Methods of subclassification of ductal carcinoma in situ of the breast

09588120 ยท 2017-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are methods of determining the aggressiveness or indolence of a ductal carcinoma in situ lesion. Also provided are methods of development treatment plans for subjects with a ductal carcinoma in situ lesion based on the aggressiveness of the lesion.

Claims

1. A method of determining the aggressiveness of a ductal carcinoma in situ (DCIS) lesion of the breast, the method comprising: (a) detecting the level of GRAP2 protein in a sample from the DCIS lesion by immunohistochemistry, Western blot, or enzyme-linked immunosorbent assay (ELISA); (b) comparing the level of GRAP2 protein in the sample against a normal level of GRAP2 protein; (c) detecting the DNA copy number of CELSR1 in the sample by array comparative genomic hybridization (aCGH), quantitative polymerase chain reaction (qPCR), or in situ hybridization; (d) comparing the DNA copy number of CELSR1 in the sample against a normal DNA copy number of CELSR1, wherein the normal DNA copy number of CELSR1 is two; and (e) determining the aggressiveness of the DCIS lesion based on the comparison in steps (b) and (d), wherein an increased level of GRAP2 protein and a decreased DNA copy number of CELSR1 in the sample as compared to the normal level of GRAP2 protein and CELSR1 DNA copy number indicates an aggressive DCIS lesion.

2. The method of claim 1, wherein the protein level of GRAP2 in the sample is detected by immunohistochemistry.

3. The method of claim 1, wherein the DNA copy number of CELSR1 in the sample is detected by qPCR.

4. The method of claim 1, wherein the DNA copy number of CELSR1 in the sample is detected by quantitative polymerase chain reaction (qPCR).

5. The method of 1, further comprising developing a treatment plan for a subject with an aggressive DCIS lesion, wherein the treatment plan includes surgery, radiation, endocrine therapy, chemotherapy, or a combination thereof.

6. The method of claim 1, further comprising detecting a DNA copy number, an mRNA level, or a protein level of CELSR1, NR4A1, NCOR2/SMRT, DYNLRB2, TAF1C, STI13, or UPK3A in the sample.

7. The method of claim 1, wherein the sample comprises one or more DCIS cells.

8. The method of claim 1, wherein the sample comprises one or more normal cells.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 is a three-dimensional graphical plot showing the principal component analysis (PCA) for 20 PD (black), 25 MD (blue) and 24 MI (red) lesions (where PD indicates pure (indolent) DCIS, MD mixed (aggressive) DCIS, and MI matched invasive carcinoma). 18 cases had both an MD and MI component and are connected by lines. The circle contains all but one of the PD lesions, indicating that they share genomic alterations that set them apart from the aggressive (MD) DCIS lesions.

(3) FIG. 2A is a graph showing the DNA copy number changes in PD lesions by their chromosomal location.

(4) FIG. 2B is a graph showing the DNA copy number changes in MD lesions by their chromosomal location.

(5) FIG. 3 is a heat map of chromosomal are 22q. The x-axis shows the 20 PD lesions on the left and the 25 MD lesions on the right. The scale on the right indicates the log 10 P-values for differential amplification (red) or deletion (green) in the two groups. The y-axis shows the chromosomal location from the telomere (top) to the centromere (bottom). Near the telomere gains are more common in PD. The remainder of the arm shows higher frequencies of deletions in MD lesions.

(6) FIG. 4 is a set of graphs showing the analysis of the DNA copy number experiments using 5 and 8 genes combinations and the ROC curves and AUCs for these experiments.

DETAILED DESCRIPTION

(7) The Examples below demonstrate that the DNA copy number of particular genes found in particular regions of several chromosomes are likely to be altered in ductal carcinoma in situ (DCIS) lesions and that the copy number of the gene in cells from the lesion is indicative of the aggressiveness of the cancer. The Examples demonstrate ductal carcinoma invasiveness can be predicted by analysis of the DNA copy number at a human chromosomal location selected from 22q13.1-q13.33, 16q23-q24.2, 12q13-q14 or 12q24-q25. The DNA copy number was shown to be increased in indolent DCIS at 22q13.1-q13.33, 16q23, 12q13-q14 or 12q24-q25 relative to controls. The DNA copy number was more likely to be increased at 22q13.1 relative to controls in DCIS lesions that were aggressive and likely to become invasive. The DNA copy number was more likely to be reduced at 16q23, 12q13-q14 or 12q24-q25 in aggressive DCIS lesions relative to controls. The DNA copy number was more likely to be reduced at 16q24.1 in indolent DCIS relative to controls.

(8) Control or normal cells are expected to have two alleles of each gene. Four or more copies of a gene is considered an increase relative to control cells and one or no copies of a gene is considered as a decrease in copy number relative to controls. The number of DNA copies of the gene can be detected in a sample from the DCIS lesion.

(9) The sample may be obtained by any means available to those skilled in the art including, but not limited to, a biopsy of the DCIS lesion, including a needle biopsy or surgical removal of tissue containing the lesion. Breast tissues with DCIS generally contain normal cells as well as neoplastic cells. In the Examples, the cells used in the samples for preparation of the DNA for aCGH were microdissected to ensure that only DCIS cells were included. As noted in the Examples, the gene copy number may be assessed in samples including both DCIS cells and normal cells. The percentage of DCIS vs. normal cells can be used to calculate whether the DCIS cells have a change in gene copy number as compared to non-neoplastic cells.

(10) Gene copy number may be assessed by any method, including methods known to those of skill in the art. For example the gene copy number may be assessed by methods, including but not limited to, array comparative genomic hybridization (aCGH), in situ hybridization (ISH, e.g., fluorescent (FISH) or chromogenic (CISH)), microarray analysis and real time quantitative PCR. Control cells for comparison may be normal, non-neoplastic cells from the same or a different subject or may be cancer cells with known genomic DNA changes and defined aggressiveness. As noted above, when assessing gene copy number, control cells are not needed for comparison due to the diploid nature of the human genome.

(11) Several specific genes whose gene copy number was predictive of the DCIS lesion's aggressiveness (i.e. the propensity of a lesion to become invasive) were also identified in the Examples. In particular, increased copy number of NCOR2/SMRT (chromosome location 12q24.31), NR4A1 (chromosome location 12q13), DYNLRB2 (chromosome location 16q23.3), CELSR1 (chromosome location 22q13.31), UPK3A (chromosome location 22q13.31) or ST13 (chromosome location 22q13.1) was shown to be indicative of indolent or non-aggressive DCIS lesions. Conversely a decreased copy number of NCOR2/SMRT, NR4A1, DYNLRB2 was indicative of increased aggressiveness and a higher likelihood of invasiveness. A decrease in ST13 copy number was indicative of an indolent lesion. An increase in GRAP2 (chromosome location 22q13.1) copy number in a DCIS cell was indicative of increased aggressiveness. A reduced copy number of TAF1C (chromosome location 16q24.1) in a DCIS lesion was indicative of an indolent lesion. The GenBank NCBI and Ensembl Gene ID No. for the genes are included in Table 1.

(12) TABLE-US-00001 TABLE 1 GenBank and Ensembl Gene ID No. Gene NR4A1 NCOR2 DYNLRB2 TAFIC NCBI: GeneID: 3164 9612 83657 9013 Ensembl Gene ID ENSG00000123358 ENSG00000196498 ENSG00000168589 ENSG00006103168 Gene GRAP2 ST13 CELSR1 UPK3A NCBI: GeneID: 9402 6767 9626 7380 Ensembl Gene ID ENSG00000160351 ENSG00000100380 ENSG00000075275 ENSG00000160373

(13) As demonstrated in the Examples, overexpression of genes as evidenced by increased mRNA or protein levels due to increased gene copy number or conversely, reduced expression of genes as evidenced by decreases in mRNA or protein levels due to reduced gene copy number may be indicative of the aggressiveness or invasive potential of the DCIS lesion. Therefore, the mRNA or protein expression level of the genes as compared to control cells may also be used to assess the aggressiveness of the DCIS lesion. Gene expression levels may be assessed either at the level of mRNA expression, e.g. by Northern blot or quantitative rtPCR, or at the level of protein expression, e.g. by Western blot, ELISA, immunohistochemistry (1HC) or functional protein assays. Other methods of assessing gene expression or protein expression may also be used, including additional methods known to those skilled in the art.

(14) The DCIS lesion may be classified or predicted to be aggressive or indolent based on analysis of the DNA copy number, mRNA expression or protein expression of a single gene, the combination of all eight genes, or a sub-combination of a portion of the eight genes identified herein. As shown in the examples below, detection of a change in DNA copy number, mRNA levels or protein levels of one of the genes described herein may be capable of predicting the likelihood of invasive carcinoma. Evaluation of NCOR2/SMRT alone could be used to determine the aggressiveness of the lesion. Evaluation and detection based on all eight genes identified herein was capable of determining the aggressiveness of the lesion with an AUC of 0.946. In addition, at least one set of five genes including NR4A, NCOR2/SMRT, DYNLRB2, GRAP2, and CELSR1 was capable of predicting the aggressiveness of the lesion with an AUC of 0.953. Any combination of the eight genes may be used in the methods described herein.

(15) The determination of the aggressiveness phenotype of the DCIS lesion may be used to develop a treatment plan for the subject with the DCIS lesion. As noted above, most DCIS is indolent, but due to the propensity of some DCIS to become invasive many subjects with DCIS are treated aggressively. A reliable test to determine the propensity of a DCIS lesion to progress to invasive cancer would save many patients from undergoing needless procedures and would reduce health care costs. Those subjects whose lesions are likely indolent may be treated by monitoring the lesion over time. Those subjects whose lesions are likely aggressive can receive aggressive therapy, such as surgery, radiation, chemotherapy or a combination thereof. Thus, the results of the methods provided herein may be used to develop treatment plans for the subject or may be used as a prognostic assay to provide physicians with additional information.

EXAMPLES

(16) Low grade (LG) DCIS cases were selected for analysis. For these studies low-grade DCIS was defined as nuclear grade 1 or 2 with no necrosis apparent. Of the 116 cases of formalin fixed, paraffin embedded (FFPE) LGDCIS samples selected, 61 of them contained a small invasive component, indicating aggressive potential (MD=mixed DCIS, MI=mixed invasive carcinoma) and 55 cases showed no evidence of invasion within at least 5 years (PD=pure DCIS). These samples were from the surgical pathology files of Duke University Medical Center (DUMC) and Roswell Park Cancer Institute (RPCI). The three different types of lesions were microdissected using laser capture microdissection (over 200 paraffin blocks; 10 m sections), genomic DNA was extracted, and 118 array comparative genomic hybridization (aCGH) hybridizations were performed utilizing high density (19 k) bacterial artificial chromosome (BAC) arrays (average genomic resolution was 170 kb). The arrays were custom made by the RPCI Genomics Core Facility. The DNA quality was assessed via the Enzo BioScore Assay and samples with poor DNA quality were not used for further analysis.

(17) Sixty-nine of the 118 aCGH hybridizations yielded interpretable DNA profiles: 20 PD, 25 MD, 24 MI (Cohort 1). Statistical analyses were performed using the generic GCH Call program. Surprisingly, while paired in situ and invasive carcinomas had comparable frequencies of DNA copy number gains and losses, pure intraductal carcinomas were characterized by a larger number of copy number changes, especially gains (Table 2). Moreover, Principal component analysis (PCA) showed that the indolent DCIS lesions clustered separately from the mixed carcinomas (circled area in FIG. 1). FIG. 2 demonstrates that 17 regions on 13 chromosomal arms contained differential copy number aberrations (CNAs), almost all of which occurred more commonly in pure (indolent) DCIS lesions. The majority of these differential CNAs were DNA gains.

(18) TABLE-US-00002 TABLE 2 DNA copy number frequencies in low grade DCIS with and without associated invasive ductal carcinoma (IDC) Average Average Average total copy number copy number copy number N gains losses changes DCIS without IDC [PD] 20 8.4% 8.2% 16.6% DCIS with IDC [MD] 25 6.3% 5.5% 11.8% Matched IDC [MI] 24 6.9% 6.1% 13.0% TOTAL 69 7.0% 6.5% 13.5%

(19) FIG. 3 details the differential copy number changes on chromosome 22q. Only this chromosomal arm contained a higher frequency of copy number losses in the MD group, suggesting possible inactivation of invasion suppressor genes on that chromosomal arm. From the 17 differentially amplified or deleted regions, 19 candidate genes were selected for further validation studies, based on statistical probability and functional interest. Of those, 8 were confirmed to be differentially amplified or deleted in PD versus MD lesions, utilizing quantitative (Q-)PCR on aliquots of genomic DNA. The primers used for the PCR are provided in Table 3. These 8 genes and the data obtained are summarized in Table 4. Of note, three of these genes have not been implicated in human neoplasia before, and only SMRT was previously described in human breast cancer.

(20) TABLE-US-00003 TABLE 3 Primers used for PCR Gene OLIGO Sequence Amplicon Tm NR4A1 Forward CTGAGACCACCAGGAAGAGC (SEQ ID NO: 1) 59.99 Reverse TCCTCCTCACGATCTGCTTT (SEQ ID NO: 2) 99 59.95 NCOR2 Forward TCCCAGCGTGACTCTTTTCT (SEQ ID NO: 3) 59.99 Reverse ACCGGTGCTATGAACCAGTC (SEQ ID NO: 4) 90 60 DYNLRB2 Forward GGGTAGCGTTGTTGACATCC (SEQ ID NO: 5) 60.38 Reverse ACGGAGACCCCAGATTTACC (SEQ ID NO: 6) 93 60.19 TAFIC Forward GCAGGTCCCTCAGTTCTCAC (SEQ ID NO: 7) 59.84 Reverse ACTCCACCCTCACCAAACAC (SEQ ID NO: 8) 84 59.86 Grap2 Forward CCTGTGTGGCATTACCCTCT (SEQ ID NO: 9) 59.99 Reverse CCCCTTTAAGAGCTGTCACG (SEQ ID NO: 10) 80 59.87 ST13 Forward CCCCGACAGCTGTAATTCAT (SEQ ID NO: 11) 59.96 Reverse GTCGAGCACAAACTTCAGCA (SEQ ID NO: 12) 88 60.18 CELSR1 Forward GGTGTCCTAGCAGTGGGTGT (SEQ ID NO: 13) 60.03 Reverse AAAGCTGGAGGCAAAAGACA (SEQ ID NO: 14) 90 59.99 UPK3A Forward GCCCACATTTTCATTTTGCT (SEQ ID NO: 15) 59.94 Reverse TGTAAGACGAAGGGGTTTGG (SEQ ID NO: 16) 100 59.96

(21) TABLE-US-00004 TABLE 4 Differential copy number changes in low grade DCIS With (MD) and without (PD) associated stromal invasion: Eight candidate genes validated by Q-PCR Candidate Chr. Involvement in Gene Loc. Differential CNA Function Human Neoplasia SMRT 12q24.31 More commonly amplified Component of repressing Expression correlated (NCOR2) in PD, nuclear receptor complex; with breast cancer more commonly deleted in involved in DNA repair recurrence MD NR4A1 12q13.13 More commonly amplified Nuclear steroid hormone Downregulated in (Nur77) in PD, receptor; AML and in follicular more commonly deleted in pro-apoptotic thyroid ca MD DYNLRB2 16q23.2 More commonly amplified Dynein light chain protein Downregulated in (DNLC2B) in PD, liver cancer more commonly deleted in MD TAF1C 16q24.1 More commonly deleted in Transcription co-factor Not described PD CELSR1 22q13.31 More commonly amplified Flamingo-type cadherin; Not described in PD component of Wnt signaling pathway UPK3A 22q13.31 More commonly amplified Cell membrane protein; involved Downregulation in PD in urothelial differentiation associated with worse prognosis in bladder cancer ST13 22q13.1 More commonly amplified Hsp70 co-chaperone Downregulated in (HIP) or colon cancer deleted in PD GRAP2 22q13.1 More commonly amplified Involved in TCP signaling Not described in MD

(22) Statistical analysis of the Q-PCR data showing the ROC curves and the AUC for combinations of 5 or 8 of the identified genes demonstrates that a change in gene copy number of at least 5 of these genes can discriminate between indolent and aggressive DCIS with high accuracy (FIG. 4).

(23) Because SMRT was the gene with the single highest discriminatory power, its differential copy number distribution was confirmed in an independent series of PD and MD lesions (Cohort 2) using quantitative PCR. Cohort 2 consisted of IOng samples from microdissected cells from a separate set of 18 PD and 17 MD lesions. The PCR assay sensitivity cut-off was +1.0 for gains and 0.5 for losses (Iog2 ratios). GAPDH was used as a reference gene. Table 5 details the results of three experiments. Each experiment demonstrated that SMRT gains were more common in PD lesions. In addition, the Q-PCR experiments revealed a much higher frequency of allele loss in the MD group. These findings suggest that SMRT may act as an invasion suppressor: it may be activated in DCIS lesions that do not have the capacity to invade and inactivated in lesions that do progress.

(24) TABLE-US-00005 TABLE 5 SMRT copy number changes in PD vs. MD PD MD Loss Normal Gain Loss Normal Gain P-Value* aCGH 0 5 15 2 17 6 0.0028 Cohort 1 Q-PCR 6 10 4 22 3 0 0.0003 Cohort 1 Q-PCR 4 10 4 11 6 0 0.0182 Cohort 2 *Unordered Kruskal-Willis test

(25) Gene copy number changes may correlate with a change in gene expression as measured by mRNA and/or protein expression levels in the cell. To test whether the protein expression levels correlated with the gene copy number immunohistochemistry (1HC) assays were performed on the tissue sections for NCOR2/SMRT protein levels. The paraffin sections were reacted with mouse monoclonal antibody 1542/H7 from Santa Cruz at 2 g/ml for 1 hour. The detection reaction utilized the Bond Refine horseradish peroxidase system from Leica. The results are shown in Table 6. Although the changes are not statistically significant due to the small number of interpretable samples (n=30), the results correlate to those obtained by aCGH and Q-PCR. The data suggest that NCOR2/SMRT levels are increased in a higher proportion of PD lesions (30% vs. 10%) and reduced or absent in a higher proportion of MD lesions (20% vs. 10%).

(26) TABLE-US-00006 TABLE 6 IHC of PD and MD lesions for NCOR2/SMRT protein levels DCIS No/Reduced Normal Increased Type Expression Expression Expression PD 1 6 3 MD 4 14 2
Prophetic Examples

(27) In the Examples above, pure populations of DCIS cells were isolated via laser capture microdissection of paraffin sections, and genomic DNA was prepared and assayed from those preparations following routine protocols. For each of the 8 genes comprising the invasion signature, appropriate primers and Q-PCR protocols were designed. GAPDH was used as a reference gene with normal copy number and defined thresholds of gains of at least two alleles, and of losses of at least one allele. However, tissue microdissection is laborious and requires specialized equipment. Whole tissue sections from the same cohort of cases from which the signature was derived will be used to determine if microdissection is necessary. Briefly, from whole tissue sections, genomic DNA will be extracted in the same fashion, and Q-PCR experiments will be performed using the established protocols. Because the tumor DNA will be diluted by DNA from non-neoplastic cells, the amplitude of copy number gains and losses is expected to be lower for each case. To account for this effect and to set appropriate thresholds that define copy number gains and losses, we will perform dilution curves for each gene. One sample with a 2 copy number, and another one with a defined loss of one allele, will be diluted with DNA extracted from formalin fixed, paraffin embedded normal human breast tissue to yield ratios of 25%, 50%, and 75%, reflecting the typical range of tumor cellularity in whole tissue sections. The evaluation of copy number over the various dilutions will be observational, and descriptive statistics and Spearman rank correlation will be used to determine threshold values for copy number losses and gains.

(28) The differential copy number gains and losses were defined using LGDCIS. We hypothesize that similar molecular changes exist in HGDCIS lesions (i.e., intraductal carcinomas with a nuclear grade of 3) as well. To this end, we will utilize 50 HGDCIS cases from the DUMC files and/or from other sources. The experiments and statistical analysis will be performed as described above.

(29) A chromogenic in situ hybridization (CISH) assay for all 8 genes will be developed. This technique also detects DNA copy number changes, but allows evaluation specifically of the neoplastic cell population. The procedure for CISH is very similar compared to the more commonly used FISH technique, except that the detection reaction utilizes chromogenic substrates instead of fluorescent dyes. CISH has several advantages, including use of brightfield microscopy and permanence of the signals. These assays may be routinely performed in a diagnostic laboratory. For each of the 8 genes, we will construct appropriate biotinylated oligonucleotide probes (Integrated DNA Technologies, Skokie, Ill.). We will employ the Dako GenPoint kit to detect the presence or absence of specific hybridization (Dako, Carpinteria, Calif.). Briefly, the slides will be deparaffinized and heated in target retrieval buffer (sub-boiling for 20 min). They will be quenched in 3% H.sub.2O.sub.2 in methanol for 20 min. The DNA will be denatured at 95 C. for 5 min. For each biotinylated oligonucleotide probe, the optimal hybridization and stringent wash temperature will be determined After incubation in the hybridizer instrument, the washed slides will be reacted with primary strepatavidin-HRP solution for 15 min. A subsequent amplification step utilizes biotinyl tyramide (15 min) This will be followed by a second streptavidin-HRP step (15 min). The chromogenic reaction utilizes DAB (5 min) Finally, the slides will be counterstained with hematoxylin and mounted for light microscopic evaluation. For any given gene, the number of signals in each tumor cell will be counted. We will evaluate 100 DCIS cells per case. An average signal number of 4 or more per cell will count as a gain; an average signal number of 1 or less will count as a loss. As controls, we will use benign tissues from non-cancer patients. Normal cells should contain 2 copies of each gene. Negative control reactions will be performed without DNA probes. When all genes have been scored in all samples, statistical analysis will be performed to determine which combination of the 8 genes has the highest power of differentiating DCIS cases with and without the capacity to invade the stroma, using the same additive and multivariate models described above.

(30) As an alternate in situ technique we will employ 1HC, which interrogates gene expression at the protein level. It is reasonable to expect that DNA copy number gains will be associated with increased, and losses with decreased, levels of the corresponding protein product. For 7 of the 8 genes in our panel, commercial antibodies are available (at present, no antibodies exist against DYNLRB2). We previously used the SMRT antibody to develop an 1HC assay to study expression of that gene in invasive breast carcinomas; we found downregulation or loss in 80% of cases. Indeed, in the Examples above the SMRT protein levels were found to correlate to the gene copy number. Briefly, 5 m paraffin sections are dewaxed and rehydrated. For each antibody, the optimal antigen retrieval method (e.g. enzymatic, heat induced, combination) is established. The optimal antibody titer and incubation time and temperature are determined, using known positive and negative controls. These include numerous well characterized human cancer cell lines that have been fixed and paraffin embedded, as well as a large number of archival normal and neoplastic tissues. Several different detection methods are available. We routinely use peroxidase based detection systems including the Vectastain Elite ABC kit (Vector), the mouse and rabbit Envision kits (Dako), and the LSAB kit (Dako). For antigens expressed at low levels, we can employ a signal amplification step (Dako). DAB is used as chromogen and hematoxylin as counterstain. Nonspecific species-matched antibodies are used in negative control reactions. Evaluation of the 1HC stains will take into account the subcellular localization, percentage of staining cells, staining pattern (diffuse, mosaic, patchy, focal) and staining intensity.