Expression system for modulating an immune response
09593340 ยท 2017-03-14
Assignee
Inventors
Cpc classification
C12N2710/16222
CHEMISTRY; METALLURGY
C12N2760/16122
CHEMISTRY; METALLURGY
C40B40/08
CHEMISTRY; METALLURGY
C40B50/04
CHEMISTRY; METALLURGY
C12N15/79
CHEMISTRY; METALLURGY
C12N2710/16634
CHEMISTRY; METALLURGY
C12N2770/24222
CHEMISTRY; METALLURGY
C12N2770/24234
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
C12N2710/16234
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2800/22
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2710/20034
CHEMISTRY; METALLURGY
C12N2710/20022
CHEMISTRY; METALLURGY
A61P33/02
HUMAN NECESSITIES
C12N15/67
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12N2710/16622
CHEMISTRY; METALLURGY
International classification
C12N15/79
CHEMISTRY; METALLURGY
C40B50/04
CHEMISTRY; METALLURGY
C40B40/08
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
Abstract
The present invention discloses methods and compositions for modulating the quality of an immune response to a target antigen in a mammal, which response results from the expression of a polynucleotide that encodes at least a portion of the target antigen, wherein the quality is modulated by replacing at least one codon of the polynucleotide with a synonymous codon that has a higher or lower preference of usage by the mammal to confer the immune response than the codon it replaces.
Claims
1. A method for constructing a synthetic polynucleotide from which a polypeptide is producible to confer a stronger or enhanced immune response to a target antigen in a mammal than that conferred by a parent polynucleotide that encodes the same polypeptide, wherein the immune response is selected from the group consisting of (1) a humoral immune response, (2) a cellular immune response and (3) a cellular immune response and a humoral immune response, wherein the polypeptide corresponds to at least a portion of the target antigen, the method comprising constructing the synthetic polynucleotide so that it is distinguished from the parent polynucleotide by replacement of at least 5% of codons which correspond to the target antigen in the parent polynucleotide with synonymous codons, wherein individual codon replacements are carried out by: (a) selecting a first codon of the parent polynucleotide for replacement with a synonymous codon according to TABLE 3: TABLE-US-00013 TABLE 3 First Codon Synonymous Codon Ala.sup.GCG Ala.sup.GCT Ala.sup.GCA Ala.sup.GCT Ala.sup.GCC Ala.sup.GCT Arg.sup.CGG Arg.sup.CGA Arg.sup.CGG Arg.sup.CGT Arg.sup.CGG Arg.sup.AGA Arg.sup.AGG Arg.sup.CGA Arg.sup.AGG Arg.sup.CGT Arg.sup.AGG Arg.sup.AGA Glu.sup.GAG Glu.sup.GAA Gly.sup.GGC Gly.sup.GGA Gly.sup.GGT Gly.sup.GGA Gly.sup.GGG Gly.sup.GGA Leu.sup.TTA Leu.sup.CTA Leu.sup.TTA Leu.sup.CTT Leu.sup.TTA Leu.sup.TTG Leu.sup.TTG Leu.sup.CTA Leu.sup.TTG Leu.sup.CTT Phe.sup.TTC Phe.sup.TTT Pro.sup.CCG Pro.sup.CCT Pro.sup.CCA Pro.sup.CCT Ser.sup.AGT Ser.sup.TCG Ser.sup.AGT Ser.sup.TCT Ser.sup.AGT Ser.sup.TCA Ser.sup.AGC Ser.sup.TCG Ser.sup.AGC Ser.sup.TCT Ser.sup.AGC Ser.sup.TCA Ser.sup.AGC Ser.sup.TCC Ser.sup.TCC Ser.sup.TCG Ser.sup.TCA Ser.sup.TCG Ser.sup.TCT Ser.sup.TCG Thr.sup.ACT Thr.sup.ACG Thr.sup.ACT Thr.sup.ACA Thr.sup.ACA Thr.sup.ACG Thr.sup.ACC Thr.sup.ACG Val.sup.GTA Val.sup.GTT and (b) replacing the first codon with the synonymous codon.
2. The method according to claim 1, further comprising (i) selecting a second codon of the parent polynucleotide for replacement with a synonymous codon, wherein the synonymous codon is selected on the basis that it exhibits a higher immune response preference than the second codon in a comparison of immune response preferences; and (ii) replacing the second codon with the synonymous codon, wherein the comparison of immune response preferences of the codons is represented by TABLE 4: TABLE-US-00014 Second Codon Synonymous Codon Ala.sup.GCG Ala.sup.GCT Ala.sup.GCG Ala.sup.GCC Ala.sup.GCA Ala.sup.GCT Ala.sup.GCA Ala.sup.GCC Ala.sup.GCC Ala.sup.GCT Arg.sup.CGG Arg.sup.CGA Arg.sup.CGG Arg.sup.CGC Arg.sup.CGG Arg.sup.CGT Arg.sup.CGG Arg.sup.AGA Arg.sup.AGG Arg.sup.CGA Arg.sup.AGG Arg.sup.CGC Arg.sup.AGG Arg.sup.CGT Arg.sup.AGG Arg.sup.AGA Asn.sup.AAT Asn.sup.AAC Asp.sup.GAT Asp.sup.GAC Cys.sup.TGT Cys.sup.TGC Glu.sup.GAG Glu.sup.GAA Gly.sup.GGC Gly.sup.GGA Gly.sup.GGT Gly.sup.GGA Gly.sup.GGG Gly.sup.GGA Ile.sup.ATA Ile.sup.ATC Ile.sup.ATA Ile.sup.ATT Ile.sup.ATT Ile.sup.ATC Leu.sup.TTA Leu.sup.CTG Leu.sup.TTA Leu.sup.CTC Leu.sup.TTA Leu.sup.CTA Leu.sup.TTA Leu.sup.CTT Leu.sup.TTA Leu.sup.TTG Leu.sup.TTG Leu.sup.CTG Leu.sup.TTG Leu.sup.CTC Leu.sup.TTG Leu.sup.CTA Leu.sup.TTG Leu.sup.CTT Leu.sup.CTT Leu.sup.CTG Leu.sup.CTT Leu.sup.CTC Leu.sup.CTA Leu.sup.CTG Leu.sup.CTA Leu.sup.CTC Phe.sup.TTC Phe.sup.TTT Pro.sup.CCG Pro.sup.CCC Pro.sup.CCG Pro.sup.CCT Pro.sup.CCA Pro.sup.CCC Pro.sup.CCA Pro.sup.CCT Pro.sup.CCT Pro.sup.CCC Ser.sup.AGT Ser.sup.TCG Ser.sup.AGT Ser.sup.TCT Ser.sup.AGT Ser.sup.TCA Ser.sup.AGT Ser.sup.TCC Ser.sup.AGC Ser.sup.TCG Ser.sup.AGC Ser.sup.TCT Ser.sup.AGC Ser.sup.TCA Ser.sup.AGC Ser.sup.TCC Ser.sup.TCC Ser.sup.TCG Ser.sup.TCA Ser.sup.TCG Ser.sup.TCT Ser.sup.TCG Thr.sup.ACT Thr.sup.ACG Thr.sup.ACT Thr.sup.ACC Thr.sup.ACT Thr.sup.ACA Thr.sup.ACA Thr.sup.ACG Thr.sup.ACA Thr.sup.ACC Thr.sup.ACC Thr.sup.ACG Tyr.sup.TAT Tyr.sup.TAC Val.sup.GTA Val.sup.GTG Val.sup.GTA Val.sup.GTC Val.sup.GTA Val.sup.GTT Val.sup.GTT Val.sup.GTG Val.sup.GTT Val.sup.GTC.
3. A method for constructing a synthetic polynucleotide from which a polypeptide is producible to confer a weaker or reduced immune response to a target antigen in a mammal than that conferred by a parent polynucleotide that encodes the same polypeptide, wherein the immune response is selected from the group consisting of (1) a humoral immune response; (2) a cellular immune response; and (3) a cellular immune response and a humoral immune response, wherein the polypeptide corresponds to at least a portion of the target antigen, the method comprising constructing the synthetic polynucleotide so that it is distinguished from the parent polynucleotide by replacement of at least 5% of codons, wherein individual codon replacements are carried out by: (a) selecting a first codon of the parent polynucleotide for replacement with a synonymous codon; and (b) replacing the first codon with the synonymous codon to construct the synthetic polynucleotide, wherein the first and synonymous codons are selected from the TABLE 5: TABLE-US-00015 First Codon Synonymous Codon Ala.sup.GCT Ala.sup.GCG Ala.sup.GCT Ala.sup.GCA Ala.sup.GCT Ala.sup.GCC Ala.sup.GCC Ala.sup.GCG Ala.sup.GCC Ala.sup.GCA Arg.sup.CGA Arg.sup.AGG Arg.sup.CGA Arg.sup.CGG Arg.sup.CGC Arg.sup.AGG Arg.sup.CGC Arg.sup.CGG Arg.sup.CGT Arg.sup.AGG Arg.sup.CGT Arg.sup.CGG Arg.sup.AGA Arg.sup.AGG Arg.sup.AGA Arg.sup.CGG Asn.sup.AAC Asn.sup.AAT Asp.sup.GAC Asp.sup.GAT Cys.sup.TGC Cys.sup.TGT Glu.sup.GAA Glu.sup.GAG Gly.sup.GGA Gly.sup.GGC Gly.sup.GGA Gly.sup.GGT Gly.sup.GGA Gly.sup.GGG Ile.sup.ATC Ile.sup.ATA Ile.sup.ATC Ile.sup.ATT Ile.sup.ATT Ile.sup.ATA Leu.sup.CTG Leu.sup.CTA Leu.sup.CTG Leu.sup.CTT Leu.sup.CTG Leu.sup.TTG Leu.sup.CTG Leu.sup.TTA Leu.sup.CTC Leu.sup.CTA Leu.sup.CTC Leu.sup.CTT Leu.sup.CTC Leu.sup.TTG Leu.sup.CTC Leu.sup.TTA Leu.sup.CTA Leu.sup.TTG Leu.sup.CTA Leu.sup.TTA Leu.sup.CTT Leu.sup.TTG Leu.sup.CTT Leu.sup.TTA Leu.sup.TTG Leu.sup.TTA Phe.sup.TTT Phe.sup.TTC Pro.sup.CCC Pro.sup.CCT Pro.sup.CCC Pro.sup.CCA Pro.sup.CCC Pro.sup.CCG Pro.sup.CCT Pro.sup.CCA Pro.sup.CCT Pro.sup.CCG Ser.sup.TCG Ser.sup.TCT Ser.sup.TCG Ser.sup.TCA Ser.sup.TCG Ser.sup.TCC Ser.sup.TCG Ser.sup.AGC Ser.sup.TCG Ser.sup.AGT Ser.sup.TCT Ser.sup.AGC Ser.sup.TCT Ser.sup.AGT Ser.sup.TCA Ser.sup.AGC Ser.sup.TCA Ser.sup.AGT Ser.sup.TCC Ser.sup.AGC Ser.sup.TCC Ser.sup.AGT Thr.sup.ACG Thr.sup.ACC Thr.sup.ACG Thr.sup.ACA Thr.sup.ACG Thr.sup.ACT Thr.sup.ACC Thr.sup.ACA Thr.sup.ACC Thr.sup.ACT Thr.sup.ACA Thr.sup.ACT Tyr.sup.TAC Tyr.sup.TAT Val.sup.GTG Val.sup.GTT Val.sup.GTG Val.sup.GTA Val.sup.GTC Val.sup.GTT Val.sup.GTC Val.sup.GTA Val.sup.GTT Val.sup.GTA.
4. A method for constructing a synthetic polynucleotide from which a polypeptide is producible to confer a weaker or reduced immune response to a target antigen in a mammal than that conferred by a parent polynucleotide that encodes the same polypeptide, wherein the immune response is selected from the group consisting of (1) a humoral immune response; (2) a cellular immune response; and (3) a cellular immune response and a humoral immune response, wherein the polypeptide corresponds to at least a portion of the target antigen, the method comprising constructing the synthetic polynucleotide so that it is distinguished from the parent polynucleotide by replacement of at least 5% of codons, wherein individual codon replacements are carried out by: (a) selecting a first codon of the parent polynucleotide for replacement with a synonymous codon; and (b) replacing the first codon with the synonymous codon to construct the synthetic polynucleotide, wherein the first and synonymous codons are selected from TABLE 6: TABLE-US-00016 First Codon Synonymous Codon Ala.sup.GCT Ala.sup.GCG Ala.sup.GCT Ala.sup.GCA Ala.sup.GCT Ala.sup.GCC Arg.sup.CGA Arg.sup.AGG Arg.sup.CGA Arg.sup.CGG Arg.sup.CGT Arg.sup.AGG Arg.sup.CGT Arg.sup.CGG Arg.sup.AGA Arg.sup.AGG Arg.sup.AGA Arg.sup.CGG Glu.sup.GAA Glu.sup.GAG Gly.sup.GGA Gly.sup.GGC Gly.sup.GGA Gly.sup.GGT Gly.sup.GGA Gly.sup.GGG Leu.sup.CTA Leu.sup.TTG Leu.sup.CTA Leu.sup.TTA Leu.sup.CTT Leu.sup.TTG Leu.sup.CTT Leu.sup.TTA Leu.sup.TTG Leu.sup.TTA Phe.sup.TTT Phe.sup.TTC Pro.sup.CCT Pro.sup.CCA Pro.sup.CCT Pro.sup.CCG Ser.sup.TCG Ser.sup.TCT Ser.sup.TCG Ser.sup.TCA Ser.sup.TCG Ser.sup.TCC Ser.sup.TCG Ser.sup.AGC Ser.sup.TCG Ser.sup.AGT Ser.sup.TCT Ser.sup.AGC Ser.sup.TCT Ser.sup.AGT Ser.sup.TCA Ser.sup.AGC Ser.sup.TCA Ser.sup.AGT Ser.sup.TCC Ser.sup.AGC Thr.sup.ACG Thr.sup.ACC Thr.sup.ACG Thr.sup.ACA Thr.sup.ACG Thr.sup.ACT Thr.sup.ACA Thr.sup.ACT Val.sup.GTT Val.sup.GTA.
5. The method according to claim 4, further comprising (i) selecting a second codon of the parent polynucleotide for replacement with a synonymous codon, wherein the synonymous codon is selected on the basis that it exhibits a lower immune response preference than the second codon in a comparison of immune response preferences; and; (ii) replacing the second codon with the synonymous codon, wherein the comparison of immune response preferences of the codons is represented by TABLE 7: TABLE-US-00017 TABLE 7 Second Codon Synonymous Codon Ala.sup.GCT Ala.sup.GCG Ala.sup.GCT Ala.sup.GCA Ala.sup.GCT Ala.sup.GCC Ala.sup.GCC Ala.sup.GCG Ala.sup.GCC Ala.sup.GCA Arg.sup.CGA Arg.sup.AGG Arg.sup.CGA Arg.sup.CGG Arg.sup.CGC Arg.sup.AGG Arg.sup.CGC Arg.sup.CGG Arg.sup.CGT Arg.sup.AGG Arg.sup.CGT Arg.sup.CGG Arg.sup.AGA Arg.sup.AGG Arg.sup.AGA Arg.sup.CGG Asn.sup.AAC Asn.sup.AAT Asp.sup.GAC Asp.sup.GAT Cys.sup.TGC Cys.sup.TGT Glu.sup.GAA Glu.sup.GAG Gly.sup.GGA Gly.sup.GGC Gly.sup.GGA Gly.sup.GGT Gly.sup.GGA Gly.sup.GGG Ile.sup.ATC Ile.sup.ATA Ile.sup.ATC Ile.sup.ATT Ile.sup.ATT Ile.sup.ATA Leu.sup.CTG Leu.sup.CTA Leu.sup.CTG Leu.sup.CTT Leu.sup.CTG Leu.sup.TTG Leu.sup.CTG Leu.sup.TTA Leu.sup.CTC Leu.sup.CTA Leu.sup.CTC Leu.sup.CTT Leu.sup.CTC Leu.sup.TTG Leu.sup.CTC Leu.sup.TTA Leu.sup.CTA Leu.sup.TTG Leu.sup.CTA Leu.sup.TTA Leu.sup.CTT Leu.sup.TTG Leu.sup.CTT Leu.sup.TTA Leu.sup.TTG Leu.sup.TTA Phe.sup.TTT Phe.sup.TTC Pro.sup.CCC Pro.sup.CCT Pro.sup.CCC Pro.sup.CCA Pro.sup.CCC Pro.sup.CCG Pro.sup.CCT Pro.sup.CCA Pro.sup.CCT Pro.sup.CCG Ser.sup.TCG Ser.sup.TCT Ser.sup.TCG Ser.sup.TCA Ser.sup.TCG Ser.sup.TCC Ser.sup.TCG Ser.sup.AGC Ser.sup.TCG Ser.sup.AGT Ser.sup.TCT Ser.sup.AGC Ser.sup.TCT Ser.sup.AGT Ser.sup.TCA Ser.sup.AGC Ser.sup.TCA Ser.sup.AGT Ser.sup.TCC Ser.sup.AGC Ser.sup.TCC Ser.sup.AGT Thr.sup.ACG Thr.sup.ACC Thr.sup.ACG Thr.sup.ACA Thr.sup.ACG Thr.sup.ACT Thr.sup.ACC Thr.sup.ACA Thr.sup.ACC Thr.sup.ACT Thr.sup.ACA Thr.sup.ACT Tyr.sup.TAC Tyr.sup.TAT Val.sup.GTG Val.sup.GTT Val.sup.GTG Val.sup.GTA Val.sup.GTC Val.sup.GTT Val.sup.GTC Val.sup.GTA Val.sup.GTT Val.sup.GTA.
6. A method of making a chimeric construct, comprising constructing a synthetic polynucleotide according to the method of claim 1 and operably linking a regulatory polynucleotide to the synthetic polynucleotide.
7. The method according to claim 6, further comprising constructing the chimeric construct so that it includes the coding sequence of an adjuvant.
8. The method according to claim 7, wherein the adjuvant is selected from: detoxified mutants of bacterial ADP-ribosylating toxins, diphtheria toxin, pertussis toxin, cholera toxin, Escherichia coli heat-labile toxins, Pseudomonas endotoxin A, Clostridium botulinum C2 and C3 toxins, toxins from C. perfringens, C. spiriforma and C. difficile; and protein-destabilizing elements.
9. The method according to claim 7, wherein the adjuvant is a protein-destabilizing element selected from a destabilizing amino acid at the amino-terminus of the polypeptide, a PEST region or an ubiquitin.
10. The method according to claim 6, further comprising formulating the chimeric construct for transcutaneous administration, epidermal administration, dermal administration, intradermal administration, biolistic delivery, microneedle delivery or intradermal injection.
11. A synthetic polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 82.
12. A chimeric construct comprising the synthetic polynucleotide of claim 11 operably linked to a regulatory polynucleotide.
13. The method of claim 1, wherein the target antigen is a herpes simplex virus antigen.
14. The method of claim 13, wherein the herpes simplex virus antigen is a glycoprotein D.
15. The method of claim 13, wherein the herpes simplex virus antigen is gD2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21) TABLE-US-00008 TABLE 8 BRIEF DESCRIPTION OF THE SEQUENCES SEQUENCE ID NUMBER SEQUENCE LENGTH SEQ ID NO: 1 IgkS2-13 Asp GAT construct nucleotide sequence 387 nts SEQ ID NO: 2 IgkS2-14 Asp GAC construct nucleotide sequence 387 nts SEQ ID NO: 3 IgkS2-15 Cys TGT construct nucleotide sequence 387 nts SEQ ID NO: 4 IgkS2-16 Cys TGC construct nucleotide sequence 387 nts SEQ ID NO: 5 IgkS2-17 Glu GAG construct nucleotide sequence 387 nts SEQ ID NO: 6 IgkS2-18 Glu GAA construct nucleotide sequence 387 nts SEQ ID NO: 7 IgkS2-19 Gln CAG construct nucleotide sequence 387 nts SEQ ID NO: 8 IgkS2-20 Gln CAA construct nucleotide sequence 387 nts SEQ ID NO: 9 IgkS2-21 Gly GGG construct nucleotide sequence 387 nts SEQ ID NO: 10 IgkS2-22 Gly GGA construct nucleotide sequence 387 nts SEQ ID NO: 11 IgkS2-23 Gly GGT construct nucleotide sequence 387 nts SEQ ID NO: 12 IgkS2-24 Gly GGC construct nucleotide sequence 387 nts SEQ ID NO: 13 IgkS2-27 Ile ATA construct nucleotide sequence 387 nts SEQ ID NO: 14 IgkS2-28 Ile ATT construct nucleotide sequence 387 nts SEQ ID NO: 15 IgkS2-29 Ile ATC construct nucleotide sequence 387 nts SEQ ID NO: 16 IgkS2-34 Ser AGT construct nucleotide sequence 387 nts SEQ ID NO: 17 IgkS2-35 Ser AGC construct nucleotide sequence 387 nts SEQ ID NO: 18 IgkS2-36 Ser TCG construct nucleotide sequence 387 nts SEQ ID NO: 19 IgkS2-37 Ser TCA construct nucleotide sequence 387 nts SEQ ID NO: 20 IgkS2-38 Ser TCT construct nucleotide sequence 387 nts SEQ ID NO: 21 IgkS2-39 Ser TCC construct nucleotide sequence 387 nts SEQ ID NO: 22 IgkS2-40 Thr ACG construct nucleotide sequence 387 nts SEQ ID NO: 23 IgkS2-41 Thr ACA construct nucleotide sequence 387 nts SEQ ID NO: 24 IgkS2-42 Thr ACT construct nucleotide sequence 387 nts SEQ ID NO: 25 IgkS2-43 Thr ACC construct nucleotide sequence 387 nts SEQ ID NO: 26 IgkS2-46 Val GTG construct nucleotide sequence 387 nts SEQ ID NO: 27 IgkS2-47 Val GTA construct nucleotide sequence 387 nts SEQ ID NO: 28 IgkS2-48 Val GTT construct nucleotide sequence 387 nts SEQ ID NO: 29 IgkS2-49 Val GTG construct nucleotide sequence 387 nts SEQ ID NO: 30 IgkS2-1 Ala GCG Linker nucleotide sequence 408 nts SEQ ID NO: 31 IgkS2-2 Ala GCA Linker nucleotide sequence 408 nts SEQ ID NO: 32 IgkS2-3 Ala GCT Linker nucleotide sequence 408 nts SEQ ID NO: 33 IgkS2-4 Ala GCC Linker nucleotide sequence 408 nts SEQ ID NO: 34 IgkS2-5 Arg AGG Linker nucleotide sequence 408 nts SEQ ID NO: 35 IgkS2-6 Arg AGA Linker nucleotide sequence 408 nts SEQ ID NO: 36 IgkS2-7 Arg CGG Linker nucleotide sequence 408 nts SEQ ID NO: 37 IgkS2-8 Arg CGA Linker nucleotide sequence 408 nts SEQ ID NO: 38 IgkS2-9 Arg CGT Linker nucleotide sequence 408 nts SEQ ID NO: 39 IgkS2-10 Arg CGC Linker nucleotide sequence 408 nts SEQ ID NO: 40 IgkS2-11 Asn AAT Linker nucleotide sequence 408 nts SEQ ID NO: 41 IgkS2-12 Asn AAC Linker nucleotide sequence 408 nts SEQ ID NO: 42 IgkS2-25 His CAT Linker nucleotide sequence 408 nts SEQ ID NO: 43 IgkS2-26 His CAC Linker nucleotide sequence 408 nts SEQ ID NO: 44 IgkS2-30 Lys AAG Linker nucleotide sequence 408 nts SEQ ID NO: 45 IgkS2-31 Lys AAA Linker nucleotide sequence 408 nts SEQ ID NO: 46 IgkS2-32 Phe TTT Linker nucleotide sequence 408 nts SEQ ID NO: 47 IgkS2-33 Phe TTC Linker nucleotide sequence 408 nts SEQ ID NO: 48 IgkS2-44 Tyr TAT Linker nucleotide sequence 408 nts SEQ ID NO: 49 IgkS2-45 Tyr TAC Linker nucleotide sequence 408 nts SEQ ID NO: 50 Influenza A Virus HA hemagglutinin (A/Hong 1707 nts Kong/213/03(H5N1)) BAE07201 wild-type SEQ ID NO: 51 Influenza A Virus HA hemagglutinin (A/Hong 568 aa Kong/213/03(H5N1)) BAE07201 wild-type SEQ ID NO: 52 Influenza A Virus HA hemagglutinin (A/Hong 1707 nts Kong/213/03(H5N1)) Codon modified SEQ ID NO: 53 Influenza A Virus HA hemagglutinin 1701 nts (A/swine/Korea/PZ72-1/2006 (H3N1)) DQ923506 wild-type SEQ ID NO: 54 Influenza A Virus HA hemagglutinin 566 aa (A/swine/Korea/PZ72-1/2006 (H3N1)) DQ923506 wild-type SEQ ID NO: 55 Influenza A Virus HA hemagglutinin 1701 nts (A/swine/Korea/PZ72-1/2006 (H3N1)) Codon modified SEQ ID NO: 56 Influenza A Virus NA neuraminidase (A/Hong 1410 nts Kong/213/03(H5N1)) AB212056 wild-type SEQ ID NO: 57 Influenza A Virus NA neuraminidase (A/Hong 469 aa Kong/213/03(H5N1)) AB212056 wild-type SEQ ID NO: 58 Influenza A Virus NA neuraminidase (A/Hong 1410 nts Kong/213/03(H5N1)) Codon modified SEQ ID NO: 59 Influenza A Virus NA neuraminidase 1410 nts (A/swine/MI/PU243/04 (H3N1)) DQ150427 wild-type SEQ ID NO: 60 Influenza A Virus NA neuraminidase 469 aa (A/swine/MI/PU243/04 (H3N1)) DQ150427 wild-type SEQ ID NO: 61 Influenza A Virus NA neuraminidase 1410 nts (A/swine/MI/PU243/04 (H3N1)) Codon modified SEQ ID NO: 62 Hepatitis C Virus E1 (Serotype 1A, isolate H77) 576 nts AF009606 wild-type SEQ ID NO: 63 Hepatitis C Virus E1 (Serotype 1A, isolate H77) NP 192 aa 751920 wild-type SEQ ID NO: 64 Hepatitis C Virus E1 (Serotype 1A, isolate H77) Codon 576 nts modified SEQ ID NO: 65 Hepatitis C Virus E2 (Serotype 1A, isolate H77) 1089 nts AF009606 wild-type SEQ ID NO: 66 Hepatitis C Virus E2 (Serotype 1A, isolate 1177) NP 363 aa 751921 wild-type SEQ ID NO: 67 Hepatitis C Virus E2 (Serotype 1A, isolate H77) Codon 1089 nts modified SEQ ID NO: 68 Epstein Barr Virus (Type 1, gp350 B95-8) NC 007605 2724 nts wild-type SEQ ID NO: 69 Epstein Barr Virus (Type 1, gp350 B95-8) CAD53417 907 aa wild-type SEQ ID NO: 70 Epstein Barr Virus (Type 1, gp350 B95-8) Codon 2724 nts modified SEQ ID NO: 71 Epstein Barr Virus (Type 2, gp350 AG876) NC 009334 2661 nts wild-type SEQ ID NO: 72 Epstein Barr Virus (Type 2, gp350 AG876) YP 886 aa 001129462 wild-type SEQ ID NO: 73 Epstein Barr Virus (Type 2, gp350 AG876) Codon 2661 nts Modified SEQ ID NO: 74 Herpes Simplex Virus 2 (Glycoprotein B strain HG52) 2715 nts NC 001798 wild-type SEQ ID NO: 75 Herpes Simplex Virus 2 (Glycoprotein B strain HG52) 904 aa CAB06752 wild-type SEQ ID NO: 76 Herpes Simplex Virus 2 (Glycoprotein B strain HG52) 2715 nts Codon modified SEQ ID NO: 77 Herpes Simplex Virus (Glycoprotein D strain HG52) 1182 nts NC 001798 wild-type SEQ ID NO: 78 Herpes Simplex Virus (Glycoprotein D strain HG52) 393 aa NP 0044536 wild-type SEQ ID NO: 79 Herpes Simplex Virus (Glycoprotein D strain HG52) 1182 nts Codon modified SEQ ID NO: 80 HPV-16 E7 wild-type 387 nts SEQ ID NO: 81 HPV-16 E7 O1 387 nts SEQ ID NO: 82 HPV-16 E7 O2 387 nts SEQ ID NO: 83 HPV-16 E7 O3 417 nts SEQ ID NO: 84 HPV-16 E7 W 387 nts SEQ ID NO: 85 HSV-2 gD2 wild-type 1182 nts SEQ ID NO: 86 HSV-2 gD2 O1 1182 nts SEQ ID NO: 87 HSV-2 gD2 O2 1182 nts SEQ ID NO: 88 HSV-2 gD2 O3 1182 nts SEQ ID NO: 89 HSV-2 gD2 W 1182 nts SEQ ID NO: 90 Common forward primer 41 nts SEQ ID NO: 91 ODN-7909 24 nts
DETAILED DESCRIPTION OF THE INVENTION
1. Definitions
(22) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.
(23) The articles a and an are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
(24) By about is meant a quantity, level, value, frequency, percentage, dimension, size, or amount that varies by no more than 15%, and preferably by no more than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% to a reference quantity, level, value, frequency, percentage, dimension, size, or amount.
(25) The terms administration concurrently or administering concurrently or co-administering and the like refer to the administration of a single composition containing two or more actives, or the administration of each active as separate compositions and/or delivered by separate routes either contemporaneously or simultaneously or sequentially within a short enough period of time that the effective result is equivalent to that obtained when all such actives are administered as a single composition. By simultaneously is meant that the active agents are administered at substantially the same time, and desirably together in the same formulation. By contemporaneously it is meant that the active agents are administered closely in time, e.g., one agent is administered within from about one minute to within about one day before or after another. Any contemporaneous time is useful. However, it will often be the case that when not administered simultaneously, the agents will be administered within about one minute to within about eight hours and preferably within less than about one to about four hours. When administered contemporaneously, the agents are suitably administered at the same site on the subject. The term same site includes the exact location, but can be within about 0.5 to about 15 centimeters, preferably from within about 0.5 to about 5 centimeters. The term separately as used herein means that the agents are administered at an interval, for example at an interval of about a day to several weeks or months. The active agents may be administered in either order. The term sequentially as used herein means that the agents are administered in sequence, for example at an interval or intervals of minutes, hours, days or weeks. If appropriate the active agents may be administered in a regular repeating cycle.
(26) As used herein, the term cis-acting sequence or cis-regulatory region or similar term shall be taken to mean any sequence of nucleotides which is derived from an expressible genetic sequence wherein the expression of the genetic sequence is regulated, at least in part, by the sequence of nucleotides. Those skilled in the art will be aware that a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the level of expression and/or cell-type-specificity and/or developmental specificity of any structural gene sequence.
(27) Throughout this specification, unless the context requires otherwise, the words comprise, comprises and comprising will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
(28) As used herein, a chimeric construct refers to a polynucleotide having heterologous nucleic acid elements. Chimeric constructs include expression cassettes or expression constructs, which refer to an assembly that is capable of directing the expression of the sequence(s) or gene(s) of interest. An expression cassette generally includes control elements such as a promoter that is operably linked to (so as to direct transcription of) a synthetic polynucleotide of the invention, and often includes a polyadenylation sequence as well. Within certain embodiments of the invention, the chimeric construct may be contained within a vector. In addition to the components of the chimeric construct, the vector may include, one or more selectable markers, a signal which allows the vector to exist as single-stranded DNA (e.g., a M13 origin of replication), at least one multiple cloning site, and a mammalian origin of replication (e.g., a SV40 or adenovirus origin of replication).
(29) As used herein, conferred immune response, immune response that is conferred and the like refer to a temporary or permanent change in immune response to a target antigen, which occurs or would occur after the introduction of a polynucleotide to the mammal, and which would not occur in the absence of that introduction. Typically, such a temporary or permanent change occurs as a result of the transcription and/or translation of genetic information contained within that polynucleotide in a cell, or in at least one cell or cell type or class of cell within a mammal or within a class of mammals, and can be used to distinguish the mammal, or class of mammals to which the polynucleotide has been provided from a similar mammal, or class of mammals, to which the polynucleotide has not been provided.
(30) By corresponds to or corresponding to is meant an antigen which encodes an amino acid sequence that displays substantial similarity to an amino acid sequence in a target antigen. In general the antigen will display at least about 30, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% similarity or identity to at least a portion of the target antigen (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the amino acid sequence of the target antigen).
(31) By effective amount, in the context of modulating an immune response or treating or preventing a disease or condition, is meant the administration of that amount of composition to an individual in need thereof, either in a single dose or as part of a series, that is effective for achieving that modulation, treatment or prevention. The effective amount will vary depending upon the health and physical condition of the individual to be treated, the taxonomic group of individual to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.
(32) The terms enhancing an immune response, producing a stronger immune response and the like refer to increasing an animal's capacity to respond to a target antigen (e.g., a foreign or disease-specific antigen or a self antigen), which can be determined for example by detecting an increase in the number, activity, and ability of the animal's cells that are primed to attack such antigens or an increase in the titer or activity of antibodies in the animal, which are immuno-interactive with the target antigen. Strength of immune response can be measured by standard immunoassays including: direct measurement of antibody titers or peripheral blood lymphocytes; cytolytic T lymphocyte assays; assays of natural killer cell cytotoxicity; cell proliferation assays including lymphoproliferation (lymphocyte activation) assays; immunoassays of immune cell subsets; assays of T-lymphocytes specific for the antigen in a sensitized subject; skin tests for cell-mediated immunity; etc. Such assays are well known in the art. See, e.g., Erickson et al., 1993, J. Immunol. 151:4189-4199; Doe et al., 1994, Eur. J. Immunol. 24:2369-2376. Recent methods of measuring cell-mediated immune response include measurement of intracellular cytokines or cytokine secretion by T-cell populations, or by measurement of epitope specific T-cells (e.g., by the tetramer technique) (reviewed by McMichael, A. J., and O'Callaghan, C. A., 1998, J. Exp. Med. 187(9)1367-1371; Mcheyzer-Williams, M. G., et al., 1996, Immunol. Rev. 150:5-21; Lalvani, A., et al., 1997, J. Exp. Med. 186:859-865). Any statistically significant increase in strength of immune response as measured for example by immunoassay is considered an enhanced immune response or immunoenhancement as used herein. Enhanced immune response is also indicated by physical manifestations such as fever and inflammation, as well as healing of systemic and local infections, and reduction of symptoms in disease, i.e., decrease in tumor size, alleviation of symptoms of a disease or condition including, but not restricted to, leprosy, tuberculosis, malaria, naphthous ulcers, herpetic and papillomatous warts, gingivitis, arthrosclerosis, the concomitants of AIDS such as Kaposi's sarcoma, bronchial infections, and the like. Such physical manifestations also encompass enhanced immune response or immunoenhancement as used herein. By contrast, reducing an immune response, producing a weaker immune response and the like refer to decreasing an animal's capacity to respond to a target antigen, which can be determined for example by conducting immunoassays or assessing physical manifestations, as described for example above.
(33) The terms expression or gene expression refer to production of RNA message and/or translation of RNA message into proteins or polypeptides.
(34) By expression vector is meant any autonomous genetic element capable of directing the synthesis of a protein encoded by the vector. Such expression vectors are known by practitioners in the art.
(35) The term gene is used in its broadest context to include both a genomic DNA region corresponding to the gene as well as a cDNA sequence corresponding to exons or a recombinant molecule engineered to encode a functional form of a product.
(36) As used herein the term heterologous refers to a combination of elements that are not naturally occurring or that are obtained from different sources.
(37) Immune response or immunological response refers to the concerted action of lymphocytes, antigen-presenting cells, phagocytic cells, granulocytes, and soluble macromolecules produced by the above cells or the liver (including antibodies, cytokines, and complement) that results in selective damage to, destruction of, or elimination from the body of cancerous cells, metastatic tumor cells, metastatic breast cancer cells, invading pathogens, cells or tissues infected with pathogens, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. In some embodiments, an immune response encompasses the development in an individual of a humoral and/or a cellular immune response to a polypeptide that is encoded by an introduced synthetic polynucleotide of the invention. As known in the art, the terms humoral immune response includes and encompasses an immune response mediated by antibody molecules, while a cellular immune response includes and encompasses an immune response mediated by T-lymphocytes and/or other white blood cells. Thus, an immune response that is stimulated by a synthetic polynucleotide of the invention may be one that stimulates the production of antibodies (e.g., neutralizing antibodies that block bacterial toxins and pathogens such as viruses entering cells and replicating by binding to toxins and pathogens, typically protecting cells from infection and destruction). The synthetic polynucleotide may also elicit production of cytolytic T lymphocytes (CTLs). Hence, an immunological response may include one or more of the following effects: the production of antibodies by B-cells; and/or the activation of suppressor T-cells and/or memory/effector T-cells directed specifically to an antigen or antigens present in the composition or vaccine of interest. In some embodiments, these responses may serve to neutralize infectivity, and/or mediate antibody-complement, or antibody dependent cell cytotoxicity (ADCC) to provide protection to an immunized host. Such responses can be determined using standard immunoassays and neutralization assays, well known in the art. (See, e.g., Montefiori et al., 1988, J Clin Microbiol. 26:231-235; Dreyer et al., 1999, AIDS Res Hum Retroviruses 15(17):1563-1571). The innate immune system of mammals also recognizes and responds to molecular features of pathogenic organisms and cancer cells via activation of Toll-like receptors and similar receptor molecules on immune cells. Upon activation of the innate immune system, various non-adaptive immune response cells are activated to, e.g., produce various cytokines, lymphokines and chemokines. Cells activated by an innate immune response include immature and mature dendritic cells of, for example, the monocyte and plamsacytoid lineage (MDC, PDC), as well as gamma, delta, alpha and beta T cells and B cells and the like. Thus, the present invention also contemplates an immune response wherein the immune response involves both an innate and adaptive response.
(38) A composition is immunogenic if it is capable of either: a) generating an immune response against a target antigen (e.g., a viral or tumor antigen) in an individual; or b) reconstituting, boosting, or maintaining an immune response in an individual beyond what would occur if the agent or composition was not administered. An agent or composition is immunogenic if it is capable of attaining either of these criteria when administered in single or multiple doses.
(39) Immunomodulation, modulating an immune response and the like refer to the modulation of the immune system in response to a stimulus and includes increasing or decreasing an immune response to a target antigen or changing an immune response from one that is predominantly a humoral immune response to one that is a more cell-mediated immune response and vice versa. For example, it is known in the art that decreasing the amount of antigen for immunization can change the bias of the immune system from a predominantly humoral immune response to a predominantly cellular immune response.
(40) By isoaccepting transfer RNA or iso-tRNA is meant one or more transfer RNA molecules that differ in their anticodon nucleotide sequence but are specific for the same amino acid.
(41) As used herein, the term mammal refers to any mammal including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; and laboratory animals including rodents such as mice, rats and guinea pigs. The term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
(42) By modulating, modulate and the like is meant increasing or decreasing, either directly or indirectly, the quality of a selected phenotype (e.g., an immune response). In certain embodiments, modulation or modulating means that a desired/selected immune response is more efficient (e.g., at least 10%, 20%, 30%, 40%, 50%, 60% or more), more rapid (e.g., at least 10%, 20%, 30%, 40%, 50%, 60% or more), greater in magnitude (e.g., at least 10%, 20%, 30%, 40%, 50%, 60% or more), and/or more easily induced (e.g., at least 10%, 20%, 30%, 40%, 50%, 60% or more) than if the parent polynucleotide had been used under the same conditions as the synthetic polynucleotide. In other embodiments, modulation or modulating means changing an immune response from a predominantly antibody-mediated immune response as conferred by the parent polynucleotide, to a predominantly cellular immune response as conferred by the synthetic polynucleotide under the same conditions. In still other embodiments, modulation or modulating means changing an immune response from a predominantly cellular immune response as conferred by the parent polynucleotide, to a predominantly antibody-mediated immune response as conferred by the synthetic polynucleotide under the same conditions.
(43) By natural gene is meant a gene that naturally encodes the protein. However, it is possible that the parent polynucleotide encodes a protein that is not naturally-occurring but has been engineered using recombinant techniques.
(44) The term 5 non-coding region is used herein in its broadest context to include all nucleotide sequences which are derived from the upstream region of an expressible gene, other than those sequences which encode amino acid residues which comprise the polypeptide product of the gene, wherein 5 non-coding region confers or activates or otherwise facilitates, at least in part, expression of the gene.
(45) The term oligonucleotide as used herein refers to a polymer composed of a multiplicity of nucleotide units (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogues thereof) linked via phosphodiester bonds (or related structural variants or synthetic analogues thereof). Thus, while the term oligonucleotide typically refers to a nucleotide polymer in which the nucleotides and linkages between them are naturally occurring, it will be understood that the term also includes within its scope various analogues including, but not restricted to, peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methyl phosphonates, 2-O-methyl ribonucleic acids, and the like. The exact size of the molecule may vary depending on the particular application. An oligonucleotide is typically rather short in length, generally from about 10 to 30 nucleotides, but the term can refer to molecules of any length, although the term polynucleotide or nucleic acid is typically used for large oligonucleotides.
(46) The terms operably connected, operably linked and the like as used herein refer to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered operably linked to the coding sequence. Terms such as operably connected, therefore, include placing a structural gene under the regulatory control of a promoter, which then controls the transcription and optionally translation of the gene. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position the genetic sequence or promoter at a distance from the gene transcription start site that is approximately the same as the distance between that genetic sequence or promoter and the gene it controls in its natural setting; i.e. the gene from which the genetic sequence or promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the genes from which it is derived.
(47) By pharmaceutically-acceptable carrier is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in topical or systemic administration.
(48) The term phenotype means any one or more detectable physical or functional characteristics, properties, attributes or traits of an organism, tissue, or cell, or class of organisms, tissues or cells, which generally result from the interaction between the genetic makeup (i.e., genotype) of the organism, tissue, or cell, or the class of organisms, tissues or cells and the environment.
(49) By phenotypic preference is meant the preference with which an organism uses a codon to produce a selected phenotype. This preference can be evidenced, for example, by the quality of a selected phenotype that is producible by a polynucleotide that comprises the codon in an open reading frame which codes for a polypeptide that produces the selected phenotype. In certain embodiment, the preference of usage is independent of the route by which the polynucleotide is introduced into the organism. However, in other embodiments, the preference of usage is dependent on the route of introduction of the polynucleotide into the organism.
(50) The term polynucleotide or nucleic acid as used herein designates mRNA, RNA, cRNA, cDNA or DNA. The term typically refers to oligonucleotides greater than 30 nucleotides in length.
(51) Polypeptide, peptide and protein are used interchangeably herein to refer to a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally occurring amino acid, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers. As used herein, the terms polypeptide, peptide and protein are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post expression modifications of a polypeptide, for example, glycosylation, acetylation, phosphorylation and the like. In some embodiments, a polypeptide refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
(52) The terms polypeptide variant, and variant refer to polypeptides that vary from a reference polypeptide by the addition, deletion or substitution (generally conservative in nature) of at least one amino acid residue. Typically, variants retain a desired activity of the reference polypeptide, such as antigenic activity in inducing an immune response against a target antigen. In general, variant polypeptides are substantially similar or substantially identical to the reference polypeptide, e.g., amino acid sequence identity or similarity of more than 50%, generally more than 60%-70%, even more particularly 80%-85% or more, such as at least 90%-95% or more, when the two sequences are aligned. Often, the variants will include the same number of amino acids but will include substitutions, as explained herein.
(53) By primer is meant an oligonucleotide which, when paired with a strand of DNA, is capable of initiating the synthesis of a primer extension product in the presence of a suitable polymerizing agent. The primer is preferably single-stranded for maximum efficiency in amplification but may alternatively be double-stranded. A primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerization agent. The length of the primer depends on many factors, including application, temperature to be employed, template reaction conditions, other reagents, and source of primers. For example, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15 to 35 or more nucleotides, although it may contain fewer nucleotides. Primers can be large polynucleotides, such as from about 200 nucleotides to several kilobases or more. Primers may be selected to be substantially complementary to the sequence on the template to which it is designed to hybridize and serve as a site for the initiation of synthesis. By substantially complementary, it is meant that the primer is sufficiently complementary to hybridize with a target nucleotide sequence. Preferably, the primer contains no mismatches with the template to which it is designed to hybridize but this is not essential. For example, non-complementary nucleotides may be attached to the 5 end of the primer, with the remainder of the primer sequence being complementary to the template. Alternatively, non-complementary nucleotides or a stretch of non-complementary nucleotides can be interspersed into a primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize therewith and thereby form a template for synthesis of the extension product of the primer.
(54) Reference herein to a promoter is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or environmental stimuli, or in a tissue-specific or cell-type-specific manner. A promoter is usually, but not necessarily, positioned upstream or 5, of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. Preferred promoters according to the invention may contain additional copies of one or more specific regulatory elements to further enhance expression in a cell, and/or to alter the timing of expression of a structural gene to which it is operably connected.
(55) The term quality is used herein in its broadest sense and includes a measure, strength, intensity, degree or grade of a phenotype, e.g., a superior or inferior immune response.
(56) The term sequence identity as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, sequence identity will be understood to mean the match percentage calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, Calif., USA) using standard defaults as used in the reference manual accompanying the software.
(57) Similarity refers to the percentage number of amino acids that are identical or constitute conservative substitutions as defined in Table 10. Similarity may be determined using sequence comparison programs such as GAP (Deveraux et al. 1984, Nucleic Acids Research 12, 387-395). In this way, sequences of a similar or substantially different length to those cited herein might be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.
(58) Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include reference sequence, comparison window, sequence identity, percentage of sequence identity and substantial identity. A reference sequence is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a comparison window to identify and compare local regions of sequence similarity. A comparison window refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res. 25:3389. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc, 1994-1998, Chapter 15.
(59) The term synthetic polynucleotide as used herein refers to a polynucleotide that is formed by recombinant or synthetic techniques and typically includes polynucleotides that are not normally found in nature.
(60) The term synonymous codon as used herein refers to a codon having a different nucleotide sequence than another codon but encoding the same amino acid as that other codon.
(61) By treatment, treat, treated and the like is meant to include both therapeutic and prophylactic treatment.
(62) By vector is meant a nucleic acid molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, or plant virus, into which a nucleic acid sequence may be inserted or cloned. A vector preferably contains one or more unique restriction sites and may be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. A vector system may comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants. Examples of such resistance genes are well known to those of skill in the art.
2. Abbreviations
(63) The following abbreviations are used throughout the application:
(64) nt=nucleotide
(65) nts=nucleotides
(66) aa=amino acid(s)
(67) kb=kilobase(s) or kilobase pair(s)
(68) kDa=kilodalton(s)
(69) d=day
(70) h=hour
(71) s=seconds
3. Immune Response Preference Ranking of Codons in Mammals
(72) The present invention provides for the first time an immune response preference ranking of individual synonymous codons in mammals. This ranking was determined using a construct system that comprises a series of reporter constructs each comprising a different coding sequence for an antigenic polypeptide (e.g., a papillomavirus E7 polypeptide), wherein the coding sequence of individual constructs is distinguished from a parent coding sequence that encodes the antigenic polypeptide by the substitution of a single species of iso-accepting codon for each other species of iso-accepting codon that is present in the parent coding sequence. Accordingly, the coding sequence of individual synthetic constructs uses the same iso-accepting codon to encode most instances and preferably every instance of a particular amino acid residue (e.g., Ala.sup.GCT for all alanines) in the antigenic polypeptide and individual synthetic constructs differ in the species of iso-accepting codon used to encode a particular amino acid residue across the polypeptide sequence. As used herein, the species of iso-accepting codon that is used to encode a particular amino acid residue in the antigenic polypeptide is referred to as a standardized codon. An illustrative synthetic construct system is described in Example 1, which covers the entire set of synonymous codons that code for amino acids.
(73) Test mammals (e.g., mice) were immunized with the synthetic construct system in which individual mammals were immunized with a different synthetic construct and the host immune response (e.g., a humoral immune response or a cellular immune response) to the antigenic polypeptide was determined for each construct. In accordance with the present invention, the strength of immune response obtained from individual synthetic constructs provides a direct correlation to the immune preference of a corresponding standardized codon in a test mammal. Accordingly, the stronger the immune response produced from a given construct in a test mammal, the higher the immune preference will be of the corresponding standardized codon.
(74) Comparison of the immune response preferences so determined with the translational efficiencies derived from codon usage frequency values for mammalian cells in general as determined by Seed (see U.S. Pat. Nos. 5,786,464 and 5,795,737) reveals several differences in the ranking of codons. For convenience, these differences are highlighted in TABLE 9, in which Seed preferred codons are highlighted with a blue background, Seed less preferred codons are highlighted with a green background, and Seed non preferred codons are highlighted with a grey background.
(75) TABLE-US-00009 TABLE 9 Preferential codon usage as predicted Experimentally determined codon by Seed for mammalian cells in immune response preferences in test aa general mammals Ala GCC >> (GCG, GCT, GCA) GCT > GCC > (GCA GCG) Arg CGC >> (CGA, CGT, AGA, AGG, (CGA, CGC, CGT, AGA) > (AGG, CGG) CGG) Asn AAC >> AAT AAC > AAT Asp GAC >> GAT GAC > GAT Cys TGC >> TGT TGC > TGT Glu (GAA, GAG) GAA > GAG Gln CAG >> CAA CAA = CAG Gly GGC > GGG > (GGT, GGA) GGA > (GGG, GGT, GGC) His CAC >> CAT CAC = CAT Ile ATC > ATT > ATA ATC >> ATT > ATA Leu CTG > CTC > (TTA, CTA, CTT, (CTG, CTC) > (CTA, CTT) >> TTG > TTG) TTA Lys AAG >> AAA AAG = AAA Phe TTC >> TTT TTT > TTC Pro CCC >> (CCG, CCA, CCT) CCC > CCT >> (CCA, CCG) Ser AGC > TCC > (TCG, AGT, TCA, TCG >> (TCT, TCA, TCC) >> (AGC, TCT) AGT) Thr ACC >> (ACG, ACA, ACT) ACG > ACC >> ACA > ACT Tyr TAC >> TAT TAC > TAT Val GTG > GTC > (GTA, GTT) (GTG, GTC) > GTT > GTA
(76) As will be apparent from the above table:
(77) (i) several codons deemed by Seed to have a higher codon usage ranking in mammalian cells than at least one other synonymous codon have in fact a lower immune response preference ranking than the or each other synonymous codon (e.g., Ala.sup.GCC has a higher codon usage ranking but lower immune response preference ranking than Ala.sup.GCT; Gly.sup.GGC has a higher codon usage ranking but lower immune response preference ranking than Gly.sup.GGA; Phe.sup.TTC has a higher codon usage ranking but lower immune response preference ranking than Phe.sup.TTT; Ser.sup.AGC has a higher codon usage ranking but lower immune response preference ranking than any one of Ser.sup.TCG, Ser.sup.TCT, Ser.sup.TCG, Ser.sup.TCA and Ser.sup.TCC; and Thr.sup.ACC has a higher codon usage ranking but lower immune response preference ranking than Thr.sup.ACG);
(78) (ii) several codons deemed by Seed to have a lower codon usage ranking in mammalian cells than at least one other synonymous codon have in fact a higher immune response preference ranking than the or each other synonymous codon (e.g., Ala.sup.GCT has a lower codon usage ranking but higher immune response preference ranking than Ala.sup.GCC; Gly.sup.GGA has a lower codon usage ranking but higher immune response preference ranking than Gly.sup.GGC or Gly.sup.GGG; Phe.sup.TTT has a lower codon usage ranking but higher immune response preference ranking than Phe.sup.TTC; Ser.sup.TCG has a lower codon usage ranking but higher immune response preference ranking than Ser.sup.AGC or Ser.sup.TCC; Ser.sup.TCT and Ser.sup.TCA have a lower codon usage ranking but higher immune response preference ranking than Ser.sup.AGC; and Thr.sup.AGC has a lower codon usage ranking but higher immune response preference ranking than Thr.sup.ACC);
(79) (iii) several codons deemed by Seed to have a higher codon usage ranking in mammalian cells than another synonymous codon have in fact the same immune response preference ranking as the other synonymous codon (e.g., Gln.sup.CAG has a higher codon usage ranking than, but the same immune response preference ranking as, Gln.sup.CAA; His.sup.CAC has a higher codon usage ranking than, but the same immune response preference ranking as, His.sup.CAT; Leu.sup.CTG has a higher codon usage ranking than, but the same immune response preference ranking as Leu.sup.CTC; Lys.sup.AAG has a higher codon usage ranking than, but the same immune response preference ranking as, Lys.sup.AAA; Val.sup.GTG has a higher codon usage ranking than, but the same immune response preference ranking as, Val.sup.GTC); and
(80) (iv) several codons deemed by Seed to have the same codon usage ranking in mammalian cells as at least one other synonymous codon have in fact a different immune response preference ranking than the or each other synonymous codon (e.g., Ala.sup.GCT has the same codon usage ranking as, but a higher immune response preference ranking than, Ala.sup.GCA and Ala.sup.GCG; Arg.sup.CGA, Arg.sup.CGT and Arg.sup.AGA have the same codon usage ranking as, but a higher immune response preference ranking than, Arg.sup.AGG and Arg.sup.CGG; Glu.sup.GAA has the same codon usage ranking as, but a higher immune response preference ranking than, Glu.sup.GAG; Gly.sup.GGA has the same codon usage ranking as, but a higher immune response preference ranking than, Gly.sup.GGT; Leu.sup.CTA and Leu.sup.CTT have the same codon usage ranking as, but a higher immune response preference ranking than, Leu.sup.TTG and Leu.sup.TTA; Pro.sup.CCT has the same codon usage ranking as, but a higher immune response preference ranking than, Pro.sup.CCA or Pro.sup.CCG; Ser.sup.TCG has the same codon usage ranking as, but a higher immune response preference ranking than, any one of Ser.sup.TCT, Ser.sup.TCA and Ser.sup.AGT; Ser.sup.TCT and Ser.sup.TCA have the same codon usage ranking as, but a higher immune response preference ranking than, Ser.sup.AGT; Thr.sup.ACG has the same codon usage ranking as, but a higher immune response preference ranking than, any one of Thr.sup.ACA and Thr.sup.ACT; Thr.sup.ACG has the same codon usage ranking as, but a higher immune response preference ranking than, Thr.sup.ACT; Val.sup.GTT has the same codon usage ranking as, but a higher immune response preference ranking than, Val.sup.GTA).
(81) Accordingly, the present invention enables for the first time the modulation of an immune response to a target antigen in a mammal from a polynucleotide that encodes a polypeptide that corresponds to at least a portion of the target antigen by replacing at least one codon of the polynucleotide with a synonymous codon that has a higher or lower preference for producing an immune response than the codon it replaces. In some embodiments, therefore, the present invention embraces methods of constructing a synthetic polynucleotide from which a polypeptide is producible to confer an enhanced or stronger immune response than one conferred by a parent polynucleotide that encodes the same polypeptide. These methods generally comprise selecting from TABLE 1 a codon (often referred to herein arbitrarily as a first codon) of the parent polynucleotide for replacement with a synonymous codon, wherein the synonymous codon is selected on the basis that it exhibits a higher immune response preference than the first codon and replacing the first codon with the synonymous codon to construct the synthetic polynucleotide. Illustrative selections of the first and synonymous codons are made according to TABLE 2.
(82) In some embodiments, the selection of the first and synonymous codons is made according to TABLE 3, which is the same as TABLE 2 with the exception that it excludes selections based on codon usage rankings as disclosed by Seed. In illustrative examples of this type, the selection of a second codon (and subsequent codons if desired) for replacement with a synonymous codon is made according to TABLE 4.
(83) Where synonymous codons are classified into three ranks (high, intermediate and low ranks) based on their immune response preference ranking (e.g., the synonymous codons for Ala, Ile, Leu, Pro, Ser, Thr and Val), it is preferred that the synonymous codon that is selected is a high rank codon when the first codon is a low rank codon. However, this is not essential and the synonymous codon can be selected from intermediate rank codons. In the case of two or more synonymous codons having similar immune response preferences, it will be appreciated that any one of these codons can be used to replace the first codon.
(84) In other embodiments, the invention provides methods of constructing a synthetic polynucleotide from which a polypeptide is producible to confer a reduced or weaker immune response than one conferred by a parent polynucleotide that encodes the same polypeptide. These methods generally comprise selecting from TABLE 1 a first codon of the parent polynucleotide for replacement with a synonymous codon, wherein the synonymous codon is selected on the basis that it exhibits a lower immune response preference than the first codon and replacing the first codon with the synonymous codon to construct the synthetic polynucleotide. Illustrative selections of the first and synonymous codons are made according to TABLE 5.
(85) In some embodiments, the selection of the first and synonymous codons is made according to TABLE 6, which is the same as TABLE 5 with the exception that it excludes selections based on codon usage rankings as disclosed by Seed. In illustrative examples of this type, the selection of a second codon (and subsequent codons if desired) for replacement with a synonymous codon is made according to TABLE 7.
(86) Where synonymous codons are classified into the three ranks noted above, it is preferred that the synonymous codon that is selected is a low rank codon when the first codon is a high rank codon but this is not essential and thus the synonymous codon can be selected from intermediate rank codons if desired.
(87) Generally, the difference in strength of the immune response produced in the mammal from the synthetic polynucleotide as compared to that produced from the parent polynucleotide depends on the number of first/second codons that are replaced by synonymous codons, and on the difference in immune response preference ranking between the first/second codons and the synonymous codons. Put another way, the fewer such replacements, and/or the smaller the difference in immune response preference ranking between the synonymous and first/codons codons, the smaller the difference will be in the immune response produced by the synthetic polynucleotide and the one produced by the parent polynucleotide. Conversely, the more such replacements, and/or the greater the difference in immune response preference ranking between the synonymous and first/second codons, the greater the difference will be in the immune response produced by the synthetic polynucleotide and the one produced by the parent polynucleotide.
(88) It is preferable but not necessary to replace all the codons of the parent polynucleotide with synonymous codons having different (e.g., higher or lower) immune response preference rankings than the first/second codons. Changes in the conferred immune response can be accomplished even with partial replacement. Generally, the replacement step affects at least about 5%, 10%, 15%, 20%, 25%, 30%, usually at least about 35%, 40%, 50%, and typically at least about 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the first/second codons of the parent polynucleotide. In embodiments in which a stronger or enhanced immune response is required, it is generally desirable to replace some, preferably most and more preferably all, low rank codons in a parent polynucleotide with synonymous codons that are intermediate, or preferably high rank codons. Typically, replacement of low with intermediate or high rank codons will result in an increase in the strength of immune response from the synthetic polynucleotide so constructed, as compared to the one produced from the parent polynucleotide under the same conditions. However, it is often desirable to replace some, preferably most and more preferably all, intermediate rank codons in the parent polynucleotide with high rank codons, if stronger or more enhanced immune responses are desired.
(89) By contrast, in some embodiments in which a weaker or reduced immune response is required, it is generally desirable to replace some, preferably most and more preferably all, high rank codons in a parent polynucleotide with synonymous codons that are intermediate, or preferably low rank codons. Typically, replacement of high with intermediate or low rank codons will result in a substantial decrease in the strength of immune response from the synthetic polynucleotide so constructed, as compared to the one produced from the parent polynucleotide under the same condition. In specific embodiments in which it is desired to confer a weaker or more reduced immune response, it is generally desirable to replace some, preferably most and more preferably all, intermediate rank codons in the parent polynucleotide with low rank codons.
(90) In illustrative examples requiring a stronger or enhanced immune response, the number of, and difference in immune response preference ranking between, the first/second codons and the synonymous codons are selected such that the immune response conferred by the synthetic polynucleotide is at least about 110%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000%, or more, of the immune response conferred by the parent polynucleotide under the same conditions. Conversely, in some embodiments requiring a lower or weaker immune response, the number of, and difference in phenotypic preference ranking between, the first/second codons and the synonymous codons are selected such that the immune response conferred by the synthetic polynucleotide is no more than about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less of the immune response conferred by the parent polynucleotide under the same conditions.
4. Modulating Immune Responses in Mammals by Expression of Isoaccepting Transfer RNA-Encoding Polynucleotides
(91) It is possible to take advantage of the immune response preference rankings of codons discussed in Section 3 to modulate an immune response to a target antigen by changing the level of iso-tRNAs in the cell population which is the target of the immunization. Accordingly, the invention also features methods of enhancing the quality of an immune response to a target antigen in a mammal, wherein the response is conferred by the expression of a first polynucleotide that encodes a polypeptide corresponding to at least a portion of the target antigen. These methods generally comprise: introducing into the mammal a first nucleic acid construct comprising the first polynucleotide in operable connection with a regulatory polynucleotide. A second nucleic acid construct is then introduced into the mammal, which comprises a second polynucleotide that is operably connected to a regulatory polynucleotide and that encodes an iso-tRNA corresponding to a low immune preference codon of the first polynucleotide.
(92) In practice, therefore, an iso-tRNA is introduced into the mammal by the second nucleic acid construct when the iso-tRNA corresponds to a low immune response preference codon in the first polynucleotide, which are suitably selected from the group consisting of Ala.sup.GCA, Ala.sup.GCG, Ala.sup.GCC, Arg.sup.AGG, Arg.sup.CGG, Asn.sup.AAT, Asp.sup.GAT, Cys.sup.TGT, Glu.sup.GAG, Gly.sup.GGG, Gly.sup.GGT, Gly.sup.GGC, Ile.sup.ATA, Ile.sup.ATT, Leu.sup.TTG, Leu.sup.TTA, Leu.sup.CTA, Leu.sup.CTT, Phe.sup.TTC, Pro.sup.CCA, Pro.sup.CCG, Pro.sup.CCT, Ser.sup.AGC, Ser.sup.AGT, Ser.sup.TCA, Ser.sup.TCC, Thr.sup.ACA, Thr.sup.ACT, Tyr.sup.TAT, Val.sup.GTA and Val.sup.GTT. In specific embodiments, the supplied iso-tRNAs are specific for codons that have low immune response preference codons, which may be selected from the group consisting of Ala.sup.GCA, Ala.sup.GCG, Arg.sup.AGG, Arg.sup.CGG, Asn.sup.AAT, Asp.sup.GAT, Cys.sup.TGT, Glu.sup.GAG, Gly.sup.GGG, Gly.sup.GGT, Gly.sup.GGC, Ile.sup.ATA, Leu.sup.TTG, Leu.sup.TTA, Phe.sup.TTC, Pro.sup.CCA, Pro.sup.CCG, Ser.sup.AGC, Ser.sup.AGT, Thr.sup.ACT, Tyr.sup.TAT, and Val.sup.GTA. The first construct (i.e., antigen-expressing construct) and the second construct (i.e., the iso-tRNA-expressing construct) may be introduced simultaneously or sequentially (in either order) and may be introduced at the same or different sites. In some embodiments, the first and second constructs are contained in separate vectors. In other embodiments, they are contained in a single vector. If desired, two or more second constructs may be introduced each expressing a different iso-tRNA corresponding to a low preference codon of the first polynucleotide. The first and second nucleic acid constructs may be constructed and administered concurrently or contemporaneously to a mammal according to any suitable method, illustrative examples of which are discussed below for the chimeric constructs of the invention.
(93) In some embodiments, a plurality of different iso-tRNA-expressing constructs (e.g., 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) are administered concurrently or contemporaneously with the antigen-expressing construct, wherein individual iso-tRNA-expressing constructs express a different iso-tRNA than other iso-tRNA-expressing constructs.
5. Antigens
(94) Target antigens useful in the present invention are typically proteinaceous molecules, representative examples of which include polypeptides and peptides. Target antigens may be selected from endogenous antigens produced by a host or exogenous antigens that are foreign to the host. Suitable endogenous antigens include, but are not restricted to, cancer or tumor antigens. Non-limiting examples of cancer or tumor antigens include antigens from a cancer or tumor selected from ABL1 proto-oncogene, AIDS related cancers, acoustic neuroma, acute lymphocytic leukemia, acute myeloid leukemia, adenocystic carcinoma, adrenocortical cancer, agnogenic myeloid metaplasia, alopecia, alveolar soft-part sarcoma, anal cancer, angiosarcoma, aplastic anemia, astrocytoma, ataxia-telangiectasia, basal cell carcinoma (skin), bladder cancer, bone cancers, bowel cancer, brain stem glioma, brain and CNS tumors, breast cancer, CNS tumors, carcinoid tumors, cervical cancer, childhood brain tumors, childhood cancer, childhood leukemia, childhood soft tissue sarcoma, chondrosarcoma, choriocarcinoma, chronic lymphocytic leukemia, chronic myeloid leukemia, colorectal cancers, cutaneous T-cell lymphoma, dermatofibrosarcoma protuberans, desmoplastic small round cell tumor, ductal carcinoma, endocrine cancers, endometrial cancer, ependymoma, oesophageal cancer, Ewing's Sarcoma, Extra-Hepatic Bile Duct Cancer, Eye Cancer, Eye: Melanoma, Retinoblastoma, Fallopian Tube cancer, Fanconi anemia, fibrosarcoma, gall bladder cancer, gastric cancer, gastrointestinal cancers, gastrointestinal-carcinoid-tumor, genitourinary cancers, germ cell tumors, gestational-trophoblastic-disease, glioma, gynecological cancers, haematological malignancies, hairy cell leukemia, head and neck cancer, hepatocellular cancer, hereditary breast cancer, histiocytosis, Hodgkin's disease, human papillomavirus, hydatidiform mole, hypercalcemia, hypopharynx cancer, intraocular melanoma, islet cell cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leiomyosarcoma, leukemia, Li-Fraumeni syndrome, lip cancer, liposarcoma, liver cancer, lung cancer, lymphedema, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, male breast cancer, malignant-rhabdoid tumor of kidney, medulloblastoma, melanoma, Merkel cell cancer, mesothelioma, metastatic cancer, mouth cancer, multiple endocrine neoplasia, mycosis fungoides, myelodysplastic syndromes, myeloma, myeloproliferative disorders, nasal cancer, nasopharyngeal cancer, nephroblastoma, neuroblastoma, neurofibromatosis, Nijmegen breakage syndrome, non-melanoma skin cancer, non-small-cell-lung-cancer (NSCLC), ocular cancers, esophageal cancer, oral cavity cancer, oropharynx cancer, osteosarcoma, ostomy ovarian cancer, pancreas cancer, paranasal cancer, parathyroid cancer, parotid gland cancer, penile cancer, peripheral-neuroectodermal tumours, pituitary cancer, polycythemia vera, prostate cancer, rare cancers and associated disorders, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, Rothmund-Thomson syndrome, salivary gland cancer, sarcoma, schwannoma, Sezary syndrome, skin cancer, small cell lung cancer (SCLC), small intestine cancer, soft tissue sarcoma, spinal cord tumors, squamous-cell-carcinoma-(skin), stomach cancer, synovial sarcoma, testicular cancer, thymus cancer, thyroid cancer, transitional-cell-cancer-(bladder), transitional-cell-cancer-(renal-pelvis/ ureter), trophoblastic cancer, urethral cancer, urinary system cancer, uroplakins, uterine sarcoma, uterus cancer, vaginal cancer, vulva cancer, Waldenstroms macroglobulinemia, Wilms' tumor. In certain embodiments, the cancer or tumor relates to melanoma. Illustrative examples of melanoma-related antigens include melanocyte differentiation antigen (e.g., gp100, MART, Melan-A/MART-1, TRP-1, Tyros, TRP2, MC1R, MUC1F, MUC1R or a combination thereof) and melanoma-specific antigens (e.g., BAGE, GAGE-1, gp100In4, MAGE-1 (e.g., GenBank Accession No. X54156 and AA494311), MAGE-3, MAGE4, PRAME, TRP2IN2, NYNSO1a, NYNSO1b, LAGE1, p97 melanoma antigen (e.g., GenBank Accession No. M12154) p5 protein, gp75, oncofetal antigen, GM2 and GD2 gangliosides, cdc27, p21ras, gp100.sup.Pmel117 or a combination thereof. Other tumour-specific antigens include, but are not limited to: etv6, aml1, cyclophilin b (acute lymphoblastic leukemia); Ig-idiotype (B cell lymphoma); E-cadherin, -catenin, -catenin, -catenin, p120ctn (glioma); p21ras (bladder cancer); p21ras (biliary cancer); MUC family, HER2/neu, c-erbB-2 (breast cancer); p53, p21ras (cervical carcinoma); p21ras, HER2/neu, c-erbB-2, MUC family, Cripto-1protein, Pim-1 protein (colon carcinoma); Colorectal associated antigen (CRC)-CO17-1A/GA733, APC (colorectal cancer); carcinoembryonic antigen (CEA) (colorectal cancer; choriocarcinoma); cyclophilin b (epithelial cell cancer); HER2/neu, c-erbB-2, ga733 glycoprotein (gastric cancer); -fetoprotein (hepatocellular cancer); Imp-1, EBNA-1 (Hodgkin's lymphoma); CEA, MAGE-3, NY-ESO-1 (lung cancer); cyclophilin b (lymphoid cell-derived leukemia); MUC family, p21ras (myeloma); HER2/neu, c-erbB-2 (non-small cell lung carcinoma); Imp-1, EBNA-1 (nasopharyngeal cancer); MUC family, HER2/neu, c-erbB-2, MAGE-A4, NY-ESO-1 (ovarian cancer); Prostate Specific Antigen (PSA) and its antigenic epitopes PSA-1, PSA-2, and PSA-3, PSMA, HER2/neu, c-erbB-2, ga733 glycoprotein (prostate cancer); HER2/neu, c-erbB-2 (renal cancer); viral products such as human papillomavirus proteins (squamous cell cancers of the cervix and esophagus); NY-ESO-1 (testicular cancer); and HTLV-1 epitopes (T cell leukemia).
(95) Foreign or exogenous antigens are suitably selected from antigens of pathogenic organisms. Exemplary pathogenic organisms include, but are not limited to, viruses, bacteria, fungi parasites, algae and protozoa and amoebae. Illustrative viruses include viruses responsible for diseases including, but not limited to, measles, mumps, rubella, poliomyelitis, hepatitis A, B (e.g., GenBank Accession No. E02707), and C (e.g., GenBank Accession No. E06890), as well as other hepatitis viruses, influenza, adenovirus (e.g., types 4 and 7), rabies (e.g., GenBank Accession No. M34678), yellow fever, Epstein-Barr virus and other herpesviruses such as papillomavirus, Ebola virus, influenza virus, Japanese encephalitis (e.g., GenBank Accession No. E07883), dengue (e.g., GenBank Accession No. M24444), hantavirus, Sendai virus, respiratory syncytial virus, orthomyxoviruses, vesicular stomatitis virus, visna virus, cytomegalovirus and human immunodeficiency virus (HIV) (e.g., GenBank Accession No. U18552). Any suitable antigen derived from such viruses are useful in the practice of the present invention. For example, illustrative retroviral antigens derived from HIV include, but are not limited to, antigens such as gene products of the gag, pol, and env genes, the Nef protein, reverse transcriptase, and other HIV components. Illustrative examples of hepatitis viral antigens include, but are not limited to, antigens such as the S, M, and L proteins of hepatitis B virus, the pre-S antigen of hepatitis B virus, and other hepatitis, e.g., hepatitis A, B, and C, viral components such as hepatitis C viral RNA. Illustrative examples of influenza viral antigens include; but are not limited to, antigens such as hemagglutinin and neuraminidase and other influenza viral components. Illustrative examples of measles viral antigens include, but are not limited to, antigens such as the measles virus fusion protein and other measles virus components. Illustrative examples of rubella viral antigens include, but are not limited to, antigens such as proteins E1 and E2 and other rubella virus components; rotaviral antigens such as VP7sc and other rotaviral components. Illustrative examples of cytomegaloviral antigens include, but are not limited to, antigens such as envelope glycoprotein B and other cytomegaloviral antigen components. Non-limiting examples of respiratory syncytial viral antigens include antigens such as the RSV fusion protein, the M2 protein and other respiratory syncytial viral antigen components. Illustrative examples of herpes simplex viral antigens include, but are not limited to, antigens such as immediate early proteins, glycoprotein D, and other herpes simplex viral antigen components. Non-limiting examples of varicella zoster viral antigens include antigens such as 9PI, gpII, and other varicella zoster viral antigen components. Non-limiting examples of Japanese encephalitis viral antigens include antigens such as proteins E, M-E, M-E-NS 1, NS 1, NS 1-NS2A, 80% E, and other Japanese encephalitis viral antigen components. Representative examples of rabies viral antigens include, but are not limited to, antigens such as rabies glycoprotein, rabies nucleoprotein and other rabies viral antigen components. Illustrative examples of papillomavirus antigens include, but are not limited to, the L1 and L2 capsid proteins as well as the E6/E7 antigens associated with cervical cancers, See Fundamental Virology, Second Edition, eds. Fields, B. N. and Knipe, D. M., 1991, Raven Press, New York, for additional examples of viral antigens.
(96) Illustrative examples of fungi include Acremonium spp., Aspergillus spp., Basidiobolus spp., Bipolaris spp., Blastomyces dermatidis, Candida spp., Cladophialophora carrionii, Coccidioides immitis, Conidiobolus spp., Cryptococcus spp., Curvularia spp., Epidermophyton spp., Exophiala jeanselmei, Exserohilum spp., Fonsecaea compacta, Fonsecaea pedrosoi, Fusarium oxysporum, Fusarium solani, Geotrichum candidum, Histoplasma capsulatum var. capsulatum, Histoplasma capsulatum var. duboisii, Hortaea werneckii, Lacazia loboi, Lasiodiplodia theobromae, Leptosphaeria senegalensis, Madurella grisea, Madurella mycetomatis, Malassezia furfur, Microsporum spp., Neotestudina rosatii, Onychocola canadensis, Paracoccidioides brasiliensis, Phialophora verrucosa, Piedraia hortae, Piedra iahortae, Pityriasis versicolor, Pseudallescheria boydii, Pyrenochaeta romeroi, Rhizopus arrhizus, Scopulariopsis brevicaulis, Scytalidium dimidiatum, Sporothrix schenckii, Trichophyton spp., Trichosporon spp., Zygomycete fungi, Absidia corymbifera, Rhizomucor pusillus and Rhizopus arrhizus. Thus, representative fungal antigens that can be used in the compositions and methods of the present invention include, but are not limited to, candida fungal antigen components; histoplasma fungal antigens such as heat shock protein 60 (HSP60) and other histoplasma fungal antigen components; cryptococcal fungal antigens such as capsular polysaccharides and other cryptococcal fungal antigen components; coccidioides fungal antigens such as spherule antigens and other coccidioides fungal antigen components; and tinea fungal antigens such as trichophytin and other coccidioides fungal antigen components.
(97) Illustrative examples of bacteria include bacteria that are responsible for diseases including, but not restricted to, diphtheria (e.g., Corynebacterium diphtheria), pertussis (e.g., Bordetella pertussis, GenBank Accession No. M35274), tetanus (e.g., Clostridium tetani, GenBank Accession No. M64353), tuberculosis (e.g., Mycobacterium tuberculosis), bacterial pneumonias (e.g., Haemophilus influenzae), cholera (e.g., Vibrio cholerae), anthrax (e.g., Bacillus anthracis), typhoid, plague, shigellosis (e.g., Shigella dysenteriae), botulism (e.g., Clostridium botulinum), salmonellosis (e.g., GenBank Accession No. L03833), peptic ulcers (e.g., Helicobacter pylori), Legionnaire's Disease, Lyme disease (e.g., GenBank Accession No. U59487), Other pathogenic bacteria include Escherichia coli, Clostridium perfringens, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus pyogenes. Thus, bacterial antigens which can be used in the compositions and methods of the invention include, but are not limited to: pertussis bacterial antigens such as pertussis toxin, filamentous hemagglutinin, pertactin, F M2, FIM3, adenylate cyclase and other pertussis bacterial antigen components; diphtheria bacterial antigens such as diphtheria toxin or toxoid and other diphtheria bacterial antigen components; tetanus bacterial antigens such as tetanus toxin or toxoid and other tetanus bacterial antigen components, streptococcal bacterial antigens such as M proteins and other streptococcal bacterial antigen components; gram-negative bacilli bacterial antigens such as lipopolysaccharides and other gram-negative bacterial antigen components; Mycobacterium tuberculosis bacterial antigens such as mycolic acid, heat shock protein 65 (HSP65), the kDa major secreted protein, antigen 85A and other mycobacterial antigen components; Helicobacter pylori bacterial antigen components, pneumococcal bacterial antigens such as pneumolysin, pneumococcal capsular polysaccharides and other pneumococcal bacterial antigen components; Haemophilus influenza bacterial antigens such as capsular polysaccharides and other Haemophilus influenza bacterial antigen components; anthrax bacterial antigens such as anthrax protective antigen and other anthrax bacterial antigen components; rickettsiae bacterial antigens such as rompA and other rickettsiae bacterial antigen component. Also included with the bacterial antigens described herein are any other bacterial, mycobacterial, mycoplasmal, rickettsial, or chlamydial antigens.
(98) Illustrative examples of protozoa include protozoa that are responsible for diseases including, but not limited to, malaria (e.g., GenBank Accession No. X53832), hookworm, onchocerciasis (e.g., GenBank Accession No. M27807), schistosomiasis (e.g., GenBank Accession No. LOS 198), toxoplasmosis, trypanosomiasis, leishmaniasis, giardiasis (GenBank Accession No. M33641), amoebiasis, filariasis (e.g., GenBank Accession No. J03266), borreliosis, and trichinosis. Thus, protozoal antigens which can be used in the compositions and methods of the invention include, but are not limited to: plasmodium falciparum antigens such as merozoite surface antigens, sporozoite surface antigens, circumsporozoite antigens, gametocyte/gamete surface antigens, blood-stage antigen pf 155/RESA and other plasmodial antigen components; toxoplasma antigens such as SAG-1, p30 and other toxoplasma antigen components; schistosoma antigens such as glutathione-S-transferase, paramyosin, and other schistosomal antigen components; leishmania major and other leishmaniae antigens such as gp63, lipophosphoglycan and its associated protein and other leishmanial antigen components; and trypanosoma cruzi antigens such as the 75-77 kDa antigen, the 56 kDa antigen and other trypanosomal antigen components.
(99) The present invention also contemplates toxin components as antigens, illustrative examples of which include staphylococcal enterotoxins, toxic shock syndrome toxin; retroviral antigens (e.g., antigens derived from HIV), streptococcal antigens, staphylococcal enterotoxin-A (SEA), staphylococcal enterotoxin-B (SEB), staphylococcal enterotoxin.sub.1-3 (SE.sub.1-3), staphylococcal enterotoxin-D (SED), staphylococcal enterotoxin-E (SEE) as well as toxins derived from mycoplasma, mycobacterium, and herpes viruses.
6. Construction of Synthetic Polynucleotides
(100) Replacement of one codon for another can be achieved using standard methods known in the art. For example codon modification of a parent polynucleotide can be effected using several known mutagenesis techniques including, for example, oligonucleotide-directed mutagenesis, mutagenesis with degenerate oligonucleotides, and region-specific mutagenesis. Exemplary in vitro mutagenesis techniques are described for example in U.S. Pat. Nos. 4,184,917, 4,321,365 and 4,351,901 or in the relevant sections of Ausubel, et al. (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. 1997) and of Sambrook, et al., (MOLECULAR CLONING. A LABORATORY MANUAL, Cold Spring Harbor Press, 1989). Instead of in vitro mutagenesis, the synthetic polynucleotide can be synthesized de novo using readily available machinery as described, for example, in U.S. Pat. No. 4,293,652. However, it should be noted that the present invention is not dependent on, and not directed to, any one particular technique for constructing the synthetic polynucleotide.
(101) The parent polynucleotide is suitably a natural gene. However, it is possible that the parent polynucleotide is not naturally-occurring but has been engineered using recombinant techniques. Parent polynucleotides can be obtained from any suitable source, such as from eukaryotic or prokaryotic organisms, including but not limited to mammals or other animals, and pathogenic organisms such as yeasts, bacteria, protozoa and viruses.
(102) The invention also contemplates synthetic polynucleotides encoding one or more desired portions of a target antigen. In some embodiments, the synthetic polynucleotide encodes at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 300, 400, 500, 600, 700, 800, 900 or 1000, or even at least about 2000, 3000, 4000 or 5000 contiguous amino acid residues, or almost up to the total number of amino acids present in a full-length target antigen. In some embodiments, the synthetic polynucleotide encodes a plurality of portions of the target antigen, wherein the portions are the same or different. In illustrative examples of this type, the synthetic polynucleotide encodes a multi-epitope fusion protein. A number of factors can influence the choice of portion size. For example, the size of individual portions encoded by the synthetic polynucleotide can be chosen such that it includes, or corresponds to the size of, T cell epitopes and/or B cell epitopes, and their processing requirements. Practitioners in the art will recognize that class I-restricted T cell epitopes are typically between 8 and 10 amino acid residues in length and if placed next to unnatural flanking residues, such epitopes can generally require 2 to 3 natural flanking amino acid residues to ensure that they are efficiently processed and presented. Class II-restricted T cell epitopes usually range between 12 and 25 amino acid residues in length and may not require natural flanking residues for efficient proteolytic processing although it is believed that natural flanking residues may play a role. Another important feature of class II-restricted epitopes is that they generally contain a core of 9-10 amino acid residues in the middle which bind specifically to class II MHC molecules with flanking sequences either side of this core stabilizing binding by associating with conserved structures on either side of class II MHC antigens in a sequence independent manner. Thus the functional region of class II-restricted epitopes is typically less than about 15 amino acid residues long. The size of linear B cell epitopes and the factors effecting their processing, like class II-restricted epitopes, are quite variable although such epitopes are frequently smaller in size than 15 amino acid residues. From the foregoing, it is advantageous, but not essential, that the size of individual portions of the target antigen is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30 amino acid residues. Suitably, the size of individual portions is no more than about 500, 200, 100, 80, 60, 50, 40 amino acid residues. In certain advantageous embodiments, the size of individual portions is sufficient for presentation by an antigen-presenting cell of a T cell and/or a B cell epitope contained within the peptide.
(103) As will be appreciated by those of skill in the art, it is generally not necessary to immunize with a polypeptide that shares exactly the same amino acid sequence with the target antigen to produce an immune response to that antigen. In some embodiments, therefore, the polypeptide encoded by the synthetic polynucleotide is desirably a variant of at least a portion of the target antigen. Variant polypeptides include proteins derived from the target antigen by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the target antigen; deletion or addition of one or more amino acids at one or more sites in the target antigen; or substitution of one or more amino acids at one or more sites in the target antigen. Variant polypeptides encompassed by the present invention will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, typically at least about 90% to 95% or more, and more typically at least about 96%, 97%, 98%, 99% or more sequence similarity or identity with the amino acid sequence of the target antigen or portion thereof as determined by sequence alignment programs described elsewhere herein using default parameters. A variant of a target antigen may differ from that antigen generally by as much 1000, 500, 400, 300, 200, 100, 50 or 20 amino acid residues or suitably by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
(104) Variant polypeptides corresponding to at least a portion of a target antigen may contain conservative amino acid substitutions at various locations along their sequence, as compared to the target antigen amino acid sequence. A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, which can be generally sub-classified as follows:
(105) Acidic: The residue has a negative charge due to loss of H ion at physiological pH and the residue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH. Amino acids having an acidic side chain include glutamic acid and aspartic acid.
(106) Basic: The residue has a positive charge due to association with H ion at physiological pH or within one or two pH units thereof (e.g., histidine) and the residue is attracted by aqueous solution so as to seek the surface positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium at physiological pH. Amino acids having a basic side chain include arginine, lysine and histidine.
(107) Charged: The residues are charged at physiological pH and, therefore, include amino acids having acidic or basic side chains (i.e., glutamic acid, aspartic acid, arginine, lysine and histidine).
(108) Hydrophobic: The residues are not charged at physiological pH and the residue is repelled by aqueous solution so as to seek the inner positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium. Amino acids having a hydrophobic side chain include tyrosine, valine, isoleucine, leucine, methionine, phenylalanine and tryptophan.
(109) Neutral/polar: The residues are not charged at physiological pH, but the residue is not sufficiently repelled by aqueous solutions so that it would seek inner positions in the conformation of a peptide in which it is contained when the peptide is in aqueous medium. Amino acids having a neutral/polar side chain include asparagine, glutamine, cysteine, histidine, serine and threonine.
(110) This description also characterizes certain amino acids as small since their side chains are not sufficiently large, even if polar groups are lacking, to confer hydrophobicity. With the exception of proline, small amino acids are those with four carbons or less when at least one polar group is on the side chain and three carbons or less when not. Amino acids having a small side chain include glycine, serine, alanine and threonine. The gene-encoded secondary amino acid proline is a special case due to its known effects on the secondary conformation of peptide chains. The structure of proline differs from all the other naturally-occurring amino acids in that its side chain is bonded to the nitrogen of the -amino group, as well as the -carbon. Several amino acid similarity matrices (e.g., PAM120 matrix and PAM250 matrix as disclosed for example by Dayhoff et al. (1978) A model of evolutionary change in proteins. Matrices for determining distance relationships In M. O. Dayhoff, (ed.), Atlas of protein sequence and structure, Vol. 5, pp. 345-358, National Biomedical Research Foundation, Washington D.C.; and by Gonnet et al., 1992, Science 256(5062): 144301445), however, include proline in the same group as glycine, serine, alanine and threonine. Accordingly, for the purposes of the present invention, proline is classified as a small amino acid.
(111) The degree of attraction or repulsion required for classification as polar or nonpolar is arbitrary and, therefore, amino acids specifically contemplated by the invention have been classified as one or the other. Most amino acids not specifically named can be classified on the basis of known behavior.
(112) Amino acid residues can be further sub-classified as cyclic or noncyclic, and aromatic or nonaromatic, self-explanatory classifications with respect to the side-chain substituent groups of the residues, and as small or large. The residue is considered small if it contains a total of four carbon atoms or less, inclusive of the carboxyl carbon, provided an additional polar substituent is present; three or less if not. Small residues are, of course, always nonaromatic. Dependent on their structural properties, amino acid residues may fall in two or more classes. For the naturally-occurring protein amino acids, sub-classification according to the this scheme is presented in the Table 10.
(113) TABLE-US-00010 TABLE 10 Original Residue Exemplary Substitutions Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Pro His Asn, Gln Ile Leu, Val Leu Ile, Val Lys Arg, Gln, Glu Met Leu, Ile, Phe Met, Leu, Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp, Phe Val Ile, Leu
(114) Conservative amino acid substitution also includes groupings based on side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. For example, it is reasonable to expect that replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the properties of the resulting variant polypeptide. Conservative substitutions are shown in Table 11 below under the heading of exemplary substitutions. More preferred substitutions are shown under the heading of preferred substitutions. Amino acid substitutions falling within the scope of the invention, are, in general, accomplished by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. After the substitutions are introduced, the variants are screened for biological activity.
(115) TABLE-US-00011 TABLE 11 EXEMPLARY AND PREFERRED AMINO ACID SUBSTITUTIONS Preferred Original Residue Exemplary Substitutions Substitutions Ala Val, Leu, Ile Val Arg Lys, Gln, Asn Lys Asn Gln, His, Lys, Arg Gln Asp Glu Glu Cys Ser Ser Gln Asn, His, Lys, Asn Glu Asp, Lys Asp Gly Pro Pro His Asn, Gln, Lys, Arg Arg Ile Leu, Val, Met, Ala, Phe, Leu Norleu Leu Norleu, Ile, Val, Met, Ala, Phe Ile Lys Arg, Gln, Asn Arg Met Leu, Ile, Phe Leu Phe Leu, Val, Ile, Ala Leu Pro Gly Gly Ser Thr Thr Thr Ser Ser Trp Tyr Tyr Tyr Trp, Phe, Thr, Ser Phe Val Ile, Leu, Met, Phe, Ala, Norleu Leu
(116) Alternatively, similar amino acids for making conservative substitutions can be grouped into three categories based on the identity of the side chains. The first group includes glutamic acid, aspartic acid, arginine, lysine, histidine, which all have charged side chains; the second group includes glycine, serine, threonine, cysteine, tyrosine, glutamine, asparagine; and the third group includes leucine, isoleucine, valine, alanine, proline, phenylalanine, tryptophan, methionine, as described in Zubay, G., Biochemistry, third edition, Wm.C. Brown Publishers (1993).
(117) The invention further contemplates a chimeric construct comprising a synthetic polynucleotide of the invention, which is operably linked to a regulatory polynucleotide. The regulatory polynucleotide suitably comprises transcriptional and/or translational control sequences, which will be compatible for expression in the organism of interest or in cells of that organism. Typically, the transcriptional and translational regulatory control sequences include, but are not limited to, a promoter sequence, a 5 non-coding region, a cis-regulatory region such as a functional binding site for transcriptional regulatory protein or translational regulatory protein, an upstream open reading frame, ribosomal-binding sequences, transcriptional start site, translational start site, and/or nucleotide sequence which encodes a leader sequence, termination codon, translational stop site and a 3 non-translated region. Constitutive or inducible promoters as known in the art are contemplated by the invention. The promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter. Promoter sequences contemplated by the present invention may be native to the organism of interest or may be derived from an alternative source, where the region is functional in the chosen organism. The choice of promoter will differ depending on the intended host or cell or tissue type. For example, promoters which could be used for expression in mammals include the metallothionein promoter, which can be induced in response to heavy metals such as cadmium, the -actin promoter as well as viral promoters such as the SV40 large T antigen promoter, human cytomegalovirus (CMV) immediate early (IE) promoter, Rous sarcoma virus LTR promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus promoter, and a HPV promoter, particularly the HPV upstream regulatory region (URR), among others. All these promoters are well described and readily available in the art.
(118) Enhancer elements may also be used herein to increase expression levels of the mammalian constructs. Examples include the SV40 early gene enhancer, as described for example in Dijkema et al. (1985, EMBO J. 4:761), the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described for example in Gorman et al., (1982, Proc. Natl. Acad. Sci. USA 79:6777) and elements derived from human CMV, as described for example in Boshart et al. (1985, Cell 41:521), such as elements included in the CMV intron A sequence.
(119) The chimeric construct may also comprise a 3 non-translated sequence. A 3 non-translated sequence refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is characterized by effecting the addition of polyadenylic acid tracts to the 3 end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5AATAAA-3 although variations are not uncommon. The 3 non-translated regulatory DNA sequence preferably includes from about 50 to 1,000 nts and may contain transcriptional and translational termination sequences in addition to a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
(120) In some embodiments, the chimeric construct further contains a selectable marker gene to permit selection of cells containing the construct. Selection genes are well known in the art and will be compatible for expression in the cell of interest.
(121) It will be understood, however, that expression of protein-encoding polynucleotides in heterologous systems is now well known, and the present invention is not directed to or dependent on any particular vector, transcriptional control sequence or technique for expression of the polynucleotides. Rather, synthetic polynucleotides prepared according to the methods set forth herein may be introduced into a mammal in any suitable manner in the form of any suitable construct or vector, and the synthetic polynucleotides may be expressed with known transcription regulatory elements in any conventional manner.
(122) In addition, chimeric constructs can be constructed that include sequences coding for adjuvants. Particularly suitable are detoxified mutants of bacterial ADP-ribosylating toxins, for example, diphtheria toxin, pertussis toxin (PT), cholera toxin (CT), Escherichia coli heat-labile toxins (LT1 and LT2), Pseudomonas endotoxin A, Clostridium botulinum C2 and C3 toxins, as well as toxins from C. perfringens, C. spiriforma and C. difficile. In some embodiments, the chimeric constructs include coding sequences for detoxified mutants of E. coli heat-labile toxins, such as the LT-K63 and LT-R72 detoxified mutants, described in U.S. Pat. No. 6,818,222. In some embodiments, the adjuvant is a protein-destabilising element, which increases processing and presentation of the polypeptide that corresponds to at least a portion of the target antigen through the class I MHC pathway, thereby leading to enhanced cell-mediated immunity against the polypeptide. Illustrative protein-destabilising elements include intracellular protein degradation signals or degrons which may be selected without limitation from a destabilising amino acid at the amino-terminus of a polypeptide of interest, a PEST region or a ubiquitin. For example, the coding sequence for the polypeptide can be modified to include a destabilising amino acid at its amino-terminus so that the protein so modified is subject to the N-end rule pathway as disclosed, for example, by Bachmair et al. in U.S. Pat. No. 5,093,242 and by Varshaysky et al. in U.S. Pat. No. 5,122,463. In some embodiments, the destabilising amino acid is selected from isoleucine and glutamic acid, especially from histidine tyrosine and glutamine, and more especially from aspartic acid, asparagine, phenylalanine, leucine, tryptophan and lysine. In certain embodiments, the destabilising amino acid is arginine. In some proteins, the amino-terminal end is obscured as a result of the protein's conformation (i.e., its tertiary or quaternary structure). In these cases, more extensive alteration of the amino-terminus may be necessary to make the protein subject to the N-end rule pathway. For example, where simple addition or replacement of the single amino-terminal residue is insufficient because of an inaccessible amino-terminus, several amino acids (including lysine, the site of ubiquitin joining to substrate proteins) may be added to the original amino-terminus to increase the accessibility and/or segmental mobility of the engineered amino terminus. In some embodiments, a nucleic acid sequence encoding the amino-terminal region of the polypeptide can be modified to introduce a lysine residue in an appropriate context. This can be achieved most conveniently by employing DNA constructs encoding universal destabilising segments. A universal destabilising segment comprises a nucleic acid construct which encodes a polypeptide structure, preferably segmentally mobile, containing one or more lysine residues, the codons for lysine residues being positioned within the construct such that when the construct is inserted into the coding sequence of the protein-encoding synthetic polynucleotide, the lysine residues are sufficiently spatially proximate to the amino-terminus of the encoded protein to serve as the second determinant of the complete amino-terminal degradation signal. The insertion of such constructs into the 5 portion of a polypeptide-encoding synthetic polynucleotide would provide the encoded polypeptide with a lysine residue (or residues) in an appropriate context for destabilization. In other embodiments, the polypeptide is modified to contain a PEST region, which is rich in an amino acid selected from proline, glutamic acid, serine and threonine, which region is optionally flanked by amino acids comprising electropositive side chains. In this regard, it is known that amino acid sequences of proteins with intracellular half-lives less than about 2 hours contain one or more regions rich in proline (P), glutamic acid (E), serine (S), and threonine (T) as for example shown by Rogers et al. (1986, Science 234 (4774): 364-368). In still other embodiments, the polypeptide is conjugated to a ubiquitin or a biologically active fragment thereof, to produce a modified polypeptide whose rate of intracellular proteolytic degradation is increased, enhanced or otherwise elevated relative to the unmodified polypeptide.
(123) One or more adjuvant polypeptides may be co-expressed with an antigenic polypeptide that corresponds to at least a portion of the target antigen. In certain embodiments, adjuvant and antigenic polypeptides may be co-expressed in the form of a fusion protein comprising one or more adjuvant polypeptides and one or more antigenic polypeptides. Alternatively, adjuvant and antigenic polypeptides may be co-expressed as separate proteins.
(124) Furthermore, chimeric constructs can be constructed that include chimeric antigen-coding gene sequences, encoding, e.g., multiple antigens/epitopes of interest, for example derived from a single or from more than one target antigen. In certain embodiments, multi-cistronic cassettes (e.g., bi-cistronic cassettes) can be constructed allowing expression of multiple adjuvants and/or antigenic polypeptides from a single mRNA using, for example, the EMCV IRES, or the like. In other embodiments, adjuvants and/or antigenic polypeptides can be encoded on separate coding sequences that are operably connected to independent transcription regulatory elements.
(125) In some embodiments, the chimeric constructs of the invention are in the form of expression vectors which are suitably selected from self-replicating extrachromosomal vectors (e.g., plasmids) and vectors that integrate into a host genome. In illustrative examples of this type, the expression vectors are viral vectors, such as simian virus 40 (SV40) or bovine papilloma virus (BPV), which has the ability to replicate as extrachromosomal elements (Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982; Sarver et al., 1981, Mol. Cell. Biol. 1:486). Viral vectors include retroviral (lentivirus), adeno-associated virus (see, e.g., Okada, 1996, Gene Ther. 3:957-964; Muzyczka, 1994, J. Clin. Invst. 94:1351; U.S. Pat. Nos. 6,156,303; 6,143,548 5,952,221, describing AAV vectors; see also U.S. Pat. Nos. 6,004,799; 5,833,993), adenovirus (see, e.g., U.S. Pat. Nos. 6,140,087; 6,136,594; 6,133,028; 6,120,764), reovirus, herpesvirus, rotavirus genomes etc., modified for introducing and directing expression of a polynucleotide or transgene in cells. Retroviral vectors can include those based upon murine leukemia virus (see, e.g., U.S. Pat. No. 6,132,731), gibbon ape leukemia virus (see, e.g., U.S. Pat. No. 6,033,905), simian immuno-deficiency virus, human immuno-deficiency virus (see, e.g., U.S. Pat. No. 5,985,641), and combinations thereof.
(126) Vectors also include those that efficiently deliver genes to animal cells in vivo (e.g., stem cells) (see, e.g., U.S. Pat. Nos. 5,821,235 and 5,786,340; Croyle et al., 1998, Gene Ther. 5:645; Croyle et al., 1998, Pharm. Res. 15:1348; Croyle et al., 1998, Hum. Gene Ther. 9:561; Foreman et al., 1998, Hum. Gene Ther. 9:1313; Wirtz et al., 1999, Gut 44:800). Adenoviral and adeno-associated viral vectors suitable for in vivo delivery are described, for example, in U.S. Pat. Nos. 5,700,470, 5,731,172 and 5,604,090. Additional vectors suitable for in vivo delivery include herpes simplex virus vectors (see, e.g., U.S. Pat. No. 5,501,979), retroviral vectors (see, e.g., U.S. Pat. Nos. 5,624,820, 5,693,508 and 5,674,703; and WO92/05266 and WO92/14829), bovine papilloma virus (BPV) vectors (see, e.g., U.S. Pat. No. 5,719,054), CMV-based vectors (see, e.g., U.S. Pat. No. 5,561,063) and parvovirus, rotavirus and Norwalk virus vectors. Lentiviral vectors are useful for infecting dividing as well as non-dividing cells (see, e.g., U.S. Pat. No. 6,013,516).
(127) Additional viral vectors which will find use for delivering the nucleic acid molecules encoding the antigens of interest include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus. By way of example, vaccinia virus recombinants expressing the chimeric constructs can be constructed as follows. The antigen coding sequence is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells that are simultaneously infected with vaccinia. Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the coding sequences of interest into the viral genome. The resulting TK-recombinant can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral plaques resistant thereto.
(128) Alternatively, avipoxviruses, such as the fowlpox and canarypox viruses, can also be used to deliver the genes. Recombinant avipox viruses, expressing immunogens from mammalian pathogens, are known to confer protective immunity when administered to non-avian species. The use of an avipox vector is particularly desirable in human and other mammalian species since members of the avipox genus can only productively replicate in susceptible avian species and therefore are not infective in mammalian cells. Methods for producing recombinant avipoxviruses are known in the art and employ genetic recombination, as described above with. respect to the production of vaccinia viruses. See, e.g., WO 91/12882; WO 89/03429; and WO 92/03545.
(129) Molecular conjugate vectors, such as the adenovirus chimeric vectors described in Michael et al., J. Biol. Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.
(130) Members of the Alphavirus genus, such as, but not limited to, vectors derived from the Sindbis virus (SIN), Semliki Forest virus (SFV), and Venezuelan Equine Encephalitis virus (VEE), will also find use as viral vectors for delivering the chimeric constructs of the present invention. For a description of Sindbis-virus derived vectors useful for the practice of the instant methods, see, Dubensky et al. (1996, J. Virol. 70:508-519; and International Publication Nos. WO 95/07995, WO 96/17072); as well as, Dubensky, Jr., T. W., et al., U.S. Pat. No. 5,843,723, and Dubensky, Jr., T. W., U.S. Pat. No. 5,789,245. Exemplary vectors of this type are chimeric alphavirus vectors comprised of sequences derived from Sindbis virus and Venezuelan equine encephalitis virus. See, e.g., Perri et al. (2003, J. Virol. 77: 10394-10403) and International Publication Nos. WO 02/099035, WO 02/080982, WO 01/81609, and WO 00/61772.
(131) In other illustrative embodiments, lentiviral vectors are employed to deliver a chimeric construct of the invention into selected cells or tissues. Typically, these vectors comprise a 5 lentiviral LTR, a tRNA binding site, a packaging signal, a promoter operably linked to one or more genes of interest, an origin of second strand DNA synthesis and a 3 lentiviral LTR, wherein the lentiviral vector contains a nuclear transport element. The nuclear transport element may be located either upstream (5) or downstream (3) of a coding sequence of interest (for example, a synthetic Gag or Env expression cassette of the present invention). A wide variety of lentiviruses may be utilized within the context of the present invention, including for example, lentiviruses selected from the group consisting of HIV, HIV-1, HIV-2, FIV, BIV, EIAV, MVV, CAEV, and SIV. Illustrative examples of lentiviral vectors are described in PCT Publication Nos. WO 00/66759, WO 00/00600, WO 99/24465, WO 98/51810, WO 99/51754, WO 99/31251, WO 99/30742, and WO 99/15641. Desirably, a third generation SIN lentivirus is used. Commercial suppliers of third generation SIN (self-inactivating) lentiviruses include INVITROGEN (ViraPower Lentiviral Expression System). Detailed methods for construction, transfection, harvesting, and use of lentiviral vectors are given, for example, in the INVITROGEN technical manual ViraPower Lentiviral Expression System version B 050102 25-0501, available at the web site, invitrogen.com/Content/Tech-Online/molecular biology/manuals_p-ps/virapower_lentiviral_system_man.pdf. Lentiviral vectors have emerged as an efficient method for gene transfer. Improvements in biosafety characteristics have made these vectors suitable for use at biosafety level 2 (BL2). A number of safety features are incorporated into third generation SIN (self-inactivating) vectors. Deletion of the viral 3 LTR U3 region results in a provirus that is unable to transcribe a full length viral RNA. In addition, a number of essential genes are provided in trans, yielding a viral stock that is capable of but a single round of infection and integration. Lentiviral vectors have several advantages, including: 1) pseudotyping of the vector using amphotropic envelope proteins allows them to infect virtually any cell type; 2) gene delivery to quiescent, post mitotic, differentiated cells, including neurons, has been demonstrated; 3) their low cellular toxicity is unique among transgene delivery systems; 4) viral integration into the genome permits long term transgene expression; 5) their packaging capacity (6-14 kb) is much larger than other retroviral, or adeno-associated viral vectors. In a recent demonstration of the capabilities of this system, lentiviral vectors expressing GFP were used to infect murine stem cells resulting in live progeny, germline transmission, and promoter-, and tissue-specific expression of the reporter (Ailles, L. E. and Naldini, L., HIV-1-Derived Lentiviral Vectors. In: Trono, D. (Ed.), Lentiviral Vectors, Springer-Verlag, Berlin, Heidelberg, N.Y., 2002, pp. 31-52). An example of the current generation vectors is outlined in FIG. 2 of a review by Lois et al. (2002, Science, 295 868-872).
(132) The chimeric construct can also be delivered without a vector. For example, the chimeric construct can be packaged as DNA or RNA in liposomes prior to delivery to the subject or to cells derived therefrom. Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid. The ratio of condensed DNA to lipid preparation can vary but will generally be around 1:1 (mg DNA:micromoles lipid), or more of lipid. For a review of the use of liposomes as carriers for delivery of nucleic acids, see, Hug and Sleight, (1991, Biochim. Biophys. Acta. 1097:1-17); and Straubinger et al., in Methods of Enzymology (1983), Vol. 101, pp. 512-527.
(133) Liposomal preparations for use in the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Felgner et al., 1987, Proc. Natl. Acad. Sci. USA 84:7413-7416); mRNA (Malone et al., 1989, Proc. Natl. Acad. Sci. USA 86:6077-6081); and purified transcription factors (Debs et al., 1990, J. Biol. Chem. 265:10189-10192), in functional form.
(134) Cationic liposomes are readily available. For example, N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Felgner et al., 1987, Proc. Natl. Acad. Sci. USA 84:7413-7416). Other commercially available lipids include (DDAB/DOPE) and DOTAP/DOPE (Boerhinger). Alternative cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Szoka et al., 1978, Proc. Natl. Acad. Sci. USA 75:4194-4198; PCT Publication No. WO 90/11092 for a description of the synthesis of DOTAP (1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
(135) Similarly, anionic and neutral liposomes are readily available, such as, from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials. Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others. These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art.
(136) The liposomes can comprise multilammelar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs). The various liposome-nucleic acid complexes are prepared using methods known in the art. See, e.g., Straubinger al., in METHODS OF IMMUNOLOGY (1983), Vol. 101, pp. 512-527; Szoka et al., 1978, Proc. Natl. Acad. Sci. USA 75:4194-4198; Papahadjopoulos et al., 1975, Biochim. Biophys. Acta 394:483; Wilson et al., 1979, Cell 17:77); Deamer and Bangham, 1976, Biochim. Biophys. Acta 443:629; Ostro et al., 1977, Biochem. Biophys. Res. Commun. 76:836; Fraley et al., 1979, Proc. Natl. Acad. Sci. USA 76:3348); Enoch and Strittmatter, 1979, Proc. Natl. Acad. Sci. USA 76:145); Fraley et al., 1980, J. Biol. Chem. 255:10431; Szoka and Papahadjopoulos, 1978, Proc. Natl. Acad. Sci. USA 75:145; and Schaefer-Ridder et al., 1982, Science 215:166.
(137) The chimeric construct can also be delivered in cochleate lipid compositions similar to those described by Papahadjopoulos et al., 1975, Biochem. Biophys. Acta. 394:483-491. See, also, U.S. Pat. Nos. 4,663,161 and 4,871,488.
(138) The chimeric construct may also be encapsulated, adsorbed to, or associated with, particulate carriers. Such carriers present multiple copies-of a selected chimeric construct to the immune system. The particles can be taken up by professional antigen presenting cells such as macrophages and dendritic cells, and/or can enhance antigen presentation through other mechanisms such as stimulation of cytokine release. Examples of particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al., 1993, Pharm. Res. 10:362-368; McGee J. P., et al., 1997, J. Microencapsul. 14(2):197-210; O'Hagan D. T., et al., 1993, Vaccine 11(2):149-54.
(139) Furthermore, other particulate systems and polymers can be used for the in vivo delivery of the chimeric construct. For example, polymers such as polylysine, polyarginine, polyornithine, spermine, spermidine, as well as conjugates of these molecules, are useful for transferring a nucleic acid of interest. Similarly, DEAE dextran-mediated transfection, calcium phosphate precipitation or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like, will find use with the present methods. See, e.g., Felgner, P. L., Advanced Drug Delivery Reviews (1990) 5:163-187, for a review of delivery systems useful for gene transfer. Peptoids (Zuckerman, R. N., et al., U.S. Pat. No. 5,831,005, issued Nov. 3, 1998) may also be used for delivery of a construct of the present invention.
(140) Additionally, biolistic delivery systems employing particulate carriers such as gold and tungsten, are especially useful for delivering chimeric constructs of the present invention. The particles are coated with the synthetic expression cassette(s) to be delivered and accelerated to high velocity, generally under a reduced atmosphere, using a gun powder discharge from a gene gun. For a description of such techniques, and apparatuses useful therefor, see, e.g., U.S. Pat. Nos. 4,945,050; 5,036,006; 5,100,792; 5,179,022; 5,371,015; and 5,478,744. In illustrative examples, gas-driven particle acceleration can be achieved with devices such as those manufactured by PowderMed Pharmaceuticals PLC (Oxford, UK) and PowderMed Vaccines Inc. (Madison, Wis.), some examples of which are described in U.S. Pat. Nos. 5,846,796; 6,010,478; 5,865,796; 5,584,807; and EP Patent No. 0500 799. This approach offers a needle-free delivery approach wherein a dry powder formulation of microscopic particles, such as polynucleotide or polypeptide particles, are accelerated to high speed within a helium gas jet generated by a hand held device, propelling the particles into a target tissue of interest. Other devices and methods that may be useful for gas-driven needle-less injection of compositions of the present invention include those provided by Bioject, Inc. (Portland, Oreg.), some examples of which are described in U.S. Pat. Nos. 4,790,824; 5,064,413; 5,312,335; 5,383,851; 5,399,163; 5,520,639 and 5,993,412.
(141) Alternatively, micro-cannula- and microneedle-based devices (such as those being developed by Becton Dickinson and others) can be used to administer the chimeric constructs of the invention. Illustrative devices of this type are described in EP 1 092 444 A1, and U.S. application Ser. No. 606,909, filed Jun. 29, 2000. Standard steel cannula can also be used for intra-dermal delivery using devices and methods as described in U.S. Ser. No. 417,671, filed Oct. 14, 1999. These methods and devices include the delivery of substances through narrow gauge (about 30 G) micro-cannula with limited depth of penetration, as defined by the total length of the cannula or the total length of the cannula that is exposed beyond a depth-limiting feature. It is within the scope of the present invention that targeted delivery of substances including chimeric constructs can be achieved either through a single microcannula or an array of microcannula (or microneedles), for example 3-6 microneedles mounted on an injection device that may include or be attached to a reservoir in which the substance to be administered is contained.
7. Compositions
(142) The invention also provides compositions, particularly immunomodulating compositions, comprising one or more of the chimeric constructs described herein. The immunomodulating compositions may comprise a mixture of chimeric constructs, which in turn may be delivered, for example, using the same or different vectors or vehicles. Antigens may be administered individually or in combination, in e.g., prophylactic (i.e., to prevent infection or disease) or therapeutic (to treat infection or disease) immunomodulating compositions. The immunomodulating compositions may be given more than once (e.g., a prime administration followed by one or more boosts) to achieve the desired effects. The same composition can be administered in one or more priming and one or more boosting steps. Alternatively, different compositions can be used for priming and boosting.
(143) The immunomodulating compositions will generally include one or more pharmaceutically acceptable excipients or vehicles such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
(144) Immunomodulating compositions will typically, in addition to the components mentioned above, comprise one or more pharmaceutically acceptable carriers. These include any carrier which does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers typically are large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art. A composition may also contain a diluent, such as water, saline, glycerol, etc. Additionally, an auxiliary substance, such as a wetting or emulsifying agent, pH buffering substance, and the like, may be present. A thorough discussion of pharmaceutically acceptable components is available in Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th ed., ISBN: 0683306472.
(145) Pharmaceutically compatible salts can also be used in compositions of the invention, for example, mineral salts such as hydrochlorides, hydrobromides, phosphates, or sulfates, as well as salts of organic acids such as acetates, proprionate, malonates, or benzoates. Especially useful protein substrates are serum albumins, keyhole limpet hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanus toxoid, and other proteins well known to those of skill in the art.
(146) The chimeric constructs of the invention can also be adsorbed to, entrapped within or otherwise associated with liposomes and particulate carriers such as PLG.
(147) The chimeric constructs of the present invention are formulated into compositions for delivery to a mammal. These compositions may either be prophylactic (to prevent infection) or therapeutic (to treat disease after infection). The compositions will comprise a therapeutically effective amount of the gene of interest such that an amount of the antigen can be produced in vivo so that an immune response is generated in the individual to which it is administered. The exact amount necessary will vary depending on the subject being treated; the age and general condition of the subject to be treated; the capacity of the subject's immune system to synthesize antibodies; the degree of protection desired; the severity of the condition being treated; the particular antigen selected and its mode of administration, among other factors. An appropriate effective amount can be readily determined by one of skill in the art. Thus, a therapeutically effective amount will fall in a relatively broad range that can be determined through routine trials.
(148) Once formulated, the compositions of the invention can be administered directly to the subject (e.g., as described above). Direct delivery of chimeric construct-containing compositions in vivo will generally be accomplished with or without vectors, as described above, by injection using either a conventional syringe, needless devices such as Bioject or a gene gun, such as the Accell gene delivery system (PowderMed Ltd, Oxford, England) or microneedle device. The constructs can be delivered (e.g., injected) either subcutaneously, epidermally, intradermally, intramuscularly, intravenous, intramucosally (such as nasally, rectally and vaginally), intraperitoneally or orally. Delivery of nucleic acid into cells of the epidermis is particularly preferred as this mode of administration provides access to skin-associated lymphoid cells and provides for a transient presence of nucleic acid (e.g., DNA) in the recipient. Other modes of administration include oral ingestion and pulmonary administration, suppositories, needle-less injection, transcutaneous, topical, and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule.
(149) In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples.
EXAMPLES
Example 1
Synthetic Construct System for Determining the Immune Response Preference of Codons in Mammals
Materials and Methods
Primer Design/Synthesis and Sequence Manipulation
(150) Oligonucleotides for site-directed mutagenesis were designed according to the guidelines included in the mutagenesis kit manuals (QUIKCHANGE II Site-directed Mutagenesis kit or QUIKCHANGE Multi Site-directed Mutagenesis Kit; STRATAGENE, La Jolla Calif.). These primers were synthesized and PAGE purified by Sigma (formerly Proligo).
(151) Oligonucleotides for whole gene synthesis were designed by eye and synthesized by Sigma (formerly Proligo). The primers were supplied as standard desalted oligos. No additional purification of the oligonucleotides was carried out.
(152) Sequence manipulation and analysis was carried out using the suite of programs on Biomanager (ANGIS) and various other web-based programs including BLAST at NCBI (see web site at ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi), NEBcutter V2.0 from New England Biolabs (see web site at tools.neb.com/NEBcutter2/index.php), the Translate Tool on ExPASy (see web site at au.expasy.org/tools/dna.html), and the SignalP 3.0 server (see web site at cbs.dtu.dk/services/SignalP/).
(153) Standard Cloning Techniques
(154) Restriction enzyme digests, alkaline phosphatase treatments and ligations were carried out according to the enzyme manufacturers' instructions (various manufacturers including New England Biolabs, Roche and Fermentas).
(155) Purification of DNA from agarose gels and preparation of mini-prep DNA were carried out using commercial kits (Qiagen, Bio-Rad, Macherey-Nagel).
(156) Agarose gel electrophoresis, phenol/chloroform extraction of contaminant protein from DNA, ethanol precipitation of DNA and other basic molecular biological procedures were carried out using standard protocols, similar to those described in Current Protocols in Molecular Biology (Ebook available via Wiley InterScience; edited by Ausubel et al.).
(157) Sequencing was carried out by the Australian Genome Research Facility (AGRF, Brisbane).
(158) Whole Gene Synthesis
(159) Overlapping 35-50mer oligonucleotides (Sigma-Proligo) were used to synthesize longer DNA sequences. Restriction enzyme sites were incorporated to facilitate cloning. The method used to synthesize the fragments is based on that given in Smith et al. (2003). First, oligonucleotides for the top or bottom strand were mixed and then phosphorylated using T4 polynucleotide kinase (PNK; New England Biolabs). The oligonucleotide mixes were then purified from the PNK by a standard phenol/chloroform extraction and sodium acetate/ethanol (NaAc/EtOH) precipitation. Equal volumes of oligonucleotide mixes for the top and bottom strands were then mixed and the oligonucleotides denatured by heating at 95 C. for 2 mins. The oligonucleotides were annealed by slowly cooling the sample to 55 C. and the annealed oligonucleotides ligated using Taq ligase (New England Biolabs). The resulting fragment was purified by phenol/CHCl.sub.3 extraction and NaAc/EtOH precipitation.
(160) The ends of the fragments were filled in and the fragments then amplified, using the outermost forward and reverse primers, with the Clontech Advantage HF 2 PCR kit (Clontech) according to the manufacturer's instructions. To fill in the ends the following PCR was used: 35 cycles of a denaturation step of 94 C. for 15 s, a slow annealing step where the temperature was ramped down to 55 C. over 7 minutes and then kept at 55 C. for 2 min, and an elongation step of 72 C. for 6 minutes. A final elongation step for 7 min at 72 C. was then carried out. The second PCR to amplify the fragment involved: an initial denaturation step at 94 C. for 30 s, followed by 25 cycles of 94 C. for 15 s, 55 C. 30 s and 68 C. for 1 min, and a final elongation step of 68 C. for 3 mins.
(161) The fragments were then purified by gel electrophoresis, digested and ligated into the relevant vector. Following transformation of E. coli with the ligation mixture, mini-preps were made for multiple colonies and the inserts sequenced. Sometimes it was not possible to isolate clones with entirely correct sequence. In those cases the errors were fixed by single or multi site-directed mutagenesis.
(162) Site-Directed Mutagenesis
(163) Mutagenesis was carried out using the QUIKCHANGE II Site-directed Mutagenesis kit or QUIKCHANGE Multi Site-directed Mutagenesis Kit (STRATAGENE, La Jolla Calif.), with appropriate PAGE (polyacrylamide gel electrophoresis)-purified primers (Sigma), according to the manufacturer's instructions.
(164) Preparation of Constructs
(165) The details of the constructs used to generate the codon preference table are summarized in TABLE 12. All constructs were made using pCDNA3 from INVITROGEN and were verified by sequencing prior to use, with the following redlined paragraph.
(166) TABLE-US-00012 TABLE 12 SUMMARY OF SECRETORY E7 CONSTRUCT SERIES 1 AND 2 Construct AA & Codon CU of Sec Seq CU of E7 E7 Protein Control Constructs IgkC1 N/A wt wt non-onc IgkC2 N/A mc mc non-onc IgkC3 N/A wt wt onc IgkC4 N/A mc mc onc Secretory E7 construct series 1 IgkS1-1 Ala GCG wt wt with all Ala non-onc gcg IgkS1-2 Ala GCA wt wt with all Ala non-onc gca IgkS1-3 Ala GCT wt wt with all Ala non-onc gct IgkS1-4 Ala GCC wt wt with all Ala non-onc gcc IgkS1-5 Arg AGG wt wt with all Arg non-onc agg IgkS1-6 Arg AGA wt wt with all Arg non-onc aga IgkS1-7 Arg CGG wt wt with all Arg non-onc cgg IgkS1-8 Arg CGA wt wt with all Arg non-onc cga IgkS1-9 Arg CGT wt wt with all Arg non-onc cgt IgkS1-10 Arg CGC wt wt with all Arg non-onc cgc IgkS1-11 Asn AAT wt wt with all Asn non-onc aat IgkS1-12 Asn AAC wt wt with all Asn non-onc aac IgkS1-13 Asp GAT wt with all Asp wt with all Asp non-onc gat gat IgkS1-14 Asp GAC wt with all Asp wt with all Asp non-onc gac gac IgkS1-15 Cys TGT wt wt with all Cys non-onc tgt IgkS1-16 Cys TGC wt wt with all Cys non-onc tgc IgkS1-17 Glu GAG wt with all Glu wt with all Glu non-onc gag gag IgkS1-18 Glu GAA wt with all Glu wt with all Glu non-onc gaa gaa IgkS1-19 Gln CAG wt wt with all Gln non-onc cag IgkS1-20 Gln CAA wt wt with all Gln non-onc caa IgkS1-21 Gly GGG wt with all Gly wt with all Gly non-onc ggg ggg IgkS1-22 Gly GGA wt with all Gly wt with all Gly non-onc gga gga IgkS1-23 Gly GGT wt with all Gly wt with all Gly non-onc ggt ggt IgkS1-24 Gly GGC wt with all Gly wt with all Gly non-onc ggc ggc IgkS1-25 His CAT wt wt with all His non-onc cat IgkS1-26 His CAC wt wt with all His non-onc cac IgkS1-27 Ile ATA wt wt with all Ile non-onc ata IgkS1-28 Ile ATT wt wt with all Ile non-onc att IgkS1-29 Ile ATC wt wt with all Ile non-onc atc IgkS1-30 Lys AAG wt wt with all Lys non-onc aag IgkS1-31 Lys AAA wt wt with all Lys non-onc aaa IgkS1-32 Phe TTT wt wt with all Phe non-onc L15F, ttt L22F IgkS1-33 Phe TTC wt wt with all Phe non-onc L15F, ttc L22F IgkS1-34 Ser AGT wt with all Ser wt with all Ser non-onc agt agt IgkS1-35 Ser AGC wt with all Ser wt with all Ser non-onc agc agc IgkS1-36 Ser TCG wt with all Ser wt with all Ser non-onc tcg tcg IgkS1-37 Ser TCA wt with all Ser wt with all Ser non-onc tca tca IgkS1-38 Ser TCT wt with all Ser wt with all Ser non-onc tct tct IgkS1-39 Ser TCC wt wt with all Ser non-onc tcc IgkS1-40 Thr ACG wt with all Thr wt with all Thr non-onc acg acg IgkS1-41 Thr ACA wt with all Thr wt with all Thr non-onc aca aca IgkS1-42 Thr ACT wt with all Thr wt with all Thr non-onc act act IgkS1-43 Thr ACC wt with all Thr wt with all Thr non-onc acc acc IgkS1-44 Tyr TAT wt wt with all Tyr non-onc tat IgkS1-45 Tyr TAC wt wt with all Tyr non-onc tac IgkS1-46 Val GTG wt with all Val wt with all Val non-onc gtg gtg IgkS1-47 Val GTA wt with all Val wt with all Val non-onc gta gta IgkS1-48 Val GTT wt with all Val wt with all Val non-onc gtt gtt IgkS1-49 Val GTC wt with all Val wt with all Val non-onc gtc gtc IgkS1-50 Leu CTG altered with Leu altered with Leu onc ctg ctg IgkS1-51 Leu CTA altered with Leu altered with Leu onc cta cta IgkS1-52 Leu CTT altered with Leu altered with Leu onc ctt ctt IgkS1-53 Leu CTC altered with Leu altered with Leu onc ctc ctc IgkS1-54 Leu TTG altered with Leu altered with Leu onc ttg ttg IgkS1-55 Leu TTA altered with Leu altered with Leu onc tta tta IgkS1-56 Pro CCG altered with Pro altered with Pro onc ccg ccg IgkS1-57 Pro CCA altered with Pro altered with Pro onc cca cca IgkS1-58 Pro CCT altered with Pro altered with Pro onc cct cct IgkS1-59 Pro CCC altered with Pro altered with Pro onc ccc ccc Secretory E7 construct series 2 IgkS2-1 Ala GCG mc mc linkerA-onc IgkS2-2 Ala GCA mc mc linkerA-onc IgkS2-3 Ala GCT mc mc linkerA-onc IgkS2-4 Ala GCC mc mc linkerA-onc IgkS2-5 Arg AGG mc mc linkerR-onc IgkS2-6 Arg AGA mc mc linkerR-onc IgkS2-7 Arg CGG mc mc linkerR-onc IgkS2-8 Arg CGA mc mc linkerR-onc IgkS2-9 Arg CGT mc mc linkerR-onc IgkS2-10 Arg CGC mc mc linkerR-onc IgkS2-11 Asn AAT mc mc linkerN-onc IgkS2-12 Asn AAC mc mc linkerN-onc IgkS2-13 Asp GAT wt with all Asp wt with all Asp onc gat gat IgkS2-14 Asp GAC wt with all Asp wt with all Asp onc gac gac IgkS2-15 Cys TGT wt wt with all Cys onc tgt IgkS2-16 Cys TGC wt wt with all Cys onc tgc IgkS2-17 Glu GAG wt with all Glu wt with all Glu onc gag gag IgkS2-18 Glu GAA wt with all Glu wt with all Glu onc gaa gaa IgkS2-19 Gln CAG wt wt with all Gln onc cag IgkS2-20 Gln CAA wt wt with all Gln onc caa IgkS2-21 Gly GGG wt with all Gly wt with all Gly onc ggg ggg IgkS2-22 Gly GGA wt with all Gly wt with all Gly onc gga gga IgkS2-23 Gly GGT wt with all Gly wt with all Gly onc ggt ggt IgkS2-24 Gly GGC wt with all Gly wt with all Gly onc ggc ggc IgkS2-25 His CAT mc mc linkerH-onc IgkS2-26 His CAC mc mc linkerH-onc IgkS2-27 Ile ATA wt wt with all Ile onc ata IgkS2-28 Ile ATT wt wt with all Ile onc att IgkS2-29 Ile ATC wt wt with all Ile onc atc IgkS2-30 Lys AAG mc mc linkerK-onc IgkS2-31 Lys AAA mc mc linkerK-onc IgkS2-32 Phe TTT mc mc linkerF-onc IgkS2-33 Phe TTC mc mc linkerF-onc IgkS2-34 Ser AGT wt with all Ser wt with all Ser onc agt agt IgkS2-35 Ser AGC wt with all Ser wt with all Ser onc agc agc IgkS2-36 Ser TCG wt with all Ser wt with all Ser onc tcg tcg IgkS2-37 Ser TCA wt with all Ser wt with all Ser onc tca tca IgkS2-38 Ser TCT wt with all Ser wt with all Ser onc tct tct IgkS2-39 Ser TCC wt wt with all Ser onc tcc IgkS2-40 Thr ACG wt with all Thr wt with all Thr onc acg acg IgkS2-41 Thr ACA wt with all Thr wt with all Thr onc aca aca IgkS2-42 Thr ACT wt with all Thr wt with all Thr onc act act IgkS2-43 Thr ACC wt with all Thr wt with all Thr onc acc acc IgkS2-44 Tyr TAT mc mc linkerY-onc IgkS2-45 Tyr TAC mc mc linkerY-onc IgkS2-46 Val GTG wt with all Val wt with all Val onc gtg gtg IgkS2-47 Val GTA wt with all Val wt with all Val onc gta gta IgkS2-48 Val GTT wt with all Val wt with all Val onc gtt gtt IgkS2-49 Val GTC wt with all Val wt with all Val onc gtc gtc IgkS2- Asn AAT wt wt with all Asn linkerN-non-onc 11b aat IgkS2- Asn AAC wt wt with all Asn linkerN-non-onc 12b aac AA = amino acid, CU = codon usage, mc = mammalian consensus, wt = wild-type, onc = oncogenic, non-onc = non-oncogenic Sec seq = secretory sequence, N/A = not applicable
(167) Control Constructs
(168) Control E7 constructs were based on those from Liu et al. (2002). Both oncogenic (i.e. wild-type) and non-oncogenic E7 control constructs were made with wild-type or mammalian consensus codon usage. Non-oncogenic E7 is E7 with D21 G, C24G, E26G mutations, i.e. with mutations that have been reported to render E7 non-transforming (Edmonds and Vousden, 1989; Heck et al, 1992).
(169) The secretory sequence was derived from Mus musculus IgK RNA for the anti-HLA-DR antibody light chain (GenBank accession number D84070). For some constructs the codon usage of this sequence was modified.
(170) Wild-Type Codon Usage Control Constructs:
(171) The wild-type (wt) codon usage E7 construct from Liu et al. was used as the template in a site-directed mutagenesis PCR to make the wt codon usage non-oncogenic E7 construct.
(172) The non-oncogenic and oncogenic wild-type codon usage E7 sequences were amplified to incorporate a 5 BamHI site and a 3 EcoRI site. The resulting fragments were cloned into BamHI and EcoRI cut pcDNA3 and sequenced. The secretory fragment was made by whole gene synthesis using wild-type codon usage with flanking KpnI and BamHI sites. The Kozak-secretory fragments were then ligated into KpnI/BamHI cut pcDNA3-wtE7 (non-oncogenic or oncogenic) to make pcDNA3-Igk-nE7 and pcDNA3-Igk-E7 (named IgkC1 and IgkC3 respectively; see TABLE 12). The identity of the constructs was confirmed by sequencing.
(173) Mammalian Consensus (mc) Codon Usage Control Constructs:
(174) As there were errors in the original mammalian consensus (mc) E7 construct (L28F, Q70R and an E35 deletion; Liu et al., 2002) it was not used. A mc non-oncogenic E7 control construct was synthesized by whole gene synthesis. A mc oncogenic E7 (i.e., wild-type E7) control construct was subsequently made from the mc non-oncogenic E7 construct by single site-directed mutagenesis.
(175) Secretory mc oncogenic and non-oncogenic constructs were made by amplifying the mc E7 sequence with a forward primer that introduced a BamHI site and a reverse primer that incorporated an EcoRI site. The resulting E7 fragment was cloned into the respective sites in pcDNA3 and sequenced. A mc secretory sequence flanked by KpnI and BamHI sites, 5 and 3 respectively, was synthesised and ligated into the KpnI and BamHI sites of pcDNA3-mcE7 (oncogenic or non-oncogenic) to make pcDNA3-mcIgk-mcnE7 and pcDNA3-mcIgk-mcE7 (named IgkC2 and IgkC4 respectively; see TABLE 12). The identity of the constructs was confirmed by sequencing.
(176) Secreted Non-Oncogenic E7 Constructs with Predominantly Wild-Type Codon Usage, Modified for Individual Codons
(177) Plasmids encoding a non-oncogenic form of E7 were made for all of the codons, with the exception of the Pro and Leu codons, stop codons and codons for non-degenerate amino acids. As Phe occurs just once in the E7 sequence, the codons for two Leu residues, L15 and L22, were mutated to Phe codons. A combination of techniques was used to make these constructs. When few mutations were required single or multi site-directed mutagenesis of a control construct encoding non-oncogenic E7 was performed (details of the control construct are given above under control constructs). When more extensive modifications were required whole gene synthesis was employed. Regardless of the methods used these constructs all include an E7 encoding sequence with identical upstream and downstream sequence cloned into the KpnI and EcoRI sites of pcDNA3. These constructs were then modified to include a secretory sequence, as described below.
(178) First, using the whole gene synthesis method, DNA fragments that included a secretory sequence flanked by KpnI and BamHI sites were synthesized. For some constructs the amino acid of interest occurred in the secretory sequence so individual modified secretory sequence fragments were made. For constructs for amino acids that did not occur in the secretory sequence, wild-type secretory sequence was used. These fragments were digested with KpnI and BamHI. Then, using the relevant nE7 construct as a template and a standard PCR protocol, a BamHI site was introduced at the 5 end of the E7 sequence. The 3 EcoRI site was retained. The resulting E7 fragments were cut with BamHI and EcoRI, purified, and ligated into pcDNA3. Following sequencing, the plasmids were cut with KpnI and BamHI and ligated with the relevant KpnI/BamHI secretory sequences. The sequences of the constructs were then confirmed. Constructs IgkS1-1 to IgkS1-49 were made in this way (see TABLE 12 and
(179) Secreted E7 Constructs with Individual Pro or Leu Codons Modified
(180) E7 DNA sequences in which the Pro or Leu codons were individually modified were designed. The rest of the codon usage for these E7 DNAs was the same for all of the Pro and Leu constructs but differed from the wild-type or mammalian consensus codon usage. [Note that this codon usage was based on our preliminary data from immunizing mice with the GFP constructs.]
(181) The Pro/LeuE7 DNA fragments, flanked by HindIII and BamHI sites, were made by whole gene synthesis and cloned into the HindIII and BamHI sites of pcDNA3. Using these constructs as templates, a KpnI site was incorporated upstream and an EcoRI site downstream, of the Pro/Leu E7 sequences by standard PCR methods. The resulting fragments were cut with KpnI and EcoRI and cloned into pcDNA3. These constructs were then used to make the secreted E7 constructs with Pro or Leu codon modifications.
(182) Firstly, using the whole gene synthesis method, DNA fragments that included a secretory sequence flanked by KpnI and BamHI sites were synthesized. As Pro and Leu occur in the secretory sequence, individually modified secretory sequence fragments were made for the different constructs. These fragments were digested with KpnI and BamHI. Then, using the relevant Pro or Leu E7 construct as a template and a standard PCR protocol, a BamHI site was introduced at the 5 end of the E7 sequence. The 3 EcoRI site was retained. The resulting fragments were cut with BamHI and EcoRI, purified, and ligated into pcDNA3. Following sequencing, the plasmids were cut with KpnI and BamHI and ligated with the relevant KpnI/BamHI secretory sequences. The resulting constructs were sequenced and are denoted IgkS1-50 to IgkS1-59 (see TABLE 12 and
(183) Secreted E7 Constructs with Predominantly Wild-Type Codon Usage, Modified for Individual Codons
(184) Constructs encoding a secreted form of oncogenic E7 (i.e. wild-type E7 protein) were made by site-directed mutagenesis of the plasmids encoding a secreted form of non-oncogenic E7. This was done for constructs for codons for the following amino acids: Asp, Cys, Glu, Gln, Gly, Ile, Ser, Thr and Val.
(185) Site-directed mutagenesis was carried out using the QUIKCHANGE II Site-directed Mutagenesis kit (STRATAGENE, La Jolla Calif.) and appropriate PAGE (polyacrylamide gel electrophoresis)-purified primers (Sigma) according to the manufacturer's instructions. The pCDNA-kIgkX-nE7X series of constructs were used as templates for the mutagenesis (i.e. constructs IgkS1-13 to 24, IgkS1-27 to 29, IgkS1-34 to 43 and IgkS1-46 to 49). The primers introduced the desired G21D, G24C, G26E mutations.
(186) The resulting constructs, IgkS2-13 to 24, IgkS2-27 to 29, IgkS2-34 to 43 and IgkS2-46 to 49 (see Table 8, SEQ ID NOs: 1 to 29), have wild-type codon usage for the Igk secretory sequence and E7 sequence with the exception that the codons for the relevant amino acid were changed, and they encode oncogenic E7.
(187) Linker Constructs
(188) Constructs encoding the N-terminal Igk secretory sequence followed by a linker sequence (XXGXGXX (SEQ ID NO:92), where X is the relevant amino acid for a particular construct and G is glycine) and the E7 protein were made for each of the following amino acids: Asn, Ala, Lys, Arg, Phe, His and Tyr.
(189) Fragments consisting of the Igk secretory sequence (with mammalian consensus codon usage) and the linker sequences were made by PCR using Taq polymerase and standard cycling conditions, as recommended by the manufacturer.
(190) The fragments were amplified from pcDNA3-kmcIgk-mcE7 using a common forward primer (5TTGAATAGGTACCGCCGCCACCATGGAGACCGACACCCTCC3; SEQ ID NO: 90) that annealed to the KpnI site, the Kozak sequence and the beginning of the Igk secretory sequence. The reverse primers were different for each linker construct and annealed to the end of the Igk secretory sequence (with mammalian consensus codon usage), introduced new sequence that encoded the relevant linker sequence and a 3 BamHI site.
(191) The fragments were digested with KpnI/BamHI and were ligated into KpnI/BamHI-cut pcDNA3-mcIgk-mcE7 (i.e. the Kozak sequence and secretory sequence had been removed from the plasmid by digestion) to make pcDNA3-mcIgk-linkerX-mcE7 (i.e., IgkS2-1 to 12, IgkS2-25 and 26, IgkS2-30 to 33 and IgkS2-44 and 45 as illustrated in Table 8, SEQ ID NOs: 30 to 49).
(192) For Asn the fragments were also ligated into KpnI/BamHI-cut pcDNA3-Igk-nE7Asn1/2 (i.e. IgkS1-11 and 12) to make pcDNA3-mcIgk-linkerN1/2-nE7Asn1/2 (i.e., IgkS2-11b and IgkS2-12b, see Table 12).
E7 Protein Expression
(193) Cell Culture
(194) CHO cells were cultured in DMEM (GIBCO from INVITROGEN) containing 10% foetal bovine serum (FBS) (DKSH), penicillin, streptomycin and glutamine (GIBCO from INVITROGEN) at 37 C. and 5% CO.sub.2. Cells were plated into 6-well plates at 310.sup.5/well, 24 hours prior to transfection. For each transfection, 2 g of DNA was mixed with 50 L OptiMEM (GIBCO from INVITROGEN) and 4 L Plus reagent (INVITROGEN) and incubated at room temperature (RT) for 30 min. Lipofectamine (INVITROGEN; 5 L in 50 L OptiMEM) was added and the complexes incubated at RT for 30 min. The cells were rinsed with OptiMEM, 2 mL OptiMEM were added to each well, and the complexes then added. The cells were incubated overnight at 37 C. and 5% CO.sub.2. The following morning the complexes were removed and 2 ml of fresh DMEM containing 2% FBS added to each well.
(195) Cell pellets and supernatants were collected about 40 h after transfection. The cell pellets were resuspended in lysis buffer (0.1% NP-40, 2 g/mL Aprotinin, 1 g/mL Leupeptin and 2 mM PMSF in PBS). Transfections were carried out in duplicate and repeated. Control transfections, with empty vector (pcDNA3), were also carried out.
(196) Western Blotting
(197) Western blots of the CHO cell supernatants or lysates were carried out according to standard protocols. Briefly, this involved firstly separating the samples by polyacrylamide gel electrophoresis (PAGE). For cell lysates, 30 g of total protein were loaded for each sample. For supernatants, 30 L of each was loaded. The protein samples were boiled with SDS-PAGE loading buffer for 10 mins before loading onto 12% SDS-PAGE gels and the gels were run at 150-200V for approximately 1 h.
(198) The separated proteins were then transferred from the gels to PVDF membrane (100V for 1 h). The membranes were blocked with 5% skim milk (in PBS/0.05% Tween 20 (PBS-T)) for 1 h at room temperature and were then incubated with the primary antibody, HPV-16 E7 Mouse Monoclonal Antibody (Zymed Laboratories) at a concentration of 1:1000 in 5% skim milk (in PBS-T) overnight at 4 C. Following washing of the membrane in PBS-T (310 min), secondary antibody, anti-mouse IgG (Sigma) in 5% skim milk, was added and the membrane incubated at room temperature for 4 h. The membranes were washed as before, incubated in a mixture containing equal volumes of solution A (4.425 mL water, 50 luminol, 22 L p-coumaric and 500 L 1M Tris pH 8.5) and solution B (4.5 mL water, 3 L1, 30% H.sub.2O.sub.2 and 500 L 1M Tris pH8.5) for 1 min, and then dried and wrapped in plastic wrap. Film was exposed to the blots for various times (1 min, 3 min or 10 min) and the film then developed.
Gene Gun Immunization Protocols
(199) Plasmid Purification
(200) All plasmids used for vaccination were grown in the Escherichia coli strain DH5a and purified using the NUCLEOBOND Maxi Kit (Machery-Nagal). DNA concentration was quantitated spectrophotometrically at 260 nm.
(201) Preparation of DNA/Gold Cartridges
(202) Coating of gold particles with plasmid DNA was performed as described in the Biorad Helios Gene Gun System instruction manual using a microcarrier loading quantity (MLQ) of 0.5 mg gold/cartridge and a DNA loading ratio of 2 g DNA/mg gold. This resulted in 1 g of DNA per prepared cartridge. In brief 50 L of 0.05M spermidine (Sigma) was added to 25 mg of 1.0 m gold particles (Bio-Rad) and the spermidine/gold was sonicated for 3 seconds. 50 g of plasmid DNA was then added, followed by the dropwise addition of 100 M CaCl.sub.2 while vortexing. The mixture was allowed to precipitate at room temperature for 10 min, then centrifuged to pellet the DNA/gold. The pellet was washed three times with HPLC grade ethanol (Scharlau), before resuspension in HPLC grade ethanol containing 0.5 mg/mL of polyvinylpyrrolidone (PVP) (Bio-Rad). The gold/plasmid suspension was then coated onto Tefzel tubing and 0.5 inch cartridges prepared.
(203) Gene Gun Immunization of Mice
(204) Groups of 8 female C57BL6/J (6-8 weeks old) (ARC, WA or Monash Animal Services, VIC) were immunized on Day 0, Day 21, Day 42 and Day 63 with the relevant DNA. The day before each immunization the abdomen of each mouse was shaved and depilatory cream (NAIR) applied for 1 minute. DNA was delivered with the HELIOS gene gun (Biorad) using a pressure of 400 psi. Mice were given 2 shots on either side of the abdomen, with 1 g of DNA delivered per shot. Serum was collected via intra-ocular bleed 2 days prior to initial immunization and 2 weeks after each subsequent immunization (Day 2, Day 35, Day 56 and Day 77).
(205) ELISA to Measure E7 Immune Response
(206) Nine peptides spanning the full-length of HPV16E7 (Frazer et al., 1995) were used to measure the E7 antibody response. The peptides were synthesised and purified to >70% purity by Auspep (Melbourne). Peptides GF101 to 106 and GF108 to 109 described in Frazer et al. were made. Note that instead of GF107, GF107a was used: HYNIVTFCCKCDSTLRL (SEQ ID NO: 154).
(207) GF102 D13G, GF103 D5G/C8G/E10 G and GF104E2G peptides, named GF102n, GF103n and GF104n respectively, were also synthesised. These peptides were used for the ELISA when measuring antibodies to non-oncogenic E7 i.e. these peptides incorporate the mutations that were made to make the E7 protein non-oncogenic.
(208) Microtiter plates were coated overnight with 50 L of 10 g/mL E7 peptide per well. After coating, microtiter plates (Maxisorp, NUNC) were washed two times with PBS/0.05% Tween 20 (PBS-T) and then blocked for two hours at 37 C. with 100 L of 5% skim milk powder in PBS-T. After blocking, plates were washed three times with PBS-T and 50 L of mouse sera at a dilution of 1 in 100 was added for 2 hours at 37 C. All serum was assayed in duplicate wells. Plates were then washed three times with PBS-T and 50 L of sheep anti-mouse IgG horseradish peroxidase conjugate (Sigma) was added at a 1 in 1000 dilution. After 1 hour plates were washed and 50 L of OPD substrate was added. Absorbance was measured after 30 min and the addition of 25 L of 2.5 M HCl at 490 nm in a MULTISKAN EX plate reader (Pathtech). Note controls were included: control primary antibody for a positive control, secondary antibody only, and day 0 serum/serum from unimmunized mice as negative controls.
(209) The immune response preferences of codons determined from these experiments are tabulated in TABLE 1.
Example 2
Construction of Codon Modified Influenza A Virus (H5N1) HA DNA for Conferring an Enhanced Immune Response to H5N1 HA
(210) The wild-type nucleotide sequence of the influenza A virus, HA gene for hemagglutinin (A/Hong Kong/213/03(H5N1), MDCK isolate, embryonated chicken egg isolate) is shown in SEQ ID NO: 50 and encodes the amino acid sequence shown in SEQ ID NO: 51. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 52.
Example 3
Construction of Codon Modified Influenza A Virus (H3N1) DNA for Conferring an Enhanced Immune Response to H3N1 HA
(211) The wild-type nucleotide sequence of the influenza A virus, HA gene for hemagglutinin (A/swine/Korea/PZ72-1/2006(H3N1)) is shown in SEQ ID NO: 53 and encodes the amino acid sequence shown in SEQ ID NO: 54. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 55.
Example 4
Construction of Codon Modified Influenza A Virus (H5N1) NA DNA for Conferring an Enhanced Immune Response to H5N1 NA
(212) The wild-type nucleotide sequence of the influenza A virus, NA gene for neuraminidase (A/Hong Kong/213/03(H5N1), NA gene neuraminidase, MDCK isolate, embryonated chicken egg isolate) is shown in SEQ ID NO: 56 and encodes the amino acid sequence shown in SEQ ID NO: 57. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 58.
Example 5
Construction of Codon Modified Influenza A Virus (H1N1) NA DNA for Conferring an Enhanced Immune Response to H3N1 NA
(213) The wild-type nucleotide sequence of the influenza A virus, NA gene for neuraminidase (A/swine/MI/PU243/04(H3N1)) is shown in SEQ ID NO: 59 and encodes the amino acid sequence shown in SEQ ID NO: 60. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 61.
Example 6
Construction of Codon Modified Hepatitis C Virus E1 (1AH77) DNA for Conferring an Enhanced Immune Response to HCV E1 (1AH77)
(214) The wild-type nucleotide sequence of the hepatitis C Virus E1, (serotype 1A, isolate H77, from polyprotein nucleotide sequence AF009606) is shown in SEQ ID NO: 62 and encodes the amino acid sequence (NP 751920) shown in SEQ ID NO: 63. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 64.
Example 7
Construction of Codon Modified Hepatitis C Virus E2 (1AH77) DNA for Conferring an Enhanced Immune Response to HCV E2 (1AH77)
(215) The wild-type nucleotide sequence of the hepatitis C Virus E2, (serotype 1A, isolate H77, from polyprotein nucleotide sequence AF009606) is shown in SEQ ID NO: 65 and encodes the amino acid sequence (NP 751921) shown in SEQ ID NO: 66. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in in SEQ ID NO: 67.
Example 8
Construction of Codon Modified Epstein-Barr Virus Type 1 gp350 DNA for Conferring an Enhanced Immune Response to EBV Type 1 gp350
(216) The wild-type nucleotide sequence of the Epstein-Barr virus, EBV type 1 gp350 (Gene BLLF1, strand 77142-79865) is shown in SEQ ID NO: 68 and encodes amino acid sequence (CAD53417) shown in SEQ ID NO: 69. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 70.
Example 9
Construction of Codon Modified Epstein-Barr Virus Type 2 gp350 DNA for Conferring an Enhanced Immune Response to EBV Type 2 gp350
(217) The wild-type nucleotide sequence of the Epstein-Barr virus, EBV type 2 gp350 (Gene BLLF1, strand 77267-29936) is shown in SEQ ID NO: 71 and encodes the amino acid sequence (YP 001129462) shown in SEQ ID NO: 72. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 73.
Example 10
Construction of Codon Modified Herpes Simplex Virus 2 Glycoprotein B DNA for Conferring an Enhanced Immune Response to HSV-2 Glycoprotein B
(218) The wild-type nucleotide sequence of the Herpes Simplex virus 2, glycoprotein B strain HG52 (genome strain NC 001798) is shown in SEQ ID NO: 74 and encodes the amino acid sequence (CAB06752) shown in SEQ ID NO: 75. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 76.
Example 11
Construction of Codon Modified Herpes Simplex Virus 2 Glycoprotein D DNA for Conferring an Enhanced Immune Response to HSV-2 Glycoprotein D
(219) The wild-type nucleotide sequence of the Herpes Simplex virus 2, glycoprotein D strain HG52 (genome strain NC 001798) is shown in SEQ ID NO: 77 and encodes the amino acid sequence (NP 044536) shown in SEQ ID NO: 78. Several codons within that sequence were mutated using the method described in Example 1. Specifically, the method involved replacing codons of the wild type nucleotide sequence with corresponding synonymous codons having higher immune response preferences than the codons they replaced, as represented in Table 1. An illustrative codon modified nucleotide sequence comprising high immune response preference codons is shown in SEQ ID NO: 79.
Example 12
Optimised E7 and HSV-2 Constructs
Design and Synthesis of Optimal and Least Optimal E7 Constructs
(220) One de-optimized (W) and three optimized (O1-O3) E7 constructs were designed and made using the codon preferences summarized in Table 1 (the Immune Coricode table). The least favourable codons were used for construct W. For the first optimized construct, O1, whose sequence is shown in SEQ ID NO: 81, all of the codons were modified to those codons determined most optimal. O2, whose sequence is shown in SEQ ID NO: 82, is an alternative optimized construct which involved changing all Ala to GCT; Arg CGG and AGG to CGA and AGA, respectively; Glu to GAA; Gly to GGA; Ile to ATC; all Leu to CTG; Phe to TTT, Pro to CCT or CCC, Ser to TCG, Thr to ACG; and all Val except GTG to GTC. The O2 modifications avoided, with the exception of Leu and Ile, changing codons to mammalian consensus-preferred codons. For O3, whose sequence is shown in SEQ ID NO: 83, only certain amino acids for which particularly distinct differences were observed between codons, and for which the optimal codon(s) was not also a mammalian consensus preferred codon, were modified. In particular, in O3 all non-preferred Gly, Leu, Pro, Ser and Thr codons were changed to GGA, CTC, CCT, TCG and ACG, respectively, and where a preferred codon was already used it was not altered. Codons for other amino acids in O3 were not modified.
Humoral and Cellular Responses to Biolistic Immunization with the Optimal and Least Optimal E7 Constructs
(221) As may be seen in
Humoral and Cellular Responses to Immunization by Intradermal Injection with the Optimal and Least Optimal E7 Constructs
(222) The humoral and cellular responses of mice to the optimized, wild-type CU and de-optimized constructs delivered by intradermal injection were also measured and the results are summarized in
(223) From the E7 protein ELISA, it is apparent that the three optimized constructs, O1-O3, were all significantly better at generating antibodies than the wild-type construct and that the de-optimized construct gave a very low antibody response similar to wild-type. The optimized constructs all gave rise to significantly more spots in the IFN-ELISPOT than the wild-type construct and the de-optimized construct failed to give rise to a measurable response.
(224) The amplitudes of the antibody responses to gene gun immunization were larger than that for the intradermally (ID) delivered vaccines, despite the ID immunization delivering more than five times the dose.
Design and Synthesis of Optimal and Least Optimal HSV-2Constructs
(225) Three optimized (O1-O3; whose sequences are shown in SEQ ID NO: 86-88, respectively) and a de-optimized construct (W; whose sequence is shown in SEQ ID NO: 88) encoding full-length glycoprotein D from Herpes Simplex Virus 2 (gD2) were prepared. A control construct pcDNA3-gD2 with wt CU was also made. Wild-type CU, whose sequence is shown in SEQ ID NO: 85, is close to MC CU.
Humoral Responses to Biolistic and Intradermal Immunization with the Optimal and Least Optimal gD2 Constructs
(226) C57Bl/6 mice were immunized in two groups (8 mice/construct; used intradermal injection (ID) and gene gun delivery) using the same immunization protocol as for the E7 constructs.
(227) Group 1 included pcDNA3-gD2 and pcDNA3-gD2 O1. Group 2 included pcDNA3-gD2, pcDNA3-gD2 O2, pcDNA3-gD2 O3, and pcDNA3-gD2 W.
(228) Antibody responses were measured by an ELISA using plates coated with CHO cell supernatant containing C-terminally His tagged and truncated gD2. The truncation is at amino acid residue 331 and removes the transmembrane region resulting in the protein being secreted into the medium. Control ELISA plates coated with supernatant from CHO cells transfected with empty vector were used as a control.
(229) For both biolistic and intradermal injection delivery routes it was found that the three optimized constructs generated similar levels of antibodies as the wt CU gD2 construct (
(230) To date, there are no DNA vaccines on the market for the treatment or prevention of disease in humans. There is a need to maximize the immune responses generated by DNA vaccines and the present invention discloses ways of enhancing efficacy of DNA vaccines by using codons that have a higher preference for producing an immune response.
(231) The study described in this Example has validated the Immune Coricode table by applying it to optimization or de-optimization of the HPV16 E7 and HSV-2 glycoprotein D (gD2) genes and demonstrating that this does enhance or reduce, respectively, the antibody or cellular response to biolistic delivery of these genes to mammals such as mice.
Material and Methods
(232) ELISPOT Assay
(233) For the IFN- ELISPOTs, mice were immunized twice, at days 0 and 21, and the spleens were collected 3 weeks after the second immunization.
(234) Intradermal Injection Protocol
(235) The timing and frequency of the immunizations by intradermal injection were the same as for gene gun immunization. At each immunization 5 g of DNA was injected per ear i.e. a total of 10 g was administered per immunization per mouse. Hair removal prior to immunization was not necessary. The timing of bleeds and spleen collection was the same as for the gene gun immunized mice.
(236) GST-E7 ELISA
(237) The GST-E7 ELISA was carried out in the same way as the peptide ELISA with the exception that the plates were coated overnight with 50 L of 10 g/mL GST-tagged E7 protein (kindly provided by the Frazer group from the Diamantina Institute, The University of Queensland, Brisbane).
(238) HSV-2 gD ELISA
(239) This ELISA was carried out in the same way as the E7 ELISAs with the exception that the plates were coated with supernatant from CHO cells transfected with a vector encoding C-terminally His-tagged and truncated gD2 protein. Control plates coated with supernatant from CHO cells transfected with empty vector were also used.
(240) Detection of HPV-Specific Responses
(241) For the detection of HPV-specific responses, 96-well filter ELISPOT plates (Millipore) were coated overnight with 10 g/mL HPV GST-tagged E7 protein in 0.1 M NaHCO.sub.3. For the detection of total IgG secreting cells, 96-well filter ELISPOT plates were coated overnight with 2 g/mL goat anti-mouse Ig (Sigma) in PBS without MgCl.sub.2 and CaCl.sub.2. After coating, plates were washed once with complete DMEM without FCS and then blocked with complete DMEM supplemented with 10% FCS for one hour at 37 C. Cultured mouse spleen cells were washed and added to ELISPOT plates at 10.sup.6 cells/100 L. For the detection of HPV-specific memory B cells, plates were incubated overnight at 37 C. and for measuring total IgG cells, plates were incubated for 1 hour at 37 C. For detection, we used biotinylated goat anti-mouse IgG (Sigma) in PBS-T/1% FCS, followed by 5 g/mL HRP-conjugated avidin (Pierce) and developed using 3-amino-9-ethylcarbozole (Sigma). Developed plates were counted using an automated ELISPOT plate counter.
(242) E7 IFN- ELISPOT
(243) 96-well filter plates (Millipore) were coated overnight with 4 g/mL of monoclonal antibody (AN18; Mabtech). After coating, plates were washed once with complete RPMI and blocked for 2 hours with complete RPMI with 10% foetal calf serum (FCS; CSL Ltd). Mouse spleens were made into single cell suspensions and treated with ACK lysis buffer, washed and resuspended at a concentration of 10.sup.7 cells/mL. Spleen cells (10.sup.6/well) were added to each well followed by the addition of complete RPMI supplemented with recombinant hIL-2 (ProSpec-Tany TechnoGene Ltd) and peptide to a final concentration of 10 IU/well and 1 g/mL, respectively. Medium containing hIL-2 without peptide was added to control wells. Plates were incubated for approximately 18 hours at 37 C. in 5-8% CO.sub.2.
(244) After overnight incubation, cells were lysed by rinsing the plates in tap water and then washed six times in PBS/0.05% Tween 20 (PBS-T). For detection, biotinylated detection mAb (R4-6A2; Mabtech) in PBS-T/2% FCS was added, followed by horse radish peroxidase (HRP)-conjugated strepavidin and DAB (Sigma). Developed plates were counted using an automated ELISPOT plate counter.
(245) The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.
(246) The citation of any reference herein should not be construed as an admission that such reference is available as Prior Art to the instant application.
(247) Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.
BIBLIOGRAPHY
(248) Ausubel, F. M. (Ed.) 2007. Current Protocols in Molecular Biology. Ebook (http://www.nrw.interscience.wiley.com/emrw/9780471142720/cp/cpmb/toc). Edmonds, C., and Vousden, K. H. (1989). A point mutational analysis of human papillomavirus type 16 E7 protein. Journal of Virology. 63: 2650-2656. Frazer, I. H., Leippe, D. M., Dunn, L. A., Leim, A., Tindle, R. W., Fernando, G. J., Phelps, W. C., and Lambert, P. F. (1995). Immunological responses in human papillomavirus 16 E6/E7 transgenic mice to E7 protein correlate with the presence of skin disease. Cancer Research. 55: 2635-2639. Heck, D. V., Yee, C. L., Howley, P. M., and Munger, K. (1992). Efficiency of binding the retinoblastoma protein correlates with the transforming capacity of the E7 oncoproteins of the human papillomaviruses. PNAS 89: 4442-4446. Liu, W. J., Gao, F., Zhao, K N., Zhao, W., Fernando, G. J, Thomas, R. And Frazer, I. H. (2002). Codon modified human papillomavirus type 16 E7 DNA vaccine enhances cytotoxic T-lymphocyte induction and anti-tumour activity. Virology 301: 43-52. Smith, H. O., Hutchison III, C. A., Pfannkoch, C. and Venter, J. C. (2003). Generating a synthetic genome by whole genome assembly: X174 bacteriophage from synthetic oligonucleotides. PNAS. 100 (26): 15440-15445.