one in two were taken from each plant and placed singly into wells of the 32-well trays. One leaf piece was placed into each well, and two leaf pieces were tested per plant and per insect. Insects were mass-infested using a paintbrush, placing ten neonate larvae into each well. Trays were sealed with perforated sticky lids which allowed ventilation during the test. Trays were placed at 28 C., 40% RH, 16 hours light: 8 hours dark for three days. After the duration of the test, a simple percent damage score was taken for each leaf piece. Damage scores for each test were averaged and used alongside protein expression analysis to conduct correlation analyses.
[0328] The results of the bioassay indicated that the TraP23 synthetic chloroplast transit peptide sequence was functional as the pDAB109808 Events provided protection against the insects tested in bioassay. In the transgenic Events, the plants expressing the Cry2Aa protein without a TraP, (pDAB107687) had a mean leaf damage that was significantly greater than the plants expressing the Cry2Aa protein with a TraP23 (pDAB109808) across all insect species tested. Although the pDAB109808 Events with TraP23 had more leaf damage as compared to the Events without a TraP, the pDAB109808 Events provided protection against the insects that were bioassayed.