Method for identifying biologically active oligonucleotides capable of modulating the immune system
09593337 ยท 2017-03-14
Assignee
Inventors
- Arezou Zargari (Solna, SE)
- Nicolai Kouznetzov (Jarfalla, SE)
- Charlotte Admyre (Vendelso, SE)
- Petra Von Stein (Upplands Vasby, SE)
- Oliver Von Stein (Upplands Vasby, SE)
Cpc classification
C12N15/117
CHEMISTRY; METALLURGY
C12N2320/11
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to methods of identifying oligonucleotides capable of modulating the immune system in a mammalian subject, comprising analysis of which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution. Further, the invention provides oligonucleotides identifiable by the methods of the invention and to their use in methods of treating diseases, such as inflammatory diseases, autoimmune diseases, infectious diseases, neurodegenerative diseases and cancer.
Claims
1. An oligonucleotide selected from the group consisting of SEQ ID NOs: 19, 20, 34, and 76.
2. The oligonucleotide according to claim 1, wherein the oligonucleotide is at most 120 nucleotides.
3. The oligonucleotide according to claim 2, wherein the oligonucleotide is at most 30 nucleotides.
4. An oligonucleotide selected from the group consisting of: SEQ ID NO: 19, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 27, 28, and 29; SEQ ID NO: 20, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 21, 22, and 23; SEQ ID NO: 21, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20; SEQ ID NO: 22, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 21, 22, and 23; SEQ ID NO: 26, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15; SEQ ID NO: 27, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 16, 17, and 18; SEQ ID NO: 28, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 15, 16, and 17; SEQ ID NO: 29, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 15, 16, and 17; SEQ ID NO: 33, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20; SEQ ID NO: 34, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20; SEQ ID NO: 35, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15; SEQ ID NO: 60, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20; SEQ ID NO: 62, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 17, 18, and 19; SEQ ID NO: 67, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16; SEQ ID NO: 72, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15; SEQ ID NO: 74, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16; SEQ ID NO: 75, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16; SEQ ID NO: 76, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 17, 18, and 19; and SEQ ID NO: 77, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 12, 13, and 14.
5. The oligonucleotide according to claim 4, wherein the oligonucleotide is at most 120 nucleotides.
6. The oligonucleotide according to claim 4, wherein the oligonucleotide is at most 30 nucleotides.
7. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 19, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 27, 28, and 29.
8. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 20, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 21, 22, and 23.
9. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 21, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20.
10. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 22, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 21, 22, and 23.
11. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 26, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15.
12. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 27, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 16, 17, and 18.
13. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 28, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 15, 16, and 17.
14. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 29, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 15, 16, and 17.
15. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 33, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20.
16. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 34, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20.
17. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 35, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15.
18. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 60, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 18, 19, and 20.
19. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 62, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 17, 18, and 19.
20. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 67, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16.
21. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 72, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 13, 14, and 15.
22. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 74, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16.
23. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 75, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 14, 15, and 16.
24. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 76, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 17, 18, and 19.
25. The oligonucleotide of claim 4, wherein the oligonucleotide is SEQ ID NO: 77, which comprises phosphorothioate or phosphorodithioate backbone modification at positions 1, 2, 3, 12, 13, and 14.
26. The oligonucleotide of claim 4, wherein the backbone modification at the positions is phosphorothioate.
27. An oligonucleotide selected from the group consisting of: SEQ ID NO: 19, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 27, 28, and 29; SEQ ID NO: 20, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 21, 22, and 23; SEQ ID NO: 21, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 18, 19, and 20; SEQ ID NO: 22, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 21, 22, and 23; SEQ ID NO: 24, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 18, 19, and 20; SEQ ID NO: 25, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 14, 15, and 16; SEQ ID NO: 26, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 13, 14, and 15; SEQ ID NO: 27, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 16, 17, and 18; SEQ ID NO: 28, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 15, 16, and 17; SEQ ID NO: 29, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 15, 16, and 17; SEQ ID NO: 30, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 13, 14, and 15; SEQ ID NO: 33, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 18, 19, and 20; SEQ ID NO: 34, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 18, 19, and 20; SEQ ID NO: 35, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 13, 14, and 15; SEQ ID NO: 60, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 18, 19, and 20; SEQ ID NO: 62, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 17, 18, and 19; SEQ ID NO: 67, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 14, 15, and 16; SEQ ID NO: 72, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 13, 14, and 15; SEQ ID NO: 74, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 14, 15, and 16; SEQ ID NO: 75, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 14, 15, and 16; SEQ ID NO: 76, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 17, 18, and 19; SEQ ID NO: 77, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 12, 13, and 14; and SEQ ID NO: 80, which comprises phosphorothioate or phosphorodithioate backbone modification at positions consisting of 1, 2, 3, 9, 10, and 11.
28. The oligonucleotide of claim 27, wherein the backbone modification at the positions is phosphorothioate.
29. A method for treating a disease, wherein the disease is selected from the group consisting of inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma, COPD, infectious diseases, inflammatory diseases, neurodegenerative diseases, cancer, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease, malignant osteopetrosis, comprising administering an effective amount of an oligonucleotide according to claim 1, to a subject in need thereof, wherein an increase or balancing the levels of cytokines is beneficial to said disease.
30. A method for treating a disease, wherein the disease is selected from the group consisting of inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma, COPD, infectious diseases, inflammatory diseases, neurodegenerative diseases, cancer, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease, malignant osteopetrosis, comprising administering an effective amount of an oligonucleotide according to claim 4, to a subject in need thereof, wherein an increase or balancing the levels of cytokines is beneficial to said disease.
31. A method for treating a disease, wherein the disease is selected from the group consisting of inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma, COPD, infectious diseases, inflammatory diseases, neurodegenerative diseases, cancer, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease, malignant osteopetrosis, comprising administering an effective amount of an oligonucleotide according to claim 27, to a subject in need thereof, wherein an increase or balancing the levels of cytokines is beneficial to said disease.
Description
SHORT DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) Before the invention is described in detail, it is to be understood that this invention is not limited to the particular compounds described or process steps of the methods described since compounds and methods may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It must be noted that, as used in the specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a sequence includes more than one such sequence, and the like.
(8) Further, the term about is used to indicate a deviation of +/2 percent of the given value, preferably +/5 percent and most preferably +/10 percent of the numeric values, when applicable.
(9) The phrase capable of modulating the immune system is used to describe a function, wherein a substance is capable to alter an immune response.
(10) Immunomodulation is an alteration, adjustment or regulation of the immune response. An immunomodulator is a substance that has an effect on the immune system in form of immunostimulation or immunosuppression or both. The modulation of the immune system may represent an increase or a balancing of the levels of cytokines. This effect can be mediated by, but is not limited to, cytokines (lymphokines, chemokines, interleukins, interferons), cell surface markers, receptors, prostaglandins and hormones. These changes in the immune response can be for example measured through the release of cytokines, expression changes of cell surface markers or other physiological parameters as proliferation. The substance or immunomodulator is preferably an oligonucleotide.
(11) The term oligonucleotide refers to a nucleic acid polymer, typically with from 8 to 120 bases, preferably of about 12 to about 30 nucleotides. Preferably, said oligonucleotide represents a DNA oligonucleotide, which should be interpreted as being equal to an oligodeoxyribonucleotide or an oligodeoxyribonucleic acid (ODN).
(12) The phrase tertiary structural type refers to different spatial organizations that an oligonucleotide may adopt. In relation to the present invention, the following described types of tertiary structure are relevant: telomeric G-quadruplex tetramer type; fragile X G-quadruplex dimer type; telomeric G-quadruplex dimer type form 1; telomeric G-quadruplex dimer type form 2; non-G-quadruplex dimer type; G-quadruplex basket monomer type; random type and G-quadruplex chair monomer type. These structural types are further described and defined below.
(13) The phrase adopts, in phosphate-buffered saline solution refers to that the tertiary structural type of the oligonucleotides of the invention adopts a particular tertiary structure type that is measurable in a phosphate-buffered saline solution. A phosphate-buffered saline solution refers here to a buffer solution system relevant or similar to physiological conditions such as a phosphate-buffered saline solution (PBS) comprising 10 mM phosphate buffer (pH 7.4) with 140 mM NaCl and 27 mM KCl. Other phosphate-buffered saline solutions or aqueous buffer solutions with similar physiological properties may also be used.
(14) The experiments related to the present invention are typically carried out at room temperature. However, they can also be carried out at 37 C.
(15) The testing of the capability for oligonucleotides of the invention to modulate the immune system in mammalian subjects, may be carried out as described below in Example 2.
(16) The invention relates to the surprising concept that if a certain oligonucleotide forms a certain tertiary structure, at least to a certain percentage in a composition, it is capable of modulating the immune system, such as increasing levels of cytokines. Therefore, there is provided methods for identification of such oligonucleotides. In order to determine the tertiary structure, samples were prepared and analyzed by circular dichroism (CD) measurement. The results were compared to the results of CD measurements of a number of reference oligonucleotides that are capable of, and established to form particular tertiary structures. The sequences of these reference oligonucleotides are disclosed in Table 1.
(17) TABLE-US-00001 TABLE1 TertiarystructurereferencesforCDspectra analysis. SEQID Structure Ref. IDX- NO Sequence5-3 type number No 1 TGGGGT telomericG- #1 0400 quadruplex tetramer 2 GCGGTTTGCGG fragileXG- #2 0405 quadruplex dimer 3 GGGTTTTGGG telomericG- #3 0415 quadruplex dimerform1 4 GGGGTTTTGGGG telomericG- #4 0420 quadruplex dimerform2 5 GCATGCT non-G- #5 0430 quadruplex dimer 6 GGTTTTGGTTTTGG G-quadruplex #6 0435 TTTTGG basket monomer 7 T*C*A*CGACCGTC random #7 9011 AAAC*T*C*C 8 GGTTGGTGTGGTTGG G-quadruplex #8 0410 chair monomer *= phosphorothioate modification
(18) The properties set out in Table 1, and adhered to throughout this specification, are to be understood as:
(19) Telomeric G-Quadruplex Tetramer Type
(20) Oligonucleotide TGGGGT is derived from the O. nova telomeric sequence. Previous work using both X-ray crystallographic (XRC) and nuclear magnetic resonance (NMR) has shown that it forms a tetrameric structure (see e.g. Phillips, K., et al. (1997) J. Mol. Biol., 273, 171-182; Aboul-ela, F. et al. (1994) J. Mol. Biol., 243, 458-471; Aboul-ela, F. et al. (1992) Nature, 360, 280-282.). Thus, the oligonucleotide TGGGGT (SEQ ID NO 1reference #1) serves as reference oligonucleotide for a telomeric G-quadruplex tetramer type and its CD spectrum is depicted in
(21) Fragile X G-Quadruplex Dimer Type
(22) Oligonucleotide GCGGTTTGCGG represents the fragile X gene repeat sequence and has been shown to form a specific dimeric structure (see Kettani, A. et al. (1995) J. Mol. Biol., 254, 638-65). Thus, the oligonucleotide GCGGTTTGCGG (SEQ ID NO 2reference #2) serves as reference oligonucleotide for a Fragile X G-quadruplex dimer type and its CD spectrum is depicted in
(23) Telomeric G-Quadruplex Dimer Type Form 1
(24) Oligonucleotide GGGTTTTGGG is derived from the O. nova telomeric sequence. NMR studies showed that it forms a specific dimeric G-quadruplex structure (see e.g. Scaria, P. V. et al. (1992) Proc. Natl Acad. Sci. USA, 89, 10336-10340; Keniry, M. A. et al. (1995) Eur. J. Biochem., 233, 631-643; Hud, N. V. et al. (1996) Biochemistry, 35, 15383-15390). Thus, the oligonucleotide GGGTTTTGGG (SEQ ID NO 3reference #3) serves as reference oligonucleotide for a telomeric G-quadruplex dimer type form 1 and its CD spectrum is depicted in
(25) Telomeric G-Quadruplex Dimer Type Form 2
(26) Oligonucleotide GGGGTTTTGGGG is derived from the O. nova telomeric sequence. Both XRC and NMR studies showed that it forms a specific G-dimeric non-GC structure (see e.g. Schultze, P. et al. (1999) Nucleic Acids Res., 27, 3018-3028; Kang, C. et al. (1992) Nature, 356, 126-131; Smith, F. W. and Feigon, J. (1993) Biochemistry, 32, 8682-8692; Haider, S. et al. (2002) Mol. Biol., 320, 189-200). Thus, the oligonucleotide GGGGTTTTGGGG (SEQ ID NO 4reference #4) serves as reference oligonucleotide for a telomeric G-quadruplex dimer type form 2 and its CD spectrum is depicted in
(27) Non-G-Quadruplex Dimer Type
(28) Oligonucleotide GCATGCT forms a specific quadruplex dimeric structure that does not involve G-quadruplex formation (see Leonard, G. A. et al. (1995) Structure, 3, 335-340). Thus, the oligonucleotide GCATGCT (SEQ ID NO 5reference #5) serves as reference oligonucleotide for a non-G-quadruplex dimer type and its CD spectrum is depicted in
(29) G-Quadruplex Basket Monomer Type
(30) Oligonucleotide GGTTTTGGTTTTGGTTTTGG forms a specific monomeric G-quadruplex structure that was shown using NMR analysis (see Marathias, V. M. and Bolton, P. H. (1999) Biochemistry, 38, 4355-4364). Thus, the oligonucleotide GGTTTTGGTTTTGGTTTTGG (SEQ ID NO 6reference #6) serves as reference oligonucleotide for a G-quadruplex basket monomer type and its CD spectrum is depicted in
(31) Random Type
(32) Oligonucleotide T*C*A*CGACCGTCAAAC*T*C*C designed by the inventors and is characterised by CD spectroscopy. It shows CD spectra characteristic for DNA that has random coil structure but doesn't form any particular specific tertiary structure. The oligonucleotide T*C*A*CGACCGTCAAAC*T*C*C (SEQ ID NO 7reference #7) thus serves as reference oligonucleotide for a random type and its CD spectrum is depicted in
(33) G-Quadruplex Chair Monomer Type
(34) Oligonucleotide GGTTGGTGTGGTTGG is known as the thrombin-binding aptamer. It was created by an in vitro selection approach. It forms a monomeric G-quadruplex structure that was shown by both NMR and crystal structures (see Padmanabhan, K. and Tulinsky, A. (1996) Acta Crystallogr. D, 52, 272-282; Kelly, J. A. et al. (1996) J. Mol. Biol., 256, 417-422; Macaya, R. F. et al. (1993) Proc. Natl Acad. Sci. USA, 90, 3745-3749; Padmanabhan, K. et al. (1993) J. Biol. Chem., 268, 17651-17654). The oligonucleotide GGTTGGTGTGGTTGG (SEQ ID NO 8reference #8) thus serves as reference oligonucleotide for a G-quadruplex chair monomer type and its CD spectrum is depicted in
(35) In a first aspect of the invention, there is provided a method for identifying an oligonucleotide capable of modulating the immune system in a mammalian subject comprising analyzing which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution. In said method, said capability of modulating the immune system can be analyzed by testing whether said oligonucleotide modulates the immune system in a mammalian subject. Said testing may be carried out in vitro.
(36) In one embodiment of this aspect, there is provided a method for identifying an oligonucleotide capable of modulating the immune system in a mammalian subject comprising analyzing which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution, wherein said modulation of the immune system represents an increase of levels of cytokines, such as interferon-, interferon-, interferon-, IL-6 and/or IL-10.
(37) The modulation of the immune system may represent an increase or balancing the levels of cytokines. Preferably, said modulation of the immune system represents an increase of the levels of cytokines.
(38) In another embodiment of this aspect, said oligonucleotide adopts, in phosphate-buffered saline solution, a tertiary structure of at least 45% of non-G-quadruplex dimer type. Preferably, said oligonucleotide adopts, in phosphate-buffered saline solution, at least 55%, more preferably 80%, even more preferably 90% of non-G-quadruplex dimer type. Said oligonucleotide are capable of modulation of the immune system by increasing levels of cytokines, in particular IL-6 and/or IL-10.
(39) In another embodiment of this aspect, there is provided a method, wherein the amount of tertiary structural non-G-quadruplex dimer type is estimated by quantifying against the tertiary structural type of a reference oligonucleotide that adopts, in phosphate-buffered saline solution, non-G-quadruplex dimer type. Said reference oligonucleotide may represent an oligonucleotide of SEQ ID NO 5. The quantifying estimate is carried out such that the amount of structural non-G-quadruplex dimer type of the reference oligonucleotide is set at 100 percent.
(40) In another embodiment of this aspect, there is provided an oligonucleotide, identifiable by the methods of said methods. Said oligonucleotide, preferably has at least one nucleotide that has a phosphate backbone modification. Said phosphate backbone modification preferably is a phosphorothioate or phosphorodithioate modification. Said oligonucleotide typically comprises of about 8 to about 120 nucleotides, preferably of about 12 to about 30 nucleotides.
(41) In another embodiment of this aspect, said oligonucleotide adopts, in phosphate-buffered saline solution, a tertiary structure of at least 40% of telomeric G-quadruplex tetramer type. Preferably, said oligonucleotide adopts, in phosphate-buffered saline solution, at least 60%, preferably 80%, more preferably 90% of telomeric G-quadruplex tetramer type. Said oligonucleotide is capable of modulation of the immune system by increasing levels of cytokines, in particular interferons, such as interferon-, interferon- and/or interferon-. The modulation of the immune system may represent an increase or balancing the levels of said cytokines. Preferably, said modulation of the immune system represents an increase of the levels of said cytokines. The amount of tertiary structural telomeric G-quadruplex tetramer type is estimated by quantifying against the tertiary structural type of a reference oligonucleotide that adopts, in phosphate-buffered saline solution, a telomeric G-quadruplex tetramer type. Said reference oligonucleotide may represent an oligonucleotide of SEQ ID NO 1. The quantifying estimate is carried out such that the amount of structural telomeric G-quadruplex tetramer type of the reference oligonucleotide is set at 100 percent.
(42) In another embodiment of this aspect, there is provided an oligonucleotide, identifiable by the methods of the invention. Said oligonucleotide, preferably has at least one nucleotide that has a phosphate backbone modification. Said phosphate backbone modification preferably is a phosphorothioate or phosphorodithioate modification. Said oligonucleotide typically comprises of about 8 to about 120 nucleotides, preferably of about 12 to about 30 nucleotides.
(43) In another aspect of the invention, there is provided a method for identifying an oligonucleotide capable of modulating the immune system in a mammalian subject comprising analyzing which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution, wherein said modulation of the immune system represents an increase or decrease of levels of cell surface markers.
(44) In another aspect of the invention, there is provided a method for identifying an oligonucleotide capable of modulating the immune system in a mammalian subject comprising analyzing which tertiary structural type said oligonucleotide adopts, in phosphate-buffered saline solution wherein said modulation of the immune system represents a change in the properties or behaviour of polymorphonuclear cells.
(45) In another aspect of the invention, there is provided an oligonucleotide selected from the group consisting of SEQ ID NOs 60, 62, 67, 68, 70, 72, 74-77 and 79-80.
(46) In another aspect of the invention, there is provided an oligonucleotide selected from the group consisting of SEQ ID NOs 76, 77 and 80.
(47) In one embodiment of this aspect, there is provided said oligonucleotide for use in therapy.
(48) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where increasing or balancing the levels of cytokines are beneficial for said treatment.
(49) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where increasing the levels of cytokines are beneficial for said treatment.
(50) In another aspect of the invention, there is provided an oligonucleotide selected from the group consisting of SEQ ID NOs 13-17, 19-22, 24-30, and 33-35.
(51) In another aspect of the invention, there is provided an oligonucleotide selected from the group consisting of SEQ ID NOs 16, 28 and 33.
(52) In one embodiment of this aspect, there is provided said oligonucleotide for use in therapy.
(53) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where increasing or balancing the levels of cytokines are beneficial for said treatment.
(54) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where increasing the levels of cytokines are beneficial for said treatment.
(55) The methods of the invention have been tested and a number of novel oligonucleotides have been shown to being capable of modulating the immune system. The invention, therefore, makes available specific novel oligonucleotides. In one aspect of the invention there is provided oligonucleotides with sequences according to any one of sequences in Table 2.
(56) In another aspect of the invention there is provided isolated oligonucleotides with sequences according to any one of SEQ ID NOs 13-17, 19-22, 24-30 and 33-35. These oligonucleotides have been identified to adopt, in phosphate-buffered saline solution, a tertiary structure composed of at least 45% of non-G-quadruplex dimer type. Further, these oligonucleotides have also been shown to be or of being capable of increasing levels of cytokines, such as IL-6 and/or IL-10. These particular oligonucleotides are presented in Table 2, which correlates the SEQ ID NOs with the nucleotide sequences and corresponding internal reference codes (IDX-No).
(57) TABLE-US-00002 TABLE2 Activeoligonucleotideswithatleast45%ofnon- G-quadruplexdimertype. SEQ ID IDX- NO Sequence5-3 No 9 TCGTCGTTCTGCCATCGTCGTT 0470 10 T*T*G*TTGTTCTGCCATCGTC*G*T*T 0475 11 T*G*C*TGCTTCTGCCATGCTG*C*T*T 0480 13 T*C*G*TTCGTCTTGTTCGTTTGTTCG*T*G*G 9013 14 T*C*G*TTCGTCTTTTCGTTTTCGTCGG*C*G*C 9014 15 T*C*C*GCGTTCGTTGTTCGTCG*C*G*G 9017 16 C*G*G*CGCGCCGTTCGTCGA*T*G*G 9028 17 C*G*G*CGCCGTTCGTCGA*T*G*G 9029 18 T*C*G*TCTGCTTGTTCGTCTTGTTC*G*T*C 9069 19 T*C*G*TTCGTCTGCTTGTTCGTCTTGTTC*G*T*C 9070 20 T*C*G*TTCGTCTTGTTCGTCGTC*T*G*C 9072 21 T*C*G*TTCGTCTTGTTCGTC*T*G*C 9073 22 T*T*T*TCGTCTGCTTTCGTTTCG*T*T*T 9091 23 T*G*C*C*A*T*T*C*G*T*C*G*T*T*C*T*C*G* 9100 T*C*G*T*T 24 T*C*G*TCGTTCTGCCATCGT*C*G*T 9138 25 T*C*G*TCGTTCTCGTC*G*T*T 9139 26 T*C*G*TTCTGCTGAT*C*G*T 9140 27 T*C*G*TCGTTCTGTCGTC*G*T*T 9141 28 T*C*G*TCGTTCGTCGTC*G*T*T 9142 29 T*C*G*TCGTTGCTCGTC*G*T*T 9143 30 T*C*G*TCGTTCTCGT*C*G*T 9144 33 T*C*G*TCGTTCGTCGTTCGT*C*G*T 9147 34 T*T*C*TCGTTCTGCCATCGT*G*A*T 9148 35 T*C*G*TTCCGCCGAT*C*G*T 9149 44 T*C*G*TCGTTCTGCCATCGTC*G*T*T 9022 45 T*C*G*TTCGTCTTGTTCGTCTTGTTC*G*T*C 9012 47 T*C*G*TTCGTCTGCTTGTTC*G*T*C 9071 48 T*C*C*GCGTTCGGCCTCCTGGCG*C*G*G 0001 49 T*G*C*CATTCGTCGTTCTCGTC*G*T*T 9024 50 T*C*G*TCGTTCGGCCGATCG*T*C*C 9038 51 T*C*G*TTCGTCTTTCGTC*T*G*C 9074 53 T*T*T*CGTCTGCTTTCGTTTCG*T*T*T 9092 54 T*C*G*TCTGCTTTCGTC*T*G*C 9095 56 T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T* 0910 TG**C*G*T*T 57 T*C*G*TCGTTTTGTCGTTTTGTC*G*T*T 0912 *= phosphorothioate modification
(58) A number of oligonucleotides that do not modulate the immune system, in particular, they do not increase levels of cytokines in the presented assays are set out in Table 3. The tertiary structural types of these oligonucleotides were identified and it was shown that they had a different tertiary structural composition than the active oligonucleotides set out in Table 2. For these reasons, the oligonucleotides in Table 3 are designated as oligonucleotides with less than 45% non-G-quadruplex dimer type contribution.
(59) TABLE-US-00003 TABLE3 Oligonucleotideswithlessthan45%non- G-quadruplexdimertypecontribution. SEQ ID IDX- NO Sequence5-3 No 7 T*C*A*CGACCGTCAAAC*T*C*C 9011 59 G*G*G*GTGCTCTGC*G*G*G 0465 31 A*A*C*GACGATGGCAGAACGA*C*G*A 9153 32 A*A*G*CAGCATGGCAGAAGCA*G*C*A 9146 43 G*C*C*TACTAAGTAATGACTGTC*A*T*G 0495 *= phosphorothioate modification
(60) In another aspect of the invention there is provided isolated oligonucleotides with sequences according to any one of sequences in Table 4, particularly isolated oligonucleotides with sequences according to any one SEQ ID NOs 60, 62, 67, 68, 70, 72, 74-77 and 79-80. These oligonucleotides have been identified to adopt, in phosphate-buffered saline solution, a tertiary structure composed of at least 40% telomeric G-quadruplex tetramer type. Further, these oligonucleotides have also been shown to being capable of increasing levels of interferons, such as interferon-, interferon- and/or interferon-. These particular oligonucleotides are presented in Table 4, which correlates the SEQ ID NOs with the nucleotide sequences and corresponding internal reference codes (IDX-No).
(61) TABLE-US-00004 TABLE4 Activeoligonucleotideswithatleast40% oftelomericG-quadruplextetramertype. SEQ ID IDX- NO Sequence5-3 No 60 T*C*T*GTCGTGTCCTTCTTT*G*G*C 9008 62 T*C*G*TCGTCTGAAGCCGC*G*G*C 9019 67 T*T*C*GTCGATGGCCG*G*C*C 9027 68 G*G*G*GTCGTCTGCTATCGATG*G*G*G 9039 70 G*G*T*CGTCTGCGACGATCGTCG*G*G*G 9041 72 G*G*G*GTCGTCTGCT*G*G*G 9047 74 G*G*G*GTCGTCTGCTC*G*G*G 9049 75 G*G*G*GTCGTCTGCCA*G*G*G 9050 76 G*A*T*CGTCCGGGTCCCGG*G*G*G 9055 77 G*A*T*CGTCCGCGG*G*G*G 9057 78 T*C*G*T*C*T*G*C*C*A*T*G*G*C*G* 9067 G*C*C*G*C*C 79 T*C*G*TCTGCCATGGCGCGC*C*G*G 9068 80 G*A*T*CGTCCG*T*G*T 9133 81 G*G*G*GTCGTCTGC*G*G*G 9054 82 GGGGTCGTCTGCGGG 0440 83 G*A*T*CGTCCG*G*G*G 9059 84 G*G*G*GTCGCAGCT*G*G*G 9004 85 T*C*G*TCCATGGTCAGGGTCCCGG*G*G*G 9005 89 G*G*G*TCGTCTG*C*G*G 9053 90 G*A*T*CGTCCGTCGG*G*G*G 9058 *= phosphorothioate modification
(62) A number of oligonucleotides that do not modulate the immune system, in particular, they do not increase levels of interferons in the presented assays, are set out in Table 5. The tertiary structural types of these oligonucleotides were identified and it was shown that they had a different tertiary structural composition than the active oligonucleotides set out in Table 4. For these reasons, the oligonucleotides in Table 5 are designated as oligonucleotides with less than 40% contribution of telomeric G-quadruplex tetramer type.
(63) TABLE-US-00005 TABLE5 Oligonucleotideswithlessthan40% contributionoftelomericG-quadruplex tetramertype. SEQ ID IDX- NO Sequence5-3 No 91 G*G*G*G*T*C*G*T*C*T*G*C*G*G*G 0445 31 A*A*C*GACGATGGCAGAACGA*C*G*A 9153 32 A*A*G*CAGCATGGCAGAAGCA*G*C*A 9146 59 G*G*G*GTGCTCTGC*G*G*G 0465 94 G*A*T*GCTCTG*G*G*G 9134 7 T*C*A*CGACCGTCAAAC*T*C*C 9011 43 G*C*C*TACTAAGTAATGACTGTC*A*T*G 0495 *= phosphorothioate modification
(64) In another aspect of the invention there is provided an isolated oligonucleotide which adopts, in phosphate-buffered saline solution, a tertiary structure composed of at least 45% of non-G-quadruplex dimer type, said oligonucleotide being capable of balancing or increasing levels of cytokines in a mammalian subject upon administration to said subject. Preferably, said non-G-quadruplex dimer type is present in at least 55%, more preferably 80%, even more preferably 90% as non-G-quadruplex dimer type. Preferably, said oligonucleotide is capable of increasing levels of cytokines in a mammalian subject.
(65) In one embodiment of this aspect, said oligonucleotide comprises at least one nucleotide that has a phosphate backbone modification. Preferably, said phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.
(66) In another embodiment of this aspect, said oligonucleotide comprises of about 8 to about 120 nucleotides, preferably of about 12 to about 30 nucleotides.
(67) In another embodiment of this aspect, said cytokine represents IL-6 and/or IL-10.
(68) In another embodiment of this aspect, said oligonucleotide is selected from the group consisting of SEQ ID NOs 13-17, 19-22, 24-30 and 33-35.
(69) In another embodiment of this aspect, said oligonucleotide is selected from the group consisting of SEQ ID NOs 13-17 and 19-22.
(70) In another embodiment of this aspect, said oligonucleotide is selected from the group consisting of SEQ ID NOs 16, 28 and 33.
(71) In another embodiment of this aspect, there is provided said oligonucleotide for use in therapy.
(72) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where balancing or increasing the levels of cytokines are beneficial for said treatment.
(73) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where increasing the levels of cytokines are beneficial for said treatment.
(74) In another embodiment of this aspect, there is provided said oligonucleotide for use in the treatment of diseases selected from inflammatory and/or autoimmune diseases.
(75) In another embodiment of this aspect, there is provided said oligonucleotide for use in the treatment of diseases selected from inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma and COPD.
(76) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment where increasing or balancing the levels of cytokines are beneficial for said treatment.
(77) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment of inflammatory and/or autoimmune diseases.
(78) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment of a disease selected from inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma and COPD.
(79) In another embodiment of this aspect, there is provided use of said oligonucleotide, which use further comprises one or more additional agents effective in treating inflammatory and/or autoimmune diseases.
(80) In another embodiment of this aspect, there is provided a method of treating a disease wherein increasing or balancing the levels of cytokines are beneficial for said treatment, comprising administering to a subject in need thereof, of said oligonucleotide.
(81) In another embodiment of this aspect, there is provided a method of treating a disease wherein increasing the levels of cytokines are beneficial for said treatment, comprising administering to a subject in need thereof, of said oligonucleotide.
(82) In another embodiment of this aspect, there is provided a method of treating inflammatory and/or autoimmune diseases, comprising administering to a subject in need thereof, of said oligonucleotide.
(83) In another embodiment of this aspect, there is provided a method of treating a disease selected from inflammatory bowel disease, meningitis, allergy, atopic eczema, asthma and COPD, comprising administering to a subject in need thereof, of said oligonucleotide.
(84) In another embodiment of this aspect, there is provided a method of treating said disease or diseases, which further comprises one or more additional agents effective in treating inflammatory and/or autoimmune diseases.
(85) The term allergy in the present invention describes an inappropriate and excessive immunological reaction triggered by an allergen. Examples of allergens include, but are not limited to, pollen, animal dander, dust mites, food, insect stings, microorganisms, chemicals and medications.
(86) In yet a further aspect of the invention there is provided an isolated oligonucleotide which adopts, in phosphate-buffered saline solution, a tertiary structure composed of at least 40% of telomeric G-quadruplex tetramer type, said oligonucleotide being capable of balancing or increasing levels of interferons in a mammalian subject upon administration to said subject. Preferably, said tertiary type is present in at least 60%, more preferably 80%, even more preferably 90% of telomeric G-quadruplex tetramer type. Preferably, said oligonucleotide is capable of increasing levels of interferons.
(87) In one embodiment of this aspect, said oligonucleotide comprises at least one nucleotide that has a phosphate backbone modification. Preferably, said phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.
(88) In another embodiment of this aspect, said oligonucleotide comprises of about 8 to about 120 nucleotides, preferably of about 12 to about 30 nucleotides.
(89) In another embodiment of this aspect, said interferon represents interferon-, interferon- and/or interferon-.
(90) In another embodiment of this aspect, said oligonucleotide is selected from the group consisting of SEQ ID NOs 60, 62, 67, 68, 70, 72, 74-77 and 79-80.
(91) In another embodiment of this aspect, said oligonucleotide is selected from the group consisting of SEQ ID NOs 76, 77 and 80.
(92) In another embodiment of this aspect, there is provided said oligonucleotide for use in therapy.
(93) In another embodiment of this aspect, there is provided said oligonucleotide for use in treating a disease where balancing or increasing the levels of interferons are beneficial for said treatment. Typically, said oligonucleotide for use in treating a disease is capable of where increasing the levels of interferons.
(94) In another embodiment of this aspect, there is provided said oligonucleotide for use in the treatment of diseases selected from infectious diseases, inflammatory diseases, neurodegenerative diseases and cancer.
(95) In another embodiment of this aspect, there is provided said oligonucleotide for use in the treatment of diseases selected from inflammatory bowel disease, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease and severe malignant osteopetrosis.
(96) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment where increasing or balancing the levels of interferons are beneficial for said treatment. Preferably, said oligonucleotide is capable of increasing the levels of interferons.
(97) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment of infectious diseases, inflammatory diseases, neurodegenerative diseases or cancer.
(98) In another embodiment of this aspect, there is provided use of said oligonucleotide, in the preparation of a medicament useful in the treatment of a disease selected from inflammatory bowel disease, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease and severe malignant osteopetrosis.
(99) In another embodiment of this aspect, there is provided use of said oligonucleotide, which use further comprises one or more additional agents effective in treating infectious diseases, inflammatory diseases, neurodegenerative diseases or cancer.
(100) In another embodiment of this aspect, there is provided a method of treating a disease wherein increasing or balancing the levels of interferons are beneficial for said treatment, comprising administering to a subject in need thereof, of said oligonucleotide. Preferably, said oligonucleotide is capable of increasing the levels of interferons.
(101) In another embodiment of this aspect, there is provided a method of treating infectious diseases, inflammatory diseases, neurodegenerative diseases or cancer, comprising administering to a subject in need thereof, of said oligonucleotide.
(102) In another embodiment of this aspect, there is provided a method of treating a disease selected from inflammatory bowel disease, hairy cell leukemia, haematological malignancy, multiple sclerosis, hepatitis B, hepatitis C, chronic hepatitis, cirrhosis, chronic granulomatosis disease and severe malignant osteopetrosis, comprising administering to a subject in need thereof, of said oligonucleotide.
(103) In another embodiment of this aspect, there is provided a method of treating said disease or diseases, in combination with one or more additional agents effective in treating infectious diseases, inflammatory diseases, neurodegenerative diseases or cancer.
(104) In another aspect of the invention, there is provided a pharmaceutical composition comprising an oligonucleotide of the invention as well as further oligonucleotides identifiable by the methods of the invention, together with pharmaceutically acceptable adjuvants, diluents or carriers.
(105) According to an embodiment, said oligonucleotide is administered in an amount of about 1 to about 2000 micro g per kg body weight, preferably about 1 to about 1000 micro g per kg body weight. Most preferably the oligonucleotide is administered in an amount of about 1 to 500 micro g per kg body weight.
(106) According to another embodiment, said oligonucleotide is administered in a sufficient amount to induce immunomodulation.
(107) In a method according to the invention, the route of administration is chosen from mucosal, subcutaneous, intramuscular, intravenous and intraperitoneal administration. According to an embodiment of the method, the mucosal administration is selected from nasal, oral, gastric, ocular, rectal, colonic, urogenital and vaginal administration.
(108) Nasal administration constitutes one embodiment of the method according to the invention. There are several methods and devices available for nasal administration; single or multi-dosing of both liquid and powder formulations, with either topical or systemic action. Using appropriate devices or administration techniques, it is possible to target the olfactory bulb region for delivery to the CNS. The present invention is not limited to particular methods or devices for administering the oligonucleotides to the nasal mucous membrane. The initial animal studies have shown that simple instillation by pipette works satisfactorily, although for human use, devices for reliable single or multi dose of administration would be preferred.
(109) According to another embodiment of the invention, the oligonucleotides are administered to the mucous membrane of the colon through rectal instillation, e.g. in the form of an aqueous enema comprising the oligonucleotides suspended in water or a suitable buffer.
(110) According to another embodiment of the invention, the oligonucleotides are administered to the mucous membrane of the lungs or the airways through inhalation of an aerosol, comprising the oligonucleotides suspended in a suitable buffer, or by performing a lavage, also comprising the oligonucleotides suspended in water or a suitable buffer.
(111) According to yet another embodiment of the invention, the oligonucleotides are administered to the mucous membrane of the urogenital tract, such as the urethra, the vagina etc through application of a solution, a buffer, a gel, salve, paste or the like, comprising the oligonucleotides suspended in water or in a suitable vehicle.
(112) A particular embodiment involves the use of an oligonucleotide according to the invention for use in conjunction with the administration of an anti cell surface marker antibody such as Rituximab. There are indications that oligonucleotides according to the invention can induce the expression of cells surface markers, such as on immune cells such as CD20 on B cells, and thereby enhance the rate of apoptosis in human B-cells mediated by monoclonal antibodies directed against CD20 (such as rituximab). The inventors thus make available a combination therapy involving the use of oligonucleotide compounds together with an anti cell surface marker antibody.
(113) A particular embodiment involves the use of an oligonucleotide according to the invention for use in conjunction with the administration of glucocorticosteroids (GCS). There are indications that the oligonucleotides according to the invention can enhance GCS action. The inventors thus make available a combination therapy involving the use of oligonucleotide compounds together with a GCS. This is contemplated to be able to reduce GCS consumption, and thereby reduce the cost, side-effects and risks associated with the said GCS therapy. Consequently, in this embodiment, said compound is administered together with a GCS.
(114) A skilled person is well aware of the fact that there are several approaches to the treatment of inflammatory and/or autoimmune diseases. Naturally new approaches are constantly being developed, and it is conceived that the oligonucleotides, their use and methods of treatment according to the present invention, will find utility also in combination with future treatments. The inventors presently believe that the inventive oligonucleotides, their use and methods of treatment would be useful as a stand-alone therapy for inflammatory and/or autoimmune diseases. It cannot however be excluded that the inventive oligonucleotides will have utility in combination with existing or future treatment therapies for these diseases.
(115) The oligonucleotide is administered in a therapeutically effective amount. The definition of a therapeutically effective dose or therapeutically effective amount is dependent on the disease and treatment setting, a therapeutically effective amount being a dose which alone or in combination with other treatments results in a measurable improvement of the patient's condition. A skilled person can determine a therapeutically effective amount either empirically, or based on laboratory experiments, performed without undue burden. The treating physician can also determine a suitable amount, based on his/her experience and considering the nature and severity of the disease, as well as the patient's condition.
(116) Another embodiment is the administration of the oligonucleotide in two or three or more separate amounts, separated in time by about 12 hours, about 24 hours, about 48 hours, about one week and about 4 weeks. Another embodiment is the administration of the oligonucleotide prior, in parallel or after the administration of a combination therapy.
(117) The embodiments of the invention have many advantages. So far, the administration of an oligonucleotide in the amounts defined by the inventors has not elicited any noticeable side-effects. Further, the mucosal administration is easy, fast, and painless, and surprisingly results in a systemic effect. It is held that this effect, either alone, or in combination with existing and future treatments, offers a promising approach to fight the diseases of interest.
(118) In another aspect of the invention, the oligonucleotides of the invention are useful for steroid re-sensitization.
(119) In another aspect of the invention, the oligonucleotides of the invention are useful to influence the properties and behaviour of polymorphonuclear cells, in particular the recruitment and/or migration of polymorphonuclear cells to a site of inflammation, and that they through this mechanism have utility in the prevention, treatment and/or alleviation of various diseases such as ischemia.
(120) SEQ ID NOs 12, 36-42, 46, 52, 55, 58, 61, 63-66, 69, 71, 73, 86-88 and 92-93 are included in the sequence listing to provide comparative oligonucleotide sequences.
EXAMPLES
Example 1
Relative Structural Composition of CD Spectra of Oligonucleotides of the Invention
(121) The fits of the CD spectra of eight reference oligonucleotides (Table 1 and
(122) CD spectra were collected in the range from 190 to 350 nm at 25 C. for all samples. The temperature in the sample holder was controlled and kept constant (0.1 C.) with the help of a Peltier element (PTC-348 WI). Data collection and evaluation were carried out by the software supplied with the instrument. The resulting spectra were normalized to the concentration of the oligonucleotide and zeroed at 320 nm.
(123) For better visualization and analysis of the tertiary structure of oligonucleotides of the invention, a custom-built computer program was used to calculate the relative composition of the CD spectra. The program was written in MatLab (Mathworks Corp.). The algorithm is based on the assumption that the samples spectra are the linear combinations of the references spectra (
Example 2
Method for Determination of Oligonucleotide-Stimulated Cytokine Production Profile of Healthy Individuals Represented by Cultured Peripheral Blood Mononuclear Cells (PBMC) PBMC Isolation, Stimulation and Cultivation
(124) Buffy coats from healthy blood donors were obtained from the Karolinska University blood bank and used for preparation of peripheral blood mononuclear cells (PBMC). PBMC were isolated by density centrifugation on Ficoll Paque (Amersham Biosciences A B, Uppsala, Sweden). The cells were then further washed in PBS, and the viability and the cell number were determined by counting the cells in Trypan blue (Sigma Aldrich, Stockholm, Sweden). Thereafter the cells were re-suspended in complete cell medium consisting of RPMI 1640 (Sigma Aldrich) supplemented with 10% heat inactivated fetal calf serum (FCS, Invitrogen), 2 mM L-glutamine, 100 U/mL penicillin, 100 g/mL streptomycin, 10 mM HEPES (Sigma Aldrich) and 5 g/mL gentamicin (Invitrogen). The PBMC were cultured in 48-well culture tissue plates (Becton Dickinson, Franklin Lakes, N.J.) at a concentration of 510.sup.6 cells/mL with 10 M of oligonucleotides of the invention, with medium alone as a negative control in a total volume of 400 l/well. The cells were incubated for 48 h at 37 C. in a humidified cell culture incubator (Thermo Scientific, Waltham, Mass.) with 5% CO.sub.2, in air, after which the culture supernatants were collected and frozen at 20 C. for later cytokine analysis.
(125) Cytometric Bead Array Measurements and Data Analysis
(126) Culture supernatants from PBMC stimulated with oligonucleotides of the invention were analyzed for the presence of the cytokines IFN-, IL-6, and IL-10 using cytometric bead array flex kit (Becton Dickinson) according to the manufacturer's instructions on a FACSArray flow cytometer (Becton Dickinson). The data were analyzed using FCAP Array software (Becton Dickinson).
(127) ELISA and Data Analysis
(128) Culture supernatants from PBMC stimulated with oligonucleotides of the invention were analyzed for the presence of IFN- using human IFN- Multi-subtype ELISA kit (PBL, Biomedical Laboratories, NJ, USA) and IFN- was detected with human IFN- ELISA kit (Fujirebio INC. Tokyo, Japan) according to the manufacturer's instructions. The absorbance was measured on a microplate reader (Tecan, Mnnedorf, Switzerland) and the data were analyzed using Magellan software (Tecan). One set of results are shown in Table 6, which shows Cytometric Bead Array (CBA) mean data (IL6, IL10, IFN-) from four healthy individuals and ELISA mean data (IFN-, IFN-) from six healthy individuals on cytokines and interferons production of PBMC cultured in presence of selected oligonucleotides of the invention.
(129) TABLE-US-00006 TABLE 6 Induction of cytokines by oligonucleotides with different contributions of non-G-quadruplex dimer type of tertiary structure. SEQ ID NO IDX-no IL-6 IL-10 IFN- IFN- IFN- 7 9011 1 59 0465 1 31 9153 32 9146 1 43 0495 44 9022 4 4 1 10 0475 3 3 1 11 0480 2 3 45 9012 3 5 57 0912 2 3 47 9071 4 4 48 0001 4 3 5 2 49 9024 3 4 50 9038 5 4 5 1 13 9013 3 4 14 9014 3 4 15 9017 4 4 3 16 9028 4 4 1 1 17 9029 4 3 2 18 9069 3 4 19 9070 3 4 20 9072 3 4 21 9073 3 4 51 9074 3 5 22 9091 3 4 53 9092 3 4 54 9095 3 4 23 9100 4 3 56 0910 3 3 24 9138 5 4 2 1 1 25 9139 4 3 4 1 1 26 9140 3 3 2 1 1 27 9141 5 3 3 1 1 28 9142 4 3 2 1 29 9143 4 3 3 1 1 30 9144 5 4 3 1 33 9147 4 3 1 34 9148 4 3 3 1 35 9149 5 3 3 2
(130) The mean concentration (pg/ml) of IFN- and IFN- is scored as follows;
(131) []<125; 125[1]<250; 250[2]<500; 500[3]<750; 750[4]<1000; and 1000[5]
(132) The mean concentration (pg/ml) of IL6, IL10 and IFN- is scored as follows;
(133) []<65; 65[1]<125; 125[2]<250; 250[3]<500; 500[4]<750; and 750[5]
(134) Another set of results are shown in Table 7, which shows Cytometric Bead Array (CBA) mean data (IL6, IL10, IFN-) from four healthy individuals and ELISA mean data (IFN-, IFN-) from six healthy individuals on cytokines and interferons production of PBMC cultured in presence of selected oligonucleotides of the invention.
(135) TABLE-US-00007 TABLE 7 Induction of cytokines by oligonucleotides with different contributions of telomeric G-quadruplex tetramer type of tertiary structure. SEQ ID No IDX-No IL6 IL10 IFN- IFN- IFN- 59 0465 2 1 91 0445 31 9153 32 9146 1 43 0495 2 1 94 9134 7 9011 1 81 9054 3 2 5 5 1 83 9059 5 4 5 5 1 80 9133 3 3 3 84 9004 3 2 5 3 1 85 9005 2 2 5 5 1 60 9008 2 3 5 1 1 62 9019 1 2 5 2 67 9027 3 3 5 2 68 9039 2 2 4 1 70 9041 4 3 5 1 1 72 9047 2 2 5 2 1 74 9049 3 4 5 1 75 9050 2 3 5 2 1 76 9055 4 3 5 5 2 77 9057 3 3 5 5 1 78 9067 4 2 5 1 79 9068 1 1 5 2 89 9053 5 3 5 1 1 90 9058 5 4 5 5 1
(136) The mean concentration (pg/ml) of IFN- and IFN- is scored as follows;
(137) []<125; 125[1]<250; 250[2]<500; 500[3]<750; 750[4]<1000; and 1000[5]
(138) The mean concentration (pg/ml) of IL6, IL10 and IFN- is scored as follows;
(139) []<65; 65[1]<125; 125[2]<250; 250[3]<500; 500[4]<750; and 750[5]
Example 3
Relation Between Tertiary Structure of Inventive Compounds and their Biological Activity
(140) The relative composition of tertiary structure of representative oligonucleotides of the invention, compared their ability to induce specific cytokines, are shown in Table 8.
(141) TABLE-US-00008 TABLE 8 Non-G-quadruplex dimer type contribution linked dominantly with IL-6/IL-10 induction. % contribution of REF #5 % % SEQ (non-G- contribution contribution ID IDX- quadruplex of REF #7 of ILs IFNs NO No dimer) (random) other REFs 6 10 7 9011 0.0 100.0 0.0 31 9153 14.5 85.5 0.0 32 9146 0.0 98.7 1.3 59 0465 28.0 5.2 66.8 43 0495 0.0 100.0 0.0 44 9022 91.6 8.4 0.0 + 10 0475 53.6 46.4 0.0 (+) 11 0480 81.4 17.8 0.0 (+) (+) 57 0912 72.2 27.8 0.0 (+) + 47 9071 60.2 39.2 0.6 48 0001 64.0 36.0 0.0 + 49 9024 83.1 16.9 0.0 + 16 9028 74.2 24.2 1.6 (+) 33 9147 97.0 0.0 3.0 + (+) 28 9142 94.7 0.0 5.3 + (+)
(142) The mean concentration (pg/ml) of IL6 and IL10 is scored as follows;
(143) []<125; 125[(+)]<350; 350[+]<500, 500[]
(144) The mean concentration (pg/ml) of IFN- is scored as follows;
(145) []<60; 60[(+)]<100; 100[+]
(146) The data in Table 8 shows that representative oligonucleotides that are present in at least 45% non-G-quadruplex dimer type (related to Ref #5, SEQ ID NO 5) are capable of increasing levels of cytokines IL-6 and IL-10. The data (IL-6, IL-10, IFN-, IFN- and IFN-) are obtained in accordance with the methods set out in Example 1. The tertiary structure of SEQ ID NO 7, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 43 and SEQ ID NO 59 (Tables 6 and 8) represents less than 45% non-G-quadruplex dimer type and, thus, according to the invention, are not capable of sufficiently increasing levels of cytokines IL-6 and IL-10.
(147) The relative composition of tertiary structure of further representative oligonucleotides of the invention, compared with their ability to induce specific cytokines, are shown in Table 9.
(148) TABLE-US-00009 TABLE 9 Telomeric G-quadruplex tetramer type contribution linked dominantly with IFN induction. % % % contribution contribution contribution of REF of REF of REF % % #1 (telomeric #2 (fragile #5 contribution Contribution SEQ G- G- (non-G- of of ID IDX- quadruplex quadruplex quadruplex REF #7 other IL IFN NO No tetramer) dimer) dimer) (random) REFs 6 10 7 9011 0.0 0.0 0.0 100.0 0.0 32 9146 0.0 0.0 0.0 98.7 1.3 43 0495 0.0 0.0 0.0 100.0 0.0 91 0445 15.3 0.0 0.0 49.1 35.6 59 0465 22.2 35.4 28.0 5.2 5.0 94 9134 25.4 41.7 6.0 22.7 4.1 81 9054 61.0 0.0 14.8 17.5 7.7 (+) (+) + (+) 83 9059 49.0 0.0 0.0 43.2 7.8 + (+) 80 9133 44.3 0.0 10.1 43.8 1.8 (+) + (+) 76 9055 90.0 0.0 0.0 10.0 0.0 + + + 77 9057 64.0 0.0 0.0 36.0 0.0 + (+) + (+)
(149) The mean concentration (pg/ml) of IFN- and IFN- is scored as follows:
(150) []<500; 500[(+)]<1000; 1000[+]<5000; 5000[]
(151) The mean concentration (pg/ml) of IL6 and IL10 is scored as follows;
(152) []<125; 125[(+)]<350; 350[+]<500; 500[]
(153) The mean concentration (pg/ml) of IFN- is scored as follows;
(154) []<60; 60[(+)]<100; 100[+]
(155) The data in Table 9 shows that representative oligonucleotides that are present in at least 40% telomeric G-quadruplex tetramer type (related to Ref #1, SEQ ID NO 1) are capable of increasing levels of interferons. The data (IL-6, IL-10, IFN-, IFN- and IFN-) are obtained in accordance with the methods set out in Example 1. The tertiary structure of SEQ ID NO 59, SEQ ID NO 91, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 43, SEQ ID NO 94 and SEQ ID NO 7 (Tables 7, and 9) represents less than 40% telomeric G-quadruplex tetramer type and, thus, according to the invention, are not capable of increasing levels of interferons.