Low-molecular-compound for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and culture method

09587225 ยท 2017-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are novel indoleacrylic acid-based compounds, and pharmaceutically acceptable salts thereof, useful for the production, maintenance and proliferation of pluripotent stem cells. Also provided are cell culture compositions comprising these compounds, and methods of using these compounds in the production and maintenance of pluripotent stem cells.

Claims

1. A method for producing reprogrammed pluripotent stem cells from differentiated cells, the method comprising the steps of: (a) introducing reprogramming factors into the differentiated cells; and (b) culturing the differentiated cells in a medium containing a composition for promoting reprogramming of differentiated cells into pluripotent stem cells, comprising a compound of the following formula 1 or a pharmaceutically acceptable salt thereof: ##STR00006## wherein (i) R.sub.1 is an amino group (NH.sub.2) and R.sub.2 is hydrogen (H) or (ii) R.sub.1 is a dimethylamino group (N(CH.sub.3).sub.2) and R.sub.2 is a hydroxyl group (OH); and a portion indicated by --- is a double bond.

2. The method of claim 1, wherein R.sub.1 is an amino group (NH.sub.2) and R.sub.2 is hydrogen.

3. The method of claim 1, wherein R.sub.1 is a dimethylamino group (N(CH.sub.3).sub.2) and R.sub.2 is a hydroxyl group (OH).

4. The method of claim 1, wherein the compound of formula 1 is selected from the group consisting of the following compounds: 1) 3-[3-(1H-indol-3-yl)acrylamido]benzamide; and 2) 3-[3-(1H-indol-3-yl)acrylamido]-4-hydroxy-N,N-dimethylbenzamide.

5. The method of claim 1, wherein the differentiated cells are somatic cells or progenitor cells.

6. The method of claim 1, wherein the pluripotent stem cells are of human origin.

7. The method of claim 1, wherein the concentration of the compound of formula 1 or a pharmaceutically acceptable salt thereof is 0.01-20 M.

8. The method of claim 1, wherein the reprogramming factors comprise proteins of Oct4, and Sox2 or nucleic acid molecules encoding the proteins.

9. The method of claim 1, wherein the reprogramming of the differentiated cells into the pluripotent stem cells corresponds to inhibition of p53, p21 or p16 level compared to that in a control group not treated with the composition.

10. The method of claim 1, wherein the reprogramming of the differentiated cells into the pluripotent stem cells corresponds to inhibition of function of HDAC1 and an increase in H3K9ace level compared to those in a control group not treated with the composition.

11. The method of claim 1, further comprising a step of isolating the reprogrammed pluripotent stem cells from a culture resulting from step (b).

12. The method of claim 1, wherein steps (a) and (b) are performed simultaneously, sequentially or in the reverse order.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a process of screening mouse cell reprogramming factors using analog library screening of novel trans-3-indoleacrylic acid-based compounds. In order to screen low-molecular-weight compounds that promote the production of reprogrammed stem cells, mouse embryonic stem cells (OG2-MEF; hemizygous for the Oct4-GFP transgene) were transduced with reprogramming viruses (Oct4, Sox2, Klf4, and c-Myc). After 5 days, the cells were seeded on gelatin-coated plates and then cultured in mouse embryonic stem cell culture media containing each of low-molecular-weight compounds until colonies having a morphology similar to that of mouse embryonic stem cells were formed. After 15 days, the number of colonies expressing endogenous Oct4 GFP fluorescence was measured, and compounds that increased the efficiency of reprogramming compared to that of a control group were selected. FIG. 1A shows an experimental process of inducing the reprogramming of mouse embryonic fibroblasts. Oct4 (O), Sox2 (S), Klf4 (K), and cMyc (M). FIG. 1B is a graph showing the increase in efficiency of reprogramming by RSC-133 and ID-558 among screened compounds. The values shown on the graph are mean values. The data are expressed as meanSD (n=3).

(2) FIG. 2a shows the results of comparatively analyzing the increase in reprogramming efficiency caused by the novel low-molecular-weight compound 133. The reprogramming-promoting effects of a DNA methyltransferase inhibitor (5-Azacytidine; AZA), a G9a histone methyltransferase inhibitor (BIX-01294) and a histone deacetylase inhibitor (Valproic acid; VPA), which are low-molecular-weight compounds reported to promote the production of reprogrammed stem cells, and the novel low-molecular-weight 133, were comparatively analyzed by measuring the number of colonies expressing endogenous Oct4 GFP fluorescence. Treatment with RSC-133 greatly increased the efficiency of reprogramming compared to control group or treatment with other compounds or reprogramming of induction of reprogramming viruses (Oct4, Sox2, Klf4, and c-Myc (OSKM)). The values shown on the graph are mean values. The data are expressed as meanSD (n=3) (**P<0.05).

(3) FIG. 2b shows the results of comparatively analyzing the increase in reprogramming efficiency caused by the novel low-molecular-weight compound 133. In a process of inducing the reprogramming of human skin fibroblasts by insertion of an OSKM reprogramming factor, the cells were treated with AZA (0.5 M), VPA (1 mM), TSA (20 nM), SB431542 (10 M) and RSC 133 (10 M), and the number of AP-positive colonies was counted to measure the efficiency of reprogramming. The values shown on the graph are mean values. The data are expressed as meanSD (n=3).

(4) FIG. 3 shows the results of screening reprogramming factors of human skin fibroblasts (hFFs) using analog library screening of novel trans-3-indoleacrylic acid-based compounds. In order to screen low-molecular-weight compounds that promote the production of reprogrammed stem cells, human fibroblasts were transduced with reprogramming viruses (Oct4, Sox2, Klf4, and c-Myc). After 5 days, the cells were seeded on Matrigel-coated plates, and then cultured in MEF-conditioned medium (CM) containing each of low-molecular-weight compounds until colonies having a morphology similar to that of human embryonic stem cells were formed. After 15 days, alkaline phosphatase (AP) activity was measured, and compounds that increased the efficiency of reprogramming compared to that of a control group were selected. RSC-133 increased the efficiency of reprogramming of human skin fibroblasts, similar to that of mouse embryonic fibroblasts. The values shown on the graph are mean values. The data are expressed as meanSD (n=3).

(5) FIG. 4 shows that the novel low-molecular-weight compound 133 increased the efficiency of reprogramming of human skin fibroblasts compared to that of a control group not only in normal conditions (21% O.sub.2), but also in hypoxic conditions (5% O.sub.2). According to previous reports, the efficiency of reprogramming increases in hypoxic conditions. The novel compound 133 can exhibit a synergistic effect in the reprogramming process promoted by such hypoxic conditions. FIG. 4A is a graph showing the results of measurement of AP activity. FIG. 4B shows the morphology of reprogrammed stem cells induced by the addition of the novel compound 133 under hypoxic conditions.

(6) FIG. 5 shows the results of examining whether the novel low-molecular-weight compound 133 shows the effect of substituting for an existing reprogramming factor (c-Myc) when the generation of reprogrammed stem cells from human skin fibroblasts is induced by addition of the novel low-molecular-weight compound 133. The compound RSC-133 alone did not show the substituting effect, but addition of the compound RSC-133 in combination with sodium butyrate (NaB) substituted for the c-Myc factor to increase the efficiency of reprogramming compared to that of a control group. The efficiency of reprogramming obtained by measuring the number of AP-positive colonies is graphically shown. The values shown on the graph are mean values. The data are expressed as meanSD (n=3). The values shown on the graph are mean values.

(7) FIG. 6 shows the .sup.1H NMR data of RSC-133.

(8) FIG. 7 shows HPLC data relating to the purity of RSC-133.

(9) FIG. 8 shows that RSC-133 increased the efficiency of reprogramming in a manner dependent on the concentration thereof in a culture medium for reprogramming. The upper panel schematically shows the experimental process. The lower panel is a graph showing the efficiency of reprogramming obtained by measuring the number AP-positive colonies as a function of the concentration of RSC-133 treated. The values shown on the graph are mean values. The data are expressed as meanSD (n=3) (**P<0.005, by t-test).

(10) FIG. 9 is a graph showing the results of analyzing the effect of RSC-133 on the cytotoxicity of human skin fibroblasts. At 72 hours after treatment with various concentrations of RSC-133, cytotoxicity was measured by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (yellow tetrazole) assays. The values shown on the graph are mean values. The data are expressed as meanSD (n=3).

(11) FIG. 10 shows the results of examining a reprogramming process, in which RSC-133 is involved, and an efficient reprogramming method utilizing the same. The left panel schematically shows the experimental process. The right panel shows the reprogramming efficiency measured by counting the number of AP-positive colonies after addition of RSC-133 during different periods of time in the reprogramming process. The values shown on the graph are mean values. The data are expressed as meanSD (n=3) (*P<0.05, **P<0.005, by t-test).

(12) FIG. 11 is a graph showing the effect of RSC-133 on cell growth during a reprogramming process. The results were obtained in the same manner as those in FIG. 10. The values shown on the graph are mean values. The data ate are expressed as meanSD (n=3).

(13) FIG. 12 is a graph showing the results of examining the effect of RSC-133 on the growth of human skin fibroblasts or human skin fibroblasts infected with a reprogramming factor (OSKM) virus. The values shown on the graph are mean values. The data are meanSD (n=3).

(14) FIG. 13 shows that RSC-133 increased proliferating cell population during a reprogramming process. Immunocytochemical analysis was performed using monoclonal antibody for bromodeoxyuridine (BrdU), and then percent BrdU positive cells are graphically shown. The values shown on the graph are mean values. The data are expressed as SD (n=3) (*P<0.05, by t-test).

(15) FIG. 14 shows that RSC-133 increased proliferating cell population in human skin fibroblasts infected with reprogramming factor (OSKM) virus. The left panel is a set of graphs showing the results of immunocytochemical analysis performed using monoclonal antibody for BrdU, and the right panel is a graph showing the results of measurement of percent BrdU positive cells. The values shown on the graph are mean values. The data are expressed as meanSD (n=3).

(16) FIG. 15 is a set of photographs showing the results of immunocytochemical analysis performed using monoclonal antibodies for BrdU and undifferentiation markers (Nanog and Tra1-81) in cells cultured in the presence or absence of RSC-133. After induction of reprogramming, human skin fibroblasts were cultured for 10 days in the presence or absence of RSC-133, followed by immunocytochemical analysis (scale bar=200 m).

(17) FIG. 16 shows the results of examining the effect of RSC-133 on a reprogramming process. The relative expression levels of mRNA during a reprogramming process were measured, and as a result, it was shown that, in a test group whose reprogramming was induced by treatment with RSC-133, the expressions of the pluripotency-specific markers Nanog, Oct4 and Rex1 were relatively increased, and the expressions of p53, p21 and p16 known to inhibit reprogramming were relatively inhibited.

(18) FIG. 17 shows the results of examining the effect of RSC-133 on cell cycle arrest (cell aging) in a reprogramming process. The degree of cell cycle arrest during a reprogramming process was measured by the measurement of SA-13-Gal, and as a result, it was shown that cell cycle arrest was relatively reduced in a test group whose reprogramming was induced by treatment with RSC-133. The values shown on the graph are mean values. The data are expressed as meanSD (scale bar=200 m, **P<0.01).

(19) FIG. 18 shows the effect of RSC-133 on histone acetylation (H3K9ace) during a reprogramming process. The left panel is a set of photographs showing the results obtained by inducing the reprogramming of human skin fibroblasts, culturing the cells for 10 days in the presence or absence of RSC-133, and then analyzing the cells by immunocytochemistry using monoclonal antibodies for H3K9ace and an undifferentiation marker (Nanog) (scale bar=200 m). The right panel shows the results of measuring the level of H3K9ace by Western blot analysis. H3 protein was used as an internal control.

(20) FIG. 19 shows the results of examining whether RSC-133 can inhibit histone deacetylase (HDAC) during the reprogramming of human skin fibroblasts. The left panel shows the results of measuring the activity of total HDAC enzymes during a reprogramming process performed in the presence or absence of RSC-133. The right panel shows the amount of HDAC1 protein measured after performing 10 days of culture in the presence or absence of RSC-133. The values shown on the graph are mean values. The data are expressed as meanSD (n=3) (*P<0.01, **P<0.005, by t-test).

(21) FIG. 20 shows the results of examining the effect of RSC-133 on the activity of DNA methyl transferase 1 (DNMT1) during the reprogramming of human skin fibroblasts. The graph shows the activity of DNMT1 measured after culturing human skin fibroblasts transduced with OSKM, for 10 days in the presence of RSC-133. For comparison, the activity of DNMT1 in the absence of RSC-133 was set at 100%.

(22) FIG. 21 shows the changes in amounts of HDAC-family proteins during the reprogramming of human skin fibroblasts in the presence or absence of RSC-133. The upper panel schematically shows an experimental process. The lower panel shows the results of measuring the changes in amounts of HDAC-family proteins by Western blot analysis. GAPDH protein was used as an internal control.

(23) FIG. 22 shows the results of immunostaining performed to analyze the expression of pluripotency-specific markers in the reprogrammed stem cells (RSC133-iPS) reprogrammed from human skin fibroblasts by addition of RSC-133.

(24) FIG. 23 shows the results of RT-PCR analysis performed to analyze the expressions of pluripotency-specific marker genes and reprogramming factors in reprogrammed stem cells (RSC133-iPS) induced from human skin fibroblasts by addition of RSC-133. Semi-quantitative RT-PCR was performed using transgene-specific PCR primers that can determine the relative expression between Total, Endo and retrovirus expression (Trans) genes.

(25) FIG. 24 shows the results of analyzing the promoter methylation patterns of Oct4 and Nanog transcription factors in the reprogrammed stem cells (RSC133-iPS) induced from human skin fibroblasts by addition of RSC-133, H9 human embryonic stem cells (hESs) and human skin somatic cells (hFFs) induced from human skin fibroblasts by addition of RSC-133. The horizontal row of circles indicates an individual sequence from one amplicon. The empty circles and the black circles indicate demethylated and methylated CpG, respectively, and the percentage (%) of methylated CpG is shown.

(26) FIG. 25 shows the results of analyzing the integration of genes into the genome of reprogrammed stem cells (RSC133-iPS) reprogrammed from human skin fibroblasts by addition of RSC-133.

(27) FIG. 26 shows that reprogrammed stem cells (RSC133-iPS) reprogrammed from human skin fibroblasts by addition of RSC-133 maintained a normal karyotype (46, XY).

(28) FIG. 27 is a set of photographs showing teratoma formation that demonstrates the in vivo differentiation potential of reprogrammed stem cells (RSC133-iPS) reprogrammed from human skin fibroblasts by addition of RSC-133.

(29) FIG. 28 shows the results of examining the function of RSC-133 that is involved in the acquisition of pluripotency. It was observed that, when H9 human embryonic stem cells (hESs) were cultured in unconditioned medium (UM), the differentiation thereof was induced, but when the cells were cultured in UM containing RSC-133, the degree of induced differentiation was inhibited, and pluripotency was acquired again. The efficiency of acquisition of pluripotency was measured by calculating the number of colonies showing AP activity. The values shown on the graph are mean values. The data are expressed as meanSD (n=3) (*P<0.01, **P<0.005, by t-test).

(30) FIG. 29 shows the results of Western blot analysis performed to examine the change in amount of the pluripotency-specific markers Oct4 or H3K9ace in H9 human embryonic stem cells cultured in the presence or absence of RSC-133. Human skin fibroblasts (hFFs) were used as a negative control group. H3 and GAPDH proteins were used as internal controls.

MODE FOR INVENTION

(31) Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1

Group of Low-Molecular-Weight Compounds

(32) 1-1. Method for Synthesis of Low-Molecular-Weight Compounds

(33) Low-molecular-weight compounds, including RSC-133 (3-(3-1H-indol-3-yl-acryloylamino)-benzamide), were synthesized by the method shown in the following reaction scheme 1:

(34) ##STR00003## ##STR00004##

(35) The reactants and reaction conditions in reaction scheme 1 are as follows: a) 2a is H.sub.2SO.sub.4; 2b to 2e are i) SOCl.sub.2, MeOH; ii) BnBr, K.sub.2CO.sub.3, DMF; iii) LiOH, THF, H.sub.2O; iv) NH.sub.4Cl, EDC, HOBt, DIPEA, DMF (2b); NH.sub.2CH.sub.3, NH.sub.2CH(CH.sub.3).sub.2, or NH(CH.sub.3).sub.2, 50% PPAA, Et.sub.3N, acetonitrile (2c-e); b) H.sub.2, 5% Pd/C, MeOH; c) 5a to 5b are NH.sub.2CH.sub.3, or NH(CH.sub.3).sub.2, 50% PPAA, Et.sub.3N, acetonitrile; d) H.sub.2, 10% Pd/C, MeOH; e) EDC, HOAt, or HOBt, DIPEA, DMF; PyBOP, DIPEA, DMF; DCC, DIPEA, THF; f) LiOH, THF/H.sub.2O; g) 10a to 10c are furfuryamine, 2-piperidin-1-yl-ethylamine, or 3-morpholin-4-yl-propylamine, HATU, DIPEA, DMF; 10d is 2-bromopropane, ionic liquid, DMF.

(36) In this synthesis process, all commercial compounds were grade-1 reagents and were used without additional purification. Solutions were dried according to standard procedures. All reactions were performed in a flame-dried glass apparatus in an atmosphere of dry argon at a pressure of 1 atm. Quantum nuclear magnetic resonance (1H-NMR) spectra were measured in Varian (400 MHz or 300 MHz) spectrometer. Unless otherwise specified, materials resulting from all reactions were purified either by flash column chromatography using silica gel 60 (230-400 mesh Kieselgel 60) or by thin layer chromatography using glass-backed silica gel plates (1 mm thickness). In addition, reactions were monitored by thin layer chromatography on 0.25 mm silica plates (E. Merck, silica gel 60 F254). Chromatograms were visualized by exposure to iodine vapor and immersion in PMA or Hanessian solution, followed by exposure to UV light. Isopropyl 4-hydroxy-3-nitrobenzoate corresponding to compound 2a in the above reaction scheme was prepared in the following manner. First, sulfuric acid (98% H.sub.2SO.sub.4) was added dropwise to a solution of 4-hydroxy-3-nitrobenzoic acid (2.0 g, 10.9 mmol) in 2-propylalcohol (25 mL) at 0 C., and the solution was refluxed in the presence of argon for 48 hours. After completion of the reaction, the reaction mixture was concentrated under reduced pressure. The resulting material was purified by silica gel column chromatography (n-hexane: EtOAc=5:1) to afford 2.11 g of isopropyl 4-hydroxy-3-nitrobenzoate (2a) as a yellow solid. .sup.1H NMR (CDCl.sub.3, 300 MHz) =10.87 (s, 1H), 8.79 (d, J=1.2 Hz, 1H), 8.23 (dd, J=1.8 Hz, 8.7 Hz, 1H), 7.22 (t, J=11.7 Hz, 1H), 5.30 (s, 2H), 5.26 (m, 1H), 1.38 (d, J=6.6 Hz, 6H).

(37) 4-Benzyloxy-3-nitrobenzamide corresponding to compound 2b in the above reaction scheme was prepared in the following manner. First, to a solution of 4-benzyloxy-3-nitrobenzoic acid 1-3 (1 g, 3.6 mmol) and ammonium chloride (294 mg, 5.5 mmol) in DMF (15 mL), EDC (842 mg, 4.4 mmol), HOBt (593 mg, 4.4 mmol) and DIPEA (1.6 mL, 9.15 mmol) were added. The reaction solution was stirred overnight at room temperature and cooled with water, followed by extraction with EA. The resulting material was purified by silica gel column chromatography (n-hexane:EA=7:3) to afford the desired compound (980 mg). .sup.1H NMR (CDCl.sub.3, 400 MHz) =8.39 (d, J=2.4 Hz, 1H), 8.08 (dd, J=2.0 Hz, 8.4 Hz, 1H), 7.32-7.46 (m, 5H), 7.16 (d, J=8.8 Hz, 1H), 5.30 (s, 2H).

(38) Amide compounds 2c to 2e in the above reaction scheme were prepared in the following manner. 4-benzyloxy-3-nitrobenzoic acid (500 mg, 1.0 equiv) was suspended in acetonitrile and Et.sub.3N (4.0 equiv), and 50% PPAA (1.2 equiv) was added thereto. The mixture was stirred at room temperature for 30 minutes, and each of suitable amines was added thereto. Then, the reaction solutions were stirred overnight, and then dried by evaporation. The resulting materials were purified by column chromatography to afford compounds 2c-2e.

(39) 1) 4-Benzyloxy-N-methyl-3-nitrobenzamide (2c) was obtained as a white solid. .sup.1H NMR (CDCl.sub.3, 300 MHz) =8.24 (d, J=2.1 Hz, 1H), 7.99 (dd, J=2.4 Hz, 9.0 Hz, 1H), 7.34-7.46 (m, 5H), 7.17 (d, J=8.7 Hz, 1H), 6.14 (br s, 1H), 5.30 (s, 2H), 3.02 (d, J=5.1 Hz, 3H).

(40) 2) 4-Benzyloxy-N-isopropyl-3-nitrobenzamide (2d) was obtained as a white solid. .sup.1H NMR (CDCl.sub.3, 300 MHz) =8.21 (d, J=2.1 Hz, 1H), 7.99 (dd, J=2.1 Hz, 8.7 Hz, 1H), 7.32-7.46 (m, 5H), 7.16 (d, J=8.7 Hz, 1H), 5.89 (d, J=7.2 Hz, 1H), 5.30 (s, 2H), 4.27 (m, 1H), 1.27 (d, J=6.6 Hz, 6H).

(41) 3) 4-Benzyloxy-N,N-dimethyl-3-nitrobenzamide (2e) was obtained as a white solid. .sup.1H NMR (CDCl.sub.3, 300 MHz) =7.96 (d, J=1.5 Hz, 1H), 7.63 (dd, J=2.1 Hz, 8.7 Hz, 1H), 7.34-7.46 (m, 5H), 7.15 (d, J=8.7 Hz, 1H), 5.28 (s, 2H), 3.07 (br s, 6H).

(42) Compounds 2a to 2e were reduced in the following manner to prepare compounds 3a to 3e. Each of compounds 2a to 2e was dissolved in anhydrous MeOH, and then 5% palladium carbon was added thereto under an argon atmosphere. Each of the reaction solutions was stirred overnight in a hydrogen atmosphere and filtered through a celite pad, and the filtrates were concentrated without additional purification to obtain crude products.

(43) 1) Isopropyl 3-amino-4-hydroxybenzoate (3a) was obtained as a light yellow solid from compound 2a. .sup.1H NMR (CDCl.sub.3, 300 MHz) =7.43 (s, 1H), 7.38 (d, J=8.7 Hz, 1H), 6.74 (d, J=8.1 Hz, 1H), 5.19 (m, 1H), 1.33 (d, J=6.6 Hz, 6H).

(44) 2) 3-Amino-4-hydroxybenzamide (3b) was obtained as a brown semi-solid from compound 2b. .sup.1H NMR (DMSO-d6, 400 MHz) =7.48 (s, 1H), 7.11 (d, J=8.7 Hz, 1H), 6.95 (dd, J=2.0 Hz, 8.4 Hz, 1H), 6.84 (br s, 1H), 6.61 (d, J=8.4 Hz, 1H).

(45) 3) 3-Amino-4-hydroxy-N-methylbenzamide (3c) was obtained as a light yellow solid from compound 2c. .sup.1H NMR (DMSO-d6, 300 MHz) =7.96 (d, J=4.5 Hz, 1H), 7.10 (d, J=2.1 Hz, 1H), 6.92 (dd, J=2.1 Hz, 8.1 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.61 (br s, 2H), 2.70 (d, J=4.5 Hz, 3H).

(46) 4) 3-Amino-4-hydroxy-N-isopropylbenzamide (3d) was obtained as a light yellow solid from compound 2d. .sup.1H NMR (DMSO-d6, 300 MHz) =7.73 (d, J=8.1 Hz, 1H), 7.10 (d, J=1.5 Hz, 1H), 6.94 (dd, J=2.1 Hz, 8.1 Hz, 1H), 6.62 (d, J=7.8 Hz, 1H), 4.60 (br s, 2H), 4.03 (m, 1H), 1.11 (d, J=6.6 Hz, 6H).

(47) 5) 3-Amino-4-hydroxy-N,N-dimethylbenzamide (3e) was obtained as a light yellow solid from compound 2e. .sup.1H NMR (DMSO-d6, 300 MHz) =9.36 (b, 1H), 6.65 (d, J=1.5 Hz, 1H), 6.63 (d, J=8.4 Hz, 1H), 6.46 (dd, J=2.1 Hz, 7.8 Hz, 1H), 4.64 (br s, 2H), 2.92 (s, 6H).

(48) Amide compounds 5a to 5b in the above reaction scheme were prepared in the following manner. 3-Nitrobenzoic acid (400 mg, 1.0 equiv) was suspended in acetonitrile and Et.sub.3N (4.0 equiv), and 50% PPAA (1.2 equiv) was added thereto. The mixture was stirred at room temperature for 30 minutes, and each of suitable amines was added thereto. Then, the reaction solutions were stirred overnight, and then dried by evaporation. The resulting materials were purified by column chromatography to afford compounds 5a-5b.

(49) 1) N-methyl-3-nitrobenzamide (5a) was obtained as a white solid. .sup.1H NMR (CDCl.sub.3, 400 MHz) =8.58 (s, 1H), 8.35-8.37 (m, 1H), 8.16 (d, J=8.0 Hz, 1H), 5.19 (t, J=7.6 Hz 1H), 6.23 (br s, 1H), 3.07 (d, J=4.8 Hz).

(50) 2) N,N-dimethyl-3-nitrobenzamide (5b) was obtained as a white solid. .sup.1H NMR (CDCl.sub.3, 400 MHz) =8.29 (s, 1H), 8.27 (d, J=2.4 Hz, 1H), 7.77 (d, J=7.6 Hz, 1H), 7.62 (t, J=7.6 Hz 1H), 3.15 (s, 3H), 3.01 (s, 3H).

(51) Meanwhile, methyl 3-aminobenzoate (6a) and 3-aminobenzamide (6b) are commercially available.

(52) Compound 5a or 5b was reduced in the following manner to prepare compound 6c or 6d. Nitrogen-substituted compound 5a or 5b was dissolved in anhydrous MeOH, and 5% palladium carbon was added thereto under an argon atmosphere. The reaction solution was stirred overnight in a hydrogen atmosphere and filtered through a celite pad, and the filtrate was purified without additional purification to obtain a crude product.

(53) 1) 3-Amino-N-methylbenzamide (6c) was obtained as a white solid from compound 5a. .sup.1H NMR (DMSO-d6, 400 MHz) =8.13 (d, J=4.0 Hz, 1H), 6.99-7.05 (m, 2H), 6.89 (d, J=7.2 Hz, 1H), 6.62-6.65 (m, 1H), 5.17 (s, 2H), 2.71 (d, J=4.8 Hz, 3H).

(54) 2) 3-Amino-N,N-dimethylbenzamide (6d) was obtained as a white solid from compound 5b. .sup.1H NMR (DMSO-d6, 400 MHz) =7.02 (t, J=7.6 Hz, 1H), 6.55-6.58 (m, 1H), 6.51 (s, 1H), 6.43 (d, J=7.6 Hz, 1H), 5.18 (s, 2H), 2.89 (d, J=11.6 Hz, 6H).

(55) The above-prepared compounds 3a to 3e or compounds 6a to 6d were reacted with trans-3-indoleacrylic acid (7a) or 3-(1H-indole-3-yl)-propionic acid (7b) to obtain compounds 8a to 8j, compound 9 and compounds 10a to 10d as shown in the above reaction scheme. Methods for preparing these compounds will be described in detail below.

(56) 1-2. Method for Synthesis of Low-Molecular-Weight Compound RSC-133 (8b)

(57) Among the above-described low-molecular-weight compounds, RSC-133 (3-[3-(1H-indol-3-yl)-acrylamido]-benzamide (8b)) was synthesized in the following manner.

(58) First, trans-3-indoleacrylic acid (7a) and 3-amino-benzamide (6b) were dissolved in DMF, and benzotriazol-1-yl-N-oxy-tris(pyrrolidino)-phosphonium hexafluorophosphate (PyBOP) and N,N-diisopropylethylamine (DIPEA) were added to the solution to perform a coupling reaction. The reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-benzamido (RSC-133) as a yellow solid. The chemical characteristics and purity of RSC-133 were analyzed by .sup.1H NMR (FIG. 6) and HPLC (FIG. 7). .sup.1H NMR (CDCl.sub.3, 300 MHz) d=8.90 (s, 1H), 8.21 (s, 1H), 7.86-8.03 (m, 4H), 7.76 (d, J=8.1 Hz, 1H), 7.36-7.41 (m, 3H), 7.20 (m, 2H), 6.60 (d, J=15.3 Hz, 2H), 3.88 (s, 3H).

(59) RSC-133 (3-[3-(1H-indol-3-yl)-acrylamido]-benzamide) synthesized in this Example has a structure of the following formula 2:

(60) ##STR00005##

(61) 1-3. Synthesis of Low-Molecular-Weight Compound ID-52 (8a)

(62) Among the above-described low-molecular-weight compounds, ID-52 (3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid methyl ester (8a)) was prepared in the following manner. Trans-3-indoleacrylic acid (7a, 150 mg, 0.8 mmol) and 3-amino-benzoic acid methyl ester (6a, 218 mg, 1.44 mmol) were dissolved in DMF, and 1-[3-(dimethyamino)propyl]-3-ethylcarbodiimide hydrochloride (EDC, 230 mg, 1.2 mmol), hydroxy-7-azabenotriazole (HOAT, 163 mg, 1.2 mmol) and N,N-diisopropylethylamine (DIPEA, 0.21 mL, 1.2 mmol) were added to the solution to cause a coupling reaction. The reaction solution was stirred overnight at room temperature. Then, the resulting material was separated and purified to obtain 3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid methyl ester (ID-52) as a yellow solid. .sup.1H NMR (CDCl.sub.3, 300 MHz) d=8.90 (s, 1H), 8.21 (s, 1H), 7.86-8.03 (m, 4H), 7.76 (d, J=8.1 Hz, 1H), 7.36-7.41 (m, 3H), 7.20 (m, 2H), 6.60 (d, J=15.3 Hz, 2H), 3.88 (s, 3H).

(63) 1-4. Synthesis of Low-Molecular-Weight Compound ID-1027 (8c)

(64) Among the above-described low-molecular-weight compounds, ID-1027 (3-[3-(1H-indol-3-yl)-acrylamido]-N-methylbenzamide (8c)) was prepared in the following manner. Trans-3-indoleacrylic acid (7a, 300 mg, 1.6 mmol) and 3-amino-N-methylbenzamide (6c, 240 mg, 1.6 mmol) were dissolved in DMF, and PyBOP (1.7 g, 3.2 mmol) and DIPEA (0.84 mL, 4.8 mmol) were added thereto. The reaction solution was stirred overnight at room temperature and fractionated with EA and brine. The organic phase fraction was dried with MgSO.sub.4 and concentrated. The resulting material was purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-N-methylbenzamide as a yellow solid. .sup.1H NMR (CD.sub.3OD, 400 MHz) d=8.08 (s, 1H), 7.98 (d, J=15.2 Hz, 1H), 7.91 (d, J=8.0 Hz, 1H), 7.88 (dd, J=1.6 Hz, J=8.4 Hz, 1H), 7.69 (s, 1H), 7.45-7.47 (m, 2H), 7.21-7.27 (m, 2H), 6.78 (d, J=15.6 Hz, 1H).

(65) 1-5. Synthesis of Low-Molecular-Weight Compound ID-1028 (8d)

(66) Among the above-described low-molecular-weight compounds, ID-1028 (3-[3-(1H-indol-3-yl)-acrylamido]-N,N-dimethylbenzamide (8d) was prepared in the following manner. Trans-3-indoleacrylic acid (7a, 300 mg, 1.6 mmol) and 3-amino-N,N-dimethylbenzamide (6d, 262.7 mg, 1.6 mmol) were dissolved in DMF, and PyBOP (1.7 g, 3.2 mmol) and DIPEA (0.84 mL, 4.8 mmol) were added thereto. The reaction solution was stirred overnight at room temperature and fractionated with EA and brine. The organic phase fraction was dried with MgSO.sub.4 and concentrated. The residue was purified to afford 3-[3-(1H-indol-3-yl)-acrylamido]-N,N-dimethylbenzamide as a yellow solid. .sup.1H NMR (CD.sub.3OD, 400 MHz) d=7.96 (d, J=8.0 Hz, 1H), 7.92 (d, J=16.0 Hz, 1H), 7.84 (s, 1H), 7.73 (d, J=7.6 Hz, 1H), 7.64 (s, 1H), 7.40-7.45 (m, 2H), 7.18-7.25 (m, 2H), 7.13 (d, J=7.6 Hz, 1H), 6.78 (d, J=15.6 Hz, 1H), 3.11 (s, 3H), 3.04 (s, 3H).

(67) 1-6. Synthesis of Low-Molecular-Weight Compound ID-134 (8e)

(68) Among the above-described low-molecular-weight compounds, ID-134 (3-[3-1H-indol-3-yl-propionylamino]benzamide (8e) was prepared in the following manner. 3-(1H-indol-3-yl)-propionic acid (7b, 189 mg, 1.0 mmol) and 3-amino-benzamide (6b, 68.1 mg, 0.5 mmol) were dissolved in DMF, and PyBOP and DIPEA were added to the solution to perform a coupling reaction. The reaction solution was stirred overnight at room temperature. Then, the resulting material was separated and purified to obtain 3-[3-1H-indol-3-yl-propionylamino]benzamide (ID-134) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d=8.02 (s, 1H), 7.75 (d, J=7.8 Hz, 1H), 7.50 (m, 2H), 7.32 (m, 2H), 6.93-7.09 (m, 3H), 3.04 (t, J=7.8 Hz, 2H), 2.68 (t, J=7.2 Hz, 2H).

(69) 1-7. Synthesis of Low-Molecular-Weight Compound ID-514 (8f)

(70) The low-molecular-weight compound ID-514 (isopropyl 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxybenzoate (8f)) was prepared in the following manner. Trans-3-indoleacrylic acid (7a, 188 mg, 1.01 mmol) and isopropyl 3-amino-4-hydroxybenzoate (3a, 295 mg, 1.51 mmol) were dissolved in DMF, and EDC (290 mg, 1.51 mmol) and 1-hydroxybenzotriazole hydrate (HOBt, 204 mg, 1.51 mmol) were added thereto. The reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain isopropyl 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxybenzoate (ID-514) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 300 MHz) d=11.65 (s, 1H), 11.07 (s, 1H), 9.60 (s, 1H), 8.65 (d, J=1.5 Hz, 1H), 8.11 (d, J=6.6 Hz, 1H), 7.83 (d, J=2.1 Hz, 1H), 7.79 (d, J=15.3 Hz, 1H), 7.57 (dd, J=1.5 Hz, 8.1 Hz, 1H), 7.47 (d, J=7.5 Hz, 1H), 7.19-7.25 (m, 2H), 7.12 (d, J=15.3 Hz, 1H), 6.96 (d, J=8.1 Hz, 1H), 5.10 (m, 1H), 1.31 (d, J=6.6 Hz, 6H).

(71) 1-8. Synthesis of Low-Molecular-Weight Compound ID-1029 (8g)

(72) The low-molecular-weight compound ID-1029 (3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxybenzamide (8g)) was prepared in the following manner. Trans-3-indoleacrylic acid (7a, 300 mg, 1.6 mmol) and 3-amino-4-hydroxybenzamide (3b, 243 mg, 1.6 mmol) were dissolved in DMF, and PyBOP (1.7 g, 3.2 mmol) and DIPEA (0.84 mL, 4.8 mmol) were added thereto. The reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxybenzamide (ID-1029) as a yellow solid. .sup.1H NMR (CD.sub.3OD, 400 MHz) d=8.08 (s, 1H), 7.98 (d, J=15.2 Hz, 1H), 7.91 (d, J=8.0 Hz, 1H), 7.88 (dd, J=1.6 Hz, J=8.4 Hz, 1H), 7.69 (s, 1H), 7.45-7.47 (m, 2H), 7.21-7.27 (m, 2H), 6.78 (d, J=15.6 Hz, 1H).

(73) 1-9. Synthesis of Low-Molecular-Weight Compound ID-557 (8h)

(74) The low-molecular-weight compound ID-557 (3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N-methylbenzamide (8h)) was prepared in the following manner. DCC (220 mg, 1.07 mmol) and DIPEA (0.2 mL, 1.07 mmol) were added to a solution of trans-3-indoleacrylic acid (7a, 100 mg, 0.53 mmol) in THF. The reaction solution was stirred at room temperature for 30 minutes while 3-amino-4-hydroxy-N-methylbenzamide (3c, 106 mg, 0.64 mmol) was added thereto. The reaction solution was stirred overnight. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N-methylbenzamide (ID-557) as a yellow solid. .sup.1H NMR (acetone-d.sub.6, 300 MHz) d=10.88 (b, 1H), 9.61 (b, 1H), 8.03 (d, J=15.6 Hz, 1H), 8.02 (d, J=2.4 Hz, 1H), 7.94 (d, J=2.1 Hz, 2H), 7.87 (d, J=2.4 Hz, 2H), 7.52-7.59 (m, 3H), 7.20-7.28 (m, 2H), 7.08 (d, J=15.3 Hz, 1H), 6.93 (d, J=8.1 Hz, 1H), 3.62 (q, J=6.6 Hz, 1H), 2.88 (d, J=4.5 Hz, 3H).

(75) 1-10. Synthesis of Low-Molecular-Weight Compound ID-556 (8i)

(76) The low-molecular-weight compound ID-556 (3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N-isopropylbenzamide (8i)) was prepared in the following manner. DCC (220 mg, 1.07 mmol) and DIPEA (0.2 mL, 1.07 mmol) were added to a solution of trans-3-indoleacrylic acid (7a, 100 mg, 0.53 mmol) in THF. The mixture was stirred at room temperature for 30 minutes while 3-amino-4-hydroxy-N-isopropylbenzamide (3d, 124 mg, 0.64 mmol) was added thereto. The reaction solution was stirred overnight. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N-isopropylbenzamide (ID-556) as a yellow solid. .sup.1H NMR (acetone-d.sub.6, 300 MHz) d=10.95 (b, 1H), 10.89 (b, 1H), 9.61 (b, 1H), 8.02 (d, J=15.6 Hz, 1H), 8.01 (s, 1H), 7.88 (t, J=3.0 Hz, 2H), 7.59 (dd, J=2.1 Hz, 8.7 Hz, 1H), 7.54 (dd, J=2.1 Hz, 6.6 Hz, 1H), 7.20-7.28 (m, 3H), 7.08 (d, J=15.3 Hz, 1H), 6.91 (d, J=8.1 Hz, 1H), 4.21 (m, 1H), 1.22 (d, J=6.6 Hz, 6H).

(77) 1-11. Synthesis of Low-Molecular-Weight Compound ID-558 (8j)

(78) The low-molecular-weight compound ID-558 (3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N,N-dimethylbenzamide (8j)) was prepared in the following manner. DCC (220 mg, 1.07 mmol) and DIPEA (0.2 mL, 1.07 mmol) were added to a solution of trans-3-indoleacrylic acid (7a, 100 mg, 0.53 mmol) in THF. The mixture was stirred at room temperature for 30 minutes while 3-amino-4-hydroxy-N,N-dimethylbenzamide (3e, 116 mg, 0.64 mmol) was added thereto. The reaction solution was stirred overnight. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-4-hydroxy-N,N-dimethylbenzamide (ID-558) as a yellow solid. .sup.1H NMR (acetone-d.sub.6, 300 MHz) d=10.85 (b, 1H), 9.51 (b, 1H), 8.01 (d, J=15.3 Hz, 1H), 7.99-8.02 (m, 1H), 7.86 (d, J=2.1 Hz, 1H), 7.58 (d, J=2.1 Hz, 1H), 7.52-7.55 (m, 1H), 7.21-7.28 (m, 2H), 7.17 (dd, J=1.8 Hz, 8.1 Hz, 1H), 7.03 (d, J=15.6 Hz, 1H), 6.93 (d, J=8.1 Hz, 1H), 3.02 (s, 6H).

(79) 1-12. Synthesis of Low-Molecular-Weight Compound ID-116 (9)

(80) The low-molecular-weight compound ID-116 (3-[3-(1H-indol-3-yl)-acrylamido]benzoic acid) was prepared in the following manner. 3-[3-(1H-indol-3-yl)-acrylamido]-benzoate (8a, 188 mg, 0.59 mmol) was dissolved in THF/H.sub.2O (1:1, 10 mL), and LiOH.H.sub.2O (49.3 mg, 1.17 mmol) was added thereto at room temperature. The reaction solution was stirred overnight at room temperature, after which it was acidified with hydrochloric acid and extracted with ethyl acetate (EA). The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]benzoic acid as a white solid. .sup.1H NMR (CD.sub.3OD, 300 MHz) d=8.53 (s, 1H), 7.90-7.96 (m, 3H), 7.74 (d, J=7.8 Hz, 1H), 7.58 (s, 1H), 7.41 (m, 2H), 7.19 (m, 2H), 6.78 (d, J=15 Hz, 1H).

(81) 1-13. Synthesis of Low-Molecular-Weight Compound ID-263 (10a)

(82) The low-molecular-weight compound ID-263 (3-[3-(1H-indol-3-yl)-acrylamido]-Nuran-2-yl-methyl)benzamide) was prepared in the following manner. 3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid (9, 500 mg, 1.63 mmol) and furfurylamine (0.23 mL, 2.45 mmol) were dissolved in DMF, and DIPEA (0.43 mL, 2.45 mmol) and HATU (0-(7-azabenzotriazol-1-yl)-N,N,NN-tetramethyluronium hexafluorophosphate (931.6 mg, 2.45 mmol) were added thereto. Then, the reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain 3-[3-(1H-indol-3-yl)-acrylamido]-Nuran-2-yl-methyl)benzamide (ID-263) as a yellow solid. .sup.1H NMR (CD.sub.3OD, 300 MHz) d=8.13 (m, 1H), 7.96 (m, 2H), 7.82 (m, 1H), 7.63 (s, 1H), 7.52 (m, 1H), 7.39-7.45 (m, 3H), 7.20 (m, 2H), 6.78 (d, J=15.9 Hz, 1H), 6.32 (m, 2H), 4.56 (s, 2H).

(83) 1-14. Synthesis of Low-Molecular-Weight Compound ID-264 (10b)

(84) The low-molecular-weight compound ID-264 (3-(3-1H-indol-3-yl-acrylamino)-N-(2-piperidin-1-yl-ethyl)-benzamide) was prepared in the following manner. 3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid (9, 150 mg, 0.49 mmol) and 2-piperidin-1-yl-erthylamine (0.10 mL, 0.73 mmol) were dissolved in DMF, and HATU (277.6 mg, 0.73 mmol) and DIPEA (0.13 mL, 0.73 mmol) were added thereto. The reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain 3-(3-1H-indol-3-yl-acryloylamino)-N-(2-piperidin-1-yl-ethyl)-benzamide (ID-264) as a yellow solid. .sup.1H NMR (DMSO-d.sub.3, 300 MHz) d=11.67 (b, 1H), 10.16 (s, 1H), 8.41 (s, 1H), 8.11 (s, 1H), 7.76-7.98 (m, 4H), 7.38-7.50 (m, 3H), 7.23 (m, 2H), 6.84 (d, J=15.9 Hz, 1H) 3.33-3.43 (m, 6H), 2.51 (m, 2H), 1.41-1.54 (m, 6H).

(85) 1-15. Synthesis of Low-Molecular-Weight Compound ID-265 (10c)

(86) The low-molecular-weight compound ID-265 (3-(3-1H-indol-3-yl-acrylamino)-N-(3-morpholin-4-yl-propyl)-benzamide) was prepared in the following manner. 3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid (9, 150 mg, 0.49 mmol) and 3-morpholin-4-yl-propylamine (0.11 mL, 0.73 mmol) were dissolved in DMF, and HATU (277.6 mg, 0.73 mmol) and DIPEA (0.13 mL, 0.73 mmol) were added thereto. The reaction solution was stirred overnight at room temperature. The resulting material was separated and purified to obtain 3-(3-1H-indol-3-yl-acryloylamino)-N-(3-morpholin-4-yl-propyl)-benzamide (ID-265) as a yellow solid. .sup.1H NMR (DMSO-d.sub.3, 300 MHz) d=11.66 (b, 1H), 10.14 (s, 1H), 8.46 (ps-t, J=5.4 Hz, 1H), 8.09 (s, 1H), 7.76-7.98 (m, 4H), 7.37-7.50 (m, 3H), 7.22 (m, 2H), 6.82 (d, J=15.9 Hz, 1H), 3.55-3.59 (m, 4H), 3.27 (m, 1H), 3.16 (d, J=15.9 Hz, 1H), 2.31-2.36 (m, 6H) 1.69 (m, 2H).

(87) 1-16. Synthesis of Low-Molecular-Weight Compound ID-517 (10d)

(88) The low-molecular-weight compound ID-517 (isopropyl 3-[3-(1H-indol-3-yl)acrylamido]benzoate) was prepared in the following manner. 3-(3-1H-indol-3-yl-acryloylamino)-benzoic acid (9, 180 mg, 0.59 mmol) and ionic liquid (1.12 g, 1.47 mmol) were dissolved in DMF, and 2-bromopropane (144 mg, 1.18 mmol) and DIPEA (152 mg, 1.18 mmol) were added thereto. The reaction solution was heated at 60 C. for 2 days and cooled with water. The resulting material was separated and purified to obtain isopropyl 3-[3-(1H-indol-3-yl)acrylamido]benzoate (ID-517) as a light yellow solid. .sup.1H NMR (DMSO-d.sub.3, 300 MHz) d=11.68 (b, 1H), 10.22 (s, 1H), 8.27 (s, 1H), 8.03 (d, J=9.0 Hz, 1H), 7.94-7.98 (m, 1H), 7.85 (s, 1H), 7.80 (d, J=16.2 Hz, 1H), 7.62 (d, J=8.1 Hz, 1H), 7.47 (t, J=7.2 Hz, 2H), 7.19-7.26 (m, 2H), 6.81 (d, J=15.6 Hz, 1H), 5.16 (m, 1H), 1.34 (d, J=6.0 Hz, 6H).

Example 2

Culture of Human Embryonic Stem Cells and Reprogrammed Stem Cells

(89) Human embryonic stem cell (hESC) H9 (NIH Code, WA09; WiCell Research Institute, Madison, Wis.) and reprogrammed stem cells (hiPSC) were generally cultured in hESC culture medium (composed of 80% DMEM/F12, 20% knockout serum replacement (KSR, Invitrogen, Carlsbad, Calif.), 1% non-essential amino acids (NEAR, Invitrogen), 1 mM L-glutamine (Invitrogen), 0.1 mM -mercaptoethanol (Sigma, St. Louis, Mo.) and 6 ng/ml bFGF (basic fibroblast growth factor, Invitrogen)) on -irradiated MEFs (mouse embryonic fibroblasts). The cells were subcultured with 1 mg/ml collagenase IV (Invitrogen) at intervals of 5-6 days. Human newborn foreskin fibroblasts (hFF, ATCC, catalog number CRL-2097; American Type Culture Collection, Manassas, Va.) were cultured in DMEM containing 10% FBS (fetal bovine serum, Invitrogen), 1% non-essential amino acid, 1 mM L-glutamine and 0.1 mM -mercaptoethanol.

Example 3

Production of Retrovirus and Induction of hiPSC

(90) A pMXs vector comprising the human cDNA of OCT4(POU5F1), SOX2, c-MYC(MYC) and KlF4, as disclosed in Takahashi, K. et al. (Cell 131, 2007, 861-872), was purchased from Addgene. GP2-293 packaging cells were transfected with retroviral vector DNA and a VSV-G envelop vector using the CalPhos transfection kit. At 24 hours after the transfection, the supernatant containing the first virus was collected, and then the medium was replaced, and after 48 hours, the supernatant containing the second virus was collected.

(91) For production of iPSC, human skin fibroblasts (hFFs) and mouse embryonic fibroblasts (MEFs) were seeded on gelatin-coated 6-well plates at a concentration of 110.sup.5 cells per well at one day before transfection and were transfected with virus in the presence of polybrene (8 g/ml). At 5 days after the transfection, hFFs or MEFs were collected by trypsin treatment and seeded again on Matrigel-coated 6-well plates at a concentration of 5 to 610.sup.4 cells per well in order to perform experiments in feeder-free conditions. The medium was replaced with MEF-CM medium containing 10 ng/ml of bFGF. MEF-CM was prepared as -irradiated MEF according to a known method (Xu C. Nat Biotechnol 19, 971-974), and 8 ng/ml bFGF was added to MEF-CM. The medium was replaced at 2-day intervals. At 20 days after the transfection, hESC-like colonies were collected and transferred to 12-well plates having MEFs as feeder cells, and then continuously cultured using the hESC culture method described in Example 2.

Example 4

Screening of Low-Molecular-Weight Compounds

(92) The OSKM reprogramming factor virus was produced according to the method of Example 3. In order to screen low-molecular-weight compounds that increase the efficiency of reprogramming, hFFs and mouse embryonic fibroblasts (OG2-MEF; hemizygous for the Oct4-GFP transgene) were seeded on gelatin-coated 6-well plates at a concentration of 110.sup.5 cells at one day before transfection, and then transfected with virus in the presence of polybrene (8 g/ml). At 5 days after the transfection, hFFs or MEFs were collected by trypsin treatment and seeded again on Matrigel- or gelatin-coated 12-well plates at a concentration of 3.510.sup.4 cells per well in order to perform experiments under feeder-free conditions. The medium was replaced with 10 ng/ml bFGF-containing MEF-CM or mouse embryonic stem cell culture medium, and then the prepared low-molecular-weight compounds that are trans-3-indoleacrylic based compounds were added at various concentrations. The culture medium containing each of the low-molecular-weight compounds was replaced at 2-day intervals. At 15 days after the transfection, the number of either colonies showing AP activity or colonies expressing endogenous Oct4 GFP fluorescence was measured to determine the efficiency of reprogramming.

Example 5

RNA Extraction, Reverse Transcription and PCR Analysis

(93) Total RNA was isolated from the produced cells using RNeasy Mini kit (Qiagen, Valencia, Calif.), and then reverse-transcribed using SuperScript First-strand synthesis system kit (Invitrogen) according to the manufacturer's instruction. Then, semi-quantitative RT-PCR was performed using platinum Tag SuperMix kit (Invitrogen) under the following conditions: initial denaturation at 94 C. for 3 min, and then 25-30 cycles, each consisting of 94 C. for 30 sec, 60 C. for 30 sec and 72 for 30 sec, followed by final extension at 72 C. for 10 min.

Example 6

Alkaline Phosphatase (ALP) Staining

(94) ALP staining was performed using a commercial ALP kit (Sigma) according to the manufacturer's instruction. Images of ALP-positive cells were recorded using HP Scanjet G4010. In addition, bight field images were obtained using an Olympus microscope (IX51, Olympus, Japan).

Example 7

Embryoid Body Differentiation

(95) In order to measure the potential of hESC differentiation, human embryoid bodies (hEBs) were cultured in hEB medium (DMEM/F12 containing 10% serum replacement) in non-tissue culture treated Petri dishes. After 5 days of growth in suspension, the embryoid bodies were transferred to gelatin-coated plates and cultured in hEBs. The cells attached to the bottom of the plate were allowed to stand under the above-described conditions for 15 days so as to differentiate while replacing the medium, if necessary.

Example 8

Immunocytochemistry

(96) For immunostaining, cells were seeded on Matrigel-coated 4-well Lab-Tek chamber slides (Nunc, Naperville, Ill.) and cultured for 5 days under the indicated conditions. The cells were fixed in 4% paraformaldehyde at room temperature for 15 minutes, and then washed with PBS/0.2% BSA. Next, the cells were passed through PBS/0.2% BSA/0.1% Triton X-100 for 15 minutes, and then incubated with 4% normal donkey serum (Molecular Probes, Eugene, Oreg., USA) in PBS/0.2% BSA at room temperature for 1 hour. The cells were diluted with PBS/0.2% BSA, and then reacted with primary antibody at 4 C. for 2 hours. After washing, the cells were reacted with FITC- or Alexa594-conjugated secondary antibody (Invitrogen) in PBS/0.2% BSA at room temperature for 1 hour. The cells were counter-stained with 10 g/ml DAPI. The chamber slide was observed with an Olympus microscope or an Axiovert 200M microscope (Carl Zeiss, Gottingen, Germany).

Example 9

Analysis of Promoter Methylation of Reprogramming Transcription Factors

(97) In order to verify the characteristics of human embryonic stem cells and induced pluripotent stem cells established using gene-transfected retrovirus, promoter methylation of Oct3/4 and Nanog that are human embryonic stem cell-specific transcription factors was analyzed. To extract genomic DNA, reprogrammed stem cells and human embryonic stem cells, cultured in human embryonic stem cell media for 6 days, were extracted using a DNA extraction kit (Qiagen Genomic DNA purification kit). Bisulfite sequencing was performed in three steps. In the first step, DNA was modified using sodium bisulfite, and in the second step, the gene region (generally promoter region) to be analyzed was amplified by PCR, and in the third step, the PCR product was sequenced to determine the degree of methylation of DNA. The DNA modification process using sodium bisulfite was performed using commercial EZ DNA Methylation Kit (Zymo Research). When DNA is treated with bisulfite, methylated cytosine does not change, whereas unmethylated cytosine is converted into uracil. Thus, when DNA is amplified by PCR using primers specific for the nucleotide sequences of cytosine and uracil, methylated DNA and unmethylated DNA can be distinguished from each other. The primers used are shown in Table 1 below.

(98) TABLE-US-00001 TABLE1 Gene Primer(Forward) Primer(Reverse) AccessionNo. Forbisulfatesequencing biOct4-1 ATTTGTTTTTTGGGTAGTTAAAGGT CCAACTATCTTCATCTTAATA NM_002701 (SEQIDNO:1) ACATCC(SEQIDNO:2) biOct4-2 GGATGTTATTAAGATGAAGATAGTTGG CCTAAACTCCCCTTCAAAATC NM_002701 (SEQIDNO:3) TATT(SEQIDNO:4) biNanog TGGTTAGGTTGGTTTTAAATTTTTG AACCCACCCTTATAAATTCTC NM_024865 (SEQIDNO:5) AATTA(SEQIDNO:6)

(99) The PCR reaction mix consisted of 1 g bisulfite-treated DNA, 0.25 mM/l dNTP, 1.5 mM/l MgCl2, 50 pM primer, 1PCR buffer and 2.5 U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, Calif., USA) and had a final volume of 20 l. The PCR reaction was performed under the following conditions: initial denaturation at 95 C. for 10 min, and then 40 cycles, each consisting of 95 C. for 1 min, 60 C. for 1 min and 72 C. for 1 min, followed by final extension at 72 C. for 10 min. The PCR reaction product was electrophoresed on 1.5% agarose gel, and after gel electrophoresis, it was cloned into a pCR2.1-TOPO vector (Invitrogen). The nucleotide sequences of methylated and unmethylated DNAs were analyzed by sequencing using a M13 primer pair.

Example 10

Karyotype Analysis

(100) Cultured human reprogrammed stem cells were analyzed by G-banding. A representative image was obtained using ChIPS-Karyo (Chromosome Image Processing System, GenDix).

Example 11

Screening of Reprogramming Stimulating Compound (RSC) 133 that is Novel Low-Molecular-Weight Compound that Increases the Efficiency of Reprogramming of Mouse and Human Cells

(101) 11-1. Discovery of Mouse Cell Reprogramming Factor by Analog Library Screening of Novel Trans-3-Indoleacrylic Acid-Based Compounds

(102) To discover low-molecular-weight compounds that are involved in the reprogramming process, analog library screening of novel trans-3-indoleacrylic acid-based compounds was performed in mouse cells. Mouse embryonic fibroblasts (OG2-MEF: hemizygous for the Oct4-GFP transgene) were transfected with reprogramming viruses of Oct4, Sox2, Klf4 and c-Myc (OSKM), and after 5 days, the cells were seeded on gelatin-coated 12-well plates and incubated with mouse embryonic stem cell culture medium containing each of low-molecular-weight compounds until colonies having a morphology similar to that mouse stem cells were formed so that endogenous Oct4 GFP fluorescence was expressed (FIG. 1A). After 15 days, the number of colonies expressing endogenous Oct4 GFP fluorescence was measured to examine compounds that increased the efficiency of reprogramming compared to that of the control group, and as a result, it was shown that RSC-133 and ID-558 among the screened compounds showed the effect of increasing the efficiency of reprogramming (FIG. 1B). Based on the results of the primary screening, novel indole-acrylic acid/indole-propionic acid derivatives (reaction scheme 1) were prepared, and structure-activity relationship (SAR) for the reprogramming efficiency of the produced compounds was evaluated. It was found that, among the candidate compounds tested, indole-acrylic acid derivative compounds RSC-133 and ID-558 comprising an amino-free indole ring coupled to a benzoic acid derivative by a double bond showed the high reprogramming efficiency. In the benzoic acid derivative portion of the two compounds, RSC-133 comprises simple benzamide, and ID-558 comprises 4-hydroxy-N, N-dimethylbenzamide.

(103) According to previous reports, a DNA methyltransferase inhibitor (5-Azacytidine), a G9a histone methyltransferase inhibitor (BIX-01294) and a histone deacetylase inhibitor (Valproic acid; VPA), which are low-molecular-weight compounds, are known to promote the production of reprogrammed stem cells. Interestingly, treatment with the novel low-molecular-weight compound RSC-133 greatly increased the efficiency of reprogramming compared to treatment with the reported compounds or compared to when increasing the MOI value of OSKM reprogramming virus (FIG. 2a). The effect of RSC-133 on the promotion of reprogramming of human cells was 1.5-3.3 times higher than those of AZA, VPA, TSA and SB431542 that are compounds known to promote the production of iPSC (FIG. 2b).

(104) 11-2. Discovery of Reprogramming Regulators of Human Cells by Analog Library Screening of Novel Trans-3-Indoleacrylic Acid-Based Compounds

(105) To discover low-molecular-weight compounds that involved in the reprogramming of human somatic cells, reprogramming regulators of human skin fibroblasts were investigated by analog library screening of thirty selected novel trans-3-indoleacrylic acid-based compounds. Human skin fibroblasts were transfected with OSKM reprogramming virus, and after 5 days, the cells were seeded on Matrigel-coated 12-well plates and incubated in MEF-conditioned medium (CM) containing each of the low-molecular-weight compounds until colonies having a morphology similar to that of human embryonic stem cells were formed. After 15 days, alkaline phosphatase (AP) activity was measured to determine compounds that increased the efficiency of reprogramming compared to that of the control group, and as a result, it was found that RSC-133 increased the efficiency of reprogramming of human skin fibroblasts, similar to that of mouse embryonic fibroblasts (FIG. 3).

(106) 11-3. Examination of Effect of Novel Low-Molecular-Weight Compound 133 on Increase in Efficiency of Reprogramming of Human Skin Fibroblasts

(107) The novel low-molecular-weight compound 133 showed the effect of increasing the efficiency of reprogramming of human skin fibroblasts not only in normal conditions (21% 02), but also hypoxic conditions (5% O.sub.2), compared to the control group (FIG. 4). The efficiency of reprogramming increases in hypoxic conditions (5% O.sub.2), and the novel compound 133 could exhibit a synergistic effect in the reprogramming process stimulated by such hypoxic conditions (5% O.sub.2) (FIG. 4A) and could form reprogrammed stem cell colonies (FIG. 4B).

(108) Meanwhile, examination was carried out to determine whether the novel low-molecular-weight compound 133 can substitute for an existing reprogramming factor (c-Myc) when the reprogramming of human skin fibroblasts is induced by the addition of the compound 133. It is known that c-Myc is an oncogene and the re-expression of c-Myc virus gene in reprogrammed stem cells formed after induction of reprogramming is involved in carcinogenesis. For this reason, studies on reprogramming methods excluding c-Myc have received attention. Interestingly, RSC-133 alone did not show the substituting effect, but the addition of RSC-133 in combination with sodium butyrate (NaB) substituted for c-Myc factor to increase the efficiency of reprogramming compared to that of the control group (FIG. 5). In conclusion, it was found that the novel low-molecular-weight compound RSC-133 is a factor that increases the efficiency of reprogramming of mouse and human cells.

Example 12

Examination of Effect of Reprogramming Factor RSC-133 on Concentration-Dependent Induction of Reprogramming

(109) Whether the effect of RSC-133 on the increase in the efficiency of reprogramming is dependent on the amount of RSC-133 added was examined. Specifically, human skin fibroblasts were transfected with OSKM virus, and then, according to the experimental method shown in FIG. 8, whether RSC-133 increases the efficiency of reprogramming in a manner dependent on the concentration thereof in a culture medium for reprogramming was examined. The efficiency of reprogramming was determined by measuring the number of colonies showing AP activity. As a result, it could be seen that RSC-133 could increase the efficiency of reprogramming in a concentration-dependent manner at a treatment concentration of up to 10 M (FIG. 8). The reason why the efficiency of reprogramming did not increase at 20 M is not that a high concentration of RSC-133 induces the cytotoxicity of human skin fibroblasts (FIG. 9). Thus, it can be seen that 10 M of RSC-133 can increase the efficiency of reprogramming of human skin fibroblasts to the highest level.

Example 13

Examination of Reprogramming Process in which RSC-133 is Involved and Establishment of Efficient Reprogramming Using the Same

(110) In order to examine the role of RSC-133 that is involved in the reprogramming process of human skin fibroblasts, RSC-133 was added during different periods of time in the reprogramming process as shown in the left panel of FIG. 10. The efficiency of reprogramming was determined by counting the number of colonies showing AP activity. As a result, when the cells were treated with RSC-133 for the same period of time (5, 10 and 15 days) and when the cells were treated with RSC-133 in the initial stage (including 5 days after viral infection) of the reprogramming process, the efficiency of reprogramming could be significantly increased compared to those in other periods of time. However, when treatment with RSC-133 was continuously performed throughout the reprogramming process, the efficiency of reprogramming was increased to the highest level (condition 1 in FIG. 10). Thus, it can be seen that, although RSC-133 is involved in the initial stage of reprogramming, continuous treatment with RSC-133 increases the efficiency of reprogramming to the highest level, suggesting that RSC-133 is involved not only in the induction of reprogramming, but also in the maintenance of reprogrammed stem cells.

Example 14

Effect of RSC-133 on Promotion of Cell Growth

(111) Recent reports indicated that the promotion of cell growth leads to an increase in the efficiency of reprogramming. In addition, the growth rate of cells is associated with the self-renewal ability of embryonic stem cells. Thus, whether the novel compound RSC-133 can promote cell growth during reprogramming was examined. As a result, it could be seen that when reprogramming was induced while the cells were treated with RSC-133, the growth rate of the cells increased by about 1.7 times compared to that of the control group (FIG. 11). In addition, even when reprogramming was not induced, RSC-133 showed a function of increasing the growth rate of human skin fibroblasts (FIG. 12). In other words, in human skin fibroblasts or human skin fibroblasts which were transfected with reprogramming factor (OSKM) virus but the reprogramming of which was not induced, treatment with RSC-133 increased the growth of the cells (FIG. 12). Meanwhile, whether RSC-133 can increase proliferating cell population was examined by immunocytochemical analysis using a monoclonal antibody for bromodeoxyuridine (BrdU). The results of the analysis indicated that, during the reprogramming process (FIGS. 13 and 16) and in human skin fibroblasts which were transfected with reprogramming factor (OSKM) virus but the reprogramming of which was not induced (FIG. 14), treatment with RSC-133 increased BrdU-positive cell population. This suggests that RSC-133 can promote cell growth to increase the efficiency of reprogramming.

Example 15

Examination of Reprogramming Process Stimulated by RSC-133

(112) In order to examine whether RSC-133 can increase the rate of reprogramming, the relative levels of mRNA expressed during the reprogramming process were measured. Specifically, according to the experimental method as shown in FIG. 10, human skin fibroblasts were transfected with OSKM virus, and then the cells were harvested at 5-day intervals, and the expression levels of genes in the cells cultured in the presence or absence of RSC-133 were analyzed by real-time RT-PCR. As a result, it was shown that, in the test group treated with RSC-133 to induce reprogramming, the expression levels of the undifferentiation markers Nanog, Oct4 and Rex1 were relatively increased (FIG. 15 and the upper panel of FIG. 16), and the expression levels of p53, p21 and p16 known to be involved in a reprogramming inhibitory mechanisms were relatively inhibited (the lower panel of FIG. 16). In addition, at 10 days after induction of reprogramming, the ratio of cellular senescence-related -galactosidase (SA--gal)-positive cells decreased by 37.23% compared to that of an untreated control group (OSKM alone) (FIG. 17). Thus, it can be seen that RSC-133 can increase the efficiency of reprogramming and also can be involved in the reprogramming process to stimulate kinetics.

Example 16

Analysis of Function of RSC-133 that is Involved in Histone Acetylation During Reprogramming

(113) Most of various low-molecular-weight compounds known to be involved in the reprogramming process are involved genome methylation patterns, histone acetylation patterns or major signaling mechanisms. Among them, histone deacetylase (HDAC) inhibitors (VPA, TSA and SAHA) that are involved in the regulation of histone acetylation patterns are known to play an important role in the reprogramming process. Particularly, an increase in H3K9 acetylation (H3K9ace) levels is associated with pluripotency and reprogramming ability. As shown in FIG. 18, reprogramming of human skin fibroblasts was induced, and the cells were cultured for 10 days in the presence or absence of RSC-133, and then analyzed by immunocytochemistry using monoclonal antibodies for H3K9ace and an undifferentiation marker (Nanog), and as a result, the ratio of undifferentiated cells having a high H3K9ace level was higher in the test group treated with RSC-133 than in the control group (the left panel of FIG. 18). The same results were also obtained when the amount of protein was quantified by measuring the H3K9ace level by Western blot analysis (the right panel of FIG. 18).

(114) Next, whether the above-described results were results of the inhibition of HDAC enzyme by RSC-133 during reprogramming of human skin fibroblasts was examined. As a result, it could be seen that the activity of total HDAC enzymes was slightly inhibited by treatment with RSC-133 during reprogramming (the left panel of FIG. 19). According to the experimental method shown in FIG. 21, the expression levels of HDAC-family proteins were measured, and as a result, it could be seen that the expression level of HDAC1 in the test group treated with RSC-133 was inhibited at 10 days after treatment with RSC-133 compared to that of the control group (the light panel of FIG. 19 and FIG. 21). It was reported that HDAC1 can occupy the Oct4, Sox2, Klf4 and c-Myc gene loci in embryonic stem cells and that the expression of pluripotency-specific marker genes in HDAC1-deleted embryonic stem cells is increased. Thus, it is believed that RSC-133 can inhibit the function of HDAC1 and increase the H3K9ace level to stimulate the reprogramming process.

Example 17

Analysis of Function of RSC-133 that is Involved in DNA Methylation During Reprogramming

(115) RSC133 regulates the activities of epigenetic regulators such as DNA methyltransferase (DNMT) and histone deacetylase (HDAC). At 10 days after induction of reprogramming by RSC133, the activity of DNMT1 was reduced by about 38% compared to that in an untreated control group (OSKM alone) (FIG. 20). Epigenetic chromatin remolding by DNA methylation and/or histone modification plays an important in a wide range of transcriptional regulation in the reprogramming process. When DNA methylation is inhibited by treatment with the DNA methylation inhibitor AZA or deletion of DNMT1, the conversion of the cells to iPSC is rapidly induced. The increased level of H3K9 histone acetylation (ace) is particularly associated with the restoration of pluripotency and reprogramming ability. It is known that DNA methylation by DNMT1 has a close connection with the change in chromatin status caused by HDAC activity. Putting these results together, it can be seen that the inhibition of DNMT1 and HDAC1 activity by RSC-133 changes DNA methylation and chromatin status and increases accessibility to the loci of above-defined four reprogramming enzymes to have an indirect effect on the transcriptional regulation of the genes, thereby promoting the reprogramming process.

Example 18

Analysis of Characteristics of Reprogrammed Human Stem Cells Induced by RSC-133

(116) 18-1. Analysis of Expression of Pluripotency-Specific Markers

(117) The stem cell characteristics of the reprogrammed stem cell lines (RSC133-iPS) induced from human skin fibroblasts by the addition of RSC-133 were analyzed by ALP staining and immunostaining. Two cell lines (RSC133-iPS1 and RSC133-iPS2) were analyzed. As a result, the RSC133-iPS cell lines were very similar such that they were not distinguished morphologically or by the ALP staining and immunostaining of human embryonic stem cell markers (OCT4, NANOG, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) (FIG. 22). In addition, the expressions of Oct4, Sox2, cMyc and Klf4 mRNA were analyzed by semi-quantitative RT-PCR, and as a result, it was shown that the RSC133-iPSs expressed Oct4, Sox2, cMyc and Klf4 at the total and endogenous levels similar to those in human embryonic stem cells and that the silencing of the genes introduced by retroviruses was completely completed (FIG. 23).

(118) 18-2. Analysis of Methylation in Reprogrammed Stem Cells Induced by RSC-133

(119) According to the method shown in Example 8, the degrees of the promoter methylation regions of the stem cell markers Oct4 and Nanog genes of the RSC133-iPSs were analyzed by bisulfite sequencing. As a result, as can be seen in FIG. 21, the RSC133-iPSs showed demethylation patterns similar to those of the human embryonic stem cells (H9), but the parent cells (hFFs) still maintained methylation (FIG. 24).

(120) 18-3. Analysis of Genomic Integration of Reprogrammed Stem Cells Induced by RSC-133

(121) Genomic integration of each of RSC133-iPS1 and RSC133-iPS2 was analyzed. Specifically, genomic DNA was extracted from each of the cell lines using a DNeasy kit (Qiagen, Valencia, Calif.), and 300 ng of each of the genomic DNAs was amplified by PCR using primers capable of specifically amplifying the genomic DNA and the transferred gene. As a result, it was found that, in the RSC133-iPS cell lines, Oct4, Sox2, cMyc and Klf4 were integrated (FIG. 25). Herein, the human embryonic stem cell line (H9, hES) and the human skin fibroblast cell line (CRL2097, hFF) were used as control groups.

(122) 18-4. Analysis of Karyotype of Reprogrammed Stem Cells Induced by RSC-133

(123) The karyotype of the RSC133-iPSCs was analyzed by G-banding. Representative images were obtained using ChIPS-Karyo (Chromosome Image Processing System, GenDix) (FIG. 26). As a result, the reprogrammed RSC133-iPSCs showed a normal karyotype showed a normal karyotype (46, XY).

(124) 18-5. Examination of Pluripotent Ability of Reprogrammed Stem Cells Induced by RSC-133

(125) In order to examine whether the reprogrammed stem cells (RSC133-iPS) from human fibroblasts by the addition of RSC-133 possess differentiation potential that is the feather of stem cells, the differentiation potential of embryoid bodies derived from each of the reprogrammed stem cell lines was examined. Specifically, the cells were cultured in suspension, and then the embryoid bodies were incubated again on gelatin-coated plates for 10 days under differentiation conditions, after which the expression of marker proteins that are expressed specifically in cells that differentiated into three germ layers was analyzed by immunochemical staining. As a result, cells positive to Tujl (exoderm), Nestin(exoderm), desmin (mesoderm), -SMA(-smooth muscle actin, mesoderm), Sox17 (endoderm) and FoxA2 (endoderm) were detected. Such results that the reprogrammed stem cells (RSC133-iPS) induced by RSC-133 had the capability to differentiate into three germ layers and maintained pluripotency.

(126) In addition, in order to examine the in vivo pluripotency of the human reprogrammed stem cells (RSC133-iPS) induced by the addition of RSC-133, the reprogrammed stem cells RSC133-iPS were injected subcutaneously into the dorsal flanks of immunodeficiency (SCID) mice. After about 12 weeks, teratomas could be observed, and neural rosette (exoderm), adipocyte(mesoderm), cartilage (mesoderm) and gut-like epithelium (endoderm) were observed in the teratoma by hematoxylin/eosin staining (FIG. 27). This suggests that the human reprogrammed stem cells (RSC133-iPSCs) induced by the addition of RSC-133 have the capability to differentiate into three germ layers in vitro and in vivo.

Example 19

Effects of RSC-133 on Maintenance and Stimulation of Pluripotency

(127) When human embryonic stem cells (H9) are cultured in unconditioned medium (UM), their differentiation is induced. However, when the cells were cultured for 6 days in UM supplemented with RSC-133, it could be observed that the degree of induced differentiation was inhibited and pluripotency was re-acquired (the upper panel of FIG. 28). As a positive control group, embryonic stem cells cultured for 6 days in MEF-conditioned medium (CM) effective for maintenance of an undifferentiated state were used. The efficiency of maintenance of an undifferentiated state and inhibition of differentiation was determined by measuring the number of colonies showing AP activity (the lower panel of FIG. 28). In addition, the results of immunostaining at the protein level indicated that, when human embryonic stem cells were cultured in UM supplemented with RSC-133, the pluripotency-specific markers (Oct4 and Tra1-81) of the human embryonic stem cells were expressed at levels similar to those of human embryonic stem cells cultured in CM. The inhibition of differentiation and maintenance of undifferentiation by RSC-133 was additionally verified by analysis of expression of the pluripotency-specific markers Oct4 and H3K9ace, and it was observed that the human embryonic stem cells cultured in UM containing RSC-133 expressed Oct4 and H3K9ace at levels similar to those in the human embryonic stem cells cultured in CM (FIG. 29). Thus, it was verified that RSC-133 has effects not only on the reprogramming of human somatic cells, but also on the maintenance of pluripotency of human pluripotent stem cells.

(128) The inhibition of differentiation and maintenance of undifferentiation by RSC-133 was additionally verified by analysis of expression of the pluripotency-specific markers Oct4 and H3K9ace, and it was observed that the human embryonic stem cells cultured in UM containing RSC-133 expressed Oct4 and H3K9ace at levels similar to those in the human embryonic stem cells cultured in CM (FIG. 31). Thus, it was verified that RSC-133 has effects not only on the reprogramming of human somatic cells, but also on the maintenance of pluripotency of human pluripotent stem cells.

(129) Although the preferred embodiments of the present invention have been described for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims.