Method for the production of recombinant polyomaviral vector particles

09587226 ยท 2017-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to improved methods for the production of viral particles, viral vector particles and recombinant proteins. In particular, the invention relates to improved methods for the production of recombinant polyomaviral vector particles and polyomaviral vector production cell lines. More in particular, the invention relates to methods for the production of simian polyomaviral vector particles such as simian virus 40 (SV40) viral vector particles. The invention also relates to compositions comprising viral vectors and uses thereof and viral vector particles to treat genetic disorders, transplant rejection, autoimmune diseases, infectious diseases, allergies or cancer. The invention also relates to methods for the production of recombinant proteins in mammalian cells and methods to enhance the production of recombinant proteins in mammalian cells.

Claims

1. Method for the production of recombinant polyomaviral vector particles not encoding a functional polyomaviral small T antigen, the method comprising: providing a non-human primate SV40 permissive cell or cell line, wherein the SV40 permissive cell or cell line comprises a gene encoding a functional polyomaviral large T antigen stably integrated into the genome of the cell; and wherein the SV40 permissive cell or cell line does not comprise a gene encoding a functional polyomaviral small T antigen, introducing into the SV40 permissive cell or cell line a polyomavirus DNA not encoding a functional polyomaviral small T antigen, culturing the cell or cell line in a growth medium under conditions allowing the formation of recombinant polyomaviral vector particles, and harvesting the recombinant polyomaviral vector particles from the cell culture.

2. A composition comprising recombinant polyomaviral vector particles not encoding a functional polyomaviral small T antigen produced by the method according to claim 1.

3. The composition of claim 2, wherein the composition comprises more than one million recombinant polyomaviral vector particles not encoding a functional polyomaviral small T antigen, the polyomaviral vector particles being incapable of replicating in cells that are permissive for the wildtype polyomavirus and do not express a functional polyomaviral large T antigen, wherein the composition does not contain a single polyomavirus particle being able to replicate in cells which are permissive for the wildtype polyomavirus wherein the cells do not express a functional polyomaviral large T antigen.

4. The composition of claim 3 wherein the polyomavirus is a primate polyomavirus.

5. The composition of claim 4 wherein the polyomavirus is a simian polyomavirus.

6. The composition of claim 5 wherein the polyomavirus is selected from the group consisting of SV40, SV12, Lymphotropic polyomavirus, African green monkey polyomavirus and Chimpanzee polyomavirus.

7. The composition of claim 6 wherein the polyomavirus is SV40.

8. The composition of claim 3, wherein the SV40 permissive cell or cell line is selected from the group consisting of Vero cells and CV1.

9. A non-human primate SV40 permissive cell or cell line, the cell or cell line comprising the recombinant polyomaviral vector particles of claim 2; wherein the cell or cell line comprises a gene encoding a functional polyomaviral large T antigen stably integrated into the genome of the cell; and wherein the cell or cell line does not comprise a gene a functional polyomaviral small T antigen.

10. A method for the production of a recombinant protein, the method comprising: utilizing the cell line of claim 9 to produce a recombinant protein.

11. The composition of claim 9, wherein the SV40 permissive cell or cell line is selected from the group consisting of Vero cells and CV1.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) The present inventor has found that the large T antigen of a polyomavirus on its own promotes expression of the polyomaviral capsid proteins and that the polyomaviral small T antigen is not required for that purpose. This means that in the absence of polyomaviral T antigens in cells, the SVEP is a constitutive but weak promoter, compared to other viral promoters such as the cytomegalovirus (CMV) immediate early promoter, whereas the SVLP is shut-off at the transcriptional or post-transcriptional level. Surprisingly, in SV40-permissive cells, the SV40 large T antigen on its own was found to be capable of sustaining the multiplication of SV40 viral vector DNA and of activating SVLP, leading to the accumulation of capsid proteins and resulting in the efficient production of SV40 viral vector particles.

(2) In the prior art, SV40 strains have been generated that are deficient in encoding the small T antigen. Gauchat et al. (Nucleic Acids Research 14: 9339-9351, 1988) describe an SV40 deletion mutant dl883 that lacks the small T antigen but produces a functional large T antigen in infected cells. When this mutant virus strain was used to infect monkey kidney cells and CV-1 cell cultures, the mutant virus strain was less efficient in inducing large T antigen-mediated cell division and subsequent virus replication than wildtype SV40. The authors concluded that the small T antigen has a helper function, assisting the large T antigen in inducing cell division and virus replication. This prior art thus teaches away from the present invention, since it shows that compared to cells infected with wildtype SV40, many cells infected with dl883 do not divide and do not produce virus particles. The absence of small T antigen in a cell is taught to be detrimental to viral vector production.

(3) The Gauchat et al. publication is inconclusive on whether virus particles are produced or not. They merely measure the production of virus DNA in cells, which is not equivalent to the production of intact virus particles.

(4) The present invention is therefore contra-intuitive for a skilled person. Moreover, it is known to a skilled person that the small T antigen is an effective inhibitor of RNAi. Since RNAi is known to serve as an antiviral mechanism, it would be expected that a decrease in the amount of intracellular small T antigen leads to an increase in the RNAi-based antiviral activity, resulting in a reduced production of virus particles. The inventors surprisingly found that the opposite is true. When the large T antigen is provided in trans, i.e. the cell line produces the large T antigen, wherein both the cell line and the polyomavirus strain lack a functional small T antigen, polyomavius particles are produced in high amounts. The difference between the present invention and the results of Gauchat et al. is that in the experiments described in Gauchat et al. a functional large T antigen is provided in cis, i.e. on the polyomaviral vector that replicates in the infected cell. This obviously leads to partial cell death and to a very inefficient viral vector production.

(5) The present invention provides methods for the replication of recombinant polyomaviral vector particles and polyomaviral vector packaging cell lines and cell lines that support replication of polyomaviral replicons said polyomaviral vectors and replicons being incapable of expressing a functional polyomaviral small T antigen.

(6) In the present invention all cells contribute to the polyomaviral vector production and levels of 110.sup.6 or even 110.sup.11 viral vector particles per milliliter cell culture volume may be obtained in a method according to the invention.

(7) The expression functional large T antigen or functional parts thereof in this context means a large T antigen or a fragment or analogue thereof obtainable from a polyomavirus that is capable of performing the same function as that required for performing the invention as attributable to the large T antigen from which they are derived, more in particular, capable of sustaining the multiplication of polyomaviral viral vector DNA and of activating the SVLP in cells permissive for the polyomavirus.

(8) The functionality of large T antigen can be tested by co-expressing an expression plasmid coding for polyomavirus large T antigen or a fragment or analogue thereof together with T antigen-deleted polyomaviral vector DNA in cells permissive for the wildtype polyomavirus and determining whether polyomavirusl vector particles are produced. It may be concluded that polyomavirus large T antigen or a fragment or analogue thereof is a functional large T antigen if a single polyomavirus particle is produced in this assay. Such may be determined by electron microscopy or any other suitable method known in the art.

(9) The expression functional small T antigen or functional parts thereof in this context means a small T antigen or a fragment or analogue thereof obtainable from a polyomavirus that is capable of performing the same function as that required for performing the invention as attributable to the large T antigen from which they are derived, more in particular, capable of interacting with and/or inhibiting protein phosphatase 2A. The functionality of small T antigen can be tested using a binding assay between a polyomaviral small T antigen or a fragment or analogue thereof and protein phosphatase 2A as described by CHO U.S. et al., PLoS Biology 5(8): e202, 2007. It may be concluded that the small T antigen or a fragment or analogue thereof is a functional small T antigen when the interaction and/or inhibition in this assay is above background.

(10) The cell lines useful in the present invention may express polyomaviral large T antigen or functional parts thereof and are incapable of expressing functional polyomaviral small T antigen. As a consequence the cell lines of the invention do not accumulate the polyomavirus-encoded T antigen oncoproteins and replication competent wildtype polyomaviruses cannot emerge from cells of the invention by recombination between the polyomaviral vector and the chromosomally inserted polyomaviral large T antigen sequences.

(11) A cell line for use in the present invention may be obtained by the skilled person using his ordinary skills. In addition, he may follow the guidance provided in the examples in order to arrive at a cell line for use in the invention.

(12) It is also an object of the present invention to provide a polyomavirus permissive cell line, preferably a primate cell line or even more preferred a simian cell line such as a Vero cell line (ref African Green Monkey kidney cell line ECACC 88020401 European Collection of Cell Cultures, Salisbury, Wiltshire, UK) comprising a gene encoding functional polyomaviral large T antigen or a functional fragment thereof, the gene sequence being incapable of expressing a functional polyomaviral small T antigen, for instance by deleting small T antigen-specific sequences. Said cell line is capable of multiplying and packaging T antigen-deleted polyomavirus vectors.

(13) The skilled addressee will appreciate that the recombinant polyomaviral vectors, such as SV40 vectors, which are produced in the cell lines of the invention may not comprise T antigen-specific gene sequences and thus will be incapable of replicating in a mammalian cell lacking large T antigen. The exemplified T antigen-deleted SV40 replicons appeared to replicate at a high rate in the production cell lines of the invention.

(14) The term nucleotide sequence homology as used herein denotes the presence of homology between two polynucleotides. Polynucleotides have homologous sequences when either a sequence of nucleotides in the two polynucleotides is the same or when a sense sequence of the one and an antisense sequence of the other polynucleotide is the same when aligned for maximum correspondence. Sequence comparison between two or more polynucleotides is generally performed by comparing portions of at least two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to 200 contiguous nucleotides in length. The percentage of sequence homology for polynucleotide sequences of the invention, such as 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 percent sequence homology may be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e. gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100 to yield the percentage of sequence homology. Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms, or by inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul, S. F., Journal of Molecular Biology 215: 403, 1990; Altschul, S. F. et al., Nucleic Acid Research 25: 3389-3402, 1997) and ClustalW programs both available on the internet. Other suitable programs include GAP, BESTFIT and FASTA in the Wisconsin Genetics Software Package (Genetics Computer Group (GCG), Madison, Wis., USA).

(15) The homology between nucleic acid sequences may be determined with reference to the ability of the nucleic acid sequences to hybridise to each other upon denaturation (e.g., under conditions of 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at a temperature of 50 degrees Celsius to 65 degrees Celsius and hybridisation for 12-16 hours, followed by washing) (Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., Cold Spring Harbor Laboratory Press, 1989 or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992).

(16) Generally speaking, those skilled in the art are well able to construct polyomavirus vectors and design protocols for recombinant gene expression. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., Cold Spring Harbor Laboratory Press, 1989.

(17) The term heterologous is used broadly throughout to indicate that the nucleic acid sequence, polynucleotide sequence, gene or sequence of nucleotides in question have been introduced into said polyoma viral vector producer cell line, using genetic engineering, i.e. by human intervention. A heterologous gene may in principle replace an endogenous equivalent gene, or be additional to the endogenous genes of the genome of the host cell or polyoma virus i.e. is non-naturally occurring in cells of the host species or in polyoma viruses.

(18) By promoter is meant a DNA sequence from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3 direction on the sense strand of double stranded DNA). Operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is under transcriptional initiation regulation of the promoter.

(19) The promoter may be a constitutive promoter, an inducible promoter or tissue-specific promoter. The terms constitutive, inducible and tissue-specific as applied to a promoter is well understood by those skilled in the art. The promoter is preferably derived from viruses, including 5-long terminal repeats from retroviruses and lentiviruses, the cytomegalovirus immediate early promoter (CMVie), the human elongation factor 1 alpha promoter (EF-1alpha) and the like. Such promoters are readily available and are well known in the art.

(20) By polyadenylation signal is meant a sequence of nucleotides from which transcription may be terminated and a poly-A tail is added to the transcript. As polyadenylation signal any polyadenylation signal applicable in human or animal cells can be used.

(21) A cell line according to the invention may be derived from any suitable cell line known in the art such as MDCK, PER.C6, HEK293, CV1 and the like, but is preferably a Vero or CHO cell line.

(22) A suitable cell line according to the invention is a polyomavirus permissive cell line incapable of expressing the polyomaviral small T antigen and preferably comprises the following genetic elements:

(23) i) the polyomaviral large T antigen coding domain or part thereof, and optionally

(24) ii) a selectable marker such as a neomycin resistance gene, puromycin resistance gene, hygromycin resistance gene or other marker.

(25) Such a cell line may be devoid of the large intron of the polyomavirus early transcript harbouring small T antigen-specific DNA sequences

(26) The cell line in a preferred embodiment may include a transcriptional enhancer sequence stably integrated into the chromosomal DNA of the cell line, such that it may be further selected on the basis of the activity of the transcriptional enhancer. Such markers and such selection procedures are well known in the art.

(27) Different polyomaviral vector production cell lines, eg SV40 viral vector producer cell lines, may be generated by transfecting the cells with different vectors, such as plasmids, depending on their pedigree. The methodology for transfection of cell lines is well known in the art. For example, the Vero cell line is widely used for the production of virus particles for vaccines. This has found many applications in prophylaxis of viral diseases.

(28) A suitable cell line may be obtained by transfection with a first plasmid comprising the following components i) the polyomaviral large T antigen coding domain or part thereof, devoid of the large intron of the polyomavirus early transcript harbouring small T antigen-specific sequences and optionally ii) a selectable marker such as a neomycin resistance gene, puromycin resistance gene, hygromycin resistance gene or other marker.

(29) Thus a single vector or plasmid could carry both the polyomaviral large T antigen coding domain and a selectable marker sequence. It is also possible that two separate DNA carrying vectors or plasmids are utilized, one carrying the polyomaviral large T antigen coding domain and a second carrying the selectable marker, depending on design. Any further genetic elements that may be needed to confer a polyomaviral vector production capability on a producer cell line may also be placed onto one or more DNA vectors or plasmids that may then be used to transfect the production cell line of choice. For instance, the Vero production cell line does not already contain polyomaviral T antigen sequences in it, so the large T antigen coding domain may be added into it, and the resulting nascent producer cells harbouring the large T antigen coding domain in them may then be selected for, by using a selectable marker system.

(30) The invention now permits for the first time the preparation of compositions comprising recombinant polyomaviral vectors in sufficient amounts for therapeutic purposes, without the risk of contamination with wildtype polyomaviruses that occur from recombination between polyomaviral vector DNA and host cell DNA. This phenomenon is well described in the literature (Gluzman Y., Cell 23: 175-182, 1981; Oppenheim A. and Peleg A., Gene 77: 79-86, 1989; Vera M. et al., Molecular Therapy 10: 780-791, 2004).

(31) The frequency with which this recombination occurs is less well documented however. The estimates vary greatly. Shaul et al estimated that recombination could occur with a frequency of at least 10.sup.6 (Shaul et al., Proc. Natl. Acad. Sci. USA 82: 3781-3784, 1985), whereas more recent estimates show a much higher recombination rate, in the order of 10.sup.3 (Arad et al., Virology 304: 155-159, 2002).

(32) A complicating factor in estimating the frequency of recombination is that the wildtype polyomavirus replicates faster than the recombinant polyomaviral vector lacking the genes encoding functional T antigens.

(33) Therefore we established the maximum number of recombinant SV40 vector particles that could be produced in a conventional cell culture according to the prior art, without the appearance of any wild type revertants.

(34) Therefore, we infected COS-1 cells with recombinant SV40 vector particles according to a standard protocol (Vera M. et al., Molecular Therapy 10: 780-791, 2004) and calculated the maximum number of viral vector particles that could be produced without the occurrence of a single detectable genome of the wildtype virus as detected by a very sensitive quantitive PCR assay.

(35) It was found that up to 110.sup.4 viral vector particles could safely be produced without the occurrence of a detectable amount of wildtype revertants in the majority of experiments performed. A significant number of preparations comprising 110.sup.5 viral vector particles however, was positive for wildtype revertants, whereas all of the preparations comprising 110.sup.6 viral vector particles were contaminated with wildtype viruses and thus unsafe for medical use.

(36) The fact that the polyomaviral vector preparations according to the prior art are unsafe for medical use is underlined by the fact that the wildtype SV40 particles in the preparations comprising more than 110.sup.6 recombinant SV40 vector particles were able to infect SV40-permissive cells in vitro when tested according to a method of the prior art as described by Katzman R. B. et al., (Journal of Virological Methods 150: 7-13, 2008).

(37) The invention now allows for the first time the preparation of a composition comprising more than 110.sup.6 polyomaviral vector particles without any wildtype polyomavirus particles being present in the composition. The invention therefore relates to composition comprising more than 110.sup.6 polyomaviral vector particles incapable of expressing a functional polyomaviral small T antigen and incapable of replicating in cells which are permissive for the wildtype polyomavirus. Such preparations may advantageously contain 110.sup.7 vector particles or more, such as up to 110.sup.8, 110.sup.9, 110.sup.10, or 110.sup.11 vector particles or more.

(38) The expression incapable of replicating in cells which are permissive for the wildtype polyomavirus means that the composition does not contain a single wildtype revertant polyomavirus particle among the at least 110.sup.6 polyomaviral vector particles. This may be measured either by the quantitative PCR assay as described by Vera M. et al., Molecular Therapy 10: 780-791, 2004, or by infecting a cell line permissive for the wildtype polyomavirus present in the composition. In the latter case the absence of a single plaque in the plaque assay (Katzman R. B. et al., Journal of Virological Methods 150: 7-13, 2008) indicates the absence of a single wildtype polyomavirus particle.

(39) In a preferred embodiment, the preparation according to the invention relates to a composition comprising a primate polyomavirus, such as a simian polyomavirus, more in particular an SV40, Simian virus 12 (SV12), Lymphotropic polyomavirus, African green monkey polyomavirus or Chimpanzee polyomavirus. Cell lines permissive for the primate polyomavirus are preferably selected from the group consisting of Vero cells, CV1 cells, PerC.6 cells, HEK293 cells and the like.

(40) In another embodiment, the preparation according to the invention relates to a composition comprising a rodent polyomavirus such as mouse or hamster polyomavirus, more in particular a Murine polyoma virus or Hamster polyomavirus. Cell lines permissive for the mouse or hamster polyomavirus are preferably selected from the group consisting of CHO cells and the like.

(41) The present invention also discloses the generation of vector production cell lines for the production of recombinant polyoma viral vector particles that are safe for medical use.

(42) Accordingly, the invention relates to a cell line permissive for a polyomavirus, said cell line being capable of expressing a functional large T antigen and incapable of expressing a small T antigen. Such a cell line adequately supports the safe production of recombinant polyomaviral vector particles without the risk of obtaining wild type revertant polyomavirus particles since the cells lack any homologous sequences between the chromosomal DNA of the cell and the recombinant polyomavirus DNA. The gene encoding the large T antigen is preferably stably integrated in the genome of the cell.

(43) The term recombinant polyomaviral vector in this context is to be interpreted as a polyomavirus incapable of expressing a functional polyomaviral large T antigen, preferably incapable of expressing a functional large and small T antigen. Such a recombinant viral vector may for instance lack the coding sequence for either the large T antigen or both the large T and the small T antigen.

(44) The expression permissive for a polyomavirus in this context means that that the cell line supports the replication of polyomavirus particles upon infection with the polyomavirus or upon the introduction of polyomavirus DNA by transfection or other means of delivering DNA into a cell.

(45) In another aspect, the invention provides a method for producing recombinant polyomavirus particles incapable of expressing a functional small T antigen comprising the steps of a. Providing a cell line permissive for a wildtype polyomavirus, said cell line being capable of expressing a functional polyomaviral large T antigen and incapable of expressing a functional small T antigen, b. Introducing into said cell line a polyomavirus DNA incapable of encoding a functional small T antigen, c. Culturing said cells in a growth medium under conditions allowing the formation of polyomavirus particles and d. Harvesting the recombinant polyomavirus particles from the cell culture.

(46) In a preferred embodiment, the polyomavirus DNA is introduced into the cell by transfection of the DNA.

(47) In further aspects of the invention there is provided a pharmaceutical composition for the treatment of an individual suffering from a disease. The pharmaceutical composition may comprise a therapeutically effective amount of one or more polyomavirus vectors such as SV40, prepared according to a process of the invention and a pharmaceutically acceptable carrier or diluent. The pharmaceutical compositions of the invention can be formulated in any suitable form for administration to the individual in need thereof. Such formulations may be in any form for administration such as topical, oral, parenteral, intranasal, intravenous, intramuscular, intralymphatic, subcutaneous, intraocular or even transdermal administration.

(48) The pharmaceutical compositions of the invention generally comprise a buffering agent, an agent that adjusts the osmolarity thereof, an optionally, one or more pharmaceutically acceptable carriers, excipients and/or additives as known in the art. Supplementary active ingredients may also be incorporated into the compositions of the invention. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The correct fluidity may be maintained by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.

(49) The invention will now be further described with reference to the following examples.

EXAMPLES

Example 1

Construction of the SV40 Derived Gene Delivery Vector

(50) Six oligonucleotides were designed:

(51) WdV101: CCGCTCGAGTTGCGGCCGCTGTGCCTTCTAGTTGCCAGCCATC (SEQ ID No. 1) (containing a XhoI and a NotI restriction site) and

(52) WdV102: GGTACCATAGAGCCCACCGCATCCCCAGCATGCC (SEQ ID No. 2) (containing a KpnI restriction site) and

(53) WdV103: GGCCGCTTTATTAATTAAGCCCTGCAGGTTGTTTAAACTTGGCGC GCCTTAT (SEQ ID. No. 3) (contains from 5 to 3 subsequently a NotI sticky restriction site, a PadI, SbfI, PmeI and an AscI intact restriction site and a ClaI sticky restriction site) and

(54) WdV104: CGATAAGGCGCGCCAAGTTTAAACAACCTGCAGGGCTTAATTAAT AAAGC (SEQ ID No. 4) (contains from 3 to 5 subsequently a NotI sticky restriction site, a PadI, SbfI, PmeI and an AscI intact restriction site and a ClaI sticky restriction site) and

(55) WdV105: CGGGATCCAGACATGATAAGATACATTG (SEQ ID NO. 5) (containing a BamHI restriction site) and

(56) WdV106: ATAGTTTAGCGGCCGCAACTTGTTTATTGCAGCTTATAATGG (SEQ ID No. 6) (containing a NotI restriction site).

(57) Purified plasmid DNA of the SV40 vector pSL-PL (De La Luna, S. et al., Journal of General Virology 74: 535-539, 1993) was subjected to PCR using oligonucleotides WdV105 and WdV106. The resulting amplified DNA fragment comprised the SV40-polyadenylation signal flanked by a BamHI restriction site at the 5 end and a NotI restriction site at the 3 end. This SV40 polyadenylation signal fragment was digested with BamHI and NotI and the resulting 150 bp long DNA fragment was isolated from an agarose gel and cloned into a likewise digested pBluescript SK plasmid (Promega), yielding pAM002.

(58) Purified pEF5/FRT/5-DEST (Invitrogen) plasmid DNA was subjected to PCR using oligonucleotides WdV101 and WdV102. The resulting amplified DNA fragment comprising the bovine growth hormone (BGH) polyadenylation signal flanked by subsequently a XhoI and a NotI restriction site at the 5 end and an KpnI restriction site at the 3 end. This BGH polyadenylation signal fragment was digested with KpnI and NotI, and the resulting 250 bp long DNA fragment was isolated from an agarose gel and ligated into the likewise digested pAM002 plasmid. Transformation with this ligation mixture was performed in a methylation insensitive E. coli strain. This resulted in plasmid pAM003.

(59) The two complementary oligonucleotides WdV103 and WdV104 were annealed by incubating them in a water bath that was cooling down autonomously from boiling temperature to room temperature, yielding a DNA linker containing subsequently a NotI sticky restriction site, a PadI, SbfI, PmeI and a AscI intact restriction site and a ClaI sticky restriction site. This linker was ligated into the pAM002 plasmid that was digested with NotI and ClaI and isolated from an agarose gel. The ligation mixture was subsequently used to transform a methylation insensitive E. coli strain, yielding pAM004.

(60) Purified plasmid DNA of the SV40 vector pSL-PL was digested with ClaI and BamHI. The resulting 2.6 kb DNA fragment that contains the SV40 origin and the SV40 late region is purified from agarose and cloned into likewise digested pAM004. This resulted in the new SV40 vector plasmid pAM005.

Example 2

Molecular Cloning of a SV40 Luciferase Expression Vector and the Production of Recombinant SV40 Luciferase Vector Particles

(61) The expression plasmid pGL3 (Promega) was used as template for cloning of the firefly luciferase using PCR. Two oligonucleotides were designed WdV389: 5-TTGGCGCGCCATGGAAGACGCCAAAAACATAAAGAAAGGC-3 (SEQ ID NO: 7) and WdV407: 5-CCCTTAATTAATTACACGGCGATCTTTCCGCCCTTC-3 (SEQ ID NO: 8) containing respectively restriction sites AscI and PacI. The PCR amplified luciferase fragment was subsequently AscI and PacI digested and ligated into pAM005, resulting in pAM006.

(62) Two oligonucleotides were designed WdV437 5 GGGATCCAGACATGATAAGATACATTG 3 (SEQ ID NO: 9) and WdV442: ATAGTTTAGCGGCCGCAATGAATGCAATTGTTGTTGTTAACTTG (SEQ ID NO: 10) containing respectively BamHI and NotI restriction site. The pSL-PL vector was used as template for cloning of the large T antigen trailer sequence using PCR. The resulting PCR fragment was digested with BamHI and NotI and cloned into the BamHI and NotI (partially digested) pAM006, resulting in pAM020.

(63) Recombinant SV40 vector particles encoding the firefly luciferase (SV-Luc) were produced according Vera M. et al., Molecular Therapy 10: 780-791, 2004. COS-1 cells were transfected with Not1-digested and recircularized pAM020 DNA and three days after transfection crude lysates were prepared from the cell culture by repeated freeze-thawing. The SV-Luc vector particles were amplified in one round in COS-1 cells growing in a T175 flask. The SV-Luc vector particles were finally concentrated and purified from the crude lysate by sucrose gradient ultracentrifugation, yielding a vector stock with 510.sup.11 SV-Luc genome copies per milliliter cell culture.

Example 3

Construction of an Expression Plasmid Encoding the SV40 Large T Antigen

(64) A synthetic multiple cloning site (MCS) was designed containing restriction sites for NotI, PacI, SbfI, PmeI, AscI and ClaI. Two oligonucleotides were designed WdV436: 5-GCCGCTTTATTAATTAAGCCCTGCAGGTTGTTTAAACTTGGCGCGCCTTAT-3 (SEQ ID NO: 11) and WdV437: 3-CGATAAGGCGCGCCAAGTTTAAACAACCTGCAGGGCTTAATTAATAAAGC-5. (SEQ ID NO 12). Both oligonucleotides WdV436 and WdV437 were annealed to each other and ligated into pBluescript SK (Promega), yielding the recombinant plasmid pAM007.

(65) Two oligonucleotides were designed to introduce an additional NotI restriction site WdV452: CGGCGGCCGCGTAC (SEQ ID NO: 13) and WdV453: GCGGCCGC. Both oligonucleotides were annealed and ligated into pAM007, yielding the recombinant vector pAM008.

(66) The expression vector pLenti6.3/V5DEST_verA (Invitrogen) was used as a template for cloning of the cytomegalovirus immediate early (CMVie) promoter using PCR. Two oligonucleotides were designed WdV286: 5-TTGGCGCGCCTCAATATTGGCCATTAGCCATATTATTCATTGG-3 (SEQ ID NO: 14) and WdV220: 3-GACAAGCTTCCAATGCACCGTTCCCGGCCGCGGAGGCTGGATCG-5 (SEQ ID NO: 15) flanking the CMV promoter. Oligonucleotides WdV286 and WdV220 contained restriction sites AscI and HindIII respectively. Subsequently, purified pLenti6.3/V5DEST_verA was subjected to PCR using oligonuleotides WdV286 and WdV220, yielding a CMV promoter DNA fragment. This fragment was AscI and HindIII digested and ligated into pBluescript SK, yielding pAM009.

(67) The expression vector pGL4.22 (Promega) was used as a template for cloning of the puromycin N-acetyltransferase antibiotic resistance gene using PCR. Two oligonucleotides were designed WdV454: 5-CCACCCAAGCTTATGACCGAGTACAAGCCCACGGTGCG-3 (SEQ ID NO: 16) and WdV455: 3-TATCCGCTCGAGTCAGGCACCGGGCTTGCGGGTCATGC-5 (SEQ ID NO: 17) flanking the puromycin N-acetyltransferase antibiotic resistance gene and containing restriction sites HindIII and XhoI, respectively. Plasmid pGL4.22 was subjected to PCR using oligonucleotides WdV454 and WdV455, yielding the puromycin N-acetyltransferase cDNA. This fragment was HindIII and XhoI digested and ligated into pAM009, yielding pAM010.

(68) The expression vector pEF5/FRT/5-DEST (Invitrogen) was used as a template for cloning of the BGH polyadenylation signal using PCR. Two oligonucleotides were designed WdV456: 5-CAACCGCTCGAGCTGTGCCTTCTAGTTGCCAGCCATC-3 (SEQ ID NO: 18) and WdV457: 3-CGGGGTACCCCATAGAGCCCACCGCATCCCC-5 (SEQ ID NO: 19) flanking the polyadenylation signal and containing restriction sites XhoI and KpnI respectively. Plasmid pEF5/FRT/V5-DEST was subjected to PCR using oligonucleotides WdV456 and WdV457, yielding the BGH polyadenylation signal cDNA. This fragment was XhoI and KpnI digested and ligated into pAM010, yielding pAM011.

(69) Plasmids pAM008 was digested with AscI and PmeI and the DNA fragment comprising the puromycin N-acetyltransferase coding domain was purified from an agarose gel and ligated into pAM008, yielding pAM012.

(70) DNA of a full-length SV40 DNA clone (ATCC number VRMC-2) was used as template for cloning of the SV40 T antigen coding region using PCR. Two oligonucleotides were designed WdV408: ACCATGGATAAAGTTTTAAACAGAGAGGAATCTTTGCAGC (SEQ ID NO: 20) containing an attB1 recombination site and WdV409: TTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGG (SEQ ID NO: 21) containing an attB2 recombination site. WdV408 and WdV409 were used to PCR amplify the genomic T antigen coding region. Subsequently, a gateway entry clone was generated from the generated DNA fragment and pDONR221, resulting in pAM013. A T antigen expression plasmid was generated by gateway recombination between pAM013 and pEF5/FRT/V5-DEST, resulting in pAM014.

(71) The NotI and PmeI restriction sites in plasmid pAM014 were eliminated by NotI and PmeI digestion of pAM014 followed by a T4 DNA polymerase treatment and re-ligation, yielding pAM015. The T antigen expression cassette was subsequently isolated by a SphI digestion followed by a T4 DNA polymerase treatment and a NruI digestion.

(72) In order to generate a shuttle plasmid two oligonucleotides were designed WdV448:

(73) TCCTGCAGGCGGGGTACCCTAGTCTAGACTAGCCGCGGGGAGTTTAAACAGCT (SEQ ID NO: 22)

(74) and WdV449:

(75) GTTTAAACTCCCCGCGGCTAGTCTAGACTAGGGTACCCCGCCTGCAGGAGTAC (SEQ ID NO: 23).

(76) Oligonucleotides WdV448 and WdV449 were annealed generating a DNA fragment that contains the KpnI, SbfI, KpnI, XbaI, SacII, PmeI and SacI restriction sites. This DNA fragment was ligated into KpnI and SacI digested pBluescript SK (Promega), yielding pAM016. Plasmid pBluescript SK was digested with KpnI and XbaI and the MCS DNA fragment was isolated from an agarose gel. The MCS DNA fragment was ligated into pAM016 digested with KpnI and XbaI, resulting in pAM017.

(77) The EF1 alpha driven T antigen expression cassette from pAM015 was isolated by a NruI and SphI digest followed by a T4 DNA polymerase treatment. The resulting DNA fragment was cloned into pAM017 digested with EcoRV, resulting in pAM018.

(78) Plasmid pAM018 was digested with SbfI and PmeI and the DNA fragment comprising the T antigen expression cassette was isolated from an agarose gel and cloned into pAM012 digested with SbfI and PmeI, resulting in pAM019.

(79) Four oligonucleotides were designed WdV487: 5-GCAGGCTACCATGGATAAAGTTTTAAACAGAGAG-3 (SEQ ID NO: 24) and WdV490: 3-CCATTCATCAGTTCCATAGGTTGGAATCTCAGTTGCATCCCAGAAGCCTCCAAAG-5 (SEQ ID NO: 25) WdV:489 5 CTTTGGAGGCTTCTGGGATGCAACTGAGATTCCAACCTATGGAACTGATGAATGGG-3 (SEQ ID NO: 26) and WdV488: 5-AGGAATGTTGTACACCATGCATTTTAAAAAGTC-3(SEQ ID NO: 27).

(80) Oligonuleotides WdV487 and WdV490 and oligonucleotides WdV489 and WdV488 were used to amplify the first and the second exon of the SV40 large T antigen respectively. Both generated DNA fragments were subsequently subjected to a fusion PCR using oligonucleotides WdV487 and WdV488.

(81) The generated DNA fragment comprising the SV40 large T antigen coding region was digested with NcoI and NsiI and cloned into likewise digested pAM019, resulting in pAM001.

(82) In summary, pAM001 contains an EF1 alpha promoter upstream of the large T antigen coding region and a CMVie promoter upstream of the puromycin N-acetyltransferase coding region.

Example 4

Generation of a Vero Producer Cell Line and Production of Recombinant SV40 Vector Particles

(83) Vero cells (Sigma-Aldrich order number: 88020401) were propagated and adapted to serum free culture DMEM medium (Invitrogen, product code: 41966-052). Adaptation to serum free conditions was performed by gradually reducing fetal bovine serum from 8, 6, 4, 2 and 0 percent in the medium each passage. From then the Vero-Serum Free (Vero-SF) cells were cultured in OptiPro SFM medium (Invitrogen) containing 2 percent L-glutamine at 37 degrees Celsius and 5 percent CO.sub.2.

(84) Vero-SF cells were transfected with pAM001 DNA using the transfection agent Exgen 500 (Fermentas, product code: R0511) according to the supplier's prescriptions. The transfected Vero-SF cells were subsequently selected for integration of the SV40 large T expression gene cassette into the chromosomal DNA by adding 2 g/ml puromycine to the cell culture medium. Surviving colonies were isolated and propagated in OptiPro SFM medium containing 2 g/ml puromycine and 2 percent L-glutamine. Puromycin-resistant cells were transferred OptiPro SFM medium containing 2 percent L-glutamine and 10 percent DMSO and stored at 156 degrees Celsius.

Example 5

Selection of SV40 High Producing SuperVero Subclones

(85) Puromycin-resistant Vero clones transfected with pAM001 and VERO-SF control cells were cultured until they reached a confluence of 50 percent. The cell cultures were transduced with 50 l of the SV-Luc vector stock containing approximately 2.510.sup.10 vector genome copies.

(86) Four hours post transduction the culture medium was replaced by fresh OptiPro SFM medium containing 2 g/ml puromycine and 2 percent L-glutamine. Three days post transduction crude lysates are prepared from the transduced cells by freeze-thawing (Vera M. et al., Molecular Therapy 10: 780-791, 2004). COS-1 cells cultivated in DMEM supplemented with 10 percent fetal bovine serum (Invitrogen) were transduced with 100 microliters of crude lysate of each puromycin-resistant and pAM001-transfected Vero SF cell clone. Two days post transduction the COS-1 cells were subsequently tested for firefly luciferase expression as a measure for the amount of SV-Luc vector production in the corresponding puromycin-resistant and pAM001-transfected Vero SF cell clone. Cell clones that exhibited a comparable luciferase expression level to COS-1 cells were selected, propagated and expanded to create a cell bank. Cell clone Vero-SF001-86 was repeatedly monitored for SV-Luc production and produces similar amounts of recombinant SV40 vector particles as COS-1. A cell subclone of Vero-SF001-86 denoted Vero-SF001-86-01 was generated by limited dilution that repeatedly produces similar amounts of recombinant SV40 vector particles as the parental Vero-SF001-86 cell clone. Quantitative PCR according to Vera M. et al., Molecular Therapy 10: 780-791, 2004, revealed that cell clone Vero-SF001-86-01 denoted SuperVero routinely produces 1-1010.sup.11 vector genome copies per milliliter cell culture.

Example 6

Molecular Cloning of a Vector Used for Production of Recombinant Proteins in SuperVero Cells

(87) The SV40 origin of replication was PCR isolated from pTracer-SV40 (Invitrogen) and cloned into the firefly luciferase expression plasmid pGL3 (Promega resulting in expression vector pAM006. Subsequently, SuperVero cells were transfected with purified pAM006 and the control pGL3 expression vector DNA. Three days after transfection luciferase expression was measured. SuperVero cells transfected with pAM6 produced significantly more firefly luciferase compared to the control pGL3 transfected cells.