NANOPARTICLES COMPRISING AMINOACYL TRNA SYNTHETASE AND ANTICANCER COMPOSITION COMPRISING SAME

20170072031 ยท 2017-03-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to nanoparticles comprising aminoacyl tRNA synthetase and an anticancer composition comprising the same and, specifically, to nanoparticles which comprise glycyl-tRNA synthetase (GRS), leucyl-tRNA synthetase (LRS), and isoleucyl-tRNA synthetase (IRS), and have anticancer or immunostimulating activity; a pharmaceutical composition for preventing or treating cancer, comprising the nanoparticles as an active ingredient; a composition for immunostimulation; and a method for preparing the nanoparticles.

    Claims

    1. nanoparticles comprising glycyl-tRNA synthetase (GRS), leucyl-tRNA synthetase (LPS), and isoleucyl-tRNA synthetase (IRS) and possessing an activity of treating cancer or enhancing immune function.

    2. The nanoparticles of claim 1, wherein the GRS comprises an amino acid sequence represented by SEQ ID NO: 1. the LRS comprises an amino acid sequence represented by SEQ ID NO: 2, and the IRS comprises an amino acid sequence represented by SEQ ID NO: 3.

    3. The nanoparticles of claim 2, wherein the 390.sup.th amino acid cysteine in the amino acid sequence of SEQ Id NO: 1 is palmitoylated-4.

    4. A pharmaceutical composition for preventing or treating cancer, the composition comprising the nanoparticles of claim 1 as an active ingredient.

    5. The pharmaceutical composition of claim 4, wherein the cancer is at least one selected from the group consisting of breast cancer, colorectal cancer, lung cancer, small cell lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, eye tumor, peritoneal cancer, uterine cancer, ovarian cancer, rectal cancer, anal cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid carcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, testicular cancer, oral cancer, gallbladder cancer, cholangiocarcinoma, chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma, and pituitary adenoma.

    6. A method for preparing the nanoparticles of claim 1, the method comprising: (a) applying apoptotic stress to cells; and (b) collecting nanoparticles secreted from the cells in step (a).

    7. The method of claim 6, wherein the apoptotic stress is at least one selected from the group consisting of oxygen deficiency, glucose starvation, Fas ligand treatment, tumor necrosis factor- (TNF-) treatment, TNF- treatment, TNF-related apoptosis inducing ligand (TRAIL) treatment, perforin treatment, Bax protein treatment, Bak protein treatment, and adriamycin treatment.

    8. The method of claim 6, wherein the cells in step (a) are immune cells.

    9. A method for preparing the nanoparticles of claim 1, the method comprising: (a) co-culturing cells and cancer cells; and (b) collecting nanoparticles secreted from the cells in step (a).

    10. The method of claim 6, the method further comprising (c) differentiating exosomes from the nanoparticles collected in step (b).

    11. The method of claim 10, wherein the exosomes comprise at least one marker selected from the group consisting of syntenin-1, CDS, CD63, and CD81.

    12. The nanoparticles of claim 1, wherein the nanoparticles further comprise vimentin and insulin-like growth factor 2 receptor (IGF2R).

    13. A pharmaceutical composition for enhancing immune function, the composition comprising the nanoparticles of claim 1 as an active ingredient.

    14. The pharmaceutical composition of claim 13, wherein the nanoparticles further comprise actin-related protein 2/3 complex (Arp2/3 complex).

    15. The nanoparticles of claim 1, wherein the nanoparticles are not exosomes.

    16. A method for preventing or treating cancer, the method comprising administering an effective amount of the nanoparticles of claim 1 to a subject in need thereof.

    17. Use of the nanoparticles of claim 1 for preparing an agent for preventing or treating cancer.

    18. A method for enhancing immune function, the method comprising administering an effective amount of the nanoparticles of claim 1 to a subject in need thereof.

    19. Use of the nanoparticles of claim 1 for preparing an agent for enhancing immune function.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0075] FIG. 1a illustrates MTT assay results of cell viability when cancer cells (H460) and macrophages (RAW264.7) were treated with ARS-SPs according to the present invention in different amounts for 24 h, confirming the anticancer effect of APS-SP (Error bar indicates meanstandard deviation from average three times of repeated tests).

    [0076] FIG. 1b illustrates the anticancer effect (cytotoxic effects) of ARS-SP according to the present invention on several cancer cell lines when various cancer cell lines were treated with 10 g/ml of ARS-SPs for 48 h.

    [0077] FIG. 2a illustrates a change in tumor volume over time after xenograft mouse models were treated with ARS-SPs according to the present invention at a dose of 6 mg/kg/day once a day for 4 days (arrows indicate the date when PBS (control) or ARS-SPs were injected into xenograft mouse models).

    [0078] FIG. 2b illustrates tumor weight of xenograft mouse models, which were treated with ARS-SPs according to the present invention at a dose of 6 mg/kg/day once a day for 4 days and then sacrificed on day 17 of the mouse model construction.

    [0079] FIG. 2c illustrates a change in body weight over time of mouse models alter the xenograft mouse models were treated with AHS-SPs according to the present invention at a dose of 6 mg/kg/day once a day for 4 days.

    [0080] FIG. 3a illustrates the proteomics profile of ARS-SP according to the present invention, showing the numbers of proteins distinctively identified from particles obtained from glucose-containing medium (Glucose +) and glucose-deprived medium (Glucose ) and the relation of sets (red circle: 3, containing glucose; green circle: 91, deficient in glucose).

    [0081] FIG. 3b illustrates the confirmatory results of the presence of exosome markers (ALB, ANXA2, CD63, CD81, CD9, PDCD6IP, SDCBP, YKHAE, YWHAZ) from ARS-SP (SNAP) according to the present invention.

    [0082] FIG. 3c illustrates comparative results between proteins predominantly identified in ARS-SP and proteins frequently found in exosomes derived from different types of cells.

    [0083] FIG. 4a illustrates immunoblotting results of investigating the presence of GRS and gp96 proteins in the medium obtained after RAW264.7 cells were cultured in the glucose-deprived medium, and in the pellets isolated from the medium, in order to determine characteristics of ARS-SPs isolated and obtained from macrophages cultured in the apoptotic stress environment (glucose-deprived medium) (WCL: whole cell lysate).

    [0084] FIG. 4b illustrates the particle size range of ARS-SPs according to the present invention, which are isolated and obtained from macrophages cultured in the glucose-deprived medium, as determined by dynamic light scattering.

    [0085] FIG. 4c illustrates results determined by immune-blotting using GRS as a representative marker, whether ARS-SPs according to the present invention were produced in the same manner when apoptotic stresses including adriamycin treatment, glucose-deprived medium, and Fas ligand (FasL) were applied to cells, respectively.

    [0086] FIG. 4d illustrates results of specific density of ARS-SPs according to the present invention, by analyzing, through immunoblotting, the presence of GRS in each sucrose density gradient fraction when fractionation using sucrose density gradient was performed on pellets from the medium obtained after macrophages were cultured in the glucose-deprived medium.

    [0087] FIG. 4e illustrates immunoblotting results of the presence of exosome marker, syntenin-1, in the medium obtained after macrophages were cultured in the glucose-deprived medium for 4 hr (Glu ()) or cultured in the serum-free condition for 18 hr (SF 18 hr) (con: glucose-containing media, WCL: whole cell lysate).

    [0088] FIG. 4f illustrates electron microscopic results of the morphology of ARS-SP particles, after ARS-SP fractions from the medium obtained by the culture of macrophages in the glucose-deprived medium were negative-stained.

    [0089] FIG. 4g illustrates results of the localization of GRS, determined by immune-gold labeling of GRS using anti-GRS antibody conjugated with gold particles when ARS-SP fractions from the medium obtained after the culture of macrophages in the glucose-deprived medium were observed through negative staining and electron microscopy (scale bar: 100 nm).

    [0090] FIG. 4h illustrates the results of the morphology of ARS-SP particles by observing ARS-SP fractions from the medium obtained after the culture of macrophages in the glucose-deprived medium, using cryo-electron microscopy.

    [0091] FIG. 5a illustrates the results of the presence of GRS proteins after ARS-SPs were treated with and without trypsin, in older to investigate whether GRS was exposed to the surface of ARS-SP nanoparticles (WCL: whole cell lysate).

    [0092] FIG. 5b illustrates results of the presence (localization) of GRS by the biotinylation of ARS-SP and the immunoprecipitation using streptavidin-agarose beads, in order to investigate the localization of GRS in ARS-SP according to the present invention (Glu: glucose-deprived () medium or glucose-containing (+) medium condition).

    [0093] FIG. 5c is a schematic diagram of functional domains of GRS (WHEP, C: catalytic domain, and ABD: anticodon binding domain), indicating the locations of cysteine residues (390.sup.th cysteine and 471.sup.st cysteine) which are predicted to be important in the palmitoylation of GRS.

    [0094] FIG. 5d illustrates the results investigating whether palmitoylation was involved in the secretion of GRS, using the modified metabolic labeling method.

    [0095] FIG. 5e illustrates the results showing the effect of 2-bromo-palmitate (2-BP) on the secretion of GRS after cells were treated with a palmitoylation inhibitor 2-BP in order to test whether palmitoylation is necessary for GRS secretion (Glu: glucose-deprived () medium or glucose-containing (+) medium condition, HCL: whole cell lysate).

    [0096] FIG. 5f illustrates LC-MS/MS assay results for the determination of palmitoylation sites in GRS and the sites of palmitoylation determined therefrom.

    [0097] FIG. 5g illustrates the results investigating the attachment of palmitic acid and the secretion through ARS-SP according to the present invention in C390S and C471S mutants of GRS (EV: empty vector, WT: GRS wild type).

    [0098] FIG. 5h illustrates the results investigating the secretion degree of ARS-SP according to the present invention in C390S and C471S mutants of GRS, where GRS was used as a representative marker in order to investigate the secretion of ARS-SP (EV: empty vector, WT: GRS wild type).

    [0099] FIG. 6a shows the analysis results of co-localization of GRS with Lysosome tracker.

    [0100] FIG. 6b shows the analysis results of co-localization of GRS with ER tracker.

    [0101] FIG. 6c shows the immunofluorescence staining results of the intracellular GRS-foci formation according to the treatment of cells with a palmitoylation inhibitor, 2-bromo-palmitate (2-BP) (anti-GRS antibody (green) and DAPI (blue)).

    [0102] FIG. 7a illustrates the immunoblotting results of the presence of IGF2R and vimentin in ARS-SP according to the present invention (indicated as SNAP) (WCL: whole cell lysate).

    [0103] FIG. 7b illustrates the results of the effect of ARS-SP according to the present invention (indicated as SNAP) on cancer cell viability when the ARS-SPs were isolated after the expressions of IGF2R and vimentin were inhibited using siRNA specific thereto (Among the siRNA treatments, I means si-IGF2R treatment and V means si-vimentin treatment; GRS Ab means treatment of cells with anti-GRS antibody).

    [0104] FIG. 8a shows an electron microscopic image of cancer cells (H460) which were treated with ARS-SPs according to the present invention and, after 10 min, chemically fixed. The images display the plasma membrane with its intra- and extracellular regions, while black arrowheads point ARS-SPs (scale bar=200 nm).

    [0105] FIG. 8b shows an electron microscopic image of cancer cells (H460) that were treated with ARS-SPs according to the present invention and, after 10 min, chemically fixed. The images display the plasma membrane with its intra- and extracellular regions, while the black arrowhead points ARS-SP (scale bars=100 nm).

    [0106] FIG. 8c shows an electron microscopic image of cancer cells (H460) that were treated with ARS-SPs according to the present invention and, after 10 min, chemically fixed. The images display the plasma membrane with its intra- and extracellular regions, while black arrowheads point ARS-SP (scale bar=200 nm).

    [0107] FIG. 8d illustrates the results of cryo-fixation electron microscopy of immuno-gold labeled ARS-SPs absorbed by cancer cells (H460), indicating that endocytosed ARS-SPs actually contain GRS. ARS-SP-treated H460 cells were cryo-fixed and immuno-stained with anti-GRS antibody. For tomography, proper images of each sample were recorded over by increasing the angle range from 60 to +60 by 2. Each numerical value means the angle of the proper sample (left). The proper images were aligned, and then used for constructing tomograms. Each numerical value indicates the order of tomographic slices (middle). The plasma membrane and ARS-SPs were shown by yellow and blue lines, respectively (right). Scale bar=100 nm, PM: plasma membrane.

    [0108] FIG. 8e illustrates the results of 3D electron tomography of immuno-gold labeled ARS-SPs absorbed by cancer cells (H460), indicating that endocytosed ARS-SPs actually contain GRS.

    [0109] FIG. 8f illustrates the results of the secretion of ARS-SP from macrophages by cancer cell challenge.

    [0110] FIG. 8g illustrates the observation results of the passage of ARS-SPs into cancer cells from macrophages, using the transwell chamber. Specifically, DiI-labeled RAW264.7 and H460 cells were seeded in upper and lower chambers of the transwell (0.4 mm pore size), respectively. After co-culturing for 60 min, DiI-labeled ARS-SPs (red) originated from macrophages in the lower chamber and the cell saturation degree (bright region) of cancer cells were observed by a fluorescence microscope (scale bar=50 m, MAC+: macrophage treatment in the upper chamber, MAC: macrophage non-treatment in the upper chamber).

    [0111] FIG. 5 illustrates the results of immune-gold staining and 3D tomography of GRS, indicating that, when macrophages were treated with ARS-SPs according to the present invention (indicated as SNAPs), the ARS-SP nanoparticles were absorbed into the macrophages by endocytosis (PM: plasma membrane).

    [0112] FIG. 10a illustrates the results of cytokine profiles determined by multiplex cytokines assay. RAW264.7 cells were treated with GRS (100 nM) or ARS-SPs (10 mg/ml) for 6 hr. The cell culture media were collected, while secreted cytokines were measured.

    [0113] FIG. 10b illustrates the ELISA results of the concentration-dependent effect of ARS-SP (SNAP) on the secretion of TNF- and IL-10.

    [0114] FIG. 10c illustrates the results of the secretion of TNF- induced by the treatment of ARS-SPs or GRS in the bone marrow-derived macrophage (BMDM). Isolated BMDM cells were cultured together with ARS-SPs or GRS for 6 hr. The secretion of TNF- and IL-10 was determined by ELISA (LPS: lipopolysaccharide-treated positive control).

    [0115] FIG. 10d illustrates the qRT-PCR analysis results of the expression levels of transcripts of TNF- and IL-10 (M1 markers) in BMDM treated with ARS-SPs or GRS for 4 hr (LPS: lipopolysaccharide-treated positive control).

    [0116] FIG. 10e illustrates the ELISA results of TNF- secreted in the culture medium after macrophages were treated with ARS-SPs (SNAPs) or GRS which were pre-incubated with anti-GRS antibody for 30 min.

    [0117] FIG. 10f illustrates the ELISA results of the secretion of TNF- after macrophages (RAW264.7) and cancer cells (H460) were co-cultured. In order to investigate the effect of GRS in the co-cultured samples, anti-GRS antibody was added to the co-cultured medium.

    [0118] FIG. 10g illustrates the immunoblotting results of MHCII, which is the M1 polarization marker protein, and CD206, which is the M2 polarization marker protein, after RAM264.7 cells were cultured together with ARS-SPs or GRS for 12 hr (LPS: lipopolysaccharide treated positive control).

    [0119] FIG. 10h illustrates the qRT-PCR analysis results of the expression levels of transcripts of iNOS and Arginase II (M2 markers) in BMDM treated with ARS-SPs or GRS for 4 hr. Error bar indicates meanstandard deviation from average three times of repeated tests (LPS: lipopolysaccharide treated positive control).

    [0120] FIG. 10i illustrates the results or the presence of Arpo2, GRS, and HSP90 in ARS-SPs (SNAPs) by immunoblotting using antibodies specific thereto. CD63 (one of exosome markers) was used as negative control (Glu: meaning glucose-deprived () medium or glucose-containing (+) medium condition, WCL: whole cell lysate).

    [0121] FIG. 10j illustrates the results of the fluorescence intensity by the microplate reader in order to quantify phagocytosis (phagocytic ability) induced by ARS-SP (SNAP) or GRS (Mac: macrophages). Error bar indicates meanstandard deviation from an average of three times of repeated tests.

    [0122] FIG. 11a illustrates the observation results of phagocyte inducing action of ARS-SP in vivo. ARS-SPs (SNAPs) or GRS was intradermally injected into the skin of LyzM-GFP mice. After 6 hr, Alexa594-conjugated bioparticles (red) were injected, and phagocytic activity of macrophages/neutrophils (LyzM, green) was visualized using custom-built, confocal microscopy for 90 min. scale bar=100 nm

    [0123] FIG. 11b illustrates the comparison of the Z stack analysis results (left) of the co-localization of GRS-treated macrophages (green) with phagocytic beads (red) and the Z stack analysis results (right) of the co-localization of ARS-SP (SNAP)-treated macrophages (green) with phagocytic beads (red).

    [0124] FIG. 12a illustrates the comparison results of cell viability of cancer cells (H460) and macrophages (RAW 264.7) determined by MTT assay when H460 cells and RAW 264.7 cells were treated with ARS-SPs (SNAPs) or GRS for 24 hr (Error bar indicates meanstandard deviation from an average of three times of repeated tests).

    [0125] FIG. 12b illustrates the anticancer effect (cytotoxic effects) of ARS-SP on several cancer cell lines when various cancer cell lines were treated with ARS-SPs (SNAPs) or GRS.

    [0126] FIG. 13a illustrates the results of the frequency of tumors having a volume of 100 mm.sup.3 or more within 15 days in the test group (a total of six mice) when H460 cells (7.510.sup.6), together with ARS-SPs (SNAPs, 6 mg/kg) or GRS (6 mg/kg) were subcutaneously injected to the flank of BALB/c nude mice (tumor initiation model).

    [0127] FIG. 13b illustrates the tumor volume measurement results of the test groups and the control 15 days after H460 cells (7.510.sup.6), together with ARS-SPs (SNAPs) or GRS (6 mg/kg) were subcutaneously injected to the flank of BALB/c nude mice (tumor initiation model).

    [0128] FIG. 13c illustrates the tumor weight measurement results of test groups and the control 15 days after H460 cells (7.510.sup.6), together with ARS-SPs (SNAPs, 6 mg/kg) or GRS (6 mg/kg) were subcutaneously injected to the flank of BALB/c nude mice (tumor initiation model).

    [0129] FIG. 14a illustrates the results of tumor growth (volume) in tumor xenograft models. The tumor xenograft models were constructed by subcutaneously injecting H460 cells into nude mice, and on day 7 after tumor implantation, ARS-SPs (SNAPS, 6 mg/kg) or GRS (6 mg/kg) was intravenously injected a total of four times once a day, and tumor growth (volume) was then monitored at predetermined time intervals.

    [0130] FIG. 14b illustrates the results or tumor weight in tumor xenograft models. The tumor xenograft models were constructed by subcutaneously injecting H460 cells into nude mice, and on day 7 after tumor implantation, ARS-SPs (SNAPs, 6 mg/kg) or GRS (6 mg/kg) was intravenously injected a total of four times once a day, and on the last day of the test, the tumor weight was measured.

    [0131] FIG. 15 illustrates the test results of the extent of which GRS present in ARS-SP (SNAP) contributes to ARS-SP (SNAP)'s anticancer activity. Cell viability of cancer cells treated with ARS-SP and GRS was determined by MTT assay. H460 cells were cultured together with ARS-SPs (10 g/ml) for 24 hr. Purified his-tagged GRS protein (100 nM) was used as a control. In order to neutralize the effect of GRS, ARS-SP or GRS was pre-incubated together with anti-GRS antibody for 30 min, and thereafter, the incubated substance was added to the H460 cell culture medium. The amount of naked GRS used in the present test and the amount of GRS present in ARS-SP were compared by immunoblotting (insert at right upper side).

    MODES FOR CARRYING OUT THE INVENTION

    [0132] Hereinafter, the present invention will fee described in detail.

    [0133] However, the following examples are merely for illustrating the present invention and are not intended to limit the scope of the present invention.

    [0134] <Method>

    [0135] 1. Cell culture and reagents

    [0136] RAW264.7 cells were grown in DMEM containing 10% FBS, 50 mg/ml streptomycin, and penicillin. H460 cells were grown RPMI 1640 medium containing 10% FBS, 50 mg/ml streptomycin, and penicillin. Among primary antibodies against respective antigens, syntenin-1 (S-31) was obtained from Santa Cruz Biotechnology, with gp96 (9G10) from Enzo life sciences, GRS from Abcam, and tubulin (TUB 2.1) from Sigma. Among secretory pathway inhibitors, brefeldin A, probenicid, sodium azide, monomycin, methyl-beta-cyclodextrin, and 2-bromo-palmitate were purchased from Sigma and Calbiochem, respectively.

    [0137] 2. Dynamic light scattering

    [0138] The secreted particles were obtained and resuspended in PBS. The particle size was measured by light scattering spectrophotometer ELS-Z (Otsuka Electronics, Japan). Measurement was performed in automatic mode after equilibration for 5 min at 20 C. Data were processed with the manufacturer's software in multiple narrow modes.

    [0139] 3. Sucrose density gradient centrifugation

    [0140] To determine the density of particles, 100,000 g pelleted particles were overlaid onto a continuous sucrose density gradient and centrifuged at 150,000 g for 15 hr. Eight fractions were collected, assayed for density by refractometry, and resuspended in SDS-PAGE sample buffer, and then immunoblotted using specific antibodies.

    [0141] 4. Electron microscopic observation of secreted particles

    [0142] For negative staining, isolated ARS-SPs were diluted 5-fold in PBS, of which 5 l was then applied to a glow-discharged carbon-coated grid (Harriett Plasma, USA) for 3 min in air, and the grid was negatively stained using 1% uranyl acetate (see Jung, H. S., et. al., Mol. Biol. Cell: 19; 3234-3242, 2008). The same procedure was used for all samples. For cryo-electron microscopy, 5 l of sample solution was suspended onto the copper R1.2/1.3 Quantifoil EH grids (SPI Supplies) that were pre-treated in air for 30 sec (in air). The grids were then blotted and frozen using an FEI Vitrobot, MarkI (FED with the setting of 100% humidity, 4 C. and blot time of 2.5 s. The vitreous ice sample grids were maintained at a temperature of around 177 C. within an electron microscope using a aide-entry Gatan 626 cryo holder (Gatan). For immuno-electronic microscopy, ARS-SPs were mixed with anti-GRS antibody for 6 hr, and then were allowed to bind with secondary antibody conjugated with 6 nm gold particles (JIRE, U.K.) (immuno-gold labeling). Thereafter, the mixture was left on ice for 12 hr, and then negatively stained as described above. The grids were tested using a Technai G2 spirit Twin TEM (FEI, USA) operated at 120 kV, Images were recorded on 4K4K Ultrascan 895 CCD (Gatan, U.S.) at a nominal magnification of 40,000 and under-focus values ranging from 2 to 3.

    [0143] 5. Election tomography

    [0144] Electron tomography was performed on immuno-gold-labeled ARS-SP localized close to the cell membrane. Sample images inclined from 60 to +60 were recorded by 2 increase and the images were magnified to 50,000 by using the megapixel CCD camera (JEOL, Tokyo, Japan). An automated data obtainment for electron tomography was conducted using Recorder module of TEMography suite (System in Frontier Inc., Tokyo, Japan). Image alignment, reconstruction, 3D volume rendering, and visualization were conducted using Composer and Visualizer module of TEMography, while the IMOD software package was partially used.

    [0145] 6. Mass spectrometry

    [0146] Secreted particles isolated from RAW264.7 cells, which were cultured in glucose-containing and glucose-deprived media as described above, were precipitated with anti-GRS antibodies. The proteins separated from the particles were separated by SDS-PAGE and digested by in-gel trypsin digestion process. Tryptic fragments were separated by reversed-phase chromatography for each run and electrospray-ionized. For reversed-phase chromatography, Eazy nano LC II autosampler (Thermo Scientific) with reversed-phase peptide trap EASY-Column (100 m inner diameter, 2 cm length) and reversed-phase analytical EASY-Column (75 m inner diameter, 10 cm length, 3 m particle size, Thermo Scientific) was used. Electrospray ionization was performed using a 30 m nano-bore stainless steel online emitter (Thermo Scientific) set at a voltage of 2.6 V and a flow rate of 300 nl/min. The chromatography system was coupled on-line with an LTQ Velos Orbitrap mass spectrometer (Thermo Scientific) equipped with an ETD source. A mass spectrometry (MS) intensity-based label-free quantitation was performed using PE-MMR as known previously. Briefly, during PE-MMR analysis, MS features of a peptide, which emerged over a period of LC elution time in LC-MS/MS, were grouped into a unique mass class (UMC). Peptide abundance for each UMC was calculated as the abundance summation of all mass spectral components of the UMC. In order to identify peptide ID for the UMC, DTA file was linked to the UMC by matching the UMC mass with the precursor mass in the DTA. When peptide ID was identified for the linked DTA file with false positive rate of 1% after MS-GF.sup.+ search and target-decoy analysis, the peptide ID was assigned to the UMC. The UMCs across the replicates were aligned using the peptide IDs and normalized over elution times. By using all the aligned peptides, the proteins were selected, as highly reliable proteins, which have at least two non-redundant peptides and a maximum intensity of at least 10.sup.5. Among them, 90 proteins each of which has at least one non-redundant peptide unique to the protein were identified as the proteins predominant in ARS-SPs.

    [0147] 7. Palmitoylation mass analysis

    [0148] Protein analysis was performed using the Proteome Discoverer v 1.3 database search engine (Thermo scientific), while searches were performed on IPI, mouse, v 3.87 database. The search parameters were set at a fragment mass tolerance of 0.6 Da, peptide mass tolerance of 25 ppm and maximum missed cleavage of 2. The results were filtered by peptide rank (maximum rank: 1), peptide number per protein (minimal number of peptides: 2) and charge state versus score (minimal XCorr score for charge state=+1: 1.7, +2: 2.5, +3: 3.2, >+4: 3.5). The carbamidomethylation (+57.021 Da) of cysteine (C) and deamidation (+0.984 Da) of asparagine or glutamine (N, Q) were set as a static or variable modification, respectively. The processed data were transformed to the sf file using Scaffold 3 program, while all the modified peptides identified from the control or glucose-starved samples were scored and compared using Scaffold PTM software.

    [0149] 8. Similarity test

    [0150] Exosome protein profiles of 12 different sample types were obtained from ExoCarta. For the discrete comparison, samples with more than 100 identified proteins were only used. Similarity scores for each experiment were calculated using Jaccard similarity coefficient.


    similarity=h(P.sub.x)*h(P.sub.g)/{|h(P.sub.x)|+|h(P.sub.g)|h(P.sub.x)*h(P.sub.g)}

    [0151] |h(P.sub.x)| and |h(P.sub.g)| are the counts of proteins in exosome and and ARS-SP respectively. h(P.sub.x)*h(P.sub.q) represents the number of proteins shared by two group. The average score for each sample was calculated and used.

    [0152] 9. Chemical fixation and electron microscopy

    [0153] After H460 cells were cultured with the isolated ARS-SPs, the samples were fixed in a mixture of 2% glutaraldehyde in 25 mM phosphate buffer solution (pH 7.2) fox 1, followed by post fixation in 2% OsO.sub.4 in 25 mM phosphate buffer solution (pH 7.2) for 2 hr. After rinsing off the phosphate buffer solution, the samples were dehydrated in ethanol and embedded in Epon. Ultrathin sections (80 nm thickness) were cut on an ultracut-S microtome (Leica), collected on copper grids, and stained in uranyl acetate and lead citrate. The stained sections were examined by electron microscopy.

    [0154] 10. Cell viability assay

    [0155] H460 and RAW264.7 cells (510.sup.3) seeded in the 96 well plate were cultured for 24 hr, and then treated With ARS-SPS (10 g/ml) or GRS (100 nM). MTT (USB) solution (5 mg/ml) was added to each well (final concentration; 0.5 mg/ml) which was additionally cultured for 4 hr. After removing medium, the MTT formazan crystals were dissolved in 100 ml of DMSO (Sigma). The absorbance was measured at 570 nm with the microplate reader (TECAN). In order to investigate the neutralizing effect of anti-GRS antibody, the isolated ARS-SPs were pre-incubated with the anti-GRS antibody for 30 min and added to cells.

    [0156] 11. Metabolic labeling palmitoylation assay

    [0157] RAW264.7 cells were pre-cultured with glucose-containing DMEM for 1 hr and labeled with 0.1 mCi/ml (3H) palmitate (PerkinElmer) for 2 hr. In order to confirm GRS modifications, the cells were cultured in glucose-deprived DMEM containing [3H] palmitate for 2 hr. The cell lysates extracted by RIPA buffer were immuno-precipitated with anti-GRS antibodies. The radiolabeled-palmitoylated GRS was detected by scintillation counter.

    [0158] 12. Biotinylation of surface of GRS-SPs

    [0159] Isolated ARS-SPs were cultured with EZ-link Sulfo-NHS-LC-Biotin (Thermo) at 0.5 mg/ml at 4 C. for 30 min. In order to stop the biotinylation reaction, tris-HCL (pH 7.5) was added to a final concentration of 100 nM. In order to determine the localization of GRS in the particles, the biotinylated lipid particles were precipitated with streptavidin-sepharose bead (GE healthcare). After washing three times, the precipitates were dissolved and separated by SDS-PAGE for immunoblotting.

    [0160] 13. Xenograft mice model

    [0161] Xenograft experiments were performed in accordance with the University Animal Care and Use Committee guidelines of Seoul National University. H460 cells (7.510.sup.6) were injected subcutaneously into the left flank of 8-week-old BALB/c female nude mice. The tumor growth was monitored and the tumor volume was measured using a caliper. The tumor volume was determined as lengthwidth.sup.20.52. The treatment with test substances was initiated when the average tumor volume of each group reached 90-100 mm.sup.3. Purified GRS or ARS-SPs were administrated via intravenous injection in a single dosage of 6 mg/kg/day for 4 days, while control group mice were injected with PBS. The tumor weights were measured on the day of sacrificing chose mice.

    [0162] For the tumor initiation model, the nude mice were treated with GRS or ARS-SPs (6 mg/kg), followed by a subcutaneous injection of H460 cells. On day 15 after the tumor implantation (subcutaneous injection), the tumor volume and weight were measured.

    [0163] 14. Multiplex ELISA assay

    [0164] RAW264.7 cells were cultured in the 12 well plate. GRS or ARS-SPs were added at different concentrations to media. After culture for 6 hr, the media were collected, and spun down by centrifugation at 3,000 g for 10 min. Secreted TNF- and IL-10 were detected using the ELISA kit (BD Science) according to the manufacturer's protocol. The samples were measured using the microplate reader (TECAN). In order to perform multiplex assay, the beads in which TNF-, IL-6, RANTES, IL-1, IL-12, IL-10, MMP-9, INF-, MIP-3, and CXCL10 were previously mixed were purchased from R&D Science. The standard group and the samples were treated with the beads, and cultured in the plate shaker for 2 hr. Subsequently, each well was treated with secondary antibodies. After culture for 1 hr, the streptavidin-PE solution was added, followed by further culture for 30 min. The beads were measured by the luminex system (BioPad, Bioplex 200), and analyzed by the bioplex software (BioRad 6.0).

    [0165] 15. Measurement of phagocytosis of macrophages

    [0166] The phagocytic activity of macrophages was measured using the Vybrant Phagocytosis Assay Kit (Invitrogon). Briefly, RAW264.7 cells were seeded in the 96 well plate. The cells were treated with ARS-SPs, GRS, or LPS for 12 hr. After the treatment, the cells were further cultured together with fluorescein-labeled phagocytosis beads for 2 hr. Then, the phagocytic activity was quantified by quenching the extracellular fluorescence using Trypan blue and measuring the fluorescence intensity using the microplate reader (BMG Labtech, FLUOstar OPTIMA).

    [0167] 16. Intravital phagocytosis imaging

    [0168] The effect of ARS-SP or GRS on the phagocytosis of macrophages in vivo was observed by customized laser-scanning confocal microscopy. For the implementation of 2D scanning, the fast-rotating polygonal mirror (Lincoln Laser) and galvanometer (Cambridge Technology) were used In order to simultaneously detect three fluorescent signals. High-sensitive photomultiplier tubes (Hamamatsu) were equipped (utilized). Three detection channels were divided by dichroic mirrors (Semrock) and bandpass filters (Semrock). Electric signals obtained from PMT were digitalized by the 8-bit 3-channel frame grabber (Matrox). After images were taken from imaging systems. 512512 pixel images were XY-shift compensated by Matlab (Mathworks), and reconstructed on one of two, XZ/YZ, by ImageJ software. Per in vivo phagocytosis imaging, male LysM-GFP (Lysozyme M-GFP) mice aged 18-22 week were used. The mice were anesthetized with a mixture of Zoletil (30 mg/kg) and xylazine (10 mg/kg). ARS-SPs (1 mg) or GRS (1 mg) conjugated to Alexa-405 (Life Technologies) was intradermally injected into the ear skin of mice using 31G micro-injector (Hamilton). Six hours after the treatment, Alexa-594-conjugated phagocytosis bioparticles (Life technologies) were injected to a location where ARS-SPs or GRS had been injected. Phagocytosis was then visualized by confocal microscopy platform for 90 min.

    [0169] 17. qRT-PCR

    [0170] Through conventionally known methods, the total RNA was extracted from the cells which had been completed with sample treatment, followed by the synthesis of cDNAs. Briefly, qRT-PCR was conducted using QRTPCR (Life Technology 7500) with cDNA template and forward and reverse primers as listed on table 1. A total of 40 cycles of the two-step reaction (95 C.-15 s and 54 C.-60 s) was conducted using The QRTPCR (Life Technology 7500) with 7500 Software 2.0.4., and the results were calculated by the relative quantification C.sub.Tmethod.

    TABLE-US-00001 TABLE1 SEQ direction ID Target (5-3) sequence NO iNOS Forward CAGCTGGGCTGTACAAACCTT 4 Reverse CATTGGAAGTGAAGCGTTTCG 5 Arginase Forward AAGAAAAGGCCGATTCACCT 6 II Reverse CACCTCCTCTGCTGTCTTCC 7 TNF- Forward CTCAAAATTCGAGTGACAAGCCTG 8 alpha Reverse ATCGGCTGGCACCACTAGTT 9 IL-10 Forward AGACTTTCTTTCAAACAAAGGA 10 Reverse ATCGATGACAGCGCCTCAG 11

    Example 1

    In Vitro Anticancer Effect of Nanoparticles Secreted from Macrophages

    [0171] <1-1> Obtaining of Nanoparticles Secreted in Glucose-Deprived Condition

    [0172] RAW 264.7 cells were cultured in glucose-deprived DMEM medium (4 hr). Subsequently, the medium was centrifuged twice at 500 g (10 min) and 10,000 g (15 min) to remove cell debris, and then centrifuged at 100,000 g (120 m) to give pellet lipid particles.

    [0173] <1-2> Verification on In Vitro Anticancer Effect

    [0174] In order to investigate the anticancer effect of the nanoparticles obtained in Example 1-1, H460 and RAW 264.7 cells were treated with the obtained nanoparticles to determine their viability, respectively.

    [0175] As a result, it was found that, on the contrary to that of RAW264.7 cells, the viability of H46C cells was decreased by the treatment of with the nanoparticles in a dose-dependent manner (FIG. 1a). In addition, 15 different cancer cell lines (HCT116, SN12C, Caki-1, H1975, HCC44, HCC15, A549, H23, HCC2108, H1703, MCF7, BT-474, RENCA, H1299, and HCC927) were treated with the nanoparticles to measure their cell viability, confirming that the nanoparticles showed a broad range of cytotoxicity (FIG. 1b).

    Example 2

    In Vivo Anticancer Effect of Nanoparticles Secreted From Macrophages

    [0176] In order to investigate whether the nanoparticles obtained in Example 1-1 also possess an in vivo anticancer effect, the nanoparticles were administered into xenograft mice. H460 cells were injected into BALB/c mice and then grown for 7 days. When tumors were grown to an average size of 90 mm.sup.3, the nanoparticles (6 mg/kg/dose) were injected by intravenous route once a day for 4 days. PBS was used as control. Compared with the control, the nanoparticle-treated tumor volume (FIG. 2a) and weight (FIG. 2b) were reduced by 68% and 48%, respectively. The lack of change in the weight and posture of the tested animals suggested no nanoparticle-induced overt toxicity (FIG. 2c). These results further support that the nanoparticles obtained in Example 1 possess an anticancer effect.

    Example 3

    [0177] Proteomics Profiling of Nanoparticles Secreted From Macrophages

    [0178] In order to test whether the total amount of the nanoparticles secreted in Example 1-1 was increased according to the introduction of glucose-deprived stress, RAW264.7 cells were stained with DiI (lipophilic fluorescence tracer). After the dye was washed off, the cells were cultured in both the glucose-containing condition and the glucose-deprive condition, respectively. After the particles secreted by the same method as in Example 1 were purified, the total fluorescence intensity was determined. It was verified that the total fluorescence intensity and the protein content of the secreted particles were enhanced by glucose starvation. These particles were confirmed to contain GRS. When the cells were stained with DiI and DAPI, no difference was observed among the cells cultured under the conditions of the presence or the absence of glucose. This suggests that the difference in the fluorescence intensity of the secreted particles does not result from cell density.

    [0179] In order to understand the functions of the nanoparticles obtained in Example 1-1, the protein composition of the nanoparticles was investigated. Macrophages were cultured in the glucose-containing medium (Glucose +) or the glucose-deprived medium (Glucose ). The cell culture media were then collected, centrifuged at 100,000 g to give particles which were then purified by immunoprecipitation using anti-GRS antibodies. The protein components of the particles were separated using SDS-PAGE, while the obtained gel bands were treated with trypsin. The resulting peptides were subjected to LTQ-Orbitrap Velos for LC/MS-MS analysis. Using the MS-GF.sup.+ search, 184 and 272 proteins (FDR<0.01) were identified in the particles obtained from glucose-containing and glucose-deprived media, respectively (FIG. 3a). Among the particles obtained in the glucose-deprived condition, 73 proteins were 6-fold increased, while 91 proteins were detected only in the particles obtained from the glucose-deprived condition. These 164 proteins found in the starvation condition were considered as predominant proteins of the nanoparticles of the present invention. Tetraspanin proteins, such as CD9, CD63 and CD82, which are known to be closely associated with exosomes, were not detected in the ARS-SPs according to the present invention (FIG. 3b). when the content of the predominant proteins in the nanoparticles according to the present invention was compared with that of exosomes derived from different cell types listed in Exocarta, a low-degree of similarity could be confirmed (FIG. 3c). These results further support the unique characteristics of the separated nanoparticles according to the present invention.

    [0180] Upon analyzing predominant proteins of the nanoparticles secreted from the cells cultured in the glucose-deprived condition, leucyl-tRNA synthetase (LRS) and isoleucyl-tRNA synthetase (IRS) as well as glycyl-tRNA synthetase (GRS) were specifically found. All these enzymes are aminoacyl tRNA synthetases, and are involved in protein synthesis. GRS has been known to possess an effect of cancer cell cytotoxicity in addition to that of protein synthesis, while the non-canonical functions of LRS and IRS have been little known. Hereinafter, these nanoparticles will be indicated as ARS-SPs (aminoacyl-tRAN synthetase-secreted particles, or SNAPs).

    Example 4

    Characterization of ARS-SP

    [0181] In order to analyze characteristics of ARS-SP, RAW264.7 cells were cultured in glucose-containing and glucose-deprived media, respectively. Then, the secreted proteins were fractionated by differential centrifugation. As a result, GRS found in the proteomics profiling in Example 3 was detected in the pellets obtained by centrifugation at 200,000 g (FIG. 4a). The obtained pellets by centrifugation did not contain Gp96 proteins, which are known to be secreted via the ER-Golgi pathway (FIG. 4a). The GRS was detected in the pellets obtained by the same method as described above together with the application of the apoptotic stress (such as adriamycin and FasL) upon the cells, like in the pellets obtained from the glucose-deprived medium (FIG. 4c). Upon measuring ARS-SPs using the light scattering spectrophotometer and analytical gradient ultracentrifugation, it was found that the ARS-SP particles have a mean diameter of 36.9 nm (FIG. 4b) and a buoyant density of 1.13-1.17 g/ml (FIG. 4d). In order to investigate whether the ARS-SPs are distinguishable from exosomes, after RAW264.7 cells were cultured in the glucose-deprived condition and the serum-deprived condition for 4 hr or 18 hr, respectively, syntenin-1, a known exosome marker, and GRS (as contained in the ARS-SP), were measured. As a result, it was confirmed that GRS was secreted from the cells only in the glucose-deprived condition, whereas syntenin-1 was secreted only in the serum-deprived condition (FIG. 4e). These results suggest that the secretion conditions of the proteins including GRS as contained in the ARS-SP, are different from those of exosomes.

    [0182] The size and morphology of the ARS-SP of the present invention were analyzed by electron microscopy. The negative staining electron microscopy showed that the ARS-SPs have a globular shape and a varying size of 20 to 50 nm (FIG. 4f). In order to investigate whether GRS is present in the nanoparticles, the nanoparticles were stained with gold particle-conjugated anti-GRS antibodies, revealing that the antibodies were enriched on the surface of the 20-50 nm particles (FIG. 4g). Upon further monitoring of the morphology and the size of ARS-SPs using cryo-electron microscopy, the same results as above were obtained (FIG. 4h). The morphology and size of the ARS-SP are distinct from those of exosomes, while showing an apparent similarity to typical lipoprotein particles.

    [0183] It can be seen from the above results that the ARS-SPs secreted by the apoptotic stress are lipoprotein-like particles, having a diameter of 20-50 nm and a density of 1.13-1.17 g/ml.

    Example 5

    Analysis of Modification of GRS in ARS-SP

    [0184] The immunogold labeling of GRS shown in electron microscopy (FIG. 4g) suggests that GRS is located on the surface of the APS-SF. In order to further confirm this possibility, the ARS-SPs were cultured with trypsin to determine whether GRS was sensitive to protease attack. As a test result, it was confirmed that GRS was removed by the treatment of trypsin (FIG. 5a). Then, in order to label surface proteins of the ARS-SP, the ARS-SPs were biotinylated by using membrane-impermeable biotins, followed by treating the biotinylated ARS-SPs with surfactants and precipitating the biotin-labeled proteins with streptavidin-agarose beads. Then, immunoblotting using anti-GRS antibodies was conducted for analysis. The amount of biotinylated GRSs in the nanoparticles obtained from the glucose-deprived media was increased (FIG. 5b). These results further support that GRS was located on the surface of the ARS-SP.

    [0185] Molecular mechanisms in which GRS is anchored to the surface of the ARS-SP were investigated. It is expected that GRS has no transmembrane domain, resulting from a sequence analysis using TMHMM server (http://www.cbs.dtu.dk/services/TMHMM, data not shown). The possibility that GRS is anchored to the surface membrane by its lipid modification was tested by analyzing its sequence with CSS-Palm 4.0 software. Two potential sites of palmitoylation were found at C-390 and C471 (FIG. 5c). Palmitoylation is known to be reversible and involved with membrane trafficking of cytosolic proteins. In order to determine whether palmitoylation is involved in the secretion of GRS, a modified metabolic labeling method was used. RAW264.7 cells were cultured in glucose-deprived medium with [.sup.3H]-palmitic acid, while GRS was immunoprecipitated using anti-GRS antibodies. Interestingly, the palmitoylation of endogenous GRS was increased with glucose starvation (FIG. 5d). In order to confirm whether the palmitoylation is required for GRS secretion, as a result of treating the cells with a palmitoylation inhibitor, 2-bromo-palmitate (2-BP), it was verified that such a treatment inhibited the secretion of GRS (FIG. 5e). Using LC-MS/MS, the palmitoylation sites of GRS were determined to be C390 and a few additional cysteines, excluding C471 (FIG. 5f). This result further supports C390 as a potential real candidate site. In order to validate these results, there were prepared two mutated, tagged forms of GRS (C390S and C471S), of which two cysteine residues C390 and C471 were replaced with a serine residue, respectively. In order to investigate whether these substitutions affect the attachment of palmitic acid and the secretion of GRS, RAW264.7 cells were transfected with the strep-tagged GRS MT and mutant constructs (C390 and C471 mutants) and cultured in glucose-deprived medium (FIGS. 5g and 5h). It was found that both the palmitoylation and the secretion or GRS were reduced in the C390S mutant, in comparison with WT GRS and the C471S mutant.

    Example 6

    Analysis of ARS-SP Secretion Pathway

    [0186] As described in Example 4 above, it was found that the ARS-SP nanoparticles according to the present invention were secreted in conditions different from those of exosome secretion and were lipoprotein-like particles in view of their morphological characteristics. For further confirmation, the characteristics associated with the secretory pathway of the ARS-SP were investigated.

    [0187] In order to investigate the cellular location at which GRS is recruited prior to the secretion of ARS-SPs, intracellular GRS in RAW264.7 cells was visualized using correlative light and cryo-electron microscopy technology, while anti-GRS antibodies conjugated to Alexa488 fluorescent dye were used for immunolabeling. Using confocal fluorescence microscopy, the fluorescence-labeled regions were first identified, and then cryo-fixation and electron microscopic observation were performed. Out of the obtained images, the fluorescence-labeled regions (white boxes in each panel) were found. The fluorescence-labeled regions contain globular-shaped particles as consistent with the result of the cryo-EM morphology shown in FIG. 4h, without the presence of MVB. This observation results demonstrated distinctive characteristics of GRS particles in terms of its size and cytosolic localization, in comparison with the fact that exosomes have a large size and co-exist with MVB upon being cultured in the glucose-deprived condition for 2 hr. Interestingly, it was found that glucose starvation increased the formation of cytosolic foci of GRS. When the co-localization analysis of GRS was performed with lysosome and ER trackers, it was verified that the GRS foci were not perfectly superimposed with either of the two markers (FIGS. 6a and 6b). Then, it was tested whether the palmitoylation of GRS was associated with its intracellular localization, revealing that the glucose starvation-induced GRS foci were inhibited by the treatment of 2-BP (FIG. 6c). These facts suggest that the lipid modification is necessary for the recruitment of GRS to the secretory particles in the cytosol prior to its secretion, which is different from the generally known secretory pathway of exosomes.

    Example 7

    Verification on Anticancer Activity Cofactor of ARS-SP

    [0188] The possibility that the ARS-SP may contain additional apoptotic factors was investigated by a method for selectively depleting some components in the secreted particles. Among factors identified in the ARS-SP. the investigation was focused on factors involved in the apoptotic processes such as IGF2R and vimentin. The presence of such factors in the separated ARS-SP was confirmed by western blotting using antibodies specific thereto (FIG. 7a). Then, the expression of the respective factors (IGF2R and vimentin) was inhibited in macrophages RAW264.7 by using siRNAs specific thereto, while the nanoparticles were manufactured by the same method as described in Example 1-1. Cancer cells were treated with the prepared IGF2R-removed or vimentin-removed ARS-SPs as such, followed by the comparison of their cancer apoptotic activities. Compared with the prepared ARS-SPs secreted from normal macrophages, the ARS-SP nanoparticles prepared from the cells having an inhibited expressions of IGF2R or vimentin showed a reduction in their apoptotic activity. This result suggests that, in addition to GRS, IGF2R and vimentin also partially contribute to the anticancer activity of the ARS-SP according to the present invention (FIG. 7b).

    Example 8

    [0189] Molecular Mechanisms of ARS-SP Action on Cancer Cells

    [0190] In order to understand the action mechanism of the ARS-SPs according to the present invention on cancer cells, a test was conducted using a cancer cell line H460. First, the uptake of ARS-SPs into the H460 cells was monitored (observed) by using electron microscopy. The H460 cells were treated with the ARS-SPs. After 10 min, it was observed (detected) that a large amount of the ARS-SPs were anchored to the cellular membrane surface of the cancer cells (FIG. 8a). Furthermore, it was detected that the ARS-SPs were in different stages of endocytosis (FIGS. 8b and 8c) Following immunogold-labeling of GRS, cryo-fixation electron microscopy and 3D electron tomography were performed, demonstrating that the endocytosed ARS-SPs actually contained GRS as described above (FIGS. 8d and 8e).

    Example 9

    ARS-SP Separation by Co-Culture With Cancer Cells

    [0191] In order to investigate whether the secretion of the ARS-SPs according to the present invention can be induced by cancer cell change, macrophages (RAW264.7) and cancer cells (H460 or HCT116) were co-cultured, confirming the secretion of ARS-SPs by using the presence of GRS as a marker. In order to prevent the physical interaction between macrophages and cancer cells, cancer cells and macrophages were seeded in upper and lower chambers of the 0.4 mm pore-size transwell plates, followed by culture in serum-deficient DMEM media overnight. GRS was detected in the nanoparticles from the cell culture medium in the upper chamber, which was separated in the same method as Example 1-1 (FIG. 8f), which suggests that the ARS-SPs are secreted even through the co-culture with cancer cells.

    [0192] In addition, the present inventors co-cultured human monocytes U937 cells and lung cancer cells H460 cells in serum-deficient RPMI medium. The culture medium was separated and then centrifuged three times at 500 g (15 min), 10,000 g (15 min), and 100,000 g (90 min), respectively, to obtain pellets. It was found that the ARS-SPs according to the present invention were present in the pellets.

    [0193] In addition, the passage of the ARS-SPs onto cancer cells from macrophages was observed using the transwell chamber. During this test, the macrophages and the cancer cells were cultured, while the macrophages with DiI (red fluorescence dye)-labeled membrane lipids were located in the upper chamber, whereas the cancer cells were located in the lower chamber. Then, the presence of structures labeled with red fluorescence, which exits in the cancer cells, and the effect thereof on the death of the cancer cells were observed. The red fluorescence originating from the macrophages was observed in the cancer cells, and dead cells were detected at the locations of red fluorescence (FIG. 8g).

    Example 10

    The Effect of ARS-SP in Enhancing Immune Function

    [0194] <10-1>Verification on the In Vitro Effect of ARS-SP in Enhancing Immune Function

    [0195] It was investigated whether the ARS-SP according to the present invention had an autocrine effect on macrophages. It was verified through immune-gold staining and 3D tomography of GRS that the ARS-SP nanoparticles were taken up into macrophages by endocytosis when macrophages were treated with the ARS-SPs (see FIG. 9). Example 1 verified that the ARS-SP does not affect the viability of macrophages. Thus, it was tested whether the ARS-SP affected the differentiation of macrophages. It was found that the ARS-SP as well as GRS increased the production of signature factors of M1-type polarization including TNF-, IL-6, and CXCL10, whereas not increasing M2-type factors including IL-1, IL-10, MMP-9, and MIP-3 (FIG. 10a). The particular effects of the ARS-SP in various concentrations on TBF- induction was further validated (FIG. 10b). In order to further investigate these activities, bone marrow-derived macrophages (BMDD) were treated with the ARS-SPs according to the present invention or GRS, followed by monitoring the induction of TNF- and IL-10 via ELISA and qRT-PCR. Regarding the above two tests, it was detected that TNF- was strongly induced in all the test groups, whereas IL-10 was not (FIGS. 10c and 10d). In order to investigate whether GRS is a key factor in the induction of M1 cytokine secretion, the ARS-SPs were pre-incubated with anti-GRS antibodies, followed by the treatment with macrophages. As a result, the secretion of TNF- induced by the ARS-SP was significantly reduced by anti-GRS-antibodies (up to 50%) (FIG. 10e). When the macrophages were co-cultured with the cancer cells using 0.4 mm pore size transwell plates in the same manner described as above, the secretion of TNF- was further increased, but was partially reduced by the treatment with anti-GRS antibodies (FIG. 10f). This result further confirmed the importance of GRS in said activity. Further, additional test was conducted to investigate whether ARS-SP could induce MHCII and iNOS, which are other known biomarkers of M1-type macrophages. It was found that the ARS-SP induced MHCII and iNOS like GRS and LPS, whereas it did not exert any effect on CD206 and arginase II which are known as markers of M2 type macrophages (FIGS. 10g and 10h).

    [0196] The phagocytic activity is still another characteristic of M1-type macrophages. The proteomic analysis of the ARS-SP suggests the possible presence of actin-related protein 2/3 complex (Arp2/3 complex) in the ARS-SP. The Arp2/3 complex is known to be related with phagocytosis. Therefore, it was investigated by western blotting whether Arpc2, a key factor of the Arp2/3 complex, was actually present in the ARS-SP. As a result, it was verified that Arpc2 actually existed in the ARS-SP as well as GRS and HSP90, whereas CD63, which is known as an exosome marker, did not exist therein (FIG. 10i). The effect of the ARS-SP on phagocytic activity of macrophages was monitored in tests in which green fluorescence phagocytosis beads was used as a prey. Like LPS, the ARS-SP and GRS improved the phagocytic activity of macrophages in a concentration-dependent manner (FIG. 10j).

    [0197] <10-2> Verification on the In Vivo Effect of ARS-SP in Enhancing Immune Function

    [0198] The in vivo phagocytosis-stimulating activity of the ARS-SP was further monitored through the intravital monitoring system. LysM-GFP mice were used for the present test, while macrophages/neutrophils in the mice could be monitored by GFP. The ARS-SPs or GRS was first Injected into the ear of mice for 6 hr. Then, the red fluorescence-labeled phagocytosis beads were introduced through the same route, while the motion and the phagocytic activity of macrophages were monitored at predetermined time intervals, it was found that the pre-treatment of the ARS-SP or GRS strongly increased the phagocytic activity of macrophages/neutrophils (FIG. 11a), in each test, LPS was used to validate the intravital phagocytosis system. Further, the Z stack analysis identified the accurate locations of macrophages/neutrophils (green) existing together with the beads (FIG. 10b). Therefore, it was verified that the activities of the ARS-SP on cancer cells and macrophages were reproduced in vivo.

    Example 11

    Comparison of Anticancer Activity of ARS-SP

    [0199] The present inventors found through the above tests that GRS was contained in the ARS-SF according to the present invention, while the GRS proteins as polypeptides per se are known to have an anticancer activity. The present inventors compared the anticancer activity between GRS proteins and the ARS-SP according to the present invention.

    [0200] <11-1> Comparison of In Vitro Anticancer Activity

    [0201] H460 cells and RAW 264.7 cells were first treated with GRS or the ARS-SPs by the same method as in Example <1-2> above, followed by determining the viability of those cells. In addition, 15 different types of cancer cell lines (HCT116, SN12C, Caki-1, H1975, HCC44, HCC15, A549, H23, HCC2108, H1703, MCF7, BT-474, RENCA, H1299, and HCC827) were treated with GRS or the ARS-SPs by the same method as in Example <1-2>, followed by comparing their apoptotic activity on those cells.

    [0202] As a result, as shown in FIGS 12a and 12b, considering that the same amounts of the ARS-SP and GRS were used for said tests, the ARS-SP according to the present invention showed a higher cancer apoptotic efficacy than GRS proteins. Especially, as shown in FIG. 12b, the ARS-SP and GRS induced apoptosis in 13 and 9 different cell lines out of a total of 15 cancer cell lines, respectively, suggesting that the ARS-SP acts on a wider spectrum of cancer cells.

    [0203] <11-2> Comparison of In Vivo Anticancer Activity

    [0204] H460 cells were first injected into BALB/c nude mice (tumor initiation models) together with the treatment of the ARS-SP or GRS, and then the effect of such treatment in triggering the occurrence of tumor was monitored. For 15 days, tumors in the control group grew to 100 mm.sup.3 or larger, whereas only two out of six animals showed tumors growing to 100 mm.sup.3 or more in the ARS-SP or GRS treatment groups (FIG. 13a). The ARS-SP or GRS treatment significantly reduced the tumor volume and weight (FIGS. 13a and 13b), but hardly affected the body weight.

    [0205] The anticancer effect was evaluated in other tumor models constructed by the same method as in example 2 above. H460 cells were first implanted into nude mice, and on day 1 after the implantation, ARS-SPs or GRS was injected once a day for a total of four days. In the above case, ARS-SP and GRS suppressed the growth of all tumors (FIGS. 14a and 14b), and hardly affected the body weight.

    [0206] Considering that the same amount of the ARS-SP and GRS were also used for in vivo tests, the ARS-SP of the present invention showed a higher cancer cell apoptotic efficacy than GRS proteins.

    [0207] <11-3> Evaluation on GRS Content Inside ARS-SP

    [0208] Then, the contribution of GRS, existing in the ARS-SP, to anticancer activity was monitored. The isolated ARS-SPs and naked GRS reduced the viability of H460 cells by 50% and 40%, respectively, when compared with the non-treatment control group (FIG. 15).

    [0209] When the western blotting was used to compare the amount of GRS existing in the ARS-SP with that of the naked GRS, the GRS in the ARS-SP was shown to be 10-fold lower than the naked GRS (insert at right upper side of FIG. 15). However, the ARS-SP exhibited a higher efficacy in the suppression of cancer cells than GRS, suggesting the presence of another factors contributing to the cytotoxicity of cancer cells, in addition to GRS. This fact has been confirmed in Example 7 above.

    INDUSTRIAL APPLICABILITY

    [0210] As described above, the present invention provides: nanoparticles comprising glycyl-tRNA synthetase (GRS), leucyl-tRNA synthetase (LRS), and isoleucyl-tRNA synthetase (IRS) and possessing an activity of treating cancer or enhancing immune function; a pharmaceutical composition for preventing or treating cancer comprising the nanoparticles as an active ingredient; and a method for preparing the nanoparticles. The nanoparticles and the composition comprising the same are effective in preventing or treating cancer, and thus are highly industrially applicable.