CELL WITH REDUCED PPGPPASE ACTIVITY

Abstract

The present invention relates to a cell which is genetically modified over its wild type in such a way that it has a reduced ppGppase activity relative to its wild type, and preferably an essential amino acid, even more preferably an essential amino acid derived from serine, most preferably methionine or tryptophan, to a feed additive comprising such a cell, to a method of preparing a cell overproducing essential amino acid, more preferably an essential amino acid derived from serine, most preferably methionine or tryptophan, comprising preparing a cell having a knocked-out gene coding for a ppGppase, and to a method of preparing an essential amino acid, more preferably an essential amino acid derived from serine, most preferably methionine or tryptophan, comprising the steps of a) culturing the cell according to the first aspect of the present invention or to any of its embodiments, and b) optionally: purifying the amino acid.

Claims

1-19. (canceled)

20. A method of preparing an essential amino acid derived from serine, comprising culturing an Escherichia coli cell, wherein said Escherichia coli cell overproduces an essential amino acid derived from serine and wherein said Escherichia coli cell is further genetically modified over its wild type in such a way that it has a reduced ppGppase activity relative to its wild type, and wherein the Escherichia coli cell has a (p)ppGpp-synthetase activity which is essentially unchanged relative to its wild type.

21. The method of claim 20, wherein the activity in the cultured Escherichia coli cell of at least one ppGppase selected from the group consisting of the amino acid sequences SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 is reduced as a result of said ppGppase having at least the following modification: an insertion of the two amino acids His and Asn is present between Asp84 and Met85.

22. The method of claim 20, wherein the essential amino acid is methionine.

23. The method of claim 20, wherein the essential amino acid is tryptophan.

24. The method of claim 20, further comprising the step of purifying the essential amino acid.

25. An Escherichia coli cell, wherein said Escherichia coli cell overproduces an essential amino acid derived from serine, wherein the activity of at least one ppGppase selected from the group consisting of the amino acid sequences SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 is reduced as a result of said ppGppase having the following modification: an insertion of the two amino acid His and Asn is present between Asp84 and Met85, and wherein the Escherichia coli cell has a (p)ppGppase-synthetase activity which is essentially unchanged relative to its wild type.

26. The Escherichia coli cell of claim 25 wherein the activity of the at least one ppGppase is reduced as a result of said at least one ppGppase having the following modifications: an insertion of the two amino acids His and Asn is present between Asp84 and Met85 and wherein the Escherichia coli cell has a (p)ppGpp-synthetase activity which is essentially unchanged relative to its wild type, and wherein the at least one ppGppase comprises the amino acid sequence of SEQ ID NO:2.

27. The Escherichia coli cell of claim 26, wherein the at least one ppGppase comprising the amino acid sequence of SEQ ID NO:2 comprises at least one modification selected from the group consisting of substitutions at the amino acids Gln9, Thr13, Tyr63, Arg109, Gln225, Cys245, Val248, Asn268, Ser270, Met280, His344, Pro436, Asn501, Gln505, His543, Ala546, Ser547, Ile548, His555, Gly556, His557, Pro559, Lys619, Thr621, Ala622, Thr627, Thr651, Ala669, Ala675, or Thr698, an insertion between Glu343 and His344, and combinations thereof.

28. The Escherichia coli cell of claim 25, wherein the at least one ppGppase has at least one modification selected from the group consisting of: 1.) substitution of Gln9 by an amino acid selected from the group consisting of Leu, Ile and Val, 2.) substitution of Thr13 by an amino acid selected from the group consisting of Lys, Arg, His, Gln and Asn, 3.) substitution of Tyr63 by an amino acid selected from the group consisting of Lys, Arg and His, 4.) substitution of Arg109 by an amino acid selected from the group consisting of Gln and Asn, 5.) substitution of Gln225 by an amino acid selected from the group consisting of Ser, Ala and Thr, 6.) substitution of Cys245 by an amino acid selected from the group consisting of Leu, Ile and Val, 7.) substitution of Val248 by an amino acid selected from the group consisting of Lys, Arg and His, 8.) substitution of Asn268 by an amino acid selected from the group consisting of Lys, Arg and His, 9.) substitution of Ser270 by an amino acid selected from the group consisting of Ala, Leu, Ile and Val, 10.) substitution of Met280 by an amino acid selected from the group consisting of Ser, Thr and Ala, 11.) insertion of the amino acids Lys and Glu between amino acids Glu343 and His344, 12.) substitution of His344 by an amino acid selected from the group consisting of Gln and Asn, 13.) substitution of Pro436 by an amino acid selected from the group consisting of Ser, Ala and Thr, 14.) substitution of Asn501 by an amino acid selected from the group consisting of Ser, Ala and Thr, 15.) substitution of Gln505 by an amino acid selected from the group consisting of Pro, Ser, Ala and Thr, 16.) substitution of His543 by an amino acid selected from the group consisting of Asn and Gln, 17.) substitution of Ala546 by an amino acid selected from the group consisting of Asn and Gln, 18.) substitution of Ser547 by an amino acid selected from the group consisting of Ala, Leu, Ile and Val, 19.) substitution of Ile548 by an amino acid selected from the group consisting of Asn and Gln, 20.) substitution of His555 by an amino acid selected from the group consisting of Leu, Ile and Val, 21.) substitution of glycine in position 556 by Lys, Arg and His, preferably Arg, 22.) substitution of His557 by an amino acid selected from the group consisting of Asn and Gln, 23.) substitution of Pro559 by an amino acid selected from the group consisting of Ser, Ala and Thr, 24.) substitution of Lys619 by an amino acid selected from the group consisting of Asn and Gln, 25.) substitution of Thr621 by an amino acid selected from the group consisting of Leu, Ile and Val, 26.) substitution of Ala622 by an amino acid selected from the group consisting of Glu and Asp, 27.) substitution of Thr627 by an amino acid selected from the group consisting of Ala and Gly, 28.) substitution of Thr651 by an amino acid selected from the group consisting of Glu and Asp, 29.) substitution of Ala669 and/or Ala675 by Thr, and 30.) substitution of Thr698 by an amino acid selected from the group consisting of Gln and Asn.

29. The Escherichia coli cell of claim 25, wherein the Escherichia coli cell overexpresses, relative to its wild type, at least one nucleic acid sequence that codes for an enzyme selected from the group consisting of:) 1.) thiosulphate/sulphate transport system CysPUWA (EC 3.6.3.25), 2.) 3-phosphoadenosine 5-phosphosulphate reductase CysH (EC 1.8.4.8), 3.) sulphite reductase CysJI (EC 1.8.1.2), 4.) cysteine synthase A CysK (EC 2.5.1.47), 5.) cysteine synthase B CysM (EC 2.5.1.47), 6.) serine acetyltransferase CysE (EC 2.3.1.30), 7.) glycine cleavage system GcvTHP-Lpd (EC 2.1.2.10, EC 1.4.4.2, EC 1.8.1.4), 8.) lipoyl synthase LipA (EC 2.8.1.8), 9.) lipoyl-protein ligase LipB (EC 2.3.1.181), 10.) phosphoglycerate dehydrogenase SerA (EC 1.1.1.95), 11.) 3-phosphoserine phosphatase SerB (EC 3.1.3.3), 12.) 3-phosphoserine/phosphohydroxythreonine aminotransferase SerC (EC 2.6.1.52), 13.) serine hydroxymethyltransferase GlyA (EC 2.1.2.1), 14.) aspartokinase I and homoserine dehydrogenase I ThrA (EC 2.7.2.4, EC 1.1.1.3), 15.) aspartate kinase LysC (EC 2.7.2.4), 16.) homoserine dehydrogenase Hom (EC 1.1.1.3), 17.) homoserine O-acetyltransferase MetX (EC 2.3.1.31), 18.) homoserine O-succinyltransferase MetA (EC 2.3.1.46), 19.) cystathionine gamma-synthase MetB (EC 2.5.1.48), 20.) 0 C-S lyase AecD (EC 4.4.1.8, also referred to as beta-lyase), 21.) cystathionine beta-lyase MetC (EC 4.4.1.8), 22.) B12-independent homocysteine S-methyltransferase MetE (EC 2.1.1.14), 23.) B12-dependent homocysteine S-methyltransferase MetH (EC 2.1.1.13), 24.) methylenetetrahydrofolate reductase MetF (EC 1.5.1.20), 25.) L-methionine exporter BrnFE from Corynebacterium glutamicum, 26.) valine exporter YgaZH from Escherichia coli (b2682, b2683), 27.) putative transporter YjeH from Escherichia coli (b4141), 28.) pyridine nucleotide transhydrogenase PntAB (EC 1.6.1.2), 29.) O-succinylhomoserine sulphhydrylase MetZ (EC 2.5.1.48), 30.) phosphoenolpyruvate carboxylase Pyc (EC 4.1.1.31), 31.) thiosulphate sulphurtransferase RDL2p (EC 2.8.1.1), 32.) thiosulphate-thiol sulphurtransferase (EC 2.8.1.3), and 33.) thiosulphate-dithiol sulphurtransferase (EC 2.8.1.5).

30. The Escherichia coli cell of claim 25, wherein the Escherichia coli cell expresses on a reduced scale, relative to its wild type, at least one nucleic acid sequence that codes for an enzyme selected from the group consisting of:) 1.) transcriptional regulator of L-methionine biosynthesis (MetJ) (b3938, ECK3930), 2.) glucose-6-phosphate isomerase (Pgi, EC 5.3.1.9) (b4025, ECK4017), 3.) homoserine kinase (ThrB, EC 2.7.1.39) (b0003, ECK0003), 4.) S-adenosylmethionine synthase (MetK, EC 2.5.1.6) (b2942, ECK2937), 5.) dihydrodipicolinate synthase (DapA, EC 4.2.1.52) (b2478, ECK2474), 6.) phosphoenolpyruvate carboxykinase (Pck, EC 4.1.1.49) (b3403, ECK3390), 7.) formyltetrahydrofolate hydrolase (PurU, EC 3.5.1.10) (b1232, ECK1227), 8.) pyruvate kinase II (PykA, EC 2.7.1.40) (b1854, ECK1855), 9.) pyruvate kinase I (PykF, EC 2.7.1.40) (b1676, ECK1672), 10.) subunit of L-methionine transporter (MetQNI) (b0197, ECK0197), 11.) subunit of L-methionine transporter (MetQNI) (b0198, ECK0198), 12.) subunit of L-methionine transporter (MetQNI) (b0199, ECK0199), 13.) deoxycytidine 5-triphosphate deaminase (Dcd, EC 3.5.4.13) (b2065, ECK2059), 14.) putative N-acyltransferase (YncA), 15.) regulatory sRNA FnrS, and 16.) sigma factor RpoS.

31. The Escherichia coli cell of claim 25, wherein the Escherichia coli cell overexpresses, relative to its wild type, at least one nucleic acid sequence that codes for an enzyme selected from the group consisting of:) 1.) anthranilate synthase (trpDE, EC 4.1.3.27), anthranilate phosphoribosyl-transferase (trpD, EC 2.4.2.18), phosphoribosylanthranilate isomerase (trpC, EC 5.3.1.24), indole-3-glycerol-phosphate synthase (trpC, EC 4.1.1.48) and tryptophan synthase (trpAB, EC 4.1.2.8 and 4.2.1.122), 2.) phosphoglycerate dehydrogenase SerA (EC 1.1.1.95), 3.) 3-phosphoserine phosphatase SerB (EC 3.1.3.3), 4.) 3-phosphoserine/phosphohydroxythreonine aminotransferase SerC (EC 2.6.1.52), 5.) L-tyrosine-sensitive DHAP synthase (aroF, EC 2.5.1.54), 6.) L-phenylalanine feedback-resistant DHAP synthase (aroG, EC 2.5.1.54), 7.) L-tryptophan-sensitive DHAP synthase (aroH, EC 2.5.1.54), 8.) phosphoenolpyruvate synthase ppsA (EC 2.7.9.2), 9.) phosphoenolpyruvate carboxykinase pck (EC 4.1.1.49), 10.) transketolase A tktA (EC 2.2.1.1), 11.) transketolase B tktB (EC 2.2.1.1), and 12.) gene product of the E. coli open reading frame (ORF) yddG.

32. The Escherichia coli cell of claim 25, wherein the Escherichia coli cell expresses on a reduced scale, relative to its wild type, at least one nucleic acid sequence that codes for an enzyme selected from the group consisting of:) 1.) tryptophanase (tnaA, EC 4.1.99.1), 2.) repressor of the trp operon (trpR), 3.) chorismate mutase T or prephenate dehydrogenase (tyrA, EC 1.3.1.12), 4.) chorismate mutase P or prephenate dehydrogenase (pheA, EC 4.2.1.51), 5.) tryptophan-specific transport protein (mtr), 6.) tryptophan permease (tnaB), 7.) transporter for aromatic amino acids (aroP), 8.) L-serine deaminase (sdaA, EC 4.3.1.17), 9.) glucose-6-phosphate isomerase (pgi, EC 5.3.1.9), 10.) tyrosine aminotransferase (tyrB), 11.) repressor of the glp regulon (glpR), and 12.) sigma factor RpoS (rpoS).

33. The Escherichia coli cell of claim 25, wherein the Escherichia coli cell overproduces methionine or tryptophan.

34. A method of preparing an essential amino acid derived from serine, comprising culturing an Escherichia coli cell of any one of claims 25 to 33.

Description

[0247] The present invention is furthermore illustrated by the figures and non-limiting examples below, from which further features, embodiments, aspects and advantages of the present invention may be drawn.

[0248] FIG. 1 shows a map of plasmid pMAK-ligB which contains a section of the ligB gene.

[0249] FIG. 2 shows a map of plasmid pCC3.

[0250] FIG. 3 shows a map of plasmid pME-RDL2a.

[0251] Length information should be taken as approximate values. The abbreviations and reference names used have the following meaning: [0252] aadA1: streptomycin/spectinomycin-resistance gene [0253] lacIq: gene for the trc-promoter repressor protein [0254] repAts: plasmid replication protein (ts); also repA [0255] oriV: origin of replication [0256] ori2: replication origin [0257] cam/Cm: chloramphenicol-resistance gene [0258] ligB insert: part of the coding region of the ligB gene [0259] serC: coding region of the serC gene [0260] serA: coding region of the serA gene [0261] glyA: coding region of the glyA gene [0262] serB: coding region of the serB gene [0263] thrA*1: coding region of the thrA gene (feedback-resistant allele) [0264] cysE: coding region of the cysE gene [0265] PgapA: gap promoter [0266] metA*11: coding region of the metA gene (feedback-resistant allele) [0267] RDL2a: coding region of the RDL2 allele coding for thiosulphate sulphurtransferase

[0268] The abbreviations for the restriction enzymes are defined as follows: [0269] AgeI: restriction endonuclease from Ruegeria gelatinovora [0270] HindIII: restriction endonuclease from Haemophilus influenzae Rd [0271] XbaI: restriction endonuclease from Xanthomonas campestris [0272] KpnI: restriction endonuclease from Klebsiella pneumoniae

[0273] The present invention is illustrated in more detail below on the basis of exemplary embodiments.

[0274] Minimal (M9) and complete media (LB) used for E. coli have been described by J. H. Miller (A Short Course in Bacteriol Genetics (1992), Cold Spring Harbor Laboratory Press). Isolation of plasmid DNA from E. coli and all techniques regarding restriction, ligation, Klenow- and alkaline-phosphatase treatment are carried out according to Sambrook et al. (Molecular CloningA Laboratory Manual (1989) Cold Spring Harbor Laboratory Press), unless stated otherwise. Transformation of E. coli is carried out according to Chung et al. (Proc. Natl. Acad. Sci. 86: 2172-2175, 1989), unless stated otherwise.

[0275] Unless stated otherwise, the incubation temperature for production of strains and transformants is 37 C.

EXAMPLE 1

Cloning of pMAK-ligB

[0276] The plasmid pMAK-ligB was cloned as a selection marker for the transduction of spoT alleles and inserted into the ligB gene in the chromosome of E. coli DM1849. The ligB gene is located in the chromosome about 1.2 kbp upstream of spoT. The E. coli DM1849 strain has a spoT allele according to the invention.

[0277] The PCR primers ligB-up and ligB-down have on their 5 ends in each case 6 randomly selected nucleotides followed by recognition sequences for the restriction endonucleases XbaI (tctaga) and KpnI (ggtacc), respectively. Nucleotides 13 to 32 of ligB-up bind from positions 3817496 to 3817516 in the E. coli MG1655 genome. Nucleotides 13 to 32 of ligB-down bind from positions 3818519 to 3818498 in the E. coli MG1655 genome.

TABLE-US-00001 ligB-up (SEQIDNO:9) 5 CAGTACtctagaAGCCACGAAGGACACTAAGG3 ligB-down (SEQIDNO:10) 5 TTAGTTggtaccCGGATGGACCGCAGTTAATG3

[0278] These two primers and genomic DNA of E. coli MG1655 as template were used to carry out a PCR. The PCR product was 1045 by in length and included the sequence from positions 3817496 to 3818519 of the MG1655 genome (SEQ ID NO:11).

[0279] Said PCR product was purified using a QIAquick PCR purification kit (Qiagen, Hilden, Germany), cleaved by the XbaI and KpnI restriction enzymes and purified again. Plasmid pMAK705 (Hamilton C M, Aldea M, Washburn B K, Babitzke P, Kushner S R (1989); J Bacteriol.; 171(9): 4617-4622) was cleaved by the XbaI and KpnI restriction enzymes, dephosphorylated by alkaline phosphatase (alkaline phosphatase, calf intestinal, New England Biolabs, Frankfurt a.M., Germany) and purified using a QIAquick PCR purification kit (Qiagen, Hilden). The PCR product was then ligated with pMAK705, and the ligation mix was transformed into E. coli DH5. Correct plasmid clones were selected by 20 mg/l chloramphenicol and identified by restriction cleavage and subsequent sequencing of the inserts. The plasmid obtained in this way was named pMAK-ligB.

EXAMPLE 2

Integration of pMAK-ligB Into the Donor Strain DM1849

[0280] The E. coli strain DM1849 carries three mutations in the ppGppase-encoding spoT gene: an insertion of the six nucleotides CATGAT downstream of nucleotide position 252 (corresponding to position 3820674 in the MG1655 genome), the substitution g520t (based on the wild-type spoT gene, corresponding to position 3820942 in the MG1655 genome) and the substitution c1585t (based on the wild-type spoT gene, corresponding to position 3822007 in the MG1655 genome).

[0281] The DM1849 strain was transformed with plasmid pMAK-ligB by electroporation. pMAK-ligB has a chloramphenicol-resistance gene and a temperature-sensitive origin of replication. The plasmid is replicated by E. coli at 30 C. but not at 44 C. The transformation mix was plated on LB agar containing 20 mg/l chloramphenicol and incubated at 30 C. for 40 hours. Cells were then picked up using an inoculation loop, resuspended in LB medium and diluted 1 in 10 000 with LB medium. 100 l of the dilution were plated on LB agar containing 20 mg/l chloramphenicol and incubated at 44 C. for another 24 hours. As a result, colonies were selected where the pMAK-ligB plasmid was chromosomally integrated in the ligB gene. One of these colonies was thinned out using an inoculation loop on LB agar containing 20 mg/l chloramphenicol and incubated at 44 C. for 24 hours. The resulting strain was named DM1849::pMAK-ligB.

EXAMPLE 3

Generation of a P1-phage Library From DM1849::pMAK-ligB

[0282] First, 10 ml of LB medium were inoculated with the DM1849::pMAK-ligB strain and cultured at 44 C. for 18 hours. Subsequently, 100 l of the culture were transferred to 10 ml of LB medium and cultured at 44 C. to an optical density (at 600 nm) of 0.5. Then calcium chloride, up to a final concentration of 5 mM, and glucose, up to a final concentration of 2 g/l, were added. This was followed by adding 100 l of a P1-phage suspension and incubating the cells at 37 C. After 4 hours, the culture was centrifuged and the supernatant was sterile-filtered twice.

EXAMPLE 4

Transduction of the Methionine Producer E. coli ECM1 with the P1-phage Library From DM1849::pMAK-ligB For Transferring the Three Mutations of DM1849

[0283] The L-methionine-producing E. coli strain ECM1 carries a feedback-resistant metA allele, a deletion of the metJ gene and a copy of the strong trc promoter upstream of each of the genes metH, metF, cysP and cysJ. It is based on the wild-type K12 strain MG1655.

[0284] 10 ml of LB medium were inoculated with the acceptor strain ECM1 and cultured at 37 C. for 18 hours. This was followed by removing 2 ml of the culture by centrifugation and resuspending the cell pellet in 1 ml of LB medium containing 10 mM MgSO.sub.4 and 5 mM CaCl.sub.2. To 300 l of the cell suspension 100 l of the P1-phage library from DM1849::pMAK-ligB were added and the mixture was incubated at 37 C. for 30 min. This was followed by adding 200 l of 1 M trisodium citrate and vortexing briefly. Then 1 ml of LB medium was added and the cells were grown at 44 C. for one hour. Subsequently, the cells were washed twice with in each case 1 ml of LB containing 100 mM trisodium citrate and finally resuspended in 100 l of LB containing 100 mM trisodium citrate. They were streaked out on LB agar containing 20 mg/l chloramphenicol and incubated at 44 C. for 48 hours. Ten colonies were thinned out on LB agar containing 20 mg/l chloramphenicol and incubated again at 44 C. for 48 hours. In these clones, a genomic fragment had been transduced that comprised the ligB region including the integrated pMAK-ligB plasmid. By subsequent DNA sequencing of the relevant sections of the spoT gene, five clones were identified in which the spoT allele from DM1849 had been co-transduced.

[0285] Excision of the pMAK-ligB plasmid from the chromosome and curing were carried out as described in Hamilton et al. (C M Hamilton, Aldea M, Washburn B K, Babitzke P, Kushner S R (1989); J Bacteriol.; 171(9): 4617-4622). One of the plasmid-free clones obtained in this way was named ECM1_spoT1849.

[0286] The strains ECM1 and ECM1_spoT1849 were deposited according to the Budapest Treaty with the DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Inhoffenstrae 7B, 38124 Brunswick, Germany) under the DSM numbers DSM 25066 (=ECM1) and DSM 25067 (=EMC1_spoT1849) on 3 Aug. 2011.

EXAMPLE 5

Cloning of the serC Gene Into Plasmid pUC18

[0287] The E. coli MG1655 serC gene was amplified with the aid of the polymerase chain reaction (PCR) and subsequently cloned into the pUC18 plasmid (Fermentas GmbH, St. Leon-Rot, Germany).

[0288] The PCR primers serCF(XbaI) and serCR(HindIII) have on their 5 ends in each case randomly selected nucleotides followed by recognition sequences for the restriction endonucleases XbaI (TCTAGA) and HindIII (AAGCTT), respectively. Nucleotides 13 to 38 of serCF(XbaI) bind from positions 956619 to 956644 in the E. coli MG1655 genome. Nucleotides 13 to 37 of serCR(HindIII) bind from positions 958028 to 958004 in the E. coli MG1655 genome.

TABLE-US-00002 serCF(XbaI) (SEQIDNO:12) 5 AGGTGCTCTAGAGTCCGCGCTGTGCAAATCCAGAATGG3 serCR(HindIII) (SEQIDNO:13) 5 TACACCAAGCTTAACTCTCTACAACAGAAATAAAAAC3

[0289] The serC gene was amplified by polymerase chain reaction (PCR) using the serCF(XbaI) and serCR(HindIII) primers and Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland). Genomic DNA of E. coli MG1655 served as template. The resulting DNA fragment was 1434 by in size. It was cleaved by the XbaI and HindIII restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). Non-methylated pUC18 plasmid DNA was cleaved by the XbaI and HindIII restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The cleaved plasmid was then ligated with the PCR product and transformed into E. coli DH5. Plasmid clones containing the serC gene were identified by restriction cleavage and DNA sequencing. The resulting plasmid was named pUC18-serC.

EXAMPLE 6

Cloning of the serA Gene Into Plasmid pUC18-serC

[0290] The E. coli MG1655 serA gene was amplified with the aid of the polymerase chain reaction (PCR) and subsequently cloned into the pUC18-serC plasmid.

[0291] The PCR primer serAF(XbaI) has on its 5 end 6 randomly selected nucleotides followed by a recognition sequence for the restriction endonuclease XbaI (TCTAGA). Nucleotides 12 to 33 bind from positions 3055199 to 3055220 in the E. coli MG1655 genome. The PCR primer serAR(SHSSNB) has on its 5 end 6 randomly selected nucleotides followed by recognition sequences for the restriction endonucleases SacI, HindIII, SphI, SmaI, NotI and BglII. Nucleotides 49 to 58 bind from positions 3056880 to 3056861 in the E. coli MG1655 genome.

TABLE-US-00003 serAF(XbaI) (SEQIDNO:14) 5 CTGTAGTCTAGATTAGTACAGCAGACGGGCGCG3 serAR(SHSSNB) (SEQIDNO:15) 5 CAAGAGCTCAAGCTTGCATGCGATTCCCGGGCGGCCGCAATAAGATC TCCGTCAGGGCGTGGTGACCG3

[0292] The serA gene was amplified by polymerase chain reaction (PCR) using the serAF(XbaI) and serAR(SHSSNB) primers and Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland). Genomic DNA of E. coli MG1655 served as template. The resulting DNA fragment was 1731 by in size.

[0293] It was cleaved by the XbaI and SacI restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The pUC18-serC plasmid was likewise cleaved by the XbaI and SacI restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The cleaved plasmid was then ligated with the PCR product and transformed into E. coli DH5. Plasmid clones containing the serA gene were identified by restriction cleavage and DNA sequencing. The resulting plasmid was named pUC18-serAC.

EXAMPLE 7

Cloning of the serB Gene Into Plasmid pUC18-serAC

[0294] The E. coli MG1655 serB gene was amplified with the aid of the polymerase chain reaction (PCR) and subsequently cloned into the pUC18-serAC plasmid.

[0295] The PCR primer serB(SphI) has on its 5 end 6 randomly selected nucleotides followed by a recognition sequence for the restriction endonuclease SphI (GCATGC). Nucleotides 13 to 34 bind from positions 4622816 to 4622837 in the E. coli MG1655 genome.

[0296] The PCR primer serB(SmaI) has on its 5 end 6 randomly selected nucleotides followed by recognition sequences for the restriction endonucleases SalI (GTCGAC) and SmaI (CCCGGG). Nucleotides 54 to 75 bind from positions 4623887 to 4623866 in the E. coli MG1655 genome.

TABLE-US-00004 serB(SphI) (SEQIDNO:16) 5 CCATGCGCATGCCCACCCTTTGAAAATTTGAGAC3 serB(SmaI) (SEQIDNO:17) 5 CCGCATGTCGACATCCCGGGGCAGAAAGGCCCACCCGAAGGTGAGCC AGTGTGATTACTTCTGATTCAGGCTGCC3

[0297] The serB gene was amplified by polymerase chain reaction (PCR) using the serB(SphI) and serB(SmaI) primers and Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland). Genomic DNA of E. coli MG1655 served as template. The resulting DNA fragment was 1137 by in size.

[0298] It was cleaved by the SphI and SmaI restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The pUC18-serAC plasmid was likewise cleaved by the SphI and SmaI restriction endonucleases, dephosphorylated by alkaline phosphatase and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The cleaved plasmid was then ligated with the PCR product and transformed into E. coli DH5. Plasmid clones containing the serB gene were identified by restriction cleavage and DNA sequencing. The resulting plasmid was named pUC18-serBAC.

EXAMPLE 8

Cloning of the glyA Gene Into Plasmid pUC18-serBAC

[0299] The E. coli MG1655 glyA gene was amplified with the aid of the polymerase chain reaction (PCR) and subsequently cloned into the pUC18-serBAC plasmid.

[0300] The PCR primer glyA-downstream has on its 5 end 6 randomly selected nucleotides followed by a recognition sequence for the restriction endonuclease BglII (AGATCT).

[0301] Nucleotides 13 to 35 bind from positions 2682063 to 2682085 in the E. coli MG1655 genome.

[0302] The PCR primer glyA-upstream has on its 5 end randomly selected nucleotides followed by recognition sequences for the restriction endonuclease NotI (GCGGCCGC). Nucleotides 15 to 33 bind from positions 2683762 to 2683744 in the E. coli MG1655 genome.

TABLE-US-00005 glyA-downstream (SEQIDNO:18) 5 ATCTAAAGATCTGTTACGACAGATTTGATGGCGCG3 glyA-upstream (SEQIDNO:19) 5 TTCATCGCGGCCGCGAAAGAATGTGATGAAGTG3

[0303] The glyA gene was amplified by polymerase chain reaction (PCR) using the glyA-downstream and glyA-upstream primers and Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland). Genomic DNA of E. coli MG1655 served as template. The resulting DNA fragment was 1726 by in size.

[0304] It was cleaved by the BglII and NotI restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The pUC18-serBAC plasmid was likewise cleaved by the BglII and NotI restriction endonucleases and purified with the aid of a QIAquick PCR purification kit (Qiagen, Hilden, Germany). The cleaved plasmid was then ligated with the PCR product and transformed into E. coli DH5. Plasmid clones containing the glyA gene were identified by restriction cleavage and DNA sequencing. The resulting plasmid was named pUC18-serB-glyA-serAC.

EXAMPLE 9

Cloning of the Genes serB-glyA-serAC From pUC18-serB-glyA-serAC to pCC1-BAC

[0305] The pUC18-serB-glyA-serAC plasmid was cleaved by the HindIII restriction endonuclease and the DNA fragments were fractionated by agarose gel electrophoresis. A 5.9 kb DNA fragment containing the serB, glyA, serA and serC genes was isolated from the gel. The fragment was ligated with the plasmid pCC1 BAC Cloning-Ready Vector (Hind III) from Epicentre/Madison, USA, which had previously been cleaved by HindIII, and transformed to E. coli EPI300. Plasmid clones containing the DNA fragment of serB, glyA, serA and serC were identified by restriction cleavage and DNA sequencing. The resulting production plasmid was named pCC3.

EXAMPLE 10

Cloning of the Production Plasmid pME-RDL2a

[0306] Cloning of the pME-RDL2a production plasmid was carried out as described in EP application 11151526.8. It includes the E. coli cysE gene, feedback-resistant alleles of the E. coli thrA and metA genes and the RDL2a gene which codes for the Saccharomyces cerevisiae thiosulphate sulphurtransferase RDL2p. In addition, it includes a streptomycin-resistance gene.

EXAMPLE 11

Transformation of Strains ECM1 and ECM1 spoT1849 With the Production Plasmids

[0307] The strains ECM1 and ECM1_spoT1849 were transformed with the production vector pCC3 of Example 9, and the transformants were selected using 20 mg/l chloramphenicol. The cells were then transformed with plasmid pME-RDL2a of Example 10 and the resulting transformants were selected using 20 mg/l chloramphenicol+100 mg/l streptomycin. The resulting strains were named ECM1/pCC3/pME-RDL2a and ECM1_spoT1849/pCC3/pME-RDL2a.

EXAMPLE 12

Performance Assay in a Shaker-Flask Experiment

[0308] Performance of the E. coli L-methionine producer strains was evaluated by production tests in 100 ml conical flasks. Precultures of in each case 10 ml of preculture medium (10% LB medium containing 2.5 g/l glucose and 90% PC1 minimal medium) inoculated with 100 l of cell culture were grown at 37 C. for 10 hours. These were then used to inoculate in each case 10 ml of PC1 minimal medium (Table 1) to an OD 600 nm of 0.2 (Eppendorf Bio-Photometer; Eppendorf AG, Hamburg, Germany) and the cultures were grown at 37 C. for 24 hours. The extracellular L-methionine concentration was determined by ion exchange chromatography and post-column derivatization with ninhydrin detection using an amino acid analyser (Sykam GmbH, Eresing, Germany). The extracellular glucose concentration was determined using a YSI 2700 Select Glucose Analyzer (YSI Life Sciences, Yellow Springs, Ohio, USA). The results are listed in Table 2. After 24 hours glucose had been used up completely in both cultures. The methionine concentration in the culture supernatant of ECM1_spoT1849/pCC3/pME-RDL2a was, at 1.56 g/I, distinctly higher than in the comparative strain (1.01 g/l). Modification of the gene coding for ppGppase by way of introducing the mutations Gly174, Leu529 and an insertion between Asp84 and Met85 thus resulted in an increase in the methionine yield over the starting strain from 10.1% (grams of methionine per gram of glucose) to 15.6%.

TABLE-US-00006 TABLE 1 Minimal medium PC1 Substance Concentration ZnSO4 * 7H2O 4 mg/l CuCl2 * 2H2O 2 mg/l MnSO4 * H2O 20 mg/l H3BO3 1 mg/l Na2MoO4 * 2H2O 0.4 mg/l MgSO4 * 7H2O 1 g/l Citric acid * 1H2O 6.56 g/l CaCl2 * 2H2O 40 mg/l K2HPO4 8.02 g/l Na2HPO4 2 g/l (NH4)2HPO4 8 g/l NH4Cl 0.13 g/l (NH4)2SO3 5.6 g/l MOPS 5 g/l NaOH 10M adjusted to pH 6.8 FeSO4 * 7H2O 40 mg/l Thiamine hydrochloride 10 mg/l Vitamin B12 10 mg/l Glucose 10 g/l Isopropyl-thio--galactoside 2.4 mg/l (IPTG) Spectinomycin 50 mg/l Chloramphenicol 20 mg/l

TABLE-US-00007 TABLE 2 L-Methionine concentrations in the fermentation broths of E. coli strains ECM1/pCC3/pME-RDL2a and ECM1_spoT1849/pCC3/pME-RDL2a Strain OD (600 nm) L-Methionine (g/l) ECM1/pCC3/pME-RDL2a 6.36 1.01 ECM1_spoT1849/pCC3/ 7.46 1.56 pME-RDL2a

[0309] The features of the invention disclosed in the foregoing description and in the claims may both individually and in any combination be essential to implementing the invention in its various embodiments.