Abstract
The present invention relates to: a lysyl tRNA synthetase (KRS) fragment which comprises an amino acid sequence represented by SEQ ID NO: 1 and is secreted from cancer cells; microvesicles comprising the KRS fragment; and a method for providing information necessary for cancer diagnosis and screening a cancer metastasis inhibiting agent using the same. The present invention can be favorably used in the development of a diagnostic kit for providing information necessary for cancer diagnosis or the development of a cancer metastasis inhibiting agent, and thus is highly industrially applicable.
Claims
1. A lysyl tRNA synthetase fragment comprising an amino acid sequence represented by SEQ ID NO: 1 and being secreted from cancer cells.
2. Microvesicles comprising the lysyl tRNA synthetase fragment of claim 1 and being secreted from cancer cells.
3. The microvesicles of claim 2, wherein the microvesicles are exosomes.
4. The microvesicles of claim 2, wherein the cancer is at least one selected from the group consisting of breast cancer, colorectal cancer, lung cancer, small cell lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid carcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma, and pituitary adenoma.
5. A method for providing information necessary for the diagnosis of cancer, the method comprising: (a) isolating microvesicles from a biological sample taken from a suspected cancer subject; (b) disrupting the microvesicles in step (a) to measure the level of the lysyl tRNA synthetase fragment of claim 1 or the expression level of a gene encoding the fragment; and (c) comparing the level of the fragment or the expression level of the gene encoding the fragment with the level of the fragment or the expression level of the gene encoding the fragment in a normal control sample.
6. A method for screening a cancer metastasis inhibiting agent, the method comprising: (A) bringing a lysyl tRNA synthetase (KRS) or a KRS fragment comprising the C-terminal region thereof, syntenin, and a test agent into contact with one another; (B) measuring a change in the binding level of the KRS or fragment thereof and syntenin; and (C) bringing the test agent, which is determined to change the binding level of the KRS or fragment thereof and syntenin, into contact with cancer cells, to evaluate whether the microvesicles of claim 2 are secreted from the cancer cells.
7. The method of claim 6, wherein the C-terminal region of the lysyl tRNA synthetase (KRS) in step (A) consists of the amino acid sequence of SEQ ID NO: 6.
8. The method of claim 6, wherein the KRS fragment in step (A) consists of the amino acid sequence of SEQ ID NO: 1.
9. The method of claim 6, wherein the syntenin in step (A) is a polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
10. The method of claim 6, the method further comprises (D) administering the test agent, which is determined to inhibit the secretion of the microvesicles of claim 2 in step (C), to an animal with cancer, to evaluate whether the test agent exhibits an effect of preventing or treating cancer metastasis.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0102] FIG. 1a illustrates western blot results verifying that N-terminus was truncated when KRS was secreted extracellularly. Myc-KRS or KRS-myc to be expressed was transfected into HCT116 cells, and after 24 hr, the transfectants were incubated with serum starvation media with or without TNF- (10 ng/ml) for 12 hr. Secreted proteins were precipitated with TCA, and monitored by western blot using anti-myc antibody (WCL: whole cell lysate).
[0103] FIG. 1b illustrates results verifying that N-terminus was truncated when KRS was secreted extracellularly using strep-KRS-myc plasmid. The strep-KRS-myc plasmid was transfected into HCT116 cells, and after 24 hr, the transfectants were incubated in serum starvation media with or without TNF- (10 ng/ml) for 12 hr. Secreted proteins were precipitated with TCA, and monitored by western blot using anti-STREP antibody and anti-myc antibody (WCL: whole cell lysate).
[0104] FIG. 1c illustrates results verifying the cleavage between 12-13 a.a. in KRS protein. Myc-KRS wild type and myc-.box-tangle-solidup.N12 (13-597 a.a. mutant) were transfected into HCT116 cells, and after 24 hr, the transfectants were incubated with serum starvation media with or without TNF- (10 ng/ml) for 12 hr. Secreted proteins were precipitated with TCA, and monitored by western blot using anti-myc antibody (WCL: whole cell lysate).
[0105] FIG. 1d illustrates results investigating the amount of KRS truncation for a pre-determined time in serum starvation condition or serum starvation+TNF-alpha condition, respectively. GFP-KRS was overexpressed in HCT116 cells, and after 24 hr, the cells were incubated with serum starvation media with or without TNF- (10 ng/ml) for 0, 30, and 60 min. Thereafter, GFP-KRS and GFP proteins (truncated GFP, N-terminus of KRS being truncated in GFP-KRS conjugate) were detected by western blot using anti-GFP antibody in whole cell lysates.
[0106] FIG. 1e illustrates luciferase assay results investigating the KRS truncation according to serum starvation treatment time. Specifically, it was investigated whether KRS was truncated by the starvation condition by using N-renilla-KRS-C-renilla vector. N-renilla-KRS-C-renilla vector and firefly luciferase vector were transfected into HCT116 cells, and after 24 hr, the transfectants were incubated in serum starvation media according to the time (0 hr, 3 hr, and 6 hr). Then, the renilla/firefly luciferase activity in each sample was determined.
[0107] FIG. 2a illustrates the results of KRS multiple-alignment using BioEdit. Caspase-cleavage consensus and eukaryote-specific expansion domains were indicated in this figure.
[0108] FIG. 2b illustrates western blot results investigating the secretion of KRS by Pan-caspase inhibiting agent. The Pan-caspase inhibiting agent, Z-VAD-FMK (14 uM), was added to starved HCT116 cells. After incubation for 12 hr, KRS secretion was monitored by western blot using anti-KRS antibody (WCL: whole cell lysate).
[0109] FIG. 2c illustrates western blot results investigating the cleavage of KRS by Pan-caspase inhibiting agent. The results show that the intracellular cleavage of KRS was inhibited by Pan-caspase inhibiting agent. GFP-KRS overexpressed cells were incubated in serum starvation media with the pan-caspase inhibiting agent (Z-VAD-FMK, 14 uM) for 1 hr. The cleavage of KRS was detected by western blot using anti-GFP antibody.
[0110] FIG. 2d illustrates the western blot results investigating the secretion of KRS through partial mutation (D12A) of KRS sequence recognized by caspase. That is, KRS-myc wild type (WT) or D12A mutant (variant in which Asp, i.e., 12th amino acid of KRS WT, is replaced with Ala) was used to test whether the secretion of KRS is caspase-dependent. KRS WT with myc-tagged C-terminus or D12A mutant to be expressed was transfected into HCT 116 cells, and after 24 hr, the transfectants were incubated in serum starvation media for 12 hr, and the secretion of KRS was monitored by western blot using anti-myc antibody (WCL: whole cell lysate).
[0111] FIG. 2e illustrates western blot results investigating the cleavage of KRS through partial mutation (D12A) of KRS sequence recognized by caspase. GFP-KRS WT or D12A mutant thereof was transfected and overexpressed in HCT116 cells, and after 24 hr, the transfectants were incubated in serum starvation media for 1 hr. GFP-KRS and cleaved GFP were detected by western blot using anti-GFP antibody.
[0112] FIG. 2f illustrates western blot results investigating the secretion of KRS by the treatment with caspase-3, -6, -8, and -9 inhibiting agents. HCT116 cells were incubated in serum starvation media treated with respective caspase-3, -6, -8, and -9 inhibiting agents (Z-VAD-DQMD (3), Z-VAD-VEID (6), Z-VAD-IETD (8), and Z-VAD-LEHD (9)) for 12 hr, and then, the extracellular secretion of KRS was monitored by western blot using anti-KRS antibody (WCL: whole cell lysate).
[0113] FIG. 2g illustrates western blot results investigating the secretion of KRS by the treatment with caspase-3, -6, -8, -9 siRNA. HCT116 cells were transfected with caspase-3, -6, -8, -9 specific siRNAs and non-specific siRNA control, and after 48 hr, the transfectants were incubated in serum starvation media, and then the secretion of KRS was monitored by western blot using anti-KRS antibody (WCL: whole cell lysate).
[0114] FIG. 2h illustrates western blot results investigating the expression levels of Caspase-3, -6, -8, -9 in serum starvation condition. HCT116 cells were incubated in serum starvation media for a pre-determined time, and then the expression level of each caspase was monitored in protein lysate.
[0115] FIG. 2i illustrates results verifying that the increased caspase-8 leads to an increase in the N-terminus truncation of KRS, by investigating the amount of KRS cleaved in caspase-8 overexpressed condition using western blot. Caspase-8 and GFP-KRS were overexpressed in HCT116 cells, and after 24 hr, the cells were incubated in serum starvation media for 1 hr, and then the cleavage of KRS in intracellular space was monitored by western blot using anti-GFP antibody.
[0116] FIG. 3a illustrates the results of multiple alignment for PDZ binding motif at C-terminus of KRS.
[0117] FIG. 3b illustrates immunoprecipitation and western blot results of the binding of KRS and syntenin-1 in starvation condition and/or TNF-alpha treatment. The results verified that the interaction between KRS and syntenin-1 was induced by starvation. HCT116 cells were incubated in serum starvation media condition or in TNF-alpha containing serum starvation media for 1 hr. The interaction between KRS and syntenin-1 was monitored by immunoprecipitation (IP) of syntenin-1 and western blot using anti-KRS antibody.
[0118] FIG. 3c illustrates western blot results investigating the binding between KRS and syntenin-1 upon the treatment with caspase-8 inhibiting agent. It was verified that the KRS-syntenin-1 interaction was reduced by caspase-8 inhibiting agent treatment. Cells were incubated in serum starvation medium treated with or without caspase-8 inhibiting agent (Z-VAD-IETD), and then the interaction between KRS and syntenin-1 was monitored by immunoprecipitation (IP) of syntenin-1 and western blot using anti-KRS antibody.
[0119] FIG. 3d illustrates results investigating the interaction between KRS and syntenin-1 using D12A mutant. C-terminus myc tagged KRS WT and D12A mutant were transfected and overexpressed in cells, and after 24 hr, the transfectants were incubated in serum starvation media for 1 hr, followed by precipitation using anti-myc antibody, and then KRS-bound syntenin-1 was monitored by western blot (mock: control with empty vector introduced into cells).
[0120] FIG. 3e illustrates results investigating the interaction (binding) of KRS and syntenin-1 using bimolecular fluorescence complementation (BiFC) assay. KRS WT-VN173 or D12A mutant-VN173 and syntenin-1-VC15 were transfected and overexpressed in cells, and after 24 hr, the transfectants were incubated in serum starvation media for 4 hr, and then monitored using fluorescence microscope. Here, one of test groups was treated with caspase-8 inhibiting agent. Flag-KRS was detected by anti-flag-antibody.
[0121] FIG. 3f illustrates western blot results investigating the secretion of KRS by syntenin-1-specific siRNA. It was verified that the secretion of KRS was dependent on syntenin-1. Syntenin-1 was down regulated by syntenin-1 specific siRNA in HCT116 cells. After 48 hr, the cells were incubated in serum starvation media for 12 hr. The secreted KRS was precipitated with TCA, and detected by western blot using anti-KRS antibody (con: siRNA control treatment, syn: syntenin-1 specific siRNA treatment, WCL: whole cell lysate).
[0122] FIG. 3g illustrates western blot results investigating the binding of syntenin-1 and the deletion mutant (.box-tangle-solidup.c5(1-592 a.a)) in which the C-terminus of KRS was truncated. KRS WT and C-terminus deletion mutant (.box-tangle-solidup.c5(1-592 a.a)) were used to investigate the interaction with syntenin-1 and the KRS secretion. HCT116 cells were transfected with KRS WT-myc or deletion mutant (.box-tangle-solidup.c5(1-592 a.a))-myc. After 24 hr, the cell lysate was immunoprecipitated (IP) using anti-syntenin-1 antibody, and then the syntenin-1 bound KRS was monitored in the precipitant by western blot using anti-myc-antibody (WCL: whole cell lysate).
[0123] FIG. 3h illustrates western blot results investigating the effect of KRS deletion mutant (.box-tangle-solidup.c5(1-592 a.a)) on KRS secretion. HCT116 cells were transfected with KRS WT and deletion mutant (.box-tangle-solidup.c5(1-592 a.a)), and after 24 hr, the transfectants were incubated in serum starvation media for 12 hr. Proteins secreted in culture media were precipitated with TCA, and then the amount of secreted KRS was detected by western blot using anti-myc antibody.
[0124] FIG. 4a shows electron microscopy images of microvesicles isolated from KRS-secreted media. HCT116 cells were incubated in serum starvation media for 12 hr, and extracellularly secreted microvesicles were isolated by centrifugation at 100,000 g, and images thereof were checked using electron microscopy.
[0125] FIG. 4b illustrates the mean size of microvesicles isolated from KRS-secreted media. HCT116 cells were incubated in serum starvation media for 12 hr, and microvesicles were isolated from the culture media by centrifugation at 100,000 g. The size of the isolated microvesicles was measured using dynamic light scattering.
[0126] FIG. 4c illustrates results verifying the density of KRS-detected microvesicles using opti-prep gradient assay. HCT116 cells were incubated in serum starvation media for 12 hr, and the microvesicles isolated from the culture media were loaded on the opti-prep gradient to obtain a total of nine fractions, which were then analyzed by western blot using anti-KRS antibody and anti-syntenin-1 antibody.
[0127] FIG. 4d illustrates results verifying that the KRS exosome secretion was dependent on syntenin-1, by monitoring the KRS exosome secretion using western blot after si-syntenin treatment. Syntenin-1 was down regulated by syntenin-1 specific siRNA in HCT116 cells. After 48 hr, the cells were incubated in serum starvation media for 12 hr. Secreted exosomes were purified by centrifugation at 100,000 g, and proteins were monitored by western blot (si-Con: siRNA control treatment having no effect on gene expression, si-syn: syntenin-1 specific siRNA treatment, WCL: whole cell lysate).
[0128] FIG. 4e illustrates western blot results investigating the effect of KRS deletion mutant (.box-tangle-solidup.c5(1-592 a.a)) on KRS exosome secretion. KRS WT-myc or deletion mutant (.box-tangle-solidup.c5(1-592 a.a))-myc was used to investigate the interaction with syntenin-1 and the KRS exosome secretion. HCT116 cells were transfected with KRS WT-myc or deletion mutant (.box-tangle-solidup.c5(1-592 a.a))-myc. After 24 hr, the transfectants were incubated in serum starvation media for 12 hr. The purified exosomes were analyzed by western blot (WCL: whole cell lysate).
[0129] FIG. 4f illustrates western blot results investigating the effect of D12A mutation on KRS exosome secretion. In order to investigate the interaction between KRS truncation and KRS exosome secretion, D12A mutant was used. C-terminus myc tagging KRS WT or D12A mutant thereof was transfected and overexpressed in HCT116 cells. After 24 hr, the transfectants were incubated in serum starvation media for 12 hr, and exosomes were isolated by centrifugation at 100,000 g, and the proteins thereof were monitored by western blot (WCL: whole cell lysate).
[0130] FIG. 5a illustrates TNF-alpha ELISA results investigating TNF-alpha secretion by treatment of macrophages with KRS WT, truncated KRS (.box-tangle-solidup.N12(13-597 a.a)), or KRS exosomes. RAW 264.7 cells were incubated together with 100 nM KRS WT, truncated KRS (.box-tangle-solidup.N12(13-597 a.a)) protein, and KRS exosomes (0.05, 0.5, 5 ug), and the secreted TNF-alpha was analyzed.
[0131] FIG. 5b illustrates results investigating cell migration by treatment of macrophages with KRS WT, truncated KRS (.box-tangle-solidup.N12(13-597 a.a)), or KRS exosomes. The cell migration by KRS exosome treatment was monitored by wound-healing assay. The RAW 264.7 cell monolayer was once scratched, and then treated with 100 nM KRS proteins (WT, .box-tangle-solidup.N12 each) or KRS exosomes (0.05, 0.5, 5 ug) in their respective concentrations. After 12 hr, the cell migration was observed by a microscope.
[0132] FIG. 6a illustrates immunoblotting results of samples obtained by purifying exosomes from si-con or si-KRS treated HCT116 cells.
[0133] FIG. 6b illustrates analysis results of TNF-alpha secretion by TNF-alpha ELISA, when RAW 264.7 cells were incubated together with 100 nM .box-tangle-solidup.N12 KRS protein or exosomes (5 ug/ml) purified from si-con or si-KRS treated HCT116 cells.
[0134] FIG. 6c illustrates analysis results of cell migration effect by transwell migration assay, when RAW 264.7 cells were incubated together with 100 nM .box-tangle-solidup.N12 KRS protein or exosomes (5 ug/ml) purified from si-con or si-KRS treated HCT116 cells (microscopic observation images (left) and quantified percentage of migrated cells (right)).
[0135] FIG. 6d shows intravital images (left) obtained by using KRS WT-myc or D12A mutant-myc overexpressed B16F10 cells and quantified results (right) of green fluorescent intensities on the images. After the B16F10 cells were injected into mouse ears, and then images according to the time were obtained at 0, 30, 60, 90 min (red: cells, green: macrophages and neutrophils).
[0136] FIG. 6e illustrates evaluation results of levels of respective cytokines secreted from macrophages treated with 100 nM KRS proteins (WT, .box-tangle-solidup.N12 each) or KRS exosomes (5 ug/ml), using luminex screening assays (bead-based multiplex kits) (Cont: non-treatment control, Exo: KRS exosome treatment group).
MODE FOR CARRYING OUT THE INVENTION
[0137] Hereinafter, the present invention will be described in detail.
[0138] However, the following examples are merely for illustrating the present invention and are not intended to limit the scope of the present invention.
[0139] <Methods>
[0140] 1. Cell Incubation and Materials
[0141] HCT116 cells were incubated in 5% CO.sub.2 incubator at 37 C. using RPMI media (together with 25 mM HEPES and L-glutamine, Hyclone) supplemented with 10% fetal bovine serum (FBS) and 50 g/mL penicillin and streptomycin. RAW264.7 cells were incubated in 5% CO.sub.2 incubator at 37 C. using high glucose DMEM (together with 2.5 g of porecine trypsin, 4.00 mM L-glutamate, 400 mg/L glutamine, and sodium pyruvate, Hyclone) supplemented with 10% fetal bovine serum (FBS) and 50 pg/mL penicillin and streptomycin. Human TNF-alpha (Sigma, USA) treatment was conducted at a concentration of 10 ng/ml in serum-free condition. si-RNA against syntenin-1 was obtained from Santa Cruz (sc-42164). si-RNA against KRS was obtained from Invitrogen; KRS si-RNA sequence (Cat. No/Lot No. 10620318-277773 C07, C08: KARS shss105656: GGGAAGACCCAUACCCACACAAGUU, AACUUGUGUGGGUAUGGGUCUUCCC). si-RNAs specific to caspase-3, -6, -8, -9 were obtained from Sigma-aldrich. Stealth universal RNAi (Santa Cruz) was used as a non-specific control, and Lipofectamine 2000 Transfection reagent (Invitrogen, Cat. No. 18324-012) was used for transfection according to the manufacturer's protocol. Here, caspase-3 inhibitor (Cat No. 219002), caspase-6 inhibitor (Cat No. 218757), caspase-8 inhibitor (Cat No. 368055), and caspase-9 inhibitor (Cat No. 218776) were obtained from Calbiochem. In addition, the caspase inhibiting agent treatment was conducted at a concentration of 14 uM under serum-free condition.
[0142] 2. Western Blot and Immunoprecipitation
[0143] The cells were lysed with 50 mM Tris-HCl (pH 7.4) buffer containing 150 mM NaCl, 10 mM NaF, 12 mM beta-glycerophosphate, 1 mM EDTA, 1% NP-40, 10% glycerol, and protease inhibiting agent. Then, the supernatant was dissolved in SDS sample buffer, followed by separation using SDS-PAGE. For immunoblotting of endogenous KRS, anti-KRS antibody was used. Antibodies against Hsp90, syntenin-1, GFP, myc, caspase-3, -6, -8, -9, while syntenin-1 were purchased from Santa Cruz, and antibodies against alix were purchased from Cell Signaling. The anti-KRS antibody was manufactured by ordinary procedures in which KRS protein (Genbank Accession No. NP_005539.1) represented by SEQ ID NO: 2 was injected into New Zealand white rabbits to induce immune response and their antibodies were obtained.
[0144] For immunoprecipitation, the cells were lysed at 4 C. in 50 mM HEPES (pH 7.4) buffer containing 150 mM NaCl, 0.5% NP-40, 2 mM EDTA, 5% glycerol and protease inhibiting agent (Calbiochem, San Diego, Calif., USA). Protein extracts were cultured together with protein-specific antibodies thereagainst with stirring at 4 C. In addition, protein G agarose was added. 4 hr after the addition of the protein G agarose, precipitate samples were obtained by centrifugation. The precipitate samples were washed three times for 5 min using cool lysis buffer. The precipitates were separated by SDS-PAGE.
[0145] 3. KRS Secretion Test
[0146] HCT116 cells were incubated in RPMI media containing 10% FBS (Hyclone), and were grown to 60% confluency on 60-mm dish. The cells were washed twice with PBS, incubated in serum-free RPMI media, and treated with 10 ng/ml TNF- for 12 hr. The supernatant of the cell culture liquid was cautiously collected, followed by centrifugation at 500 g for 10 min. The supernatant thus obtained was again centrifuged at 10,000 g for 30 min, thereby removing membrane organelles. Then, 12% TCA was added to the supernatant, followed by culture at 4 C. for 12 hr, so the supernatant was subjected to precipitation treatment. After the precipitation treatment, the supernatant was centrifuged at 18,000 g for 15 min, and the upper part was then discarded and the remaining pellets were neutralized with 100 mM HEPES (pH 8.0), and then 5 sample buffer was added to perform separation using SDS-PAGE. The products separated by SDS-PAGE were western blotted using anti-KRS antibody.
[0147] 4. Preparation of Human Full Length KRS and Truncated KRS Protein (.box-tangle-solidup.N12 KRS)
[0148] First, cDNA encoding Human KRS of SEQ ID NO: 2 was subcloned into pET-28a (Novagen) using restriction enzymes, EcoRI and XhoI, and then was introduced and overexpressed into Escherichia coli BL21 (DE3). Then, his-tagged KRS was purified using nickel affinity (Invitrogen) and Mono Q ion-exchange chromatography according to the manufacturer's protocol. For the removal of lipopolysaccharide (LPS), KRS-containing solution was dialyzed with pyrogen-free buffer. For the removal of still remaining LPS, the KRS solution was again dialyzed with PBS containing 20% glycerol, and filtered through Posidyne membrane (Pall Gelman Laboratory).
[0149] 5. Immunofluorescent Staining
[0150] KRS-VN173 plasmid and syntenin-1-VC155 plasmid were all transduced in HCT116 cells, and the cells were incubated in starvation condition or serum-free condition for 4 hr. The HCT116 cells were located on 9-mm coverslip, fixed using 4% paraformaldehyde, and washed shortly with cool PBS. The cells were incubated in 5% BSA blocking buffer for 1 hr, and DAPI stained for 10 min. The cells were washed six times with cool PBS five times for 5 min for each time, and then mounted on slide glass. Thereafter, the samples were observed using confocal laser scanning microscope A1 (Nikon).
[0151] 6. Microvesicle Isolation
[0152] HCT116 cells were incubated for a predetermined period of time in each treatment condition (especially, serum-starvation condition), and then the media were separated and consecutively centrifuged. Centrifugation was conducted three times at 500 g (10 min), 10,000 g (30 min), and 100,000 g (90 min) to form microvesicle pellets. The amount of microvesicle proteins was determined by using Bradford assay.
[0153] 7. Opti-Prep Gradient Centrifugation
[0154] In order to measure density of microvesicles, microvesicles pelletized at 100,000 g were loaded onto the continuous opti-prep gradient, and then centrifuged at 150,000 g for 15 hr. Nine fractions were obtained, followed by density measurement using a refractive index, and then resuspended using SDS-PAGE sample buffer, and subjected to immunoblotting using specific antibodies.
[0155] 8. Electron Microscopic Observation
[0156] For negative staining, isolated microvesicles were diluted 5-fold with PBS. Following dilution, 5 l was applied to a glow-discharged carbon-coated grid (Harrick Plasma, USA) for 3 min in air, and the grid was negatively stained using 1% uranyl acetate (see Jung, H. S., et. al., Mol. Biol. Cell: 19; 3234-3242, 2008). The same procedure was used for all samples. For immuno-electronic microscopy, the microvesicles were mixed with polyclonal anti-GRS antibody for 6 hr or less, and then were allowed to bind with secondary rabbit antibody conjugated with 6 nm gold particles (JIRE, U.K.). Thereafter, the mixture was left on ice for 12 hr, and then negatively stained as described above. The grids were tested using a Technai G2 Spirit Twin TEM (FEI, USA) operated at 120 kV. Images were recorded on 4K4K Ultrascan 895 CCD (Gatan, USA).
[0157] 9. Dynamic Light Scattering
[0158] The secreted microvesicles were obtained and resuspended in PBS. Thereafter, the particle size was measured by light scattering spectrophotometer ELS-Z (Otsuka Electronics, Japan). Measurement was performed in automatic mode after equilibration for 5 min at 20 C. Data were processed with manufacturer's software in multiple narrow modes.
[0159] 10. BiFC-Renilla Luciferase Assay
[0160] The Renilla Luciferase Reporter Assay System (Promega, Madison, Wis.) was used to measure the luciferase activity. In addition, firefly luciferase vector was used as a control. The luciferase activity was calculated using FLUOstar OPTIMA (BMG LABTECH). After BiFC-renilla luciferase KRS plasmid and firefly luciferase plasmid were introduced, the cells were incubated in serum free media. After the media were removed, the cells were washed using PBS. 80 ul/well of lysis buffer (Promega, Madison, Wis.) was added to each well, and gently stirred at room temperature for 15 min. Cell lysates were harvested, and used for luciferase assay. First, 20 ul of the cell lysate was transferred on the 2 white opaque 96-well plates (Falcon, 353296). In addition, Firefly and Renilla luciferin were transferred on each of the 2 white opaque 96-well plates. After the injector dispensing assay reagent was injected into each well, 2-second pre-measurement delay and thereafter 10-second measurement period were given for each luminescence reading. Luciferase assays were based on the Renilla/Firefly ratio to normalize the number of cells and the transformation efficiency.
[0161] 11. Wound Healing Assay
[0162] RAW264.7 cells were dispensed on the coverslip, and grown to >95% confluency. Subsequently, the RAW 264.7 monolayer was scratched to create wounds, and then the wounds were treated with 100 nM KRS proteins (WT, .box-tangle-solidup.N12) or KRS exosomes (0.05, 0.5, 5 ug) in their respective concentrations, followed by incubation for 12 hr. The cell morphology of cells was observed using microscopy.
[0163] 12. TNF-Alpha Secretion ELISA Assay
[0164] RAW264.7 cells (210.sup.4) were incubated in 24-well plate containing DMEM supplemented with 10% FBS and 1% antibiotic for 12 hr, and starved in serum starvation media for 2 hr. 100 nM KRS protein (WT, .box-tangle-solidup.N12 each) and KRS exosomes (0.05, 0.5, 5 ug) were added, followed by treatment for 6 hr. Thereafter, cell media were collected by centrifugation at 3,000 g for 5 min. TNF-alpha secreted from the cells was detected using the TNF-alpha ELISA kit (Pharmingen, BD Science) according to the manufacturer's protocol.
[0165] 13. Transwell Migration Assay
[0166] The transwell cell culture chamber 24-well plate (6.5 mm insert with 5.0 uM polycarbonate membrane) was purchased from Costar. The 5 uM inserts were coated with 10 uL of 0.5 mg/mL gelatin (Sigma), and dried under UV overnight. RAW264.7 cells were suspended in serum-free DMEM, and added to the inserts at 110.sup.5 cells. Each well was treated with exosomes (5 ug/ml) purified from cells treated with BSA (100 nM), KRS (.box-tangle-solidup.N12) (100 nM), si-control, or si-KRS, and incubated in 5% CO.sub.2 incubator at 37 C. for 8 hr. The inserts were washed twice using cool PBS, and the cells were fixed with a solution containing 70% methanol and 30% PBS for 30 min. Subsequently, the inserts were washed three times with PBS, and stained with hematoxylin (Sigma) for 30 min. The inserts were washed three times with distilled water, and non-migrated cells were removed using the cotton swab. The membrane was collected using a razor blade, and mounted on the microslide using Gel Mount (Biomeda). The images of migrated cells were obtained using Optinity microscope installed with Top view program.
[0167] 14. Intravital Imaging
[0168] 14.1 Imaging System and Imaging Procedure
[0169] In order to visualize that macrophage/neutrophil recruitment was increased by KRS, the custom-built laser-scanning confocal microscope identical to one used in previous study of K. Choe et al., 2013 was used. Three CW lasers for 488 nm (MLD488 60 mW, Cobolt), 561 nm (Jive 50 mW, Cobolt), and 640 nm (MLD640 100 mW, Cobolt) were used as excitation sources. For the implementation of 2D scanning, the fast-rotating polygonal mirror (MC-5, aluminum coated, Lincoln Laser) and galvanometer (6230H, Cambridge Technology) were used. For simultaneous detection of three-color fluorescent signals, the High-sensitive photomultiplier tube (R9110, Hamamatsu) was used. Three detection channels were divided by dichroic mirrors (FF01-442/46-25, FF02-525/50-25, FF01-585/40-25, FF01-685/40-25, Semrock) and bandpass filters (FF484-FDi01, FF560-Di01, FF649-Di01, Semrock). Electric signals obtained from PMT were digitalized by the 8-bit 3-channel frame grabber (Solios, Matrox). The Field of view (FOV) of images obtained from 20 (LUMFLN60XW, NA1.1, Olympus) was 500500 m.sup.2. 512512 pixel images were obtained from the imaging system, and then subjected to XY-shift compensation using Matlab (Mathworks). For accurate adjustment of sample position, the motorized XYZ translational stage (MPC-200-ROE, Sutter Instrument) with 1 m resolution was used during the imaging procedure.
[0170] 14.2 Animal Model
[0171] In the present study, LysM-GFP (Lysozyme M-GFP) mice endogenously exhibiting GFP fluorescence in macrophages and neutrophils were used (N. Faust et al., 2000). 12-20 week-old male LysM-GFP mice were anesthetized by intraperitoneal injection of Zoletil (30 mg/kg) and xylazine (Rompun, 10 mg/kg). The body temperature was maintained at 37 C. using the homeothermic controller (PhysioSuite, RightTemp, Kent Scientific) during the imaging procedure. In order to remove the possibility of occurrence of immune response due to depilation, the mouse ear skin was shaved at least 12 hr prior to imaging.
[0172] 14.3 Intravital Imaging Using Cells
[0173] In order to investigate the effect of KRS secretion increased by tumor cells, B16F10 cells were transfected with KRS-myc, D12A-myc, or empty vector using Lipofectamine 3000 (Invitrogen, 11668027). The transgenic B16F10 cells were fluorescence-labeled with the Vybrant DiD solution (V-22887, Life Technologies), as a lipophilic fluorescent dye, and this procedure was performed by adding 5 L DiD of the solution per 1 ml of cell media and incubating the cells. After washing three times with PBS, the labeled cells were suspended in PBS solution for preparation (0.4 million cells/L). 410.sup.4 cells were injected into the mouse ear skin using the 31G microinjector. In order to visualize macrophage/neutrophil recruitment along the location of the cell injection, time-lapse images were taken by 90 min after the injection at intervals of 30 min.
[0174] 15. Luminex Screening Assays (Bead-Based Multiplex Kits)
[0175] RAW264.7 cells were incubated in 12-well plate using DMEM media containing 10% FBS and 1% antibiotic for 12 hr, and starved in serum starvation media for 2 hr. KRS proteins (WT, .box-tangle-solidup.N12 each) and KRS exosomes (5 ug) in different amounts were respectively added to the media. After 12 hr, conditioned media were collected, and spun down through centrifugation at 3,000 g for 10 min. For multiplex assay, premixed beads for TNF-alpha, mCRG-2, IL-6, mIL-lbeta, mIL-12, mIL-10, MMP9, INF-gamma, mMIP3a, and CXCL10 were purchased from R&D Science, and used according to the manufacturer's protocol. Each sample were analyzed by BioRad Bioplex 200 system and software.
Example 1
Truncation of KRS N-Terminus in KRS Secretion
[0176] It has been known that KRS proteins are secreted from cancer cells to increase TNF-alpha secretion and macrophage migration through macrophage, causing inflammation responses. It has been known that KRS is secreted at the serum starvation, and the secretion of KRS is increased upon a simultaneous treatment of TNF-alpha. Little has been known about how the KRS is secreted. Herein, when Myc-KRS and KRS-myc plasmid were transfected into HCT116 cells and then KRS secretion was observed by western blot, the truncation of its N-terminus was confirmed at the time of KRS secretion (see FIG. 1a). In order to investigate these results, the test was performed after the plasmid composed of KRS with strep-tagged N-terminus and myc-tagged C-terminus was constructed. As a result, it was again verified that the N-terminus of KRS was truncated both when treated with serum starvation and when treated with serum starvation and TNF-alpha together (see FIG. 1b). Herein, in order to ensure the cleaved portion, a preliminary test was performed. As a result, the cleavage between 12th and 13th a.a. was confirmed. In order to verify these results, myc-KRS WT (1-597) or myc-KRS mutant (13-597, also designated by .box-tangle-solidup.N12 and meaning the peptide of SEQ ID NO: 1) was transfected into cells before the secretion test was performed. As a result, the cleavage between 12th and 13th a.a was again confirmed (see FIG. 1c). As stated above, KRS was secreted by starvation, and the KRS secretion was increased by starvation+TNF-alpha. As shown in FIG. 1b, it was verified that the amount of KRS truncation was constant for both cases of starvation and TNF-alpha treatment. In order to investigate those facts again and ensure the signal of KRS truncation, GFP-KRS was used. GFP-KRS was transfected into HCT116 cells, which were then treated with starvation and TNF-alpha. In starvation and TNF-alpha treatments for each time, the amount of KRS truncation was the same (see FIG. 1d). These results verified that starvation is a signal for truncating KRS. In order to ensure the KRS truncation at the time of starvation, N-renilla-KRS-C-renilla plasmid was used. This plasmid has renilla luciferase activity at ordinary times through the combination of one half of renilla at the KRS N-terminus and the other half of renilla at the KRS C-terminus, but has no activity in the absence of any one of the two. N-renilla-KRS-C-renilla plasmid and firefly luciferase plasmid were transfected into HCT116 cells before the test was performed. As a result, it was confirmed that the renilla luciferase activity was reduced according to the time of starvation, and the above results confirmed that the KRS N-terminus was truncated (see FIG. 1e). These results confirmed that the truncation procedure was necessary for the secretion of KRS.
Example 2
KRS Cleaved by Cascase-8
[0177] A large number of proteases exist in cells, and particular proteases recognize their recognizable particular sequences to perform a cleavage procedure. Herein, in order to find KRS-cleaving proteases, it was investigated whether there is any particular sequence in the KRS sequence. As a result of multiple alignment, caspase-cleavable sequences conserved in higher eukaryotes were found (see FIG. 2a). In order to investigate the effect of caspase on KRS, pan-caspase inhibitor was used. It was investigated whether KRS secretion and KRS cleavage were reduced after the treatment with pan-caspase inhibitor. As a result of pan-caspase inhibitor treatment, it was verified that the KRS secretion and KRS cleavage were reduced (see FIGS. 2b and 2c). The secretion of KRS unrecognizable by caspase and the reduction of the KRS cleavage were investigated through partial mutation (D12A) of the KRS sequence recognized by caspase. It could be seen from test results that the secretion and cleavage were reduced for D12A mutant (see FIGS. 2d and 2e). It could be seen through the above two tests that the caspase was involved in the cleavage of KRS and the cleavage by the caspase increased the secretion of KRS. Among various caspases, the sequences of KRS have a possibility of being cleaved by caspase-3, -6, and -8. Particularly, KRS secretion by the treatment with caspase-3, -6, -8, -inhibitors was investigated. It could be seen from test results that only caspase-8 inhibitor inhibited KRS secretion (see FIG. 2f). In addition, from the results of monitoring KRS secretion after the expression level of particular caspase protein was reduced using siRNA, it was verified that the secretion of KRS was reduced only when caspase-8 was reduced, which was identical to the results of tests using caspase inhibitor (see FIG. 2g). If caspase-8 functions to cleave KRS at the time of KRS secretion occurring in starvation environment, there would be a change in the expression level and activity in the starvation environment. It was verified that the amount of caspase-8 was increased over time unlike caspase-3, -6, -9 in the starvation condition inducing the secretion of KRS (see FIG. 2h). When the amount of KRS cleaved after caspase-8 overexpression was investigated using GFP-KRS, it was found that the amount of KRS cleaved was increased with the increasing amount of caspase-8 (see FIG. 2i). The above test results validated that caspase-8 was increased, leading to KRS cleavage in the starvation environment. Through the tests, it was verified that caspase-8 functions to cleave KRS and this cleavage is an important procedure necessary for KRS secretion. The above results validated that a front region of the 13th a.a of the N-terminus is cleaved at the time of KRS secretion, and this procedure is an important key point in the KRS secretion.
Example 3
Binding of Truncated KRS and Syntenin-1
[0178] In order to find an answer to the question why the cleavage of KRS by caspase-8 is important in KRS secretion, cytokine activity of KRS was measured. The reason is that the cytokine activity depends on the cleavage for a protein, such as IL1-beta. Upon testing, it was found that the cytokine activity was identical in WT and .box-tangle-solidup.N12 mutant (13-597 a.a) of KRS. Next, it was assumed that the cleavage of KRS would influence the binding affinity between KRS and another protein. Previous literatures already validated that KRS can bind to syntenin-1. Syntenin-1 is a trafficking protein that functions to move proteins bound thereto inside cells. It has recently been reported that syntenin-1 plays an important role in exosome biogenesis. KRS binds to syntenin-1 through the particular C-terminal sequence thereof. The C-terminus of KRS may be covered by its N-terminus due to its structure characteristics. Therefore, the N-terminus-truncated KRS exposes a larger area of the sequence that binds to syntenin-1, thereby increasing the binding affinity with syntenin. The multiple-alignment confirmed that this portion is also conserved in higher eukaryotes like in the portion cleaved by caspase-8 (see FIG. 3a). In addition, it was verified that the binding of KRS and syntenin-1 was increased by starvation and/or TNF-alpha treatment (see FIG. 3b), and the binding between KRS and syntenin increased by starvation was reduced by the treatment with caspase-8 inhibiting agent (see FIG. 3c). The binding amount of KRS with syntenin-1 was less in D12A, which is not cleaved by caspase-8, than WT (see FIG. 3d). In order to investigate this fact again, the bimolecular fluorescence complementation (BiFC) assay was used. According to the BiFC assay, KRS-vn173 and syntenin-vc155 plasmids, in which the venus proteins cleaved in half bind to KRS and syntenin, respectively, emit the venus (green) fluorescence light only when KRS binds with syntenin. As a result, the BiFC fluorescence was observed at the time of starvation, and the BiFC fluorescence was not observed upon the caspase-8 inhibitor treatment and the use of D12A (see FIG. 3e). The above results confirmed that the cleavage of KRS increased the KRS-syntenin binding. The test regarding the effect of syntenin, which has an increased binding with KRS, on KRS secretion was conducted. As a result of reducing the syntenin protein using si-syntenin, the KRS secretion was definitely reduced compared with the non-reduction of syntenin (see FIG. 3f). In addition, in order to investigate whether the C-terminus of KRS is important in binding with syntenin, deletion mutant KRS with truncated C-terminus (corresponding to 1-592 a.a of the full-length sequence of SEQ ID NO: 2, also designated by .box-tangle-solidup.c5) was constructed to investigate the binding with syntenin. It was verified that the ability of deletion mutant (1-592 a.a, .box-tangle-solidup.c5) to bind with syntenin was significantly deteriorated compared with WT (see FIG. 3g). The degree of secretion was investigated using KRS WT and KRS deletion mutant (1-592 a.a, .box-tangle-solidup.c5) that cannot bind with syntenin. As a result of verification, the amount of secretion was less in the deletion mutant (.box-tangle-solidup.c5) than WT (see FIG. 3h). These results established the fact that the truncation of the N-terminus exposed the syntenin binding motif at the C-terminus of KRS, thereby increasing the binding between syntenin and KRS, and validated that the increased binding with syntenin is important in the KRS secretion.
Example 4
Secretion of Truncated KRS Through Exosome Secretion Pathway
[0179] In order to investigate the extracellular secretion of KRS, only vesicles are isolated from KRS-secreted media, followed by electron microscopy analysis. As a result of electron microscopy analysis, cup-shaped figurations are shown (see FIG. 4a). This shape corresponds to the morphology of exosomes. Exosomes have a cup shape in electron microscopy analysis, and are characterized by having a diameter of 50-150 nm and a density of 1.15-1.19 g/ml. The mean diameter of the isolated vesicles is 147.3 nm, which is also consistent to the characteristics of exosomes (see FIG. 4b). Lastly, when the density was investigated using opti-prep gradient assay, KRS-detected vesicles have a density of approximately 1.09-1.15 g/ml. It was also verified that syntenin is present in the same vesicles (see FIG. 4c). These results validated that KRS was secreted together with syntenin into exosomes. In order to investigate the relationship between KRS exosome secretion and syntenin, KRS exosome secretion was investigated after si-syntenin treatment. As a result, the KRS secretion through exosomes was reduced at the time of si-syntenin treatment (see FIG. 4d). As a result of investigating the exosome secretion using deletion mutant (.box-tangle-solidup.c5, 1-592 a.a) that does not bind with syntenin, the exosome secretion was reduced in deletion mutant (.box-tangle-solidup.c5, 1-592 a.a) in comparison with than WT (see FIG. 4e). It was seen through the above two tests that syntenin does not exist together with KRS in the same exosomes, but is involved in KRS exosome secretion. As shown in FIGS. 3a to 3h, it was validated that the truncation of KRS increased the binding of KRS with syntenin. So, lastly, the exosome secretion of untruncated D12A mutant was compared with that of KRS WT. The secretion levels were significantly reduced in D12A mutant compared with KRS WT (see FIG. 4f). To summarize the results, it can be seen that syntenin is important in KRS exosome secretion, and the truncation of KRS plays an essential role in KRS exosome secretion through syntenin.
Example 5
Enhancement of KRS Exosome Activity by KRS Truncation
[0180] The present inventors investigated that truncated KRS was secreted through exosomes. The exosome is known to be a mediator for cell-cell signaling. The Exosome has various pieces of information with respect to proteins, mi-RNA, tRNA, and the like. Due to these characteristics of the exosome, the information is transferred from a cell to another cell, and due to the transferred information, the cell plays roles different from its original roles. In order to investigate functions of KRS exosomes, KRS WT, truncated KRS (.box-tangle-solidup.N12(13-597 a.a)), and KRS exosomes, respectively, were treated with macrophage for 5 hr to investigate TNF-alpha secretion effects thereof. As a result, it was verified that KRS exosomes have an effect of increasing TNF-alpha secretion, like KRS proteins (see FIG. 5a). These results validated that KRS proteins and KRS exosomes have the same effects. In order to validate this fact again, the increase of migration was investigated using macrophages. The wound-healing assay results verified that the migration of the macrophages was increased 12 hr after the treatment with KRS proteins (WT, .box-tangle-solidup.N12(13-597 a.a) each) and KRS exosomes (see FIG. 5b). KRS exosomes showed the same effect as in the KRS proteins. To sum the results of the above two tests, it was validated that the KRS fragments contained in the KRS exosome are involved in the activity of KRS exosomes, indicating that the truncation of KRS is important in the activity of KRS exosomes. Therefore, it is believed that the KRS truncated by caspase-8 enhances its binding with syntenin to increase the migration into the exosomes, thereby enhancing the activity of KRS exosomes.
Example 6
Cancer Metastasis Effect of .box-tangle-solidup.N12 KRS and Secretary Exosomes Containing the Same
[0181] In order to investigate the importance of KRS in inflammation effects due to exosomes as shown in FIG. 5, cells were first treated with si-RNAs (si-con and si-KRS). At 48 hr after si-RNA treatment, the cells were incubated in serum starvation media for 12 hr. The exosomes were purified in the media, and then proteins existing in each exosome were analyzed (hereinafter, the exosome purified in media of si-con treated cells is named si-con exosome; and the exosome purified in media of si-KRS treated cells is named si-KRS exosome, for convenience). As a result of analysis, it was verified that KRS proteins existing in the exosome was reduced in the exosome purified in si-KRS treated cells (FIG. 6a).
[0182] In order to investigate the reduction of the exosome inflammation effect by the reduced levels of KRS proteins, the TNF-alpha secretion and the migration effect in macrophages were investigated (FIG. 6b and FIG. 6c). As a result of verification, it can be seen that, when macrophages were treated with si-KRS exosomes, the TNF-alpha secretion from macrophages was reduced and the migration effect was reduced (FIG. 6b and FIG. 6c). Therefore, KRS is an important part of the exosome inflammation activity.
[0183] In order to investigate effects of KRS, which is important in the exosome effect, in actual cells and animal models, the intravital confocal visualization of macrophage and neutrophil recruitment test was performed. For the test, B16F10 cell (Mus musculus skin melanoma) was first used. Since immune responses due to a difference in species occur in the mouse test using general human cancer cells, B16F10 cell was used. KRS WT-myc and KRS D12A-myc were transfected in B16F10 cells, followed by incubation for 24 hr. After 24 hr, the respective cells were injected at 410.sup.4 into the back skin of the ears in LysM-GFP (Lysozyme M-GFP) mice (mice having GFP-expressed macrophages and neutrophils). After the injection, the recruitment of macrophages and neutrophils was verified during the time course. The recruitment of, at the maximum, twice as many macrophages and neutrophils was confirmed when KRS WT-myc was injected into the transgenic cells than when KRS D12A-myc was injected (FIG. 6d). These results again established the fact that KRS is important in cancer related inflammation through exosomes.
[0184] In order to investigate accurate mechanisms of inflammation by KRS, various inflammatory cytokine secretion types were investigated using KRS proteins (KRS-WT, KRS.box-tangle-solidup.N12) and KRS exosomes. As shown in FIG. 6e, it was found that KRS proteins and KRS exosomes induced the secretion of IL-6, mCRG-2, and MMP9 as well as TNF-alpha from macrophages. Mouse CRG-2 is a protein pertaining to cxc chemokines, and functions to enhance the macrophage recruitment. It has been reported that a large number of macrophages are associated with cancer metastasis and poor prognosis in actual tumor microenvironments. IL-6 acts on cancer cells to lower E-cadherin. The reduction of E-cadherin is one of the important procedures of cancer metastasis, and is one of the important markers for the epithelial-mesenchymal transition (EMT) mechanism that increases cancer cell motility. MMP9 plays an important role in extracellular matrix degradation and vascular remodeling. Therefore, it can be seen that the cytokines secreted from macrophages by KRS-expressed exosomes (that is, KRS exosomes) help the metastasis of all cancer cells. That is, the inflammation reaction occurring by KRS-expressed exosomes is anticipated to help the cancer cell metastasis, and KRS having an important role in exosome activity is thought to play an important role in cancer metastasis.
INDUSTRIAL APPLICABILITY
[0185] As set forth above, the present invention is directed to a lysyl tRNA synthetase (KRS) fragment comprising the amino acid sequence represented by SEQ ID NO: 1 and being secreted from cancer cells, microvesicles containing the KRS fragment, and methods for providing information necessary for the diagnosis of cancer and screening a cancer metastasis inhibiting agent using the same. The present invention can be favorably used in the development of a diagnostic kit for providing information necessary for diagnosis of cancer or the development of a cancer metastasis inhibiting agent, and thus the present invention is highly industrially applicable.
