Gene-targeted apoptosis
09587238 ยท 2017-03-07
Assignee
Inventors
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Described herein are methods of triplex-induced apoptosis, in which multiple triplexes are formed in cells in which gene amplification has occurred (cells comprising/characterized by at least one amplified gene), referred to as target cells, and apoptosis is induced in the target cells.
Claims
1. A method of inducing apoptosis in breast cancer cells in which the HER2 gene is amplified, the method comprising contacting breast cancer cells in which the HER2 gene is amplified with (a) triplex inducing oligonucleotides (TFOs) specific for a polypurine site in the amplified HER2 gene and (b) a transport peptide, under conditions under which the TFOs and the transport peptide enter the breast cancer cells and the TFOs enter the breast cancer cells in sufficient quantity to induce apoptosis.
2. A method of inducing apoptosis in breast cancer cells comprising an amplified HER2 gene, the method comprising contacting breast cancer cells comprising an amplified HER2 gene with (a) triplex forming oligonucleotides (TFOs), specific for a polypurine site in the amplified HER2 gene and (b) a transport peptide, under conditions under which the TFOs and the transport peptides enter the breast cancer cells comprising amplified HER2 gene and TFOs enter the breast cancer cells comprising amplified HER2 gene in sufficient quantity, bind multiple polypurine site(s) in the amplified HER2 gene and form multiple triplexes in the cells and induce apoptosis.
3. The method of claim 1, wherein the TFOs and the transport peptides are linked, either covalently or non-covalently.
4. The method of claim 1, wherein the TFOs and the transport peptides are not linked and are contacted with the breast cancer cells as a mixture.
5. The method of claim 1, wherein the breast cancer cells in which the HER2 gene is amplified are resistant to Herceptin.
6. The method of claim 2, wherein the TFOs and the transport peptides are linked, either covalently or non-covalently.
7. The method of claim 2, wherein the TFOs and the transport peptides are not linked and are contacted with the breast cancer cells as a mixture.
8. The method of claim 2, wherein the breast cancer cells comprising an amplified HER2 gene are resistant to Herceptin.
9. The method of claim 1, wherein the TFOs comprise 5GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16).
10. The method of claim 9, wherein the transport peptide comprises a cationic cell-penetrating peptide.
11. The method of claim 1, wherein the TFOs comprise 5GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16) and the transport peptide comprises a peptide selected from the group consisting of: Penetratin or Antenapedia (RQIKIWFQNRRMKWKK (SEQ ID NO: 1), PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2); HIV TAT protein (YGRKKRRQRRR (SEQ ID NO: 3); SynB1 (RGGRLSYSRRRFSTSTGR (SEQ ID NO: 4); SynB3 (RRLSYSRRRF (SEQ ID NO: 5); PTD-4 (PIRRRKKLRRLK (SEQ ID NO: 6); PTD-5 (RRQRRTSKLMKR (SEQ ID NO: 7); FHV Coat-(35-49) (RRRRNRTRRNRRRVR (SEQ ID NO: 8); BMV Gag-(7-25) (KMTRAQRRAAARRNRWTAR (SEQ ID NO: 9); HTLV-II Rex-(4-16) (TRRQRTRRARRNR (SEQ ID NO: 10); D-Tat (GRKKRRQRRRPPQ (SEQ ID NO: 11); and R9-Tat (GRRRRRRRRRPPQ (SEQ ID NO: 12).
12. The method of claim 2, wherein the TFOs comprise 5GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16).
13. The method of claim 12, wherein the transport peptide comprises a cationic cell-penetrating peptide.
14. The method of claim 2, wherein the TFOs comprise: 5GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16 and the transport peptide comprises a peptide selected from the group consisting of: Penetratin or Antenapedia (RQIKIWFQNRRMKWKK (SEQ ID NO: 1), PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2); HIV TAT protein (YGRKKRRQRRR (SEQ ID NO: 3); SynB1 (RGGRLSYSRRRFSTSTGR (SEQ ID NO: 4); SynB3 (RRLSYSRRRF (SEQ ID NO: 5); PTD-4 (PIRRRKKLRRLK (SEQ ID NO: 6); PTD-5 (RRQRRTSKLMKR (SEQ ID NO: 7); FHV Coat-(35-49) (RRRRNRTRRNRRRVR (SEQ ID NO: 8); BMV Gag-(7-25) (KMTRAQRRAAARRNRWTAR (SEQ ID NO: 9); HTLV-II Rex-(4-16) (TRRQRTRRARRNR (SEQ ID NO: 10); D-Tat (GRKKRRQRRRPPQ (SEQ ID NO: 11); and R9-Tat (GRRRRRRRRRPPQ (SEQ ID NO: 12).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the presence disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION
(24) As described herein, triplex DNA formed at chromosomal sites by exogenous triplex-forming oligonucleotides (TFOs) induces apoptosis in human cells. Apoptosis is induced in response to formation of multiple triplex structures, not just one or two triplex structures, because the nucleotide excision repair (NER) pathway is capable of efficiently repairing a low level of damage.
(25) DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. The initial reaction of the cell to DNA damage is to repair the damage. However, if significant damage has been sustained and the DNA is irreparably compromised the cell switches to cell cycle arrest or to apoptosis. Perhaps the most versatile DNA damage removal system is the nucleotide excision repair (NER) pathway. This pathway is responsible for the removal of bulky, helix-distorting structures, including lesions produced by triplex formation. Triplex-forming oligonucleotides (TFOs) create a helical distortion upon binding to duplex DNA that strongly provokes NER-dependent DNA repair. When low-levels of triplex-distorting damage are produced, NER participates in damage repair. However, when excessive DNA damage is induced by the formation of multiple triplex structures, apoptosis prevails. Hence, triplex-induced DNA damage can be exploited to provide the foundation for a totally new therapeutic approach: tumor-specific induction of apoptosis in cancers characterized by gene amplification through the formation of multiple triplex structures at specific amplified gene sequences.
(26) As described herein, triplex-forming oligonucleotides can be used to form altered helical distortions in a cell (e.g. a cancer cell) and pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of H2AX foci. Without wishing to be bound by any particular theory, it has been demonstrated that XPD is subsequently recruited to the triplex-induced double strand breaks and co-localized with H2AX at the damage site. Furthermore, phosphorylation of H2AX at tyrosine residue 142 can stimulate the signaling pathway of XPD-dependent apoptosis. This mechanism may play an active role in minimizing genomic instability induced by naturally occurring non-canonical structures, perhaps protecting against cancer initiation.
(27) Key proteins that contribute to cellular survival by acting in DNA repair can become executioners in the face of excess DNA damage. Studies suggest that some proteins required for efficient nucleotide excision repair (NER) may also play a role in apoptosis (1). The XPD protein has been identified as having two primary functions in NER: (i) stabilization of the transcription factor complex TFIIH and (ii) 5.fwdarw.3 helicase function (2). In addition to its function in NER, transcription and possibly cell cycle regulation, XPD is also required for p53-mediated apoptosis (3-5).
(28) The NER pathway occupies an important position in the recognition and repair of a wide array of helix distorting lesions. Previous studies have shown that high affinity DNA binding molecules can create helical distortions upon binding to duplex DNA that strongly provoke NER dependent repair (6,7). However, it was unknown whether formation of these structures caused a severe enough alteration in the DNA double helix to trigger activation of apoptotic pathways. Triplex DNA is formed when triplex-forming oligonucleotides (TFOs) bind as third strands in a sequence-specific manner within the major groove of duplex DNA at polypurine stretches. These molecules provide a means to experimentally create bulky helical distortions that are subject to NER and afford an opportunity to evaluate cellular responses to increasing levels of structurally induced DNA damage.
(29) The human genome includes DNA sequence patterns that can adopt a variety of alternative structures in addition to the B-conformation described by Watson and Crick (8). For example, H-DNA (triplex) formation is favored by sequences that contain mirror repeat symmetry and occurs at purine/pyrimidine tracts (9-11). Naturally occurring sequences capable of forming H-DNA are found in the human genome as frequently as 1 in every 50,000 base pairs (12). Formation of these structures cause severe genomic alterations and represent an endogenous source of genotoxic stress (12,13). For instance, the H-DNA forming sequence located in the promoter region of the c-myc gene has been implicated in the translocation of the gene in Burkitt's lymphoma (14). Because the triplex region found in endogenous H-DNA is similar in structure to intermolecular triplexes formed by TFOs, they represent an excellent model to study the molecular pathways that determine cellular fate in response to endogenous sources of genotoxic stress.
(30) As demonstrated herein, the formation of multiple (e.g. more than 2) triplex structures in a cell provokes apoptotic responses and reveals an XPD-dependent mechanism that modulates survival/apoptotic decisions in response to structurally induced DNA damage. In conjunction with the use of an established cell line and a transgenic mouse model containing multiple chromosomal target sites, sequence-specific TFOs were used to synthetically create altered helical structures. In some embodiments, at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 50 or more triplex structures are formed in the cell. The number of triplex structures formed by the TFM in a cancer cell characterized by gene amplification is greater than the number of triplex structures formed by the TFM in a normal cell (e.g., not a cancer cell).
(31) As used herein, triplex-forming molecules (TFMs) such as triplex-forming oligonucleotides (TFOs), refer to oligonucleotides of any nucleic acid sequence that can bind to a polypurine site within an amplified cancer gene and form a triplex structure. The polypurine site within an amplified cancer gene is referred to a target site. One advantage of the methods and compositions described herein is that TFMs are active and bind their target sites, particularly target polypurine sites, and induce apoptosis in target cells (e.g. cancer cells or other abnormal cells which comprise at least one amplified gene) and not in healthy cells, thus avoiding adverse effects on healthy cells. In some embodiments, the TFO comprises the nucleic acid sequence provided by HER2-1 (SEQ ID NO: 15: 5-GGGAGGAGGAGGTGGAGGAGGAAGAGGA). In some embodiments, the TFO comprises the nucleic acid sequence provided by HER2-205 (SEQ ID NO: 16: 5-GAGGAGGAGTGGGAGAATGGGGGG).
(32) As also described herein, triplex-induced double strand breaks (DSBs) stimulate cells to activate apoptosis both in vitro and in vivo. Although knockdown of XPD did not modulate the extent of triplex-induced DSBs, its depletion resulted in a decrease in triplex-induced apoptosis. Further investigation determined that XPD is recruited to the H2AX serine139 phosphorylation site and its presence is required for the phosphorylation of the H2AX tyrosine142 residue, which has been shown to be an essential post-translational modification for the recruitment of pro-apoptotic factors to the tail of H2AX. These results identify a new role for XPD in addition to its previously reported requirement for p53-mediated apoptosis in regulating cellular fate decisions. Results support a key role for XPD-dependent apoptosis in preserving genomic integrity in the presence of excessive structurally induced DNA damage.
(33) The methods and compositions provided herein relate to entry of TFMs into cells in order to bind the target site in sufficient quantity to induce apoptosis. TFMs, such as TFOs, can be introduced into a cell by any method known in the art, such as through modification of the oligonucleotide backbone or the use of a carrier or transport agent, which can be attached (covalently or non-covalently) to the TFM or mixed with (and not attached or conjugated to) TFMs. For example, hydrophobic molecules, such as lipids, (e.g., cationic lipids including transfection reagents), cell-penetrating peptides (CPP) and cell-targeting ligands can be used to enhance the ability of TFMs, such as TFOs, to enter cells/improve their interaction with the cell membrane lipid (hydrophobic) bi-layer. In some embodiments, the method of introducing TFMs, such as TFOs, into a cell involves electroporation.
(34) In some embodiments, the TFMs are introduced into a cell using a population of nanoparticles. Nanoparticles compatible for use in the methods and compositions described herein will be apparent to one of skill in the art. In some embodiments, the nanoparticles are polymeric nanoparticles. In some embodiments, the TFMs, such as TFOs, are encapsulated within the nanoparticles. In some embodiments, the TFMs, such as TFOs, are linked or conjugated to the nanoparticles.
(35) In specific embodiments, transport peptides (also known as protein transduction domains (PTDs), membrane translocating sequences (MTSs), and Trojan peptides) are used to enhance/facilitate uptake of TFOs into cells. Any cell-penetrating peptide capable of assisting or facilitating the entry of a TFM into a cell is compatible with the present disclosure. CPPs are short peptides (40 amino acids) that are cationic, able to enter many cell types, and typically made up of mostly hydrophilic amino acids/rich in arginine and lysine. They have been shown to be able to carry many types of entities, including oligonucleotides, into cells. Hydrophilic CPPs include, but are not limited to: Penetratin or Antenapedia (RQIKIWFQNRRMKWKK (SEQ ID NO: 1) or alternatively, PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2)); HIV TAT protein (YGRKKRRQRRR (SEQ ID NO: 3)); SynB1 (RGGRLSYSRRRFSTSTGR (SEQ ID NO: 4)); SynB3 (RRLSYSRRRF (SEQ ID NO: 5)); PTD-4 (PIRRRKKLRRLK (SEQ ID NO: 6)); PTD-5 (RRQRRTSKLMKR (SEQ ID NO: 7)); FHV Coat-(35-49) (RRRRNRTRRNRRRVR (SEQ ID NO: 8)); BMV Gag-(7-25) (KMTRAQRRAAARRNRWTAR (SEQ ID NO: 9)); HTLV-II Rex-(4-16) (TRRQRTRRARRNR (SEQ ID NO: 10)); D-Tat (GRKKRRQRRRPPQ (SEQ ID NO: 11)); and R9-Tat (GRRRRRRRRRPPQ (SEQ ID NO: 12)). Such CPPs can be covalently or non-covalently linked to TFMs, such as TFOs, or not linked to TFMs, such as TFOs; in the latter case, TFMs (TFOs) and CPPs are unconjugated when administered. In both embodiments, a sufficient quantity of TFMs (TFOs) and CPPs is administered to result in formation of multiple triplexes and induce apoptosis in the target cells. In the cells, TFMs, such as TFOs, bind their target sites. In some embodiments, the transport peptide is the Antennapedia peptide or fragment thereof. In some embodiments, the transport peptide is provided by the amino acid sequence of SEQ ID NO: 1. In some embodiments, the transport peptide is provided by the amino acid sequence of SEQ ID NO: 2.
(36) In some embodiments, the transport peptide is the Antennapedia peptide comprises one or more modifications, such as the addition, deletion, or substitution of at least one amino acid. In some embodiments, the modification of the Antennapedia peptide is the presence of at least one additional terminal lysine residue.
(37) One embodiment described herein is a method of inducing apoptosis in cancer cells comprising (that comprise)/are characterized by an amplified cancer gene, comprising contacting cancer cells comprising an amplified cancer gene with (a) triplex forming molecules (TFMs), such as triplex forming oligonucleotides (TFOs), specific for a (at least one, one or more) polypurine site (a, at least one, one or more) target site) in the amplified cancer gene and (b) a (at least one, one or more) transport peptide, under conditions under which TFMs (TFOs) and transport peptides enter cancer cells and TFMs (TFOs) enter the cancer cells in sufficient quantity, bind the polypurine site(s) and induce apoptosis. In some embodiments, the TFMs, such as TFOs, and transport peptides are linked, either covalently or non-covalently. Methods of covalently linking a TFM such as a TFO to a peptide such as a transport peptide will be known in the art. In some embodiments, the TFMs, such as TFOs, and transport peptides are not linked/are mixed or combined and are contacted with cancer cells as a mixture or combination. In some embodiments, the TFM and transport peptides are mixed or combined in the presence of a pharmaceutically acceptable carrier, excipient, or buffer compatible with administration to an individual.
(38) In some embodiments, the amplified cancer gene is HER2 and the cancer cells are breast cancer cells or ovarian cancer cells. In some embodiments, the cancer cells are in an individual. In some embodiments, the individual is a human. In some embodiments, the individual is a woman.
(39) In some embodiments, the cancer gene is a gene in the TABLE and cancer cells are of cancer type corresponding to the gene in the TABLE. In some embodiments, the cancer gene is HER2 and the cancer cells are breast cancer cells or ovarian cancer cells. In some embodiments, the cancer cells are in an individual. In some embodiments, the individual is a human.
(40) In other aspects, methods of creating triplex-induced strand breaks, such as double strand breaks, in genomic DNA in cells (such as cells that comprise amplified DNA (genomic DNA), such as an amplified cancer gene) sufficient to induce apoptosis in the cells are provided. The method comprises introducing into the cells purine-rich (such as guanine-rich) triplex forming molecules, such as triplex forming oligonucleotides (TFOs) that bind a (at least one, one or more) polypurine site of genomic DNA in the cells in sufficient quantity to form multiple apoptosis-inducing triplexes in the genomic DNA.
(41) In some embodiments, a (at least one, one or more) transport peptide is introduced into the cells with TFMs, such as TFOs; TFMs/TFOs, and transport peptides are (a) linked, either covalently or non-covalently or (b) not linked/are mixed or combined and are contacted with cancer cells as a mixture or combination. In some embodiments, the amplified cancer gene is HER2 and the cancer cells are breast cancer cells or ovarian cancer cells. In some embodiments, the cancer cells are in an individual. In some embodiments, the individual is a human. In some embodiments, the individual is a woman. In some embodiments, the cancer gene is a gene in the TABLE and cancer cells are of cancer type corresponding to the gene in the TABLE.
(42) Other aspects relate to methods of inducing apoptosis of cancer cells characterized by an amplified cancer gene comprising contacting the cell with a TFM and a population of nanoparticles under conditions in which TFMs, such as TFOs, and the nanoparticles enter the cell and the TFM binds a target site in sufficient quantity to induce apoptosis.
(43) In any of the embodiments, one or more different TFMs (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different TFMs), such as one or more different TFOs, can be used. For example, one type of TFM, such as one type of TFO, to a first/that binds a first polypurine site and a second, different TFM, such as a second, different TFO to/that binds a second, different polypurine site can be administered. The first and second polypurine sites (target sites) can be in the same amplified gene (e.g., both are in one amplified cancer gene, such as HER2) or in different amplified genes (e.g., one polypurine site is in a first amplified gene and the second polypurine site is in a second, different amplified gene). It is also possible that the same polypurine site (target site) is present in two different amplified cancer genes, in which case one type of TFM, such as one type of TFO, can be used. All transport peptides can be the same or a combination of several types of transport peptides can be used in the embodiments described.
(44) The disclosure also provides compositions comprising a (at least one, one or more) triplex forming molecule (TFM), such as a triplex forming oligonucleotide (TFO) and a (at least one, one or more) transport peptide. In some embodiments, the compositions comprise a (at least one, one or more) triplex forming molecule (TFM), such as a triplex forming oligonucleotide (TFO) and a population of nanoparticles.
(45) In some embodiments, the TFO binds a polypurine site (target site) of a (at least one, one or more) gene amplified in cancer cells and the transport peptide(s) is/are a (at least one, one or more) cell penetrating peptide(s). In some embodiments, the at least one, one or more transport peptide(s) is/are all or a fragment of Antennapedia peptide (the homeodomain of the Drosophila homeoprotein Antennapedia (residues 43-58) having all or a portion of sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 1) (also represented Arg Gln Ile Lys IleTrp Phe Gln Asn Arg Arg Met Lys Trp LysLys), all or a portion of sequence PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2) or a modification of the Antennapedia peptide of either sequence RQIKWFQNRRMKWKK (SEQ ID NO: 1) or PTD RQIKIWFQNRRMKWKK (SEQ ID NO: 2). In some embodiments, the modification of the Antennapedia peptide is the presence of at least one additional terminal lysine.
(46) Aspects of the disclosure relate to methods of inducing apoptosis of cancer cells. In some embodiments, the cancer cells comprise or are characterized by an amplified cancer gene. As used herein, an amplified cancer gene refers to gene that has an increased copy number as compared to the copy number of the gene in a normal cell (not a cancer cell). The increase in copy of number of the amplified gene may result in overexpression of the gene. In cases in which the amplified gene is a cancer gene (e.g. an oncogene or a cancer associated gene), amplification and overexpression can result in cancer. In some embodiments, the amplified cancer gene is a gene presented in the TABLE. In some embodiments, the cancer type is presented in the TABLE. In some embodiments, the amplified cancer gene is a gene in the TABLE and the cancer cells are of the cancer type corresponding to the gene in the TABLE. In some embodiments, the amplified cancer gene is HER2. In some embodiments, the cancer type is breast cancer or ovarian cancer. In some embodiments, the amplified cancer gene is HER2 and the cancer type is breast cancer or ovarian cancer.
(47) TABLE-US-00001 TABLE Amplified and Overexpressed Genes in Human Cancer (Source: T. Santarius et al., Medscape Today. A Census of Amplified and Overexpressed Genes in Human Cancer) Cancer type Gene Acute myeloid leukemia TRIB1 Bladder YWHAQ, E2F3, YWHAZ, ERRB2, AURKA Breast SHC1, CKS1B, RUVBL1, C8orf4, LSM1, FGFR1, BAG4, MTDH, MYC, EMSY, PAK1, CDK4, MDM2, PLA2G10, STARD3, GRB7, RPS6KB1, PPM1D, CCNE1, YWHAB, ZNF217, AURKA, PTK6, CCND1, NCOA3, ERBB2 Colorectal MYC, EGFR Diffuse large B cell REL lymphoma Endometrial ERBB2 Gastric RAB23, MET, MYC, ERBB2, CDC6 Glioma MDM4, EGFR, CDK4, MDM2, AKT3, CCND2, CDK6, MET Head and neck DCUN1D1 Hepatocellular carcinoma CHD1L Hodgkin's lymphoma REL Laryngeal squamous cell FADD carcinoma Liver YAP1, BIRC2 Lung MYCN, EGFR, MET, WHSC1L1, YWHAZ, MYC, CCND1, MDM2, BCL2L2, PAX9, NKX2-1, KIAA0174, DCUN1D1, EEF1A2, MYCL1, SKP2, NKX2-8 Malignant melanoma MITF, CCND1, CDK4 Medulloblastoma MYC Melanoma C-MYC, C-RAS Neuroblastoma MDM2, MYCN Oesophageal PRKCI, ZNF639, SKP2, EGFR, SHH, DYRK2, ERBB2, CCNE1, AURK Oral squamous cell CCND1 carcinoma Osteosarcoma COPS3 Ovarian EIF5A2, EVI1, EMSY, ERBB2, RPS6KB1, AKT2, RAB25, PIK3CA Pancreatic ARPC1A, SMURF1, MED29 Pancreatobillary GATA6 Prostate MYC, AR Retinoblastoma E2F3, MDM4 Rhabdomyosarcoma MYCN, FGFR1, GPC5 Sarcoma JUN, MAP3K5, YEATS4, CDK4, DYRK2, MDM2 Soft tissue sarcoma SKP2 Testicular germ cell KIT, KRAS tumour Wilm's tumour CACNA1E Key: AR, androgen receptor; ARPC1A, actin-related protein complex subunit A; AURKA, Aurora kinase A; BAG4, BCL-2 associated anthogene 4; BCL2L2, BCL-2 like 2; BIRC2, Baculovirus IAP repeat containing protein 2; CACNA1E, calcium channel voltage dependent alpha-1E subunit; CCNE1, cyclin El; CDK4, cyclin dependent kinase 4; CHD1L, chromodomain helicase DNA binding domain 1-like; CKS1B, CDC28 protein kinase 1B; COPS3, COP9 subunit 3; DCUN1D1, DCN1 domain containing protein 1; DYRK2, dual pecificity tyrosine phosphorylation regulated kinase 2; EEF1A2, eukaryotic elongation transcription factor 1 alpha 2; EGFR, epidermal growth factor receptor; FADD, Fas-associated via death domain; FGFR1, fibroblast growth factor receptor 1, GATA6, GATA binding protein 6; GPC5, glypican 5; GRB7, growth factor receptor bound protein 7; MAP3K5, mitogen activated protein kinase kinase kinase 5; MED29, mediator complex subunit 5; MITF, microphthalmia associated transcription factor; MTDH, metadherin; NCOA3, nuclear receptor coactivator 3; NKX2-1, NK2 homeobox 1; PAK1, p21/CDC42/RAC1-activated kinase 1; PAX9, paired box gene 9; PIK3CA, phosphatidylinositol-3 kinase catalytic a; PLA2G10, phopholipase A2, group X; PPM1D, protein phosphatase magnesium-dependent 1D; PTK6, protein tyrosine kinase 6; PRKCI, protein kinase C iota; RPS6KB1, ribosomal protein S6 kinase 70kDa; SKP2, S-phase kinase associated protein; SMURF1, SMAD specific E3 ubiquitin protein ligase 1; SHH, sonic hedgehog homologue; STARD3, STAR- related lipid transfer domain containing protein 3; YWHAQ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta isoform; ZNF217, zinc finger protein 217.
EXAMPLES
Example 1
Materials and Methods
(48) The following materials and methods were used in the work described herein.
(49) Oligonucleotides. Oligonucleotides were synthesized with a 3-amino-modifier C7 CPG (Glen Research) by the Midland Certified Reagent Company Inc. and purified by RP-HPLC. The sequence of the TFO, AG30, used and its target site are depicted in
(50) Cells Lines and Transfections. C127 cells were obtained from ATCC. The mouse epithelial cell line, AV16, containing 100 randomly integrated chromosomal copies of the triplex target site were derived from the parental C127 cell line and target site copy number was determined using quantitative DNA dot blot analysis as previously described (16). A mouse fibroblast cell line with the supFG1 (lambda supFG1) vector chromosomally integrated and deficient in XPA was derived from transgenic mice carrying the supFG1 vector as a transgene and targeted disruptions in the NER gene, XPA. A similar cell line containing the supFG1 vector was derived from wild-type mice and used for comparison.
(51) Cells were seeded in six-well plates at a density of 210.sup.5 cells per well the day before transfection. Cells were transfected with 2 g of AG3O or MIX30 using Oligofectamine (Invitrogen) transfection reagent. Transfection was performed as per manufacturer's instructions. siRNA directed against XPD, GAPDH and non-target controls (ON-Target plus SMARTpool reagents; Dharmacon) were transfected into AV16 cells using Dharmafect-1 transfection reagent (Dharmacon) according to the manufacturer's instructions. Western blot analysis was used to confirm knockdown of protein.
(52) AV16 cells were used to generate XPD/ cells using shRNA. Briefly, lentivirus shRNA vectors for XPD knockdown, were obtained from Sigma-Aldrich (XPD-18: TRCN0000071118; XPD-19: TRCN0000071119; XPD-58: TRCN0000338058). AV16 cells were transduced with Lentiviral expression constructs either for non-target shRNA or GFP shRNA or one of the three different shRNA targeting XPD (ERCC2). Stable clones expressing the shRNA were established via puromycin dihydrochloride selection (2 g/ml). AV16 clone XPD-19-1 stably expressing shRNA XPD-19 was used in the mutagenesis experiments.
(53) Metaphase Chromosome Spreads. AV16 cells were transfected with 2 g of rhodamine labeled MIX30 or AG30. Twenty-four hours post-transfection, cells were treated for 5 h with Colcemid (0.1 g/l). Cells were then collected and washed once with PBS. To the cell pellet a 75 mM KCl solution was added for 20 minutes at 37 C. Cell pellets were then resuspended in Carnoy's fixative solution (75% methanol, 25% acetic acid). After 10 min incubation at room temperature, the cells were pelleted and resuspended in an additional 500 l of Carnoy's fixative solution. Cells were dropped from a height onto glass slides and mounting medium with DAPI (Prolong Gold antifade reagent, Invitrogen) was added to each slide. Pictures were taken of 50-60 metaphase spreads using an Axiovert 200 microscope (Carl Zeiss Micro Imaging, Inc.).
(54) Survival Assays. Cell survival was assayed either by visualization of monolayer growth or by colony formation. To quantify survival by monolayer growth, cells were seeded at a defined density in either 6 or 12 well dishes and treated with the TFO as previously described. Cells were stained with crystal violet 24, 48 and 72 hours post treatment for monolayer visualization. To assay for cell survival by clonogenic survival, cells were treated with 2 g of AG3O or MIX30 for 48 h and then seeded at 250-500 cells per well. Colonies were washed with 0.9% saline solution and stained with crystal violet 10-14 days later. Colonies consisting of >50 cells were counted. Colony formation was normalized to plating efficiency of the non-treated cells. Errors bars in the survival analysis are based on three independent experiments.
(55) Apoptosis Analysis. Cells were analyzed by flow cytometry 24 hrs post-treatment using the Annexin V-FITC/PI apoptosis detection kit (BD Pharmingen) according to the manufacturer's protocol. The apoptotic rate was calculated as the combined percentage of early apoptotic and late apoptotic cells. Data analysis was performed using FlowJo software.
(56) Western Analysis. Floating and adherent cells were collected, cell pellets were lysed with RIPA buffer (150 mM NaCl, 0.1% SDS, and inhibitors), and 30-50 g of total protein per sample was resolved by SDS-PAGE. Proteins were detected by a standard immunoblot protocol using the following primary antibodies: cleaved PARP; cleaved caspase-3; phospho-p53 (ser15); phospho-H2AX (serine 139); (Cell Signaling Technology, Inc. Danvers, Mass.); phospho-H2AX (tyrosine 142) (Millipore Corporation, Billerica, Mass.); XPD (BD Biosciences, San Jose, Calif.); tubulin (clone B-512; Sigma, St. Louis, Mo.). Each experiment was carried out a minimum of three times, and representative Western blots are shown.
(57) Immunofluorescence. Cells, seeded onto UV-irradiated coverslips, were treated for 24 hrs and samples were prepared under reduced light as previously described (17). Cells were incubated with the following antibodies: rabbit anti-H2AX antibody (Cell Signaling) and FITC-conjugated F(ab)2 fragment donkey anti-rabbit IgG (H+L) (Molecular Probes Inc.), and then stained with 100 ng/mL DAPI (Sigma). Images were captured using an Axiovert 200 microscope (Carl Zeiss Micro Imaging, Inc.).
(58) Neutral Comet Assay. Cells were collected 24 h post-treatment and neutral comet assays were performed according to the manufacturer's protocol (Trevigen Inc) with one adjustment of 3.510.sup.5 cells/ml for each single cell suspension. Comets were visualized using an Axiovert 200 microscope and analyzed with Comet Score software (TriTek Corp). Approximately 100-150 randomly selected, non-overlapping cells were analyzed per experiment. Results were expressed as mean tail moment.
(59) In Vivo Analysis of Triplex-Induced DNA Strand Breaks. AV mice were derived from the CD1 background (Charles River Laboratories, Wilmington, Mass.) and were generated as previously described (18). DNA dot blot analysis confirmed the AV founder mouse to carry 50 copies of the triplex target site in its genome. AV mice or CD1 control mice (14-days old) were treated by i.p. injection with PBS, MIX30, or AG30 (50 mg/kg). Three mice were used per treatment group. Mice were sacrificed 6 hours after treatment and tissue samples were collected. Spleen tissue was collected and fixed in 4% paraformaldehyde overnight at 4 C., embedded in paraffin and cut into sections for evaluation by immunohistochemistry. Cut sections were stained for phospho-H2AX (Cell Signaling) and activated caspase 3 (Abcam) and analyzed by microscopy. All sections were analyzed and quantified by counting 12 randomly selected sections of the same sample. The number of cells positive for activated caspase 3 and H2AX were manually counted on digital images of the specimens. The differences in the percentage of positive cells were analyzed by one way Anova and tukey test as posthoc. Representative depiction of immunohistochemistry is shown. Animal studies were approved and performed according to the guidelines of the Institutional Animal Care and Use Committee of Yale University.
(60) Coimmunopreciptation. AV16 cells were transfected with AG30 or MIX30 and 24 hrs post-transfection, cells were lysed in IP lysis buffer (Thermo Scientific). To observe the interaction of XPD with H2AX, cell lysates were immunoprecipitated with polyclonal rabbit antibody H2AX (Santa Cruz) or rabbit IgG (Jackson Immunoresearch Lab) using protein A/G beads (Santa Cruz) at 4 C. for 90 minutes. The immunoprecipitated complex was analyzed by immuno-blotting.
(61) Cell Cycle Analysis and H2AX. AV16 cells were collected at 6 and 24 hrs following transfection with either MIX30 or AG30. After washing once with PBS, the cells were fixed in 1% paraformaldehyde for 15 min on ice. Cells were centrifuged and fixed in 70% ethanol at 20 C. for 2 hrs. The cells were then washed with BSA-T-PBS (1% w/v Bovine Serum Albumin and 0.2% v/v Triton X-100 in PBS) and incubated with H2AX antibody (Cell Signaling) in BSA-T-PBS overnight at 4 C. After washing, the cells were incubated with anti-rabbit IgG Fab2 Alexa 488 (Molecular Probes) at room temperature for 1 h in the dark. Cells were washed and the pellet resuspended and incubated at room temperature in PI staining solution (PI/RNase solution, BD) for 15 minutes. Cells were analyzed by flow cytometry.
(62) Mutagenesis Assay. The mouse cell lines were established with multiple chromosomally integrated copies of the recoverable supFG1 shuttle vector carrying the supFG1 reporter gene. Following 48-72 hrs of TFO treatment, genomic DNA was isolated and incubated with in vitro packaging extracts for shuttle vector rescue and reporter gene analysis as previously described (16,19). Briefly, functional supFG1 genes suppress the nonsense mutations in the host bacteria -galactosidase gene yielding blue plaques in the presence of IPTG and X-Gal. If however a mutation occurs in the supFG1 gene, the amber mutation will not be suppressed and the resulting plaque will be white. Mutation frequency was calculated by dividing the number of colorless mutant plaques by the total number of plaques counted. Experiments were done in triplicate and standard errors were calculated for the mutation frequencies as indicated by the error bars.
(63) Statistical Analysis. Differences in the mean number of H2AX foci/cell, the number of apoptotic cells, and tail moment were analyzed by one way Anova and tukey test as posthoc. All statistical analyses were performed using Graphpad Prism software. ***p<0.001, **p<0.01, *p<0.05
Example 2
Triplex-Induced Apoptosis
(64) Triplex Induced Cell Death
(65) Using an assay to measure the induction of repair synthesis, research has determined that TFOs create a helical distortion upon binding to duplex DNA that strongly provokes DNA repair (6,7). Additional studies have confirmed the importance of the NER pathway in the recognition and repair of TFO-induced DNA alterations (7,20). In order to investigate the potential for helical distortions to induce apoptosis in cells, we generated a mouse epithelial cell line (AV16) with 100 copies of randomly integrated chromosomal triplex target sites (
(66) Following this validation, we proceeded to examine whether triplex formation was capable of inducing death in cells with multiple TFO target sites. The parental cell line, C127, which lacks the target site, served as a control to assess the possibility of non-specific oligonucleotide interactions that could result in cell death. Forty-eight hours after treatment, monolayer growth assays demonstrated a decrease in cell growth that correlated with the formation of triplex structures, suggesting that DNA helical distortions can lead to cell death (
(67) In order to investigate the possibility that the observed cell death could be attributed to G-quadruplex formation (23-25), A8G30 was designed with the same sequence as AG30 but with every third guanine substituted with the modified guanine base, 7-deaza-8-aza-guanine (PPG or G) (
(68) Triplex Induced Apoptosis
(69) Studies were then initiated to determine whether the increase in cell death observed in the survival assays following TFO treatment resulted from the activation of a pro-apoptotic pathway. AV16 cells were treated with a mock transfection, MIX30, or AG30 and analyzed for induction of apoptosis 24 hrs post treatment by detection of Annexin-V binding using flow cytometry. Annexin-V binding to exposed phosphatidylserine residues in the cell membrane is an early marker of apoptosis and 23% of the AG30-treated cells were determined to be Annexin-V positive as a result of triplex induced helical distortions (
(70) To test the impact of multiple triplex structure formation on the level of induced apoptosis, AV16 cells were exposed to increasing concentrations of AG30. As shown in
(71) Triplex-Induced DSBs
(72) To determine whether TFO-induced altered helical structures can act as a fragile site resulting in DSBs, we performed neutral comet assays. Single cell comets were observed microscopically after separation of DNA fragments from the cells by electrophoresis (
(73) Histone variant H2AX becomes phosphorylated on serine139 (H2AX) in response to DNA damage that involves formation of DSBs (28) and foci formation is frequently used as a quantitative marker for DSBs in immunofluorescence microscopy (29). The presence of triplex-induced DSBs was also determined by co-staining for H2AX and DAPI 24 hrs after treatment (
(74) To ensure that the presence of H2AX foci was truly a hallmark of DSBs and not generated in the course of DNA fragmentation during apoptosis, we utilized a multiparameter cytometry assay (30-32). The presence of triplex-induced DSBs was determined using flow cytometry by staining for H2AX in the presence of propidium iodine. H2AX expression attributed to DSBs is cell cycle independent, while high intense H2AX expression in S-phase is associated with apoptosis (30). Cells were harvested 6 hrs and 24 hrs after treatment with AG30. Flow cytometry analysis of H2AX expression during the cell cycle indicated increased levels of H2AX in all phases of the cell cycle of AV16 cells 6 hrs after exposure to AG30 (
(75) In Vivo Generation of Triplex-Induced DSBs
(76) To evaluate the potential for triplex DNA to induce DSBs in vivo, we utilized a transgenic mouse model (AV mouse), with 50 copies of the triplex target sequence chromosomally integrated into its genome (
(77) NER Deficiency Results in Increased Apoptosis Levels
(78) Activation of apoptosis in response to DNA damage provides a default mechanism that can be implemented to prevent clonal expansion of cells with unrepaired damage. As a result, studies were initiated to investigate cellular response to triplex-induced DSBs under circumstances where cells may be ineffective at repair. XPA is a key NER factor responsible for verifying altered DNA conformations, and is crucial for correct assembly of the remaining repair machinery around a lesion (33). Previous studies have determined that TFOs were capable of binding to duplex DNA and creating altered helical structures that strongly provoked XPA-dependent DNA repair. To investigate whether triplex formation induced DSBs in an XPA-dependent manner, we treated XPA-proficient and XPA-deficient mouse fibroblast cells with a mock transfection, MIX30 or AG30. Cells were harvested 24 hrs following treatment and through the use of flow cytometry, we evaluated the levels of triplex-induced DNA strand breaks by staining for H2AX. Analysis of H2AX expression levels as a measure of double strand break formation indicated increased levels of H2AX in both the XPA-proficient anddeficient cells following AG30-treatment (
(79) We then proceeded to evaluate induced apoptosis levels as a result of triplex-induced DNA strand breaks in XPA-deficient cells. XPA-deficient cells were treated with a mock transfection, MIX30, or AG30 and analyzed for the induction of apoptosis. Following 24 hr administration of AG30, 55% of the deficient cells were determined to be Annexin V positive compared to 32% of the AG30-treated NER-proficient cells (
(80) XPD Requirement for Triplex-Induced Apoptosis
(81) After determining that activation of apoptosis was a cellular response to extensive triplex-induced DNA strand breaks both in vitro and in vivo, we were interested in determining which proteins were involved in maintaining the switch from DNA repair to apoptosis. We hypothesized that a dual role NER protein like XPD, which contributes to genomic stability by participating in both repair and apoptosis, may also aid in triggering the cell to activate a pro-apoptotic pathway in the presence of excessive triplex-induced DNA double strand breaks. AV16 cells proficient or deficient for XPD were treated with AG30 and analyzed for the activation of apoptosis. As expected, monolayer growth assays demonstrated a decrease in cell survival in the XPD-proficient cells (
(82) XPD helicase mediates strand separation at the site of the DNA lesion (34). In addition, tumor suppressor p53, a central component of apoptosis, can bind to and inhibit its helicase activity. After AG30 treatment, we determined by Western blot that an increase in p53 protein levels corresponded to increased caspase-3 mediated cleavage of PARP in XPD-proficient cells (
(83) To investigate whether the differential induction of apoptosis in XPD-proficient and deficient cells was the hallmark of a differential induction of DNA damage, we performed neutral comet assays. As shown, in
(84) Recruitment of XPD to the DSB Site
(85) XPD has been implicated in our studies to occupy an important role in activating apoptosis in response to triplex-induced DSBs. To determine whether XPD protein interacts with H2AX foci, we treated AV16 cells with MIX30 or AG30. Confocal microscopy analysis indicates co-localization of XPD with H2AX foci following treatment with the TFO, AG30 (
(86) In order to verify that XPD-depletion did not inhibit the formation of H2AX foci, thus resulting in a reduction in triplex-induced apoptosis, we evaluated H2AX foci formation in XPD-proficient and deficient cells following TFO treatment using immunofluorescene (
(87) Activation of Apoptosis Preserves Genomic Integrity
(88) Apoptosis plays an important role in maintaining genomic integrity by providing a mechanism by which a cell can actively control its own death in response to a variety of DNA-damaging stimuli. Xia et al. (38) and Cook et al. (39) have independently discovered that the phosphorylation status of the tyrosine 142 residue (Y142) of H2AX is critical in determining the relative recruitment of either DNA repair or pro-apoptotic factors to the site of DSBs. Both groups demonstrate that unlike 5139, Y142 is phosphorylated in normal undamaged cells. When repair is possible following DNA damage, Y142 is gradually dephosphorylated, allowing the H2AX (S139 phosphorylation) modification and the recruitment of repair factors to occur. However, in cases where DNA damage is excessive Y142-phosphorylated H2AX persists in the presence of S139 phosphorylation. This doubly phosphorylated H2AX recruits pro-apoptotic factors like the JNK complex, an established inducer of apoptosis.
(89) To establish a role for Y142 phosphorylation in regulation of the apoptotic response following triplex-induced DNA strand breaks, we probed both H2AX phosphorylation sites by Western blot analysis. NER-proficient and XPA-deficient cells were treated with AG30 and 24 hrs post-treatment cell lysates were prepared. As we observed in our previous experiments (
(90) XPD-proficient and siRNA XPD-depleted cells were also treated with AG30 and 24 hrs post-treatment cell lysates were prepared. As we observed in our previous experiments, when AV16 cells were XPD-depleted using siRNA there was a decrease in the level of apoptotic cells (
(91) Following confirmation that apoptosis plays a key role in processing triplex-induced DNA DSBs, we proceeded to investigate its importance in preserving genomic integrity. Site-directed mutagenesis induced by triplex structures has been established in vitro and in vivo (40,41). Because cells defective in apoptosis tend to survive with excess damage, we examined the effect of XPD-depletion on triplex-induced genomic instability. Using an assay for targeted mutagenesis in mammalian cells, we evaluated triplex-induced mutations using AV16 cells, which contain 100 copies of the supFG1 shuttle vector DNA in a chromosomal locus. Through the use of packaging extracts, the vector DNA can be isolated from genomic DNA into phage particles and subsequently analyzed for induced mutations. SupFG1 not only encodes an amber suppressor tRNA whose function can be scored in indicator bacteria, but also contains the AG30 triplex-binding site (16).
(92) AV16 and AV16 XPD-19-1 cells, which stably expressed XPD shRNA (
DISCUSSION
(93) Cells are faced with the fundamental decision of activating the appropriate ratio of DNA repair and apoptosis in response to damage. Data presented herein suggest that the TFIIH protein, XPD is involved in maintaining the balance between these two outcomes in response to the formation of altered helical structures. Thus, we provide evidence that the NER pathway is not only necessary for the repair of triplex structures, but is also important in the activation of pro-apoptotic pathways in response to helical distorting DNA structures. A key question exists as to how the cell determines when damage is excessive and how this determination triggers the shift from repair to apoptosis. The present study indicates that the absence of XPD results in a decrease in phosphorylation of the tyrosine 142 residue of H2AX in addition to p53. Recent work has determined that a balance between the kinase activity of WSTF and the phosphatase activity of Eya proteins help to regulate cellular fate following DNA damage (38,39). When repair is possible Y142 must be de-phosphorylated by Eya to allow for 5139 phosphorylation and recruitment of repair proteins. Otherwise, Y142 phosphorylation persists causing the cell to activate apoptosis, thus eliminating the cells with irreversible damage.
(94) Although studies indicate that Y142 is gradually de-phosphorylated after DNA damage, it is possible that Y142 is re-phosphorylated after futile attempts to repair the excessive DNA damage in order to facilitate apoptosis. It is theoretically possible that if XPD is not present to trigger the switch to activate apoptosis, this re-phosphorylation does not take place and the remaining DNA damage response proteins necessary for apoptosis are not recruited. Chymkowitch et al have recently shown that the TFIIH complex is able to phosphorylate the androgen receptor at position AR/S515 via cdk7 (42). Additionally, mutations in the C-terminal domain of XPD were found to disturb the architecture of TFIIH leading to the dysregulation of cdk7-related phosphorylation (43,44). Taken together, these findings along with our result that XPD co-localizes with H2AX provide support for an XPD-dependent apoptotic pathway.
(95) The XPD protein has been identified as having a role in NER, transcription and possibly cell cycle. However, XPD also exists in non-TFIIH complexes, such as CAK-XPD and MMXD and has function in other cellular processes, including apoptosis. Knockdown of XPD did not reduce the intensity of triplex-induced DSBs or H2AX foci formation, although a significant decrease in apoptosis was observed. It is apparent from the work presented that key proteins, which contribute to cellular survival through their involvement in DNA repair, also participate in the mechanism that shifts the cell from DNA repair to apoptosis.
(96) Intramolecular triplex DNA structures exist transiently in genomic DNA and represent an endogenous source of genomic instability. Naturally occurring sequences capable of forming H-DNA are typically located in promoters and exons and are believed to be involved in the regulation of expression of several disease-linked genes (45-48). The human c-myc gene, which is often translocated and overexpressed in tumors, contains an H-DNA forming sequence in its promoter (45). Many breakpoints on the translocated c-myc gene are clustered around the H-DNA forming sequence in the promoter region in Burkitt's lymphoma (14). Studies suggest that non-canonical structures result in fragile sites or mutation hotspots, and can lead to double strand breaks (DSBs) and subsequent translocation of the gene. The maintenance of a mechanism by which the cell can actively determine cellular fate in response to the formation of these structures may be of central importance for avoiding progression to cancer, because the default mechanism of apoptosis prevents expansion of cells in which unrepaired damage would lead to mutation and to carcinogenesis. Additionally, XPD may be an integral component in determining the fate of cells assaulted by other NER-recognized DNA damage including those induced by UV. Work described herein highlights the complexity of the balance between DNA repair and apoptosis in response to damage induced by altered helical structures.
Example 3
Triplex-Induced Apoptosis in Breast Cancer
(97) The threshold for triplex-induced apoptosis in vivo can be determined using known methods and the molecular mechanisms responsible for the anticancer activity of HER2-targeted TFOs was characterized (
(98) The mechanisms involved in triplex-induced apoptosis were also assessed, with emphasis on DNA damage recognition and response pathways (
(99) The therapeutic efficacy of HER2-targeted TFOs to specifically suppress the growth and metastasis of HER2-positive breast tumors in vivo was also assessed by evaluating the antitumor activity of HER2-targeted TFOs in an athymic nude mouse model for HER2-positive breast cancer (
Example 4
Triplex Induced Apoptosis in Chemotherapeutic-Resistant Cancers
(100) Herceptin-resistance can be attributed in part to the activation of aberrant signaling pathways that compensate for the inhibition of HER2 cellular growth activity. Targeted drugs that utilize a mechanism of action that is independent of HER2 cellular function may avoid this form of acquired resistance. The feasibility of using gene-targeted apoptosis as a treatment strategy for Herceptin-resistant breast cancers is further assessed, for example, by testing the ability of the biologically active HER2-targeted TFOs to inhibit cell growth and induce apoptosis in Herceptin-resistant breast cancer cells. As shown in
Example 5
Triplex Induced Apoptosis in Ovarian Cancer Cells
(101) Susceptibility of HER2-positive ovarian cancer cells to gene-targeted apoptosis was determined using ovarian cancer cell lines. The cells were treated with the triplex forming oligonucleotide HER2-205 or the control oligonucleotide MIX24 and assessed for the induction of apoptosis. As shown in
REFERENCES
(102) 1. Bernstein, C., Bernstein, H., Payne, C. M. and Garewal, H. (2002) DNA repair/pro-apoptotic dual-role proteins in five major DNA repair pathways: fail-safe protection against carcinogenesis. Mutation research, 511, 145-178. 2. de Laat, W. L., Jaspers, N. G. and Hoeijmakers, J. H. (1999) Molecular mechanism of nucleotide excision repair. Genes & development, 13, 768-785. 3. Wang, X. W., Vermeulen, W., Coursen, J. D., Gibson, M., Lupold, S. E., Forrester, K., Xu, G., Elmore, L., Yeh, H., Hoeijmakers, J. H. et al. (1996) The XPB and XPD DNA helicases are components of the p53-mediated apoptosis pathway. Genes & development, 10, 1219-1232. 4. Robles, A. I., Wang, X. W. and Harris, C. C. (1999) Drug-induced apoptosis is delayed and reduced in XPD lymphoblastoid cell lines: possible role of TFIIH in p53-mediated apoptotic cell death. Oncogene, 18, 4681-4688. 5. Wang, X. W., Yeh, H., Schaeffer, L., Roy, R., Moncollin, V., Egly, J. M., Wang, Z., Freidberg, E. C., Evans, M. K., Taffe, B. G. et al. (1995) p53 modulation of TFIIH-associated nucleotide excision repair activity. Nature genetics, 10, 188-195. 6. Wang, G., Seidman, M. M. and Glazer, P. M. (1996) Mutagenesis in mammalian cells induced by triple helix formation and transcription-coupled repair. Science (New York, N. Y, 271, 802-805. 7. Rogers, F. A., Vasquez, K. M., Egholm, M. and Glazer, P. M. (2002) Site-directed recombination via bifunctional PNA-DNA conjugates. Proceedings of the National Academy of Sciences of the United States of America, 99, 16695-16700. 8. Watson, J. D. and Crick, F. H. (1974) Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid. J. D. Watson and F. H. C. Crick. Published in Nature, number 4356 Apr. 25, 1953. Nature, 248, 765. 9. Htun, H. and Dahlberg, J. E. (1988) Single strands, triple strands, and kinks in H-DNA. Science (New York, N. Y, 241, 1791-1796. 10. Voloshin, O. N., Mirkin, S. M., Lyamichev, V. I., Belotserkovskii, B. P. and Frank-Kamenetskii, M. D. (1988) Chemical probing of homopurine-homopyrimidine mirror repeats in supercoiled DNA. Nature, 333, 475-476. 11. Mirkin, S. M., Lyamichev, V. I., Drushlyak, K. N., Dobrynin, V. N., Filippov, S. A. and Frank-Kamenetskii, M. D. (1987) DNA H form requires a homopurine-homopyrimidine mirror repeat. Nature, 330, 495-497. 12. Schroth, G. P. and Ho, P. S. (1995) Occurrence of potential cruciform and H-DNA forming sequences in genomic DNA. Nucleic acids research, 23, 1977-1983. 13. Wang, G. and Vasquez, K. M. (2004) Naturally occurring H-DNA-forming sequences are mutagenic in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America, 101, 13448-13453. 14. Saglio, G., Grazia Borrello, M., Guerrasio, A., Sozzi, G., Serra, A., di Celle, P. F., Foa, R., Ferrarini, M., Roncella, S., Borgna Pignatti, C. et al. (1993) Preferential clustering of chromosomal breakpoints in Burkitt's lymphomas and L3 type acute lymphoblastic leukemias with a t(8;14) translocation. Genes, chromosomes & cancer, 8, 1-7. 15. Knauert, M. P., Lloyd, J. A., Rogers, F. A., Datta, H. J., Bennett, M. L., Weeks, D. L. and Glazer, P. M. (2005) Distance and affinity dependence of triplex-induced recombination. Biochemistry, 44, 3856-3864. 16. Rogers, F. A., Manoharan, M., Rabinovitch, P., Ward, D. C. and Glazer, P. M. (2004) Peptide conjugates for chromosomal gene targeting by triplex-forming oligonucleotides. Nucleic acids research, 32, 6595-6604. 17. Stachelek, G. C., Dalal, S., Donigan, K. A., Campisi Hegan, D., Sweasy, J. B. and Glazer, P. M. Potentiation of temozolomide cytotoxicity by inhibition of DNA polymerase beta is accentuated by BRCA2 mutation. Cancer research, 70, 409-417. 18. Rogers, F. A., Lin, S. S., Hegan, D. C., Krause, D. S. and Glazer, P. M. (2012) Targeted gene modification of hematopoietic progenitor cells in mice following systemic administration of a PNA-peptide conjugate. Molecular therapy: the journal of the American Society of Gene Therapy, 20, 109-118. 19. Gunther, E. J., Yeasky, T. M., Gasparro, F. P. and Glazer, P. M. (1995) Mutagenesis by 8-methoxypsoralen and 5-methylangelicin photoadducts in mouse fibroblasts: mutations at cross-linkable sites induced by offoadducts as well as cross-links. Cancer research, 55, 1283-1288. 20. Wang, G., Chen, Z., Zhang, S., Wilson, G. L. and Jing, K. (2001) Detection and determination of oligonucleotide triplex formation-mediated transcription-coupled DNA repair in HeLa nuclear extracts. Nucleic acids research, 29, 1801-1807. 21. Macris, M. A. and Glazer, P. M. (2003) Transcription dependence of chromosomal gene targeting by triplex-forming oligonucleotides. The Journal of biological chemistry, 278, 3357-3362. 22. Johnson, M. D., 3rd and Fresco, J. R. (1999) Third-strand in situ hybridization (TISH) to non-denatured metaphase spreads and interphase nuclei. Chromosoma, 108, 181-189. 23. Schwartz, T. R., Vasta, C. A., Bauer, T. L., Parekh-Olmedo, H. and Kmiec, E. B. (2008) G-rich oligonucleotides alter cell cycle progression and induce apoptosis specifically in OE19 esophageal tumor cells. Oligonucleotides, 18, 51-63. 24. Qi, H., Lin, C. P., Fu, X., Wood, L. M., Liu, A. A., Tsai, Y. C., Chen, Y., Barbieri, C. M., Pilch, D. S. and Liu, L. F. (2006) G-quadruplexes induce apoptosis in tumor cells. Cancer research, 66, 11808-11816. 25. Do, N. Q., Lim, K. W., Teo, M. H., Heddi, B. and Phan, A. T. (2011) Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Nucleic acids research, 39, 9448-9457. 26. Kutyavin, I. V., Lokhov, S. G., Afonina, I. A., Dempcy, R., Gall, A. A., Gorn, V. V., Lukhtanov, E., Metcalf, M., Mills, A., Reed, M. W. et al. (2002) Reduced aggregation and improved specificity of G-rich oligodeoxyribonucleotides containing pyrazolo[3,4-d]pyrimidine guanine bases. Nucleic acids research, 30, 4952-4959. 27. Shah, G. M., Shah, R. G. and Poirier, G. G. (1996) Different cleavage pattern for poly(ADP-ribose) polymerase during necrosis and apoptosis in HL-60 cells. Biochemical and biophysical research communications, 229, 838-844. 28. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S. and Bonner, W. M. (1998) DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. The Journal of biological chemistry, 273, 5858-5868. 29. Fernandez-Capetillo, O., Lee, A., Nussenzweig, M. and Nussenzweig, A. (2004) H2AX: the histone guardian of the genome. DNA repair, 3, 959-967. 30. Huang, X., Okafuji, M., Traganos, F., Luther, E., Holden, E. and Darzynkiewicz, Z. (2004) Assessment of histone H2AX phosphorylation induced by DNA topoisomerase I and II inhibitors topotecan and mitoxantrone and by the DNA cross-linking agent cisplatin. Cytometry. Part A: the journal of the International Society for Analytical Cytology, 58, 99-110. 31. Cleaver, J. E. (2011) gammaH2Ax: biomarker of damage or functional participant in DNA repair all that glitters is not gold!. Photochemistry and photobiology, 87, 1230-1239. 32. Huang, X., Halicka, H. D., Traganos, F., Tanaka, T., Kurose, A. and Darzynkiewicz, Z. (2005) Cytometric assessment of DNA damage in relation to cell cycle phase and apoptosis. Cell proliferation, 38, 223-243. 33. Batty, D. P. and Wood, R. D. (2000) Damage recognition in nucleotide excision repair of DNA. Gene, 241, 193-204. 34. de Boer, J., Donker, I., de Wit, J., Hoeijmakers, J. H. and Weeda, G. (1998) Disruption of the mouse xeroderma pigmentosum group D DNA repair/basal transcription gene results in preimplantation lethality. Cancer research, 58, 89-94. 35. Kapoor, M., Hamm, R., Yan, W., Taya, Y. and Lozano, G. (2000) Cooperative phosphorylation at multiple sites is required to activate p53 in response to UV radiation. Oncogene, 19, 358-364. 36. Shieh, S. Y., Ikeda, M., Taya, Y. and Prives, C. (1997) DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell, 91, 325-334. 37. Steegenga, W. T., van der Eb, A. J. and Jochemsen, A. G. (1996) How phosphorylation regulates the activity of p53. Journal of molecular biology, 263, 103-113. 38. Xiao, A., Li, H., Shechter, D., Ahn, S. H., Fabrizio, L. A., Erdjument-Bromage, H., Ishibe-Murakami, S., Wang, B., Tempst, P., Hofmann, K. et al. (2009) WSTF regulates the H2A.X DNA damage response via a novel tyrosine kinase activity. Nature, 457, 57-62. 39. Cook, P. J., Ju, B. G., Telese, F., Wang, X., Glass, C. K. and Rosenfeld, M. G. (2009) Tyrosine dephosphorylation of H2AX modulates apoptosis and survival decisions. Nature, 458, 591-596. 40. Vasquez, K. M., Narayanan, L. and Glazer, P. M. (2000) Specific mutations induced by triplex-forming oligonucleotides in mice. Science (New York, N. Y, 290, 530-533. 41. Vasquez, K. M., Wang, G., Havre, P. A. and Glazer, P. M. (1999) Chromosomal mutations induced by triplex-forming oligonucleotides in mammalian cells. Nucleic acids research, 27, 1176-1181. 42. Chymkowitch, P., Le May, N., Charneau, P., Compe, E. and Egly, J. M. The phosphorylation of the androgen receptor by TFIIH directs the ubiquitin/proteasome process. The EMBO journal, 30, 468-479. 43. Keriel, A., Stary, A., Sarasin, A., Rochette-Egly, C. and Egly, J. M. (2002) XPD mutations prevent TFIIH-dependent transactivation by nuclear receptors and phosphorylation of RARalpha. Cell, 109, 125-135. 44. Compe, E., Drane, P., Laurent, C., Diderich, K., Braun, C., Hoeijmakers, J. H. and Egly, J. M. (2005) Dysregulation of the peroxisome proliferator-activated receptor target genes by XPD mutations. Molecular and cellular biology, 25, 6065-6076. 45. Kinniburgh, A. J. (1989) A cis-acting transcription element of the c-myc gene can assume an H-DNA conformation. Nucleic acids research, 17, 7771-7778. 46. Pestov, D. G., Dayn, A., Siyanova, E., George, D. L. and Mirkin, S. M. (1991) H-DNA and Z-DNA in the mouse c-Ki-ras promoter. Nucleic acids research, 19, 6527-6532. 47. Bacolla, A., Jaworski, A., Connors, T. D. and Wells, R. D. (2001) Pkd1 unusual DNA conformations are recognized by nucleotide excision repair. The Journal of biological chemistry, 276, 18597-18604. 48. Belotserkovskii, B. P., De Silva, E., Tornaletti, S., Wang, G., Vasquez, K. M. and Hanawalt, P. C. (2007) A triplex-forming sequence from the human c-MYC promoter interferes with DNA transcription. The Journal of biological chemistry, 282, 32433-32441.