QPCR-BASED METHOD TO ASSESS T CELL FUNCTION
20170058353 ยท 2017-03-02
Inventors
Cpc classification
C12N5/0638
CHEMISTRY; METALLURGY
A61K40/15
HUMAN NECESSITIES
C12Q2600/106
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides a method of determining T cell function in a subject in need of immunotherapy comprising: i) providing a blood sample comprising a population of T cells from the subject; ii) activating the T cells in the sample; and iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
Claims
1. A method of determining T cell function in a subject in need of immunotherapy comprising: i) providing a blood sample comprising a population of T cells from the subject; ii) activating the T cells in the sample; and iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
2. The method of claim 1, wherein the blood sample comprises isolated peripheral blood mononuclear cells (PBMC).
3. The method of any of claims 1-2, wherein the subject is afflicted with a disease.
4. The method of any of claims 1-2, wherein the subject has an infection.
5. The method of claim 4, wherein the disease is cancer.
6. The method of claim 5, wherein the cancer is selected from the group consisting of breast cancer; bladder cancer; lung cancer; prostate cancer; thyroid cancer; leukaemia, lymphoma, CLL (chronic lymphocytic leukemia), CML (chronic myelocytic leukaemia), ALL (acute lymphoblastic leukaemia), AML (acute myelocytic leukaemia), PML (pro-myelocytic leukaemia), T-cell lymphoma, colon cancer; glioma; seminoma; liver cancer; pancreatic cancer; bladder cancer; renal cancer; cervical cancer; testicular cancer; head and neck cancer; ovarian cancer; neuroblastoma and melanoma.
7. The method of claim 4, wherein the infection is a bacterial infection, a viral infection, or a parasitic infection.
8. The method of claim 7, wherein the infection is a bacterial infection from a bacteria selected from the group consisting of Helicobacter pylori, Chlamydia pneumoniae, Chlamydia trachomatis, Ureaplasma urealyticum, Mycoplasma pneumoniae, Staphylococcus spp., Staphylococcus aureus, Streptococcus spp., Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus viridans, Enterococcus faecalis, Neisseria meningitidis, Neisseria gonorrhoeae, Bacillus anthracia, Salmonella spp., Salmonella typhi, Vibrio cholera, Pasteurella pestis, Pseudomonas aeruginosa, Campylobacter spp., Campylobacter jejuni, Clostridium spp., Clostridium difficile, Mycobacterium spp., Mycobacterium tuberculosis, Treponema spp., Borrelia spp., Borrelia burgdorferi, Leptospria spp., Hemophilus ducreyi, Corynebacterium diphtheria, Bordetella pertussis, Bordetella parapertussis, Bordetella bronchiseptica, hemophilus influenza, Escherichia coli, Shigella spp., Erlichia spp., and Rickettsia spp.
9. The method of claim 7, wherein the infection is a parasitic infection.
10. The method of claim 9, wherein the subject has a parasitic infection selected from the group consisting of amebiasis from Entamoeba histolytica, amebic meningoencephalitis from the genus Naegleria or Acanthamoeba, malaria from Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium falciparum, leishmaniasis from protozoa Leishmania donovani, Leishmania infantum, Leishmania chagasi, Leishmania tropica, Leishmania major, Leishmania aethiopica, Leishmania mexicana, and Leishmania braziliensis, Chagas' disease from the protozoan Trypanosoma cruzi, sleeping sickness from Trypanosoma brucei, Trypanosoma gambiense, and Trypanosoma rhodesiense, toxoplasmosis from Toxoplasma gondii, giardiasis from Giardia lamblia, cryptosporidiosis from Cryptosporidium parvum, trichomoniasis from Trichomonas vaginalis, Trichomonas tenax, Trichomonas hominis, pneumocystis pneumonia from Pneumocystis carinii, bambesosis from Bambesia microti, Bambesia divergens, and Bambesia boris.
11. The method of claim 7, wherein the infection is a viral infection caused by any one of a member of the Adenoviridae family, a member of the Coronavirus family, a member of the Picornaviridae family, a member of the Herpesviridae family, a member of the Hepadnaviridae family, a member of the Flaviviridae family, a member of the Retroviridae family, a member of the Orthomyxoviridae family, a member of the Paramyxoviridae family, a member of the Papovaviridae family, a member of the Rhabdoviridae family, or a member of the Togaviridae family
12. The method of any of claims 1-11, wherein the T cells are Natural Killer T cells.
13. The method of any of claims 1-12, wherein the subject is a mammal
14. The method of any of claims 1-13, wherein the mammal is selected from the group consisting of a human, mouse, rat, guinea pig, cat, dog, horse, cow, sheep or pig.
15. The method of any of claims 1-14 wherein the T cells are activated by CD1d bound to ligand.
16. The method of claim 15, wherein the CD1d bound ligand is selected from the group consisting of C-glycosidific form of alpha-galactosylceramide (-C-GalCer, alpha-galactosylceramide (-GalCer), 12 carbon acyl form of galactosylceramide (-GalCer (C12)), -D-glucopyranosylceramide (-GlcCer), 1,2diacyl-3-O-galactosyl-sn-glycerol (BbGL-II), diacylglycerol containing glycolipids (Glc-DAG-s2), Ganglioside (GD3), gangliotriaosylceramide (Gg3Cer), glycosylphosphatidylinositol (GPI), alpha-glucuronosylceramide (GSL-1), alpha-glucuronosylceramide (GSL-4), house dust extract+ovalbumin (HDE+OVA), isoglobotrihexosylceramide (iGb3), lipophosphoglycan (LPG), lyosphosphatidylcholine (LPC), alpha-galactosylceramide analog (OCH), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), PI dimannoside (PIM4), phenyl pentamethyldihydrobenzofuran sulfonates (PPBF), sulfatide, phosphatidylserine (PS), threitolceramide and combinations thereof.
17. The method of any of claims 1-16, wherein the method further comprises assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) from control T cells that have not been activated.
18. The method of any of claims 17, wherein the method comprises comparing the expression level of one or more T cell activation markers from the activated with the expression level of one or more T cell activation markers from control T cells.
19. The method of claim 17, wherein the activated T cells and the control T cells are from the same subject.
20. The method of any of claims 1-19, further comprising obtaining or assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) from a control, healthy subject.
21. The method of any of claims 1-20, wherein the method further comprises comparing the expression level of one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy with the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject.
22. The method of any of claims 1-21, further comprising administering to the subject an effective amount of immunotherapy.
23. The method of any of claims 1-22, wherein if the expression level of the one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy is at least 30% of the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject, then the subject in need of immunotherapy is administered an effective amount of immunotherapy.
24. The method of any of claims 1-21, wherein the subject is not administered an immunotherapy when the expression level of the one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy is below 10% of the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject.
25. The method of any of claims 1-24, wherein PBMC are isolated using Ficoll density gradient.
26. The method of any of claims 1-25, wherein approximately 10.sup.6 PBMC cells are stimulated.
27. The method of any of claims 1-26, wherein the T cells are stimulated with CD1d bound to -GalCer.
28. The method of any of claims 1-26, wherein the T cells are stimulated with an antigen presenting cell comprising CD1d.
29. The method of any of claims 1-26, wherein the T cells are stimulated with an antigen presenting cell comprising CD1d bound to -GalCer.
30. The method of any of claims 1-26, wherein the T cells are stimulated with an artificial antigen presenting cell.
31. The method of any of claims 1-26, wherein the T cells are stimulated with an artificial antigen presenting cell comprising CD1d bound to -GalCer.
32. The method of claim 30, wherein the artificial antigen presenting cell comprises a magnetic bead loaded with CD1d bound to ligand.
33. The method of claim 32, wherein the ligand is -GalCer.
34. The method of any of claims 1-26, wherein the total T cells are stimulated with an antigen presenting cell comprising anti-CD3 and anti-CD28.
35. The method of claim 30, wherein the artificial antigen presenting cell comprises a magnetic bead loaded with anti-CD3 and anti-CD28.
36. The method of any of claims 1-35, wherein the T cells are stimulated from 2-8 hours at 37 C.
37. The method of any of claims 1-36, wherein the T cells are stimulated for about 4 hrs at 37 C.
38. The method of any of claims 1-37, wherein the one or more T cell activation markers is selected from the group consisting of IFN-, TNF-, and GM-CSF.
39. The method of any of claims 1-38, wherein the one or more T cell activation markers is induced at least 5-fold over cells that have not been activated.
40. The method of any of claims 1-39, wherein the one or more T cell activation markers is induced at least 10-fold over cells that have not been activated.
41. A method of determining NKT cell function in a subject in need of immunotherapy comprising: i) providing a blood sample comprising a population of T cells from the subject; ii) activating the NKT cells in the sample with an artificial antigen presenting cell comprising CD1d bound to -GalCer; and iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
42. A method of determining total T cell function in a subject in need of immunotherapy comprising: i) providing a blood sample comprising a population of T cells from the subject; ii) activating the total T cells in the sample with an artificial antigen presenting cell comprising anti-CD3 and anti-CD28; and iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
44. A method of determining NKT cell function in a subject comprising: i) providing a blood sample comprising a population of T cells from the subject; ii) activating the NKT cells in the sample; and iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample, wherein the subject has a disease wherein NKT cells are aberrantly activated.
45. The method of claim 44, wherein the subject has a disease selected from the group consisting of asthma, psoriasis, and atherosclerosis.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
DETAILED DESCRIPTION
[0044] Reference will now be made in detail to embodiments of the invention which, together with the drawings and the following examples, serve to explain the principles of the invention. These embodiments describe in sufficient detail to enable those skilled in the art to practice the invention, and it is understood that other embodiments may be utilized, and that structural, biological, and chemical changes may be made without departing from the spirit and scope of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.
[0045] One skilled in the art may refer to general reference texts for detailed descriptions of known techniques discussed herein or equivalent techniques. These texts include Current Protocols in Molecular Biology (Ausubel et. al., eds. John Wiley & Sons, N.Y. and supplements thereto), Current Protocols in Immunology (Coligan et al., eds., John Wiley St Sons, N.Y. and supplements thereto), Current Protocols in Pharmacology (Enna et al., eds. John Wiley & Sons, N.Y. and supplements thereto) and Remington: The Science and Practice of Pharmacy (Lippincott Williams & Wilicins, 2Vt edition (2005)), for example.
[0046] Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341).
[0047] For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of the word a or an when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one. The use of the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and and/or. As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Furthermore, where the description of one or more embodiments uses the term comprising, those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language consisting essentially of and/or consisting of. As used herein, the term about means at most plus or minus 10% of the numerical value of the number with which it is being used.
[0048] The present invention is based on the discovery of a sensitive method to rapidly assess T cell function in patients. In some embodiments, the method can be used to assay total T cell function. In other embodiments, NKT cell function can be assayed. The assay has particular utility in patients prior to undergoing immunotherapy. The assay also has particular relevance as a diagnostic or prognostic in various disease conditions where T cells or NKT cells are aberrantly activated. For example, in asthma, psoriasis, and atherosclerosis, NKT cells have been shown to be aberrantly activated. In some embodiments, the method could be used to detect the abnormal (over) activation of NKT cells and could be useful as a diagnostic or prognostic test.
[0049] In some embodiments, the methods can be performed prior to immunotherapy to assay baseline levels of T cell, and/or NKT cell activation in order to determine which patients may benefit from T cell-based therapies. NKT cells comprise a rare, but important subset of T cells which account for 0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells can be approximately 50% lower or more in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. Accordingly, it is currently difficult to determine which patients would benefit from T cell or NKT cell-based immunotherapy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy, thus the goal of this study was to develop a sensitive method to rapidly assess NKT cell function. Artificial antigen presenting cells were utilized in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. It was found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPC can be used as a novel tool in adoptive immunotherapeutic strategies.
[0050] In some embodiments, the invention provides a method of determining T cell function in a subject comprising:
[0051] i) providing a blood sample comprising a population of T cells from the subject;
[0052] ii) activating the T cells in the sample; and
[0053] iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
[0054] In some embodiments, the invention provides a method of determining NKT cell function in a subject in need of immunotherapy comprising:
[0055] i) providing a blood sample comprising a population of T cells from the subject;
[0056] ii) activating the NKT cells in the sample with an artificial antigen presenting cell comprising CD1d bound to -GalCer; and
[0057] iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
[0058] In some embodiments, the invention provides a method of determining total T cell function in a subject in need of immunotherapy comprising:
[0059] i) providing a blood sample comprising a population of T cells from the subject;
[0060] ii) activating the total T cells in the sample with an artificial antigen presenting cell comprising anti-CD3 and anti-CD28; and
[0061] iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample.
[0062] In some embodiments, the invention provides a method of determining T cell function in a subject comprising:
[0063] i) providing a blood sample comprising a population of T cells from the subject;
[0064] ii) activating the T cells in the sample; and
[0065] iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample, wherein the subject has a disease wherein T cells are aberrantly activated.
[0066] In some embodiments, the invention provides a method of determining NKT cell function in a subject comprising:
[0067] i) providing a blood sample comprising a population of T cells from the subject;
[0068] ii) activating the NKT cells in the sample; and
[0069] iii) assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) after activating the T cells in the sample, wherein the subject has a disease wherein NKT cells are aberrantly activated. In some embodiments, the subject has a disease selected from the group consisting of asthma, psoriasis, and atherosclerosis.
[0070] The subject whose T cells will be activated and assayed is not limiting. In some embodiments, the subject is in need of immunotherapy for one or more diseases or conditions. In some embodiments, the subject has a disease or condition where T cells are aberrantly activated. In some embodiments, the subject is a normal, healthy subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is selected from the group consisting of a human, mouse, rat, guinea pig, cat, dog, horse, cow, sheep or pig.
[0071] In some embodiments, the expression level of the one or more T cell activation markers is compared between a subject in need of immunotherapy for one or more diseases or conditions and a normal, healthy subject.
[0072] In some embodiments, the expression level of the one or more T cell activation markers is compared between a subject having a disease in which T cells are aberrantly activated and a normal, healthy subject.
[0073] The blood sample comprising a population of T cells is not limiting. In some embodiments, the blood sample can include whole blood or fractionated blood comprising a population of T cells. In some embodiments, the blood sample comprising a population of T cells is an isolated peripheral blood mononuclear cell sample (PBMC). PBMC can be prepared using known methods and techniques. In some embodiments, PBMC can be isolated by Ficoll-Hypaque (Amersham Pharmacia Biotek, Uppsala, Sweden) density gradient centrifugation. In some embodiments, approximately 10.sup.6 PBMC cells are stimulated. In some embodiments, the T cells are stimulated from 2-8 hours at 37 C. In some embodiments, the T cells are stimulated for about 4 hrs at 37 C.
[0074] In some embodiments, NKT cells are activated and the expression level of one or more NKT cell activation markers is assayed. NKT cells can recognize lipid or glycolipid antigen in the context of CD1d molecules and subsequently produce cytokines that activate cells of both the innate and adaptive immune responses. In some embodiments, the NKT cells are activated by CD1d bound to a lipid or glycolipid ligand. In some embodiments, the NKT cells are activated with CD1d bound to ligand on present on antigen presenting cells. Antigen presenting cells can include various cell types including cells as dendritic cells and macrophages. In some embodiments, the antigen presenting cells are the subjects own dendritic cells.
[0075] The CD1d bound ligand is not limiting provided it is able to activate NKT cells when to CD1d. In some embodiments, the CD1d bound ligand is selected from the group consisting of C-glycosidific form of alpha-galactosylceramide (-C-GalCer, alpha-galactosylceramide (-GalCer), 12 carbon acyl form of galactosylceramide (-GalCer (C12)), -D-glucopyranosylceramide (-GlcCer), 1,2-diacyl-3-O-galactosyl-sn-glycerol (BbGL-II), diacylglycerol containing glycolipids (Glc-DAG-s2), Ganglioside (GD3), gangliotriaosylceramide (Gg3Cer), glycosylphosphatidylinositol (GPI), alpha-glucuronosylceramide (GSL-1), alpha-glucuronosylceramide (GSL-4), house dust extract+ovalbumin (HDE+OVA), isoglobotrihexosylceramide (iGb3), lipophosphoglycan (LPG), lyosphosphatidylcholine (LPC), alpha-galactosylceramide analog (OCH), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), PI dimannoside (PIM4), phenyl pentamethyldihydrobenzofuran sulfonates (PPBF), sulfatide, phosphatidylserine (PS), threitolceramide and combinations thereof.
[0076] In some embodiments, the NKT cells are stimulated with an antigen presenting cell comprising CD1d. In some embodiments, the NKT cells are stimulated with an antigen presenting cell comprising CD1d bound to -GalCer. In some embodiments, the NKT cells are stimulated with an artificial antigen presenting cell comprising CD1d. In some embodiments, the NKT cells are stimulated with an artificial antigen presenting cell comprising CD1d bound to -GalCer. In some embodiments, the artificial antigen presenting cell comprises a magnetic bead loaded with CD1d bound to ligand.
[0077] In some embodiments, the ligand is added directly to the blood sample where it will become associated with endogenous CD1d present on cells in the sample and thereby activate NKT cells. In some embodiments, the ligand is combined with antigen presenting cells prior to addition to the blood sample. In some embodiments, the ligand and antigen presenting cells are added separately to the blood sample.
[0078] In some embodiments, artificial antigen presenting cells (aAPC) are used to activate total T cells or NKT cells. In some embodiments, where NKT cells are activated, the aAPC comprise CD1d loaded beads which, when combined with a ligand to bind CD1d, are able to bind to NKT cells and induce their activation. In some embodiments, the CD1D-based aAPC can be prepared as described in Shiratsuchi et al., J Immunol Methods 345, 49-59 (2009) or Webb et al., J Immunol Methods 346, 38-44 (2009) which are incorporated herein by reference. In some embodiments of making the aAPC for activating NKT cells, hCD1d-Ig (Pharmingen) can be added to epoxy beads (Dynal, product #140.01, Dynabeads, M-450, Epoxy, 410.sup.8 beads/ml) in sterile 0.1M Borate buffer, pH 7.0-7.4, in the presence of anti-CD28 mAb (Biolegend). The bead protein combination can be mixed with rotation and incubated for 24 h at 4 C. The beads can be subsequently washed and the hCD1d molecules loaded with 40 molar excess lipid antigen, such as -GalCer (Enzo) in PBS, calculated based on the amount of hCD1d-Ig protein added to the beads.
[0079] In some embodiments, the total T cells are stimulated with an antigen presenting cell. In some embodiments, the total T cells are stimulated with an artificial antigen presenting cell. In some embodiments, where total T cells are activated, anti-CD3 and anti-CD28 are added to microbeads for use as artificial antigen presenting cells. In some embodiments, about 20 g of each mAb (Biolegend) can be added to 410.sup.8 beads.
[0080] In some embodiments, the one or more T or NKT cell activation markers is selected from the group consisting of IFN-, TNF-, and GM-CSF. In one embodiment, the marker to be assayed is IFN-. In one embodiment, IFN- can be assayed using the following primer sequences: [0081] Forward primer AGCTCTGCATCGTTTTGGGTT (SEQ ID NO:1) [0082] Reverse primer GTTCCATTATCCGCTACATCTGAA (SEQ ID NO:2)
Assaying with these primers will give a product length of 118 base pair nucleic acid fragment.
[0083] In some embodiments, the subject is afflicted with a disease, such as cancer. In some embodiments, the subject has a cancer selected from the group consisting of breast cancer; bladder cancer; lung cancer; prostate cancer; thyroid cancer; leukaemia, lymphoma, CLL (chronic lymphocytic leukemia), CML (chronic myelocytic leukaemia), ALL (acute lymphoblastic leukaemia), AML (acute myelocytic leukaemia), PML (pro-myelocytic leukaemia), T-cell lymphoma, colon cancer; glioma; seminoma; liver cancer; pancreatic cancer; bladder cancer; renal cancer; cervical cancer; testicular cancer; head and neck cancer; ovarian cancer; neuroblastoma and melanoma.
[0084] In some embodiments, the subject has a bacterial infection, a viral infection, or a parasitic infection. In some embodiments, the infection is a bacterial infection from a bacteria selected from the group consisting of Helicobacter pylori, Chlamydia pneumoniae, Chlamydia trachomatis, Ureaplasma urealyticum, Mycoplasma pneumoniae, Staphylococcus spp., Staphylococcus aureus, Streptococcus spp., Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus viridans, Enterococcus faecalis, Neisseria meningitidis, Neisseria gonorrhoeae, Bacillus anthracia, Salmonella spp., Salmonella typhi, Vibrio cholera, Pasteurella pestis, Pseudomonas aeruginosa, Campylobacter spp., Campylobacter jejuni, Clostridium spp., Clostridium difficile, Mycobacterium spp., Mycobacterium tuberculosis, Treponema spp., Borrelia spp., Borrelia burgdorferi, Leptospria spp., Hemophilus ducreyi, Corynebacterium diphtheria, Bordetella pertussis, Bordetella parapertussis, Bordetella bronchiseptica, hemophilus influenza, Escherichia coli, Shigella spp., Erlichia spp., and Rickettsia spp.
[0085] In some embodiments, the subject has a parasitic infection. In some embodiments, the parasitic infection is selected from the group consisting of amebiasis from Entamoeba histolytica, amebic meningoencephalitis from the genus Naegleria or Acanthamoeba, malaria from Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium falciparum, leishmaniasis from protozoa Leishmania donovani, Leishmania infantum, Leishmania chagasi, Leishmania tropica, Leishmania major, Leishmania aethiopica, Leishmania mexicana, and Leishmania braziliensis, Chagas' disease from the protozoan Trypanosoma cruzi, sleeping sickness from Trypanosoma brucei, Trypanosoma gambiense, and Trypanosoma rhodesiense, toxoplasmosis from Toxoplasma gondii, giardiasis from Giardia lamblia, cryptosporidiosis from Cryptosporidium parvum, trichomoniasis from Trichomonas vaginalis, Trichomonas tenax, Trichomonas hominis, pneumocystis pneumonia from Pneumocystis carinii, bambesosis from Bambesia microti, Bambesia divergens, and Bambesia bovis.
[0086] In some embodiments, the subject has a helminthic infection, including from the species: Taenia solium, Taenia saginata, Diphyllobothrium lata, Echinococcus granulosus, Echinococcus multilocularis, Hymenolepis nana, Schistosoma mansomi, Schistosoma japonicum, Schistosoma hematobium, Clonorchis sinensis, Paragonimus westermani, Fasciola hepatica, Fasciolopsis buski, Heterophyes heterophyes, Enterobius vermicularis, Trichuris trichiura, Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichinella spiralis, Wuchereria bancrofti, Onchocerca volvulus, Loa loa, and Dracunculus medinensis.
[0087] In some embodiments, the subject has an infection from a fungal pathogen such as: Sporothrix schenckii, Coccidioides immitis, Histoplasma capsulatum, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Candida albicans, Cryptococcus neoformans, Aspergillus fumigatus, Aspergillus flavus, fungi of the genera Mucor and Rhizopus, Fusarium solani and species causing chromomycosis such as those of the genera Phialophora and Cladosporium.
[0088] In some embodiments, the subject has an infection from a veterinary protozoal pathogen such as: Babesia caballi, Babesia canis, Babesia equi, Babesia felis, Balantidium coli, Besnoitia darlingi, Eimeria acervulina, Eimeria adenoeides, Eimeria ahata, Eimeria alabamensis, Eimeria auburnensis, Eimeria bovis, Eimeria brasiliensis, Eimeria brunetti, Eimeria canadensis, Eimeria cerdonis, Eimeria crandallis, Eimeria cylindrica, Eimeria debliecki, Eimeria despersa, Eimeria ellipsoidalis, Eimeria fauvei, Eimeria gallopavonis, Eimeria gilruthi, Eimeria granulosa, Eimeria hagani, Eimeria illinoisensis, Eimeria innocua, Eimeria intricate, Eimeria leuskarti, Eimeria maxima, Eimeria meleagridis, Eimeria meleagrimitis, Eimeria mitis, Eimeria mivati, Eimeria necatrix, Eimeria neodebliecki, Eimeria ninakohlyakimorae, Eimeria ovina, Eimeria pallida, Eimeria parva, Eimeria perminuta, Eimeria porci, Eimeria praecox, Eimeria punctata, Eimeria scabs, Eimeria spinoza, Zimeria subrotunda, Eimeria subsherica, Eimeria suis, Eimeria tenella, Eimeria wyomingensis, Eimeria zuernii, Endolimax gregariniformis, Endolimax nana, Entamoeba bovis, Entamoeba gallinarum, Entamoeba histolytica, Entamoeba suis, Giardia bovis, Giardia canis, Giardia cati, Giardia lamblia, Haemoproteus meleagridis, Hexamita meleagridis, Histomonas meleagridis, Iodamoeba buetschili, Isospora bahiensis, Isospora burrowsi, Isospora canis, Isospora fells, Isospora ohioensis, Isospora rivolta, Isospora suis, Klossiella equi, Leucocytozoon caallergi, Leucocytozoon smithi, Parahistomonas wenrichi, Pentatrichomonas hominis, Sarcocystis betrami, Sarcocystis bigemina, Sarcocystis cruzi, Sarcocystis fayevi, hemionilatrantis, Sarcocystis hirsuta, Sarcocystis miescheviana, Sarcocystis muris, Sarcocystis ovicanis, Sarcocystis tenella, Tetratrichomonas buttreyi, Tetratrichomonas gallinarum, Theileria mutans, Toxoplasma gondii, Toxoplasma hammondi, Trichomonas canistomae, Trichomonas gallinae, Trichomonas felistomae, Trichomonas eberthi, Trichomonas equi, Trichomonas foetus, Trichomonas ovis, Trichomonas rotunda, Trichomonas suis, and Trypanosoma melophagium.
[0089] In some embodiments, the subject has a viral infection. In some embodiments, the infection is caused by any one of a member of the Adenoviridae family, a member of the Coronavirus family, a member of the Picornaviridae family, a member of the Herpesviridae family, a member of the Hepadnaviridae family, a member of the Flaviviridae family, a member of the Retroviridae family, a member of the Orthomyxoviridae family, a member of the Paramyxoviridae family, a member of the Papovaviridae family, a member of the Rhabdoviridae family, or a member of the Togaviridae family.
[0090] In some embodiments, the method comprises assaying an expression level of one or more T cell activation markers using quantitative real time PCR (qPCR) from control T cells that have not been activated and comparing the expression level of one or more T cell activation markers from the activated with the expression level of one or more T cell activation markers from control T cells. In some embodiments, the activated T cells and the control T cells are from the same subject.
[0091] In some embodiments, the method comprises comparing the expression level of one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy with the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject.
[0092] In some embodiments, the methods further comprise administering to the subject an effective amount of immunotherapy. In some embodiments, if the expression level of the one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy is at least 20% of the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject, then the subject in need of immunotherapy is administered an effective amount of immunotherapy.
[0093] In some embodiments, if the expression level is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject, then the subject in need of immunotherapy is administered an effective amount of immunotherapy.
[0094] In some embodiments, the subject is not administered an immunotherapy when the expression level of the one or more T cell activation markers from the activated T cells from the subject in need of immunotherapy is below 10% of the expression level of one or more T cell activation markers from activated T cells from a control, healthy subject.
[0095] In some embodiments, the one or more T cell activation markers is induced at least 5-fold over cells that have not been activated. In some embodiments, the one or more T cell activation markers is induced at least 10-fold, at least 15-fold, at least 20-fold, at least 30-fold, at least 40-fold, and at least 50-fold over cells that have not been activated.
[0096] While the invention has been described with reference to certain particular examples and embodiments herein, those skilled in the art will appreciate that various examples and embodiments can be combined for the purpose of complying with all relevant patent laws (e.g., methods described in specific examples can be used to describe particular aspects of the invention and its operation even though such are not explicitly set forth in reference thereto).
[0097] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect applies to other aspects as well and vice versa. Each embodiment described herein is understood to be embodiments that are applicable to all aspects of the invention. It is contemplated that any embodiment discussed herein can be implemented with respect to any device, method, or composition, and vice versa. Furthermore, systems, compositions, and kits of the invention can be used to achieve methods of the invention.
[0098] Aspects of the present teachings may be further understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.
EXAMPLES
Example 1
[0099] Development of a qPCR Method to Rapidly Assess the Function of NKT Cells
[0100] NKT cells comprise a rare, but important subset of T cells which account for 0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy, thus the goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPC will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies.
Materials and Methods
Peripheral Blood Mononuclear Cells (PBMC)
[0101] PBMC were isolated by Ficoll-Hypaque (Amersham Pharmacia Biotek, Uppsala, Sweden) density gradient centrifugation or with BD Vacutainer PPT Tubes for Molecular Diagnostics (20-959-51D; Fisher Scientific, Suwanee, Ga.) All donors gave written informed consent before enrolling in the study. The Institutional Review Board at the University of Maryland School of Medicine approved this investigation. To optimize the protocol, leukocyte paks were purchased from a commercial vendor, Biological Specialty Corp., Colmar, Pa. The percentages of NKT cells were assessed in newly diagnosed patients, prior to treatment and healthy donors.
Preparation of Artificial Antigen Presenting Cells (aAPC)
[0102] CD1D-based aAPC were prepared as previously described (Shiratsuchi, T., Schneck, J., Kawamura, A. and Tsuji, M., 2009, Human CD1 dimeric proteins as indispensable tools for research on CD1-binding lipids and CD1-restricted T cells. J Immunol Methods 345, 49-59; Webb, T. J., Bieler, J. G., Schneck, J. P. and Oelke, M., 2009, Ex vivo induction and expansion of natural killer T cells by CD1d1-Ig coated artificial antigen presenting cells. J Immunol Methods 346, 38-44). In brief, to conjugate hCD1d-Ig dimer molecules to beads, 50 g of hCD1d-Ig (Pharmingen) was added to 0.5 ml of epoxy beads (Dynal, product #140.01, Dynabeads, M-450, Epoxy, 410.sup.8 beads/ml) in sterile 0.1M Borate buffer, pH 7.0-7.4, in the presence of anti-CD28 mAb (Biolegend). The bead protein combination was mixed with rotation and incubated for 24 h at 4 C. The beads were subsequently washed and the hCD1D molecules were loaded with 40 molar excess lipid antigen (-GalCer, Enzo) in PBS, calculated based on the amount of hCD1d-Ig protein added to the beads. For anti-CD3/CD28 microbeads, 20 g of each mAb (Biolegend) was added to 410.sup.8 beads. The beads were washed and used as described above.
Stimulation of PBMC
[0103] Human PBMC were cultured in complete medium: RPMI 1640 medium supplemented with non-essential amino acids (Sigma-Aldrich), sodium pyruvate (Gibco, Invitrogen Corporation), vitamin solution (Gibco), 2-mercaptoethanol (Gibco), 10% fetal calf serum (Gibco), and Pen/Strep (Gibco). PBMC (10.sup.6) were added to borosilicate glass vials (Wheaton Science Products) and different stimuli were added: empty beads as a negative control, anti CD3/CD28 beads, CD1d/CD28 beads and PMA (50 ng/ml) and ionomycin (1 M) was used as a positive control. The total volume of cell culture was 1 ml and a 1:1 (PBMC: beads) ratio was maintained for each experiment.
[0104] For the time course studies, the PBMCs stimulated for 0, 30, 60, 120 or 240 minutes at 37 C. After the incubation the beads were removed via an EasySep magnet (Invitrogen) and the cells were transferred into 1.5 ml eppendorf tubes and centrifuged for 5 minutes at 5000 rpm. The supernatants were collected in separate 1.5 ml eppendorf tubes for further use and stored at 20 C., the cells were washed with 1 PBS, and the cell pellets were stored at 20 C. or immediately used for RNA isolation.
ELISA
[0105] To detect the cytokine production following stimulation of PBMC, standard sandwich ELISAs (IFN-, TNF-, GM-CSF, all purchased from Biolegend) were performed according to the manufacturer's instructions. The plate was read by Synergy H1 Hybrid reader from BioTek and the data recorded. The data were analyzed by Excel and GraphPad Prism.
RT-PCR
[0106] RNA was isolated using the RNA Easy Plus Kit (Qiagen) according to the manufacturer's protocol. After isolation the RNA concentration and purity was determine using the Take 3 plate and the Synergy H1 Hybrid reader. The purity was also checked by 1% agarose gel. Reverse transcription PCR performed by the iScript cDNA Synthesis Kit (Biorad) according to the manufacturer's directions. The PCR was done with primers using proprietary sequences generated by Qiagen that were specific for IFN- (cat. #PPH00380C) and 18S (cat. #PPH05666E). Primers for V24 (Va24_CCY9XUZ, cat. #4400294) were purchased from Applied Biosciences by Life Technologies. For PCR, the HotStarTaq Plus Master Mix kit (Qiagen) was used and the PCR protocol included 35 cycles. For each sample: 10 l master mix, 2 l Coral load, 6 l Nuclease free water, 1 l cDNA and 1 l primer set were used.
Real-Time Quantitative PCR (qPCR)
[0107] To measure the induction of IFN- mRNA in the stimulated PBMC qPCR was performed. The ABI Sybr Green master mix and HotStarTaq master mix kit from QIAGEN was used. qPCR was performed using primers specific for 185, V24 and IFN-, as described above. The total volume of the reaction mix was 20 l and consisted of 10 l master mix, 1 l primer mix(3 M), 5 l H.sub.2O and 4 l cDNA (diluted 1:10). The Applied Biosystems 7500 Fast Real Time PCR system was used. The C.sub.T values were collected and the fold increase calculated as follows: n-fold increase in IFN- mRNA=2.sup.[(CTsampleCT 18S rRNA)(CTempty beadsCT 18S rRNA)]where CT is the threshold cycle.
Antibodies and Flow Cytometry
[0108] Data were acquired with a BD LSR II Flow Cytometer (BD Biosciences) and analyzed with FCS Express V3 (De Novo Software, Los Angeles, Calif.). Doublets were excluded with FSC-A and FSC-H linearity. Human antibodies were as follows: anti-TCR V24-J18 (clone 6B11), anti-CD3 (clone UCHT1)all purchased from BD Biosciences, anti-TCR V24 (clone C15) and anti-TCR V11 (Beckman Coulter), and CD1d tetramers loaded with PBS57, an analog of -GalCer (National Institutes of Health Tetramer Core Facility, Atlanta, Ga.).
Statistical Analysis
[0109] An unpaired two-tailed Student t test was performed by Prism software (version 5.02 for Windows; GraphPad) to compare healthy donors to cancer patients. A p value <0.05 was considered significant. The error bars in the bar graphs show the S.E.M.
Results
Circulating NKT Cells Levels are Low
[0110] Despite the importance of NKT cells in regulating immune responses, their low frequency significantly restricts their potential for clinical application. As a precursor to developing a method to rapidly assess their function, we first examined the percentage of NKT cells in healthy donors and newly diagnosed breast cancer patients prior to treatment or surgery (
Human T Cells Produce Cytokine Within Hours Following Stimulation
[0111] Given the low frequency of NKT cells within the peripheral blood, the goal of this study was to develop a sensitive assay in order to assess NKT cell function. First, we conducted time course studies to determine the kinetics of cytokine production. PBMC were stimulated for 0, 1, 2 and 4 hours with PMA and ionomycin. As shown in
[0112] We conducted studies to determine the sensitivity of qPCR compared to flow cytometry for examining the NKT cell population. In order to assess the sensitivity of each assay, we sought to determine the lowest percentage of NKT cells that could be accurately measured by qPCR. To do these studies, purified NKT cells were serially diluted into a million PBMC and IFN- and V24 transcripts were measured by qPCR. We were able to detect a clear linear relationship between 100-10.sup.4 NKT cells (V24J18) and IFN- mRNA (data not shown). We also compared the V24 transcripts by qPCR results to -GalCer tetramer.sup.+ NKT cells by flow cytometry (
aAPC-qPCR can be Used to Assess NKT Cell Function
[0113] Studies from our laboratory and others have shown that -GalCer artificial antigen presenting cells (aAPC) can be used to activate NKT cells (Shiratsuchi, T., Schneck, J., Kawamura, A. and Tsuji, M., 2009, Human CD1 dimeric proteins as indispensable tools for research on CD1-binding lipids and CD1-restricted T cells. J Immunol Methods 345, 49-59; Webb, T. J., Bieler, J. G., Schneck, J. P. and Oelke, M., 2009, Ex vivo induction and expansion of natural killer T cells by CD1d1-Ig coated artificial antigen presenting cells. J Immunol Methods 346, 38-44; Sun, W., Subrahmanyam, P. B., East, J. E. and Webb, T. J., 2012, Connecting the dots: artificial antigen presenting cell-mediated modulation of natural killer T cells. J Interferon Cytokine Res 32, 505-16). Thus, after our initial studies defined the optimal incubation time for assessing T cell activation, PBMC of healthy donors were incubated for four hours with various stimuli (see schematic of experimental design in
NKT Cell Function can be Rapidly Assessed in Breast Cancer Patients
[0114] We have shown that aAPC-qPCR can be used to measure circulating NKT cell responses in the PBMC from healthy donors, but NKT cells have been reported to be reduced in number and function in cancer patients. As shown in
Discussion
[0115] NKT cells comprise a rare, but important subset of T cells that are activated following the recognition cognate lipid antigen presented in the context of CD1D (Godfrey, D. I., MacDonald, H. R., Kronenberg, M., Smyth, M. J. and Van Kaer, L., 2004, NKT cells: what's in a name? Nat Rev Immunol 4, 231-7). Following activation, NKT cells can directly lyse tumors and rapidly produce a plethora of cytokines (Fowlkes, B. J., Kruisbeek, A. M., Ton-That, H., Weston, M. A., Coligan, J. E., Schwartz, R. H. and Pardoll, D. M., 1987, A novel population of T-cell receptor ab-bearing thymocytes which predominantly expresses a single Vb gene family Nature 329, 251-4; Berzins, S. P., Smyth, M. J. and Baxter, A. G., 2011, Presumed guilty: natural killer T cell defects and human disease. Nat Rev Immunol 11, 131-42). Thus, NKT cell are considered to be important for immune surveillance (Prigozy, T. I., Naidenko, O., Qasba, P., Elewaut, D., Brossay, L., Khurana, A., Natori, T., Koezuka, Y., Kulkarni, A. and Kronenberg, M., 2001, Glycolipid antigen presentation by CD1d molecules. Science 291, 664-667). NKT cells have been demonstrated to play a role in autoimmune disease (Illes, Z., Kondo, T., Newcombe, J., Oka, N., Tabira, T. and Yamamura, T., 2000, Differential expression of NK T cell V alpha 24J alpha Q invariant TCR chain in the lesions of multiple sclerosis and chronic inflammatory demyelinating polyneuropathy. J Immunol 164, 4375-81), tumor surveillance (Terabe, M. and Berzofsky, J. A., 2008, The role of NKT cells in tumor immunity. Advances in cancer research 101, 277-348; Swann, J. B., Uldrich, A. P., van Dommelen, S., Sharkey, J., Murray, W. K., Godfrey, D. I. and Smyth, M. J., 2009, Type I natural killer T cells suppress tumors caused by p53 loss in mice. Blood 113, 6382-5), hematological cancers (Neparidze, N. and Dhodapkar, M. V., 2009, Harnessing CD1d-restricted T cells toward antitumor immunity in humans. Annals of the New York Academy of Sciences 1174, 61-7), infectious disease (Prigozy, T. I., Naidenko, O., Qasba, P., Elewaut, D., Brossay, L., Khurana, A., Natori, T., Koezuka, Y., Kulkarni, A. and Kronenberg, M., 2001, Glycolipid antigen presentation by CD1d molecules. Science 291, 664-667), and inflammatory conditions such as ischemia reperfusion injury (Kinjo, Y., Wu, D., Kim, G., Xing, G. W., Poles, M. A., Ho, D. D., Tsuji, M., Kawahara, K., Wong, C. H. and Kronenberg, M., 2005, Recognition of bacterial glycosphingolipids by natural killer T cells. Nature 434, 520-5).
[0116] Despite the importance of NKT cells in regulating immune responses, their low number diminishes their potential for clinical application. Previous studies have shown that circulating NKT cell numbers are reduced in cancer patients (Kawano, T., Nakayama, T., Kamada, N., Kaneko, Y., Harada, M., Ogura, N., Akutsu, Y., Motohashi, S., Iizasa, T., Endo, H., Fujisawa, T., Shinkai, H. and Taniguchi, M., 1999, Antitumor cytotoxicity mediated by ligand-activated human V alpha24 NKT cells. Cancer Res 59, 5102-5; Tahir, S. M., Cheng, O., Shaulov, A., Koezuka, Y., Bubley, G. J., Wilson, S. B., Balk, S. P. and Exley, M. A., 2001, Loss of IFN-gamma production by invariant NK T cells in advanced cancer. J Immunol 167, 4046-50; Giaccone, G., Punt, C. J., Ando, Y., Ruijter, R., Nishi, N., Peters, M., Von Blomberg, B. M., Scheper, R. J., Van Der Vliet, H. J., Van Den Eertwegh, A. J., Roelvink, M., Beijnen, J., Zwierzina, H. and Pinedo, H. M., 2002, A Phase I study of the natural killer T-cell ligand -galactosylceramide (KRN7000) in patients with solid tumors. Clin Cancer Res 8, 3702-9; Motohashi, S., Kobayashi, S., Ito, T., Magara, K. K., Mikuni, O., Kamada, N., Iizasa, T., Nakayama, T., Fujisawa, T. and Taniguchi, M., 2002, Preserved IFN-alpha production of circulating Valpha24 NKT cells in primary lung cancer patients. Int J Cancer 102, 159-65; Crough, T., Purdie, D. M., Okai, M., Maksoud, A., Nieda, M. and Nicol, A. J., 2004, Modulation of human Valpha24(+)Vbeta11(+) NKT cells by age, malignancy and conventional anticancer therapies. Br J Cancer 91, 1880-6; Nieda, M., Okai, M., Tazbirkova, A., Lin, H., Yamaura, A., Ide, K., Abraham, R., Juji, T., Macfarlane, D. J. and Nicol, A. J., 2004, Therapeutic activation of Valpha24+Vbeta11+NKT cells in human subjects results in highly coordinated secondary activation of acquired and innate immunity. Blood 103, 383-9; Chang, D. H., Osman, K., Connolly, J., Kukreja, A., Krasovsky, J., Pack, M., Hutchinson, A., Geller, M., Liu, N., Annable, R., Shay, J., Kirchhoff, K., Nishi, N., Ando, Y., Hayashi, K., Hassoun, H., Steinman, R. M. and Dhodapkar, M. V., 2005, Sustained expansion of NKT cells and antigen-specific T cells after injection of alpha-galactosyl-ceramide loaded mature dendritic cells in cancer patients. J Exp Med 201, 1503-17; Moiling, J. W., Kolgen, W., van der Vliet, H. J., Boomsma, M. F., Kruizenga, H., Smorenburg, C. H., Molenkamp, B. G., Langendijk, J. A., Leemans, C. R., von Blomberg, B. M., Scheper, R. J. and van den Eertwegh, A. J., 2005, Peripheral blood IFN-gamma-secreting Valpha24+Vbeta11+NKT cell numbers are decreased in cancer patients independent of tumor type or tumor load. Int J Cancer 116, 87-93). While NKT cells are low in cancer patients, their strong anti-tumor functions have lead several groups to attempt to activate NKT cells in cancer patients (Nieda, M., Okai, M., Tazbirkova, A., Lin, H., Yamaura, A., Ide, K., Abraham, R., Juji, T., Macfarlane, D. J. and Nicol, A. J., 2004, Therapeutic activation of Valpha24+Vbeta11+NKT cells in human subjects results in highly coordinated secondary activation of acquired and innate immunity. Blood 103, 383-9; Ishikawa, A., Motohashi, S., Ishikawa, E., Fuchida, H., Higashino, K., Otsuji, M., Iizasa, T., Nakayama, T., Taniguchi, M. and Fujisawa, T., 2005, A phase I study of alpha-galactosylceramide (KRN7000)-pulsed dendritic cells in patients with advanced and recurrent non-small cell lung cancer. Clin Cancer Res 11, 1910-7; Uchida, T., Horiguchi, S., Tanaka, Y., Yamamoto, H., Kunii, N., Motohashi, S., Taniguchi, M., Nakayama, T. and Okamoto, Y., 2008, Phase I study of alpha-galactosylceramide-pulsed antigen presenting cells administration to the nasal submucosa in unresectable or recurrent head and neck cancer. Cancer Immunol Immunother 57, 337-45). These studies showed promise for NKT cell based immunotherapeutic strategies, because it was found that cancer patients that received -GalCer-pulsed dendritic cells had enhanced NK and CD8+ T cell responses. However, the best responses were observed in patients with detectable baseline levels of NKT cells. Thus, in the current study we have developed a novel method to assess baseline NKT function in healthy donors and breast cancer patients using aAPC in combination with qPCR, in order to help to determine which patients may benefit most from NKT cell-based therapies.
[0117] As expected, we found that induction of NKT cells in breast cancer patients was reduced compared to healthy donors. Specifically, there was a modest 3 fold increase in IFN- by qPCR in one of the breast cancer patients following stimulation with -GalCer-loaded aAPC, compared to cells incubated with the control beads. Notably, the lymphocytes from healthy donors and breast cancer patients were activated by anti-CD3/CD28 and PMA/ionomycin and this could be observed by ELISA as well as by conventional RT-PCR. These data highlight the need for a sensitive method for NKT cell activation because we were able to detect NKT cell activation in very few patient samples. Likewise, our data show that the mRNA fold change is much higher in healthy donors, compared to breast cancer patients for each type of stimulation.
[0118] It has been recently reported by Schneiders, et al. that levels of NKT cells were strong predictors of clinical outcome in patients with HNSCC treated with curative-intent radiotherapy (Schneiders, F. L., de Bruin, R. C., van den Eertwegh, A. J., Scheper, R. J., Leemans, C. R., Brakenhoff, R. H., Langendijk, J. A., Verheul, H. M., de Gruijl, T. D., Moiling, J. W. and van der Vliet, H. J., 2012, Circulating invariant natural killer T-cell numbers predict outcome in head and neck squamous cell carcinoma: updated analysis with 10-year follow-up. J Clin Oncol 30, 567-70). In this study, the authors further highlight the prognostic potential of NKT cells since their group and others have established a direct relation between a low frequency of intratumoral NKT cells and poor prognosis (van der Vliet, H. J., Balk, S. P. and Exley, M. A., 2006, Natural killer T cell-based cancer immunotherapy. Clin Cancer Res 12, 5921-3). We have validated our method using fresh and frozen PBMCs and are currently working to optimize the conditions needed to assess NKT cell function using whole blood.
[0119] In summary, herein we show that NKT cells function can be rapidly assessed in vitro after stimulation with aAPC in healthy donors and breast cancer patients. Although activation levels were highly donor specific, we were able to detect a clear induction in IFN- mRNA following stimulation. Ongoing studies will help us to address the mechanisms by which NKT cells are numerically reduced and functionally impaired in breast cancer patients; however, this method has the potential to provide a better understanding of which patients may benefit from NKT cell-based immunotherapeutic strategies.
[0120] While there have been shown and described what are presently believed to be the preferred embodiments of the present invention, those skilled in the art will realize that other and further embodiments can be made without departing from the spirit and scope of the invention described in this application, and this application includes all such modifications that are within the intended scope of the claims set forth herein. All patents and publications mentioned and/or cited herein are incorporated by reference to the same extent as if each individual publication was specifically and individually indicated as having been incorporated by reference in its entirety.