COMPOSITIONS AND METHODS OF USING SAME FOR CONTROLLING PATHOGENICALLY INFECTED MOSQUITOES
20170058278 ยท 2017-03-02
Inventors
- Nitzan PALDI (MOSHAV BAR GIORA, IL)
- Humberto Freire BONCRISTIANI JUNIOR (Odenton, MD, US)
- Eyal MAORI (Rishon-LeZion, IL)
- Avital WEISS (Karkur, IL)
- Emerson Soares BERNARDES (Sao Paulo, BR)
Cpc classification
A01K2227/706
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N15/8245
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N15/827
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/8261
CHEMISTRY; METALLURGY
C12N2320/35
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
A01N25/002
HUMAN NECESSITIES
C12N15/8271
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A01N25/00
HUMAN NECESSITIES
Abstract
A method of controlling a pathogenically infected mosquito is disclosed. The method comprising administering to a larva of a mosquito an isolated nucleic acid agent comprising a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene product of the mosquito, wherein downregulation of the expression of the at least one mosquito pathogen resistance gene in the larvae renders an adult stage of the mosquito lethally susceptible to the pathogen, thereby controlling the pathogenically infected mosquito.
Claims
1. A method of controlling a pathogenically infected mosquito, the method comprising administering to a larva of a mosquito an isolated nucleic acid agent comprising a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene product of said mosquito, wherein downregulation of said expression of said at least one mosquito pathogen resistance gene in said larvae renders an adult stage of said mosquito lethally susceptible to said pathogen, thereby controlling said pathogenically infected mosquito.
2. The method of claim 1, wherein said mosquito comprises a female mosquito being capable of transmitting a disease to a mammalian organism.
3. The method of claim 1, wherein said mosquito is of a species selected from the group consisting of Aedes aegypti, Aedes albopictus and Anopheles gambiae.
4. The method of claim 1, wherein said administering comprises feeding, spraying or soaking.
5. The method of claim 1, wherein said administering comprises soaking said larva with said isolated nucleic acid agent for about 12-48 hours.
6. The method of claim 5, wherein said larva comprises third instar larva.
7. The method of claim 5, further comprising feeding said larva with said isolated nucleic acid agent until said larva reaches pupa stage.
8. The method of claim 1, wherein said pathogenically infected mosquito carries an infection selected from the group consisting of a viral infection, a nematode infection, a protozoa infection and a bacterial infection.
9. The method of claim 8, wherein said viral infection is caused by an arbovirus.
10. The method of claim 9, wherein said arbovirus is selected from the group consisting of an alphavirus, a flavivirus, a bunyavirus and an orbivirus.
11. The method of claim 9, wherein said arbovirus is selected from the group consisting of a La Crosse encephalitis virus, an Eastern equine encephalitis virus, a Japanese encephalitis virus, a Western equine encephalitis virus, a St. Louis encephalitis virus, a Tick-borne encephalitis virus, a Ross River virus, a Venezuelan equine encephalitis virus, a Chikungunya virus, a West Nile virus, a Dengue virus, a Yellow fever virus, a Bluetongue disease virus, a Sindbis Virus and a Rift Valley Fever virus a Colorado tick fever virus, a Murray Valley encephalitis virus, an Oropouche virus and a Flock House virus.
12. The method of claim 8, wherein said protozoa infection is caused by a Plasmodium.
13. The method of claim 8, wherein said protozoa infection causes malaria.
14. The method of claim 8, wherein said nematode infection is caused by a Heartworm (Dirofilaria immitis) or a Wuchereria bancrofti.
15. The method of claim 8, wherein said nematode infection causes Heartworm Disease.
16. A mosquito larva-ingestible compound comprising an isolated nucleic acid agent comprising a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene product in a mosquito and a microorganism or algae on which mosquito larva feed.
17. The mosquito larva-ingestible compound of claim 16 formulated as a solution.
18. The mosquito larva-ingestible compound of claim 16 formulated in a solid or semi-solid formulation.
19. The mosquito larva-ingestible compound of claim 18, wherein said semi-solid formulation comprises an agarose.
20. The mosquito larva-ingestible compound of claim 16, wherein said microorganism is selected from the group consisting of a bacteria and a water surface microorganism.
21. The method of claim 1, wherein said mosquito pathogen resistance gene is selected from the group consisting of a RNA interference related gene, a piRNA pathway related gene, an immunity related gene, a metabolism related gene, a cytoskeleton related gene, a cell membrane related gene, a cell motility related gene, an extracellular structure related gene, a post-translational modification related gene, a protein turnover related gene, a chaperone related gene, a signal transduction related gene, a proteolysis related gene, an oxidoreductase activity related gene, a transcription related gene, a translation related gene, a diverse related gene, a transport related gene, a cell-cycle related gene, an energy production and conversion related gene, a chromatin structure and dynamics related gene, a Toll related gene and a JAK/STAT related gene.
22. The method of claim 1, wherein said mosquito pathogen resistance gene is selected from the group consisting of AAEL003673 [histone H4], AAEL003689 [histone H4], AAEL003669 [histone H2], AAEL002610 [serine protease], AAEL005004, AAEL011455 [CTLMA12], AAEL007599, AAEL007585 [cathepsin B], AAEL017536 [holotricin], AAEL003603, AAEL007669, AAEL001702, AAEL017571, AAEL015312 [cathepsin B], AAEL012216 [cathepsin B], AAEL008418 [pyrroline-5-carboxylate reductase]), AAEL013857, AAEL000335 [lamin], AAEL003211, AAEL003950 [helicase], AAEL002422 [cytoplasmic polyadenylation element binding protein], AAEL015328, AAEL000652 [GNBPA2], AAEL009178 [GNBPB4], AAEL007064 [GNBPB6], AAEL003253 [CLIPB13B], AAEL001929 [SPZ5], AAEL011608 [PGRPLD], AAEL007696 [REL1A], AAEL015515 [CECG], AAEL004522 [GAM], AAEL015404 [LYSC], AAEL012471 [DOME], AAEL012553 [HOP], AAEL009692 [STAT], AAEL006949 [SOCS16D], AAEL006936 [SOCS16D], AAEL000255 [SOCS44A], AAEL000393 [SOCS], AAEL015099 [SUMO], AAEL011753 (r2d2), AAEL006794 (dcr2), AAEL017251 (ago2), AAEL007823 (Ago3), AAEL013235 (Spn-E), AAEL007698 (AuB), AAEL000709 (Cactus), AAEL007768 (MyD88), AAEL003832, AAEL007562, AAEL000598 and AAEL010179.
23. The method of claim 1, wherein said mosquito pathogen resistance gene is selected from the group consisting of AAEL007768 (MyD88), AAEL000709 (Cactus), AAEL007698 (AuB), AAEL003832, AAEL007562, Rel1A (AAEL007696), AAEL000598 and AAEL010179.
24. An isolated nucleic acid agent comprising a polynucleotide expressing a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene selected from the group consisting of AAEL003673 [histone H4], AAEL003689 [histone H4], AAEL003669 [histone H2], AAEL002610 [serine protease], AAEL005004, AAEL011455 [CTLMA12], AAEL007599, AAEL007585 [cathepsin B], AAEL017536 [holotricin], AAEL003603, AAEL007669, AAEL001702, AAEL017571, AAEL015312 [cathepsin B], AAEL012216 [cathepsin B], AAEL008418 [pyrroline-5-carboxylate reductase]), AAEL013857, AAEL000335 [lamin], AAEL003211, AAEL003950 [helicase], AAEL002422 [cytoplasmic polyadenylation element binding protein], AAEL015328, AAEL000652 [GNBPA2], AAEL009178 [GNBPB4], AAEL007064 [GNBPB6], AAEL003253 [CLIPB13B], AAEL001929 [SPZ5], AAEL011608 [PGRPLD], AAEL007696 [REL1A], AAEL015515 [CECG], AAEL004522 [GAM], AAEL015404 [LYSC], AAEL012471 [DOME], AAEL012553 [HOP], AAEL009692 [STAT], AAEL006949 [SOCS16D], AAEL006936 [SOCS16D], AAEL000255 [SOCS44A], AAEL000393 [SOCS], AAEL015099 [SUMO], AAEL011753 (r2d2), AAEL006794 (dcr2), AAEL017251 (ago2), AAEL007823 (Ago3), AAEL013235 (Spn-E), AAEL007698 (AuB), AAEL000709 (Cactus), AAEL007768 (MyD88), AAEL003832, AAEL007562, AAEL010179 and AAEL000598.
25. An isolated nucleic acid agent comprising a polynucleotide expressing a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene selected from the group consisting of AAEL007768 (MyD88), AAEL000709 (Cactus), AAEL007698 (AuB), AAEL003832, AAEL007562, Rel1A (AAEL007696), AAEL010179 and AAEL000598.
26. A nucleic acid construct comprising a nucleic acid sequence encoding the isolated nucleic acid agent of claim 24.
27. A cell comprising the isolated nucleic acid agent of claim 24.
28. The cell of claim 27 selected from the group consisting of a bacterial cell and a cell of a water surface microorganism.
29. A mosquito larva-ingestible compound comprising the cell of claim 27.
30. The cell of claim 27, wherein said nucleic acid agent is a dsRNA.
31. The cell of claim 30, wherein said dsRNA is a naked dsRNA.
32. The cell of claim 30, wherein said dsRNA comprises a carrier.
33. The cell of claim 32, wherein said carrier comprises a polyethyleneimine (PEI).
34. The cell of claim 30, wherein said dsRNA is effected at a dose of 0.001-1 g/L for soaking or at a dose of 1 pg to 10 g/larvae for feeding.
35. The cell of claim 30, wherein said dsRNA is selected from the group consisting of SEQ ID NOs: 1315-1324 and 1330.
36. The cell of claim 30, wherein said dsRNA is selected from the group consisting of siRNA, shRNA and miRNA.
37-40. (canceled)
41. The method of claim 1, wherein said isolated nucleic acid agent is comprised in a cell.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0069] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0070] In the drawings:
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0081] The present invention, in some embodiments thereof, relates to isolated nucleic acid agents, and, more particularly, but not exclusively, to the use of same for controlling pathogenically infected mosquitoes.
[0082] The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.
[0083] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
[0084] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 1315 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an endo 1,4 beta glucanase nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
[0085] Mosquitoes pose an important threat to human and animal health. Mosquitoes are vectors for numerous pathogens, including viruses, bacteria, protozoa and nematodes. In fact over 500 arthropod-borne viruses (arboviruses) have been identified, among which approximately 100 are harmful to humans. While mosquitoes transmit these harmful pathogens, arboviruses do not cause pathology in mosquitoes suggesting that the insect's immune system restricts virus infection to non-pathogenic levels, thus allowing the pathogen to replicate in the mosquito and be transmitted to humans and animals.
[0086] While reducing the present invention to practice, the present inventors have uncovered that feeding dsRNA to mosquito larvae, wherein the dsRNA specifically downregulates an expression of at least one mosquito pathogen resistance gene, makes adult mosquitoes of the larvae more susceptible to a pathogen which they carry and exterminates pathogenically infected mosquitoes.
[0087] Specifically, the present inventors have shown that soaking mosquito larvae in dsRNA targeting specific genes (e.g. MyD88 (AAEL007768), cactus (AAEL000709), AAEL003832, AAEL010179, AAEL007562) for 24 hours followed by feeding the larvae with agarose cubes containing dsRNA for two more days (until they reach pupa stage) efficiently increased the virus titer at 2 hours postinfection (
[0088] The present inventors postulate that downregulating genes which are involved in mosquito pathogen resistance, including genes whose products are involved in RNA interference, piRNA pathway, immunity, metabolism, cytoskeleton, cell membrane, cell motility, extracellular structure, post-translational modification, protein turnover, chaperone, signal transduction, proteolysis, oxidoreductase activity, transcription, translation, diverse, transport, cell-cycle, energy production and conversion, chromatin structure and dynamics, and Toll and JAK/STAT pathways, can be used for extermination of pathogenically infected mosquitoes. Specifically, the present inventors uncovered that downregulating these genes by feeding dsRNA to mosquito larvae makes adult stage of these mosquitoes more susceptible to pathogenic infection that they carry (e.g. viral infection) and only those mosquitoes that contract the pathogen infection are killed.
[0089] Thus, according to one aspect of the present invention there is provided a method of controlling a pathogenically infected mosquito, the method comprising administering to a larva of a mosquito an isolated nucleic acid agent comprising a nucleic acid sequence which specifically downregulates an expression of at least one mosquito pathogen resistance gene product of the mosquito, wherein downregulation of the expression of the at least one mosquito pathogen resistance gene in the larva renders an adult stage of the mosquito lethally susceptible to the pathogen, thereby controlling the pathogenically infected mosquito.
[0090] As used herein the term controlling refers to managing the population of mosquitoes to reduce their damage to human health, economies, and enjoyment. According to some embodiments of the invention, mosquito management is typically effected using an agent for exterminating (e.g. destroying/killing mosquitoes) or reducing a population of mosquitoes.
[0091] The term mosquito or mosquitoes as used herein refers to an insect of the family Culicidae. The mosquito of the invention may include an adult mosquito, a mosquito larva, a pupa or an egg thereof.
[0092] An adult mosquito is defined as any of slender, long-legged insect that has long proboscis and scales on most parts of the body. The adult females of many species of mosquitoes are blood-eating pests. In feeding on blood, adult female mosquitoes transmit harmful diseases to humans and other mammals.
[0093] A mosquito larvae is defined as any of an aquatic insect which does not comprise legs, comprises a distinct head bearing mouth brushes and antennae, a bulbous thorax that is wider than the head and abdomen, a posterior anal papillae and either a pair of respiratory openings (in the subfamily Anophelinae) or an elongate siphon (in the subfamily Culicinae) borne near the end of the abdomen.
[0094] Typically, a mosquito's life cycle includes four separate and distinct stages: egg, larva, pupa, and adult. Thus, a mosquito's life cycle begins when eggs are laid on a water surface (e.g. Culex, Culiseta, and Anopheles species) or on damp soil that is flooded by water (e.g. Aedes species). Most eggs hatch into larvae within 48 hours. The larvae live in the water feeding on microorganisms and organic matter and come to the surface to breathe. They shed their skin four times growing larger after each molting and on the fourth molt the larva changes into a pupa. The pupal stage is a resting, non-feeding stage of about two days. At this time the mosquito turns into an adult. When development is complete, the pupal skin splits and the mosquito emerges as an adult. According to one embodiment, the mosquitoes are of the sub-families
[0095] Anophelinae and Culicinae. According to one embodiment, the mosquitoes are of the genus Culex, Culiseta, Anopheles and Aedes. Exemplary mosquitoes include, but are not limited to, Aedes species e.g. Aedes aegypti, Aedes albopictus, Aedes polynesiensis, Aedes australis, Aedes cantator, Aedes cinereus, Aedes rusticus, Aedes vexans; Anopheles species e.g. Anopheles gambiae, Anopheles freeborni, Anopheles arabiensis, Anopheles funestus, Anopheles gambiae Anopheles moucheti, Anopheles balabacensis, Anopheles baimaii, Anopheles culicifacies, Anopheles dirus, Anopheles latens, Anopheles leucosphyrus, Anopheles maculatus, Anopheles minimus, Anopheles fluviatilis s.l., Anopheles sundaicus Anopheles superpictus, Anopheles farauti, Anopheles punctulatus, Anopheles sergentii, Anopheles stephensi, Anopheles sinensis, Anopheles atroparvus, Anopheles pseudopunctipennis, Anopheles bellator and Anopheles cruzii; Culex species e.g. C. annulirostris, C. antennatus, C. jenseni, C. pipiens, C. pusillus, C. quinquefasciatus, C. rajah, C. restuans, C. salinarius, C. tarsalis, C. territans, C. theileri and C. tritaeniorhynchus; and Culiseta species e.g. Culiseta incidens, Culiseta impatiens, Culiseta inornata and Culiseta particeps.
[0096] According to one embodiment, the mosquitoes are capable of transmitting disease-causing pathogens. The pathogens transmitted by mosquitoes include viruses, protozoa, worms and bacteria.
[0097] Non-limiting examples of viral pathogens which may be transmitted by mosquitoes include the arbovirus pathogens such as Alphaviruses pathogens (e.g. Eastern Equine encephalitis virus, Western Equine encephalitis virus, Venezuelan Equine encephalitis virus, Ross River virus, Sindbis Virus and Chikungunya virus), Flavivirus pathogens (e.g. Japanese Encephalitis virus, Murray Valley Encephalitis virus, West Nile Fever virus, Yellow Fever virus, Dengue Fever virus, St. Louis encephalitis virus, and Tick-borne encephalitis virus), Bunyavirus pathogens (e.g. La Crosse Encephalitis virus, Rift Valley Fever virus, and Colorado Tick Fever virus), Orthobunyavirus pathogens (e.g. Oropouche virus) and Orbivirus (e.g. Bluetongue disease virus).
[0098] Non-limiting examples of worm pathogens which may be transmitted by mosquitoes include nematodes e.g. filarial nematodes such as Wuchereria bancrofti, Brugia malayi, Brugia pahangi, Brugia timori and heartworm (Dirofilaria immitis).
[0099] Non-limiting examples of bacterial pathogens which may be transmitted by mosquitoes include gram negative and gram positive bacteria including Yersinia pestis, Borellia spp, Rickettsia spp, and Erwinia carotovora.
[0100] Non-limiting examples of protozoa pathogens which may be transmitted by mosquitoes include the Malaria parasite of the genus Plasmodium e.g. Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei, Plasmodium gallinaceum, and Plasmodium knowlesi.
[0101] As used herein, the phrase pathogenically infected mosquito refers to a mosquito carrying a disease-causing pathogen. Typically the mosquito is infected with the pathogen (e.g. via a blood meal) and acts as a vector for the pathogen, enabling replication of the pathogen (e.g. in the mid gut and salivary glands of the mosquito) and transmission thereof into a host.
[0102] It will be appreciated that the mosquito of the invention may be a healthy mosquito not infected or not yet infected by a pathogen.
[0103] A host may be any animal upon which the mosquito feeds and/or to which a mosquito is capable of transmitting a disease-causing pathogen. Non-limiting examples of hosts are mammals such as humans, domesticated pets (e.g. dogs and cats), wild animals (e.g. monkeys, rodents and wild cats), livestock animals (e.g. sheep, pigs, cattle, and horses), avians such as poultry (e.g. chickens, turkeys and ducks) and other animals such as crustaceans (e.g. prawns and lobsters), snakes and turtles.
[0104] According to one embodiment, the mosquito comprises a female mosquito being capable of transmitting a disease to a mammalian organism. According to another embodiment the female mosquito is pathogenically infected.
[0105] Non-limiting examples of mosquitoes and the pathogens which they transmit include species of the genus Anopheles (e.g. Anopheles gambiae) which transmit malaria parasites as well as microfilariae, arboviruses (including encephalitis viruses) and some species also transmit Wuchereria bancrofti; species of the genus Culex (e.g. C. pipiens) which transmit West Nile virus, filariasis, Japanese encephalitis, St. Louis encephalitis and avian malaria; species of the genus Aedes (e.g. Aedes aegypti, Aedes albopictus and Aedes polynesiensis) which transmit nematode worm pathogens (e.g. heartworm (Dirofilaria immitis)), arbovirus pathogens such as Alphaviruses pathogens that cause diseases such as Eastern Equine encephalitis, Western Equine encephalitis, Venezuelan equine encephalitis and Chikungunya disease; Flavivirus pathogens that cause diseases such as Japanese encephalitis, Murray Valley Encephalitis, West Nile fever, Yellow fever, Dengue fever, and Bunyavirus pathogens that cause diseases such as LaCrosse encephalitis, Rift Valley Fever, and Colorado tick fever.
[0106] According to one embodiment, pathogens that may be transmitted by Aedes aegypti are Dengue virus, Yellow fever virus, Chikungunya virus and heartworm (Dirofilaria immitis).
[0107] According to one embodiment, pathogens that may be transmitted by Aedes albopictus include West Nile Virus, Yellow Fever virus, St. Louis Encephalitis virus, Dengue virus, and Chikungunya fever virus.
[0108] According to one embodiment, pathogens that may be transmitted by Anopheles gambiae include malaria parasites of the genus Plasmodium such as, but not limited to, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei, Plasmodium gallinaceum, and Plasmodium knowlesi.
[0109] In another embodiment, the invention provides a method of controlling (e.g. exterminating) a pathogenically infected mosquito.
[0110] It will be appreciated that the mosquito of the invention is less likely to transmit a pathogen compared to its wild-type counterpart, since a mosquito encountering a pathogen (e.g. virus, protozoa, bacteria, nematode) will be impaired or exterminated (i.e. killed).
[0111] In one embodiment, the mosquito has an enhanced susceptibility to a pathogen.
[0112] As used herein, the term enhanced susceptibility refers to a mosquito which is more susceptible to a pathogen by at least 10%, 20%, 30%, 40%, 50%, or more, say 60%, 70%, 80%, 90% or more even 100% as compared to wild type (i.e. control) mosquito not treated by the agents of the invention.
[0113] Enhancing susceptibility of a mosquito to a pathogen is achieved by downregulating an expression of at least one mosquito pathogen resistance gene product of the mosquito.
[0114] As used herein, the term mosquito pathogen resistance gene refers to an endogenous gene of the mosquito (naturally occurring within the mosquito) whose product is involved in the natural resistance of the mosquito to a pathogen or to its products (e.g. toxins). According to one embodiment, a mosquito pathogen resistance gene is part of the mosquito's innate immunity.
[0115] As used herein, the term endogenous refers to a gene originating from within the organism, e.g. mosquito.
[0116] As used herein, the phrase gene product refers to an RNA molecule or a protein.
[0117] According to one embodiment, the mosquito pathogen resistance gene product is one which is essential for mosquito viability upon encounter with a pathogen. Downregulation of such a gene product would typically result in death of the mosquito upon encounter with the pathogen.
[0118] Specifically, in the absence of mosquito resistance to a pathogen (e.g. as a result of lack in digestive enzymes, digestive processes, intracellular processes and/or immune system), upon encounter with a pathogen (e.g. within a blood meal), the pathogen will typically replicate and exert a severe infection in the mosquito (e.g. in the midgut and/or salivary glands of the mosquito) and will overcome the natural barriers typically found in mosquitoes [e.g. the midgut infection barrier (MIB), the midgut escape barrier (MEB) and the salivary gland infection barrier (SIB)]. Thus, in the absence of mosquito resistance, the pathogen titers are significantly increased, the midgut infection is significantly increased, pathogen dissemination rates and extrinsic incubation periods are shortened and consequently high mortality of the mosquitoes is evident approximately 2 hours to 21 days (e.g. 12 hours to 15 days, 1 to 15 days, 3 to 10 days, 4 to 7 days) postinfection.
[0119] Exemplary pathogen resistance gene products that may be downregulated according to this aspect of the present invention include, but are not limited to, RNA interference related genes, piRNA pathway related genes, immunity related genes, metabolism related genes, cytoskeleton related genes, cell membrane related genes, cell motility related genes, extracellular structure related genes, post-translational modification related genes, protein turnover related genes, chaperone related genes, signal transduction related genes, proteolysis related genes, oxidoreductase activity related genes, transcription related genes, translation related genes, diverse related genes, transport related genes, cell-cycle related genes, energy production and conversion related genes, chromatin structure and dynamics related genes, Toll related genes and JAK/STAT related genes.
[0120] Tables 1A-B, below, provide a partial list of mosquito genes associated with pathogen resistance, which can be potential targets for reduction in expression by introducing the nucleic acid agent of the invention.
[0121] The present teachings contemplate the targeting of homologs and orthologs according to the selected mosquito species.
[0122] Homologous sequences include both orthologous and paralogous sequences. The term paralogous relates to gene-duplications within the genome of a species leading to paralogous genes. The term orthologous relates to homologous genes in different organisms due to ancestral relationship. Thus, orthologs are evolutionary counterparts derived from a single ancestral gene in the last common ancestor of given two species (Koonin E V and Galperin M Y (SequenceEvolutionFunction: Computational Approaches in Comparative Genomics. Boston: Kluwer Academic; 2003. Chapter 2, Evolutionary Concept in Genetics and Genomics. Available from: ncbi(dot)nlm(dot)nih(dot)gov/books/NBK20255) and therefore have great likelihood of having the same function. As such, orthologs usually play a similar role to that in the original species in another species.
[0123] Homology (e.g., percent homology, sequence identity+sequence similarity) can be determined using any homology comparison software computing a pairwise sequence alignment.
[0124] As used herein, sequence identity or identity in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are to have sequence similarity or similarity. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Henikoff S and Henikoff J G. [Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 1992, 89(22): 10915-9].
[0125] According to a specific embodiment, the homolog sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even identical to the sequences (nucleic acid or amino acid sequences) provided hereinbelow.
TABLE-US-00001 TABLE1A Listoftargetgenes Aedesaegypti Culex Anophelesgambiae Access.No. Access.No. Access.No. Functionalgroup TOLLpathway relatedgenes AAEL009176 CPIJ013556 AGAP002796 patternrecognition (SEQIDNO:1), (SEQIDNO:6), (SEQIDNO:15), receptor AAEL003889 CP1J008997 AGAP012409 (SEQIDNO:2), (SEQIDNO:7), (SEQIDNO:16), AAEL009178 CP1J004325 AGAP004455 (SEQIDNO:3), (SEQIDNO:8), (SEQIDNO:17), AAEL007626 CPIJ003613 AGAP002799 (SEQIDNO:4), (SEQIDNO:9), (SEQIDNO:18), AAEL000652 CP1J004324 AGAP002798 (SEQIDNO:5) (SEQIDNO:10), (SEQIDNO:19), CPIJ004323 AGAP006761 (SEQIDNO:11), (SEQIDNO:20) CPIJ004321 (SEQIDNO:12), CPIJ005217 (SEQIDNO:13), CPIJ004320 (SEQIDNO:14) AAEL007064 CPIJ004231 patternrecognition (SEQIDNO:21) (SEQIDNO:22) receptor AAEL007347 CPIJ001059 AGAP011325 signalmodulation (SEQIDNO:23), (SEQIDNO:32), (SEQIDNO:40), AAEL014724 CP1J020127 AGAP004855 (SEQIDNO:24), (SEQIDNO:33), (SEQIDNO:41) AAEL003243 CPIJ003622 (SEQIDNO:25), (SEQIDNO:34), AAEL003280 CPIJ016225 (SEQIDNO:26), (SEQIDNO:35), AAEL003233 CPIJ017738 (SEQIDNO:27), (SEQIDNO:36), AAEL003279 CPIJ010296 (SEQIDNO:28), (SEQIDNO:37), AAEL012775 CPIJ010295 (SEQIDNO:29), (SEQIDNO:38), AAEL014163 CPIJ001060 (SEQIDNO:30), (SEQIDNO:39) AAEL003253 (SEQIDNO:31) AAEL013435 CPIJ000273 AGAP006484 Toll (SEQIDNO:42), (SEQIDNO:48), (SEQIDNO:53), AAEL013434 CP1J000272 AGAP006483 (SEQIDNO:43), (SEQIDNO:49), (SEQIDNO:54), AAEL000499 CP1J009906 AGAP007177 (SEQIDNO:44), (SEQIDNO:50), (SEQIDNO:55) AAEL001435 CPIJ006792 (SEQIDNO:45), (SEQIDNO:51), AAEL013433 CPIJ014270 (SEQIDNO:46), (SEQIDNO:52) AAEL001929 (SEQIDNO:47) AAEL014989 CPIJ008514 AGAP005552 patternrecognition (SEQIDNO:56), (SEQIDNO:58) (SEQIDNO:59) receptor AAEL011608 (SEQIDNO:57) AAEL006930 CPIJ015741 AGAP009515 Toll (SEQIDNO:60), (SEQIDNO:62), (SEQIDNO:65) AAEL007696 CPIJ019376 (SEQIDNO:61) (SEQIDNO:63), CPIJ002469 (SEQIDNO:64) AAEL015515 Effector (SEQIDNO:66) AAEL004522 CPIJ016084 AGAP008645 Effector (SEQIDNO:67) (SEQIDNO:68) (SEQIDNO:69) AAEL003723 CPIJ005451 AGAP007347 Effector (SEQIDNO:70), (SEQIDNO:76), (SEQIDNO:81), AAEL009670 CP1J005450 AGAP005717 (SEQIDNO:71), (SEQIDNO:77), (SEQIDNO:82), AAEL015404 CPIJ002161 AGAP007386 (SEQIDNO:72), (SEQIDNO:78), (SEQIDNO:83), AAEL005988 CPIJ010731 AGAP007343 (SEQIDNO:73), (SEQIDNO:79), (SEQIDNO:84), AAEL003712 CPIJ010730 AGAP007385 (SEQIDNO:74), (SEQIDNO:80) (SEQIDNO:85) AAEL010100 (SEQIDNO:75) JAK/STAT pathwayrelated genes AAEL012471 CP1J017416 AGAP010083 (SEQIDNO:86) (SEQIDNO:87) (SEQIDNO:88) AAEL012553 CPIJ001760 AGAP008354 (SEQIDNO:89) (SEQIDNO:90) (SEQIDNO:91) AAEL009692 CPIJ016471 AGAP010423 (SEQIDNO:92) (SEQIDNO:93), (SEQIDNO:95), CPIJ016469 AGAP000099 (SEQIDNO:94) (SEQIDNO:96) AAEL006949 AGAP000880 (SEQIDNO:97), (SEQIDNO:100), AAEL006936 AGAP004844 (SEQIDNO:98), (SEQIDNO:101) AAEL000255 (SEQIDNO:99) AAEL000393 CP1J003379 AGAP011042 (SEQIDNO:102) (SEQIDNO:103), (SEQIDNO:105) CPIJ003380 (SEQIDNO:104) AAEL015099 CP1J009163 AGAP005031 (SEQIDNO:106) (SEQIDNO:107) (SEQIDNO:108) Signal Transduction relatedgenes AAEL012230 CPIJ005494 (SEQIDNO:109), (SEQIDNO:112) AAEL015328 (SEQIDNO:110), AAEL012225 (SEQIDNO:111) RNAi/piRNA pathwayrelated genes AAEL011753 CP1J011746 AGAP009887 r2d2 (SEQIDNO:113), (SEQIDNO:117), (SEQIDNO:120), AAEL007470 CP1J000296 (SEQIDNO:114), (SEQIDNO:118), AGAP009781 AAEL013721 CPIJ004832 (SEQIDNO:121) (SEQIDNO:115), (SEQIDNO:119) AAEL008687 (SEQIDNO:116), AAEL006794 CPIJ010534 AGAP012289 dcr2 (SEQIDNO:122) (SEQIDNO:123) (SEQIDNO:124) AAEL007823 CPIJ005275 AGAP008862 PIWI (SEQIDNO:125) (SEQIDNO:126) (SEQIDNO:127) AAEL013235 CPIJ017541 AGAP002829 Spn-E (SEQIDNO:128) (SEQIDNO:129) (SEQIDNO:130) Chromatin structureand dynamicsrelated genes AAEL003833 CPIJ012378 AGAP012586 histoneH4 (SEQIDNO:131), (SEQIDNO:143), (SEQIDNO:145), AAEL003863 CP1J014768 AGAP003909 (SEQIDNO:132), (SEQIDNO:144) (SEQIDNO:146), AAEL003823 AGAP005026 (SEQIDNO:133), (SEQIDNO:147), AAEL003846 AGAP012574 (SEQIDNO:134), (SEQIDNO:148), AAEL003838 AGAP012558 (SEQIDNO:135), (SEQIDNO:149), AAEL000517 AGAP005023 (SEQIDNO:136), (SEQIDNO:150), AAEL003814 AGAP012885 (SEQIDNO:137), (SEQIDNO:151), AAEL000501 AGAP010724 (SEQIDNO:138), (SEQIDNO:152) AAEL003689 (SEQIDNO:139), AAEL003673 (SEQIDNO:140), AAEL000490 (SEQIDNO:141), AAEL000513 (SEQIDNO:142) AAEL000497 CPIJ015010 AGAP012711 histoneH2 (SEQIDNO:153), (SEQIDNO:166), (SEQIDNO:182), AAEL003669 CPIJ014767 AGAP003911 (SEQIDNO:154), (SEQIDNO:167), (SEQIDNO:183), AAEL003862 CP1J012408 AGAP012198 (SEQIDNO:155), (SEQIDNO:168), (SEQIDNO:184), AAEL000518 CPIJ012399 AGAP012895 (SEQIDNO:156), (SEQIDNO:169), (SEQIDNO:185), AAEL007925 CPIJ012421 AGAP003913 (SEQIDNO:157), (SEQIDNO:170), (SEQIDNO:186) AAEL000525 CPIJ012390 (SEQIDNO:158), (SEQIDNO:171), AAEL000494 CPIJ012412 (SEQIDNO:159), (SEQIDNO:172), AAEL003706 CPIJ010360 (SEQIDNO:160), (SEQIDNO:173), AAEL003851 CPIJ012419 (SEQIDNO:161), (SEQIDNO:174), AAEL003820 CPIJ005867 (SEQIDNO:162), (SEQIDNO:175), AAEL003687 CPIJ012380 (SEQIDNO:163), (SEQIDNO:176), AAEL003826 CPIJ012403 (SEQIDNO:164), (SEQIDNO:177), AAEL003818 CPIJ015004 (SEQIDNO:165) (SEQIDNO:178), CPIJ012395 (SEQIDNO:179), CPIJ004104 (SEQIDNO:180), CPIJ012425 (SEQIDNO:181) AAEL003950 CPIJ011033 AGAP010699 helicase (SEQIDNO:187) (SEQIDNO:188) (SEQIDNO:189) Metabolism relatedgenes AAEL008418 CPIJ005082 AGAP002308 pyrroline-5-carboxylate (SEQIDNO:190) (SEQIDNO:191) (SEQIDNO:192) reductase Cytoskeleton relatedgenes AAEL000335 CPIJ003869 AGAP008015 lamin (SEQIDNO:193) (SEQIDNO:194) (SEQIDNO:195) Proteolysis relatedgenes AAEL002610 CPIJ017789 AGAP011792 serineprotease (SEQIDNO:196), (SEQIDNO:201), (SEQIDNO:204), AAEL002593 CP1J017793 AGAP011783 (SEQIDNO:197), (SEQIDNO:202), (SEQIDNO:205), AAEL002600 CPIJ017792 AGAP011789 (SEQIDNO:198), (SEQIDNO:203) (SEQIDNO:206), AAEL002629 AGAP011781 (SEQIDNO:199), (SEQIDNO:207), AAEL002595 AGAP011780 (SEQIDNO:200) (SEQIDNO:208), AGAP011787 (SEQIDNO:209), AGAP011793 (SEQIDNO:210) AAEL013857 CP1J004497 AGAP004700 (SEQIDNO:211) (SEQIDNO:212) (SEQIDNO:213) transcriptionand translation relatedgenes AAEL005004 CPIJ009211 hypotheticalprotein (SEQIDNO:214) (SEQIDNO:215) AaeL AAEL005226 CP1J015541 AGAP005819 (SEQIDNO:216), (SEQIDNO:234), (SEQIDNO:259), AAEL008917 CPIJ007121 AGAP006214 (SEQIDNO:217), (SEQIDNO:235), (SEQIDNO:260), AAEL009082 CP1J000335 AGAP009638 (SEQIDNO:218), (SEQIDNO:236), (SEQIDNO:261), AAEL009592 CP1J008475 AGAP000906 (SEQIDNO:219), (SEQIDNO:237), (SEQIDNO:262), AAEL012429 CP1J018334 AGAP011037 (SEQIDNO:220), (SEQIDNO:238), (SEQIDNO:263), AAEL000710 CPIJ016494 AGAP002907 (SEQIDNO:221), (SEQIDNO:239), (SEQIDNO:264), AAEL000021 CP1J019878 AGAP000904 (SEQIDNO:222), (SEQIDNO:240), (SEQIDNO:265) AAEL003589 CPIJ020103 (SEQIDNO:223), (SEQIDNO:241), AAEL011208 CPIJ013244 (SEQIDNO:224), (SEQIDNO:242), AAEL009079 CPIJ011969 (SEQIDNO:225), (SEQIDNO:243), AAEL009063 CPIJ005309 (SEQIDNO:226), (SEQIDNO:244), AAEL003603 CPIJ019506 (SEQIDNO:227), (SEQIDNO:245), AAEL007264 CPIJ012797 (SEQIDNO:228), (SEQIDNO:246), AAEL007465 CPIJ015236 (SEQIDNO:229), (SEQIDNO:247), AAEL000406 CPIJ016969 (SEQIDNO:230), (SEQIDNO:248), AAEL005940 CPIJ002091 (SEQIDNO:231), (SEQIDNO:249), AAEL015447 CPIJ011518 (SEQIDNO:232), (SEQIDNO:250), AAEL015509 CPIJ015370 (SEQIDNO:233) (SEQIDNO:251), CPIJ003366 (SEQIDNO:252), CPIJ007027 (SEQIDNO:253), CPIJ020171 (SEQIDNO:254), CPIJ006503 (SEQIDNO:255), CPIJ001232 (SEQIDNO:256), CPIJ015841 (SEQIDNO:257), CPIJ019509 (SEQIDNO:258) AAEL002422 CPIJ009745 AGAP003080 cytoplasmic (SEQIDNO:266), (SEQIDNO:268), (SEQIDNO:270) polyadenylationelement AAEL012065 CPIJ009440 bindingprotein (SEQIDNO:267) (SEQIDNO:269) Immunityrelated genes AAEL011455 galactose-specificC- (SEQIDNO:271) typelectin AAEL007599 CPIJ015762 AGAP004531 cathepsinB (SEQIDNO:272), (SEQIDNO:277), (SEQIDNO:279) AAEL007585 CPIJ015761 (SEQIDNO:273), (SEQIDNO:278) AAEL007590 (SEQIDNO:274), AAEL015312 (SEQIDNO:275), AAEL012216 (SEQIDNO:276) AAEL007585 CPIJ015762 AGAP004531 cathepsinB (SEQIDNO:280), (SEQIDNO:285), (SEQIDNO:287) AAEL007599 CPIJ015761 (SEQIDNO:281), (SEQIDNO:286) AAEL007590 (SEQIDNO:282), AAEL015312 (SEQIDNO:283), AAEL012216 (SEQIDNO:284) AAEL007585 CPIJ015762 AGAP004531 cathepsinB (SEQIDNO:288), (SEQIDNO:293), (SEQIDNO:295) AAEL007599 CPIJ015761 (SEQIDNO:289), (SEQIDNO:294) AAEL007590 (SEQIDNO:290), AAEL015312 (SEQIDNO:291), AAEL012216 (SEQIDNO:292) Redoxactivity relatedgenes AAEL003211 CPIJ001081 AGAP008143 beta-carotene (SEQIDNO:296) (SEQIDNO:297) (SEQIDNO:298) dioxygenase Additionalgenes AAEL001702 CP1J015159 AGAP005312 (SEQIDNO:299) (SEQIDNO:300) (SEQIDNO:301)
TABLE-US-00002 TABLE 1B List of Aedes aegypti target genes Aedes aegypti target genes eq id no Gene symbol Gene Name 305 AAEL001411 myosin heavy chain, nonmuscle or smooth muscle 306 AAEL014394 growth factor receptor-bound protein 307 AAEL000700 cadherin 308 AAEL001028 hypothetical protein 309 AAEL010410 odorant receptor 9a, putative 310 AAEL011202 bhlhzip transcription factor bigmax 311 AAEL003355 conserved hypothetical protein 312 AAEL002920 hypothetical protein 313 AAEL012339 cdk1 314 AAEL013329 cdk1 315 AAEL009962 hypothetical protein 316 AAEL000931 alkaline phosphatase 317 AAEL000776 conserved hypothetical protein 318 AAEL009022 adenylate cyclase type 319 AAEL005766 fructose-bisphosphate aldolase 320 AAEL002473 hypothetical protein 321 AAEL012551 conserved hypothetical protein 322 AAEL011648 cyclin d 323 AAEL001246 Thymidylate kinase, putative 324 AAEL011892 receptor for activated C kinase, putative 325 AAEL003581 amidophosphoribosyltransferase 326 AAEL014001 yellow protein precursor, putative 327 AAEL012865 conserved hypothetical protein 328 AAEL002510 serine hydroxymethyltransferase 329 AAEL014025 cell division cycle 20 (cdc20) (fizzy) 330 AAEL011250 conserved hypothetical protein 331 AAEL010818 hypothetical protein 332 AAEL005522 conserved hypothetical protein 333 AAEL003325 niemann-pick C1 334 AAEL009773 geminin, putative 335 AAEL004710 spingomyelin synthetase 336 AAEL003465 hypothetical protein 337 AAEL012510 IMD pathway signaling I-Kappa-B Kinase 2 (IKK2 IKK-gamma). 338 AAEL013749 conserved hypothetical protein 339 AAEL012085 hypothetical protein 340 AAEL015080 conserved hypothetical protein 341 AAEL013320 translocon-associated protein, delta subunit 342 AAEL008686 hypothetical protein 343 AAEL000217 serine/threonine protein kinase 344 AAEL007799 regulator of chromosome condensation 345 AAEL013912 conserved hypothetical protein 346 AAEL002388 zinc finger protein 347 AAEL012224 zinc finger protein 348 AAEL010899 hypothetical protein 349 AAEL010430 ras-related protein, putative 350 AAEL003650 inhibitor of growth protein, ing1 351 AAEL005631 conserved hypothetical protein 352 AAEL011295 conserved hypothetical protein 353 AAEL003606 purine biosynthesis protein 6, pur6 354 AAEL010762 Actin-related protein 8 355 AAEL009645 hypothetical protein 356 AAEL004699 conserved hypothetical protein 357 AAEL012356 GPCR Somatostatin Family 358 AAEL008084 phosphatidylserine receptor 359 AAEL001352 scaffold attachment factor b 360 AAEL007848 conserved hypothetical protein 361 AAEL014844 conserved hypothetical protein 362 AAEL002495 conserved hypothetical protein 363 AAEL011714 conserved hypothetical protein 364 AAEL008952 sentrin/sumo-specific protease 365 AAEL011141 hypothetical protein 366 AAEL010905 conserved hypothetical protein 367 AAEL013797 conserved hypothetical protein 368 AAEL007526 electron transfer flavoprotein-ubiquinone oxidoreductase 369 AAEL006832 GPCR Frizzled/Smoothened Family 370 AAEL011069 conserved hypothetical protein 371 AAEL006519 conserved hypothetical protein 372 AAEL012635 conserved hypothetical protein 373 AAEL010659 lethal(2)essential for life protein, l2efl 374 AAEL013343 lethal(2)essential for life protein, l2efl 375 AAEL011639 WAP four-disulfide core domain protein 2 precursor, putative 376 AAEL005439 mical 377 AAEL000236 hypothetical protein 378 AAEL012566 conserved hypothetical protein 379 AAEL002896 conserved hypothetical protein 380 AAEL006649 tnf receptor associated factor 381 AAEL001856 adenosine kinase 382 AAEL003549 hypothetical protein 383 AAEL012043 secreted modular calcium-binding protein 384 AAEL003425 conserved hypothetical protein 385 AAEL007832 GPCR Muscarinic Acetylcholine Family 386 AAEL015037 G-protein-linked acetylcholine receptor gar-2a 387 AAEL001420 leucine-rich immune protein (Short) 388 AAEL009615 ultraviolet wavelength sensitive opsin 389 AAEL007397 Ecdysone-induced protein 75B isoform A Nuclear receptor 390 AAEL000153 conserved hypothetical protein 391 AAEL008015 hypothetical protein 392 AAEL013552 conserved hypothetical protein 393 AAEL005083 conserved hypothetical protein 394 AAEL012562 circadian locomoter output cycles kaput protein (dclock) (dpas1) 395 AAEL000580 conserved hypothetical protein 396 AAEL011417 synaptojanin 397 AAEL000041 forkhead box protein (AaegFOXM2) 398 AAEL000945 conserved hypothetical protein 399 AAEL002355 conserved hypothetical protein 400 AAEL009230 conserved hypothetical protein 401 AAEL002653 semaphorin 402 AAEL009305 numb-associated kinase 403 AAEL003574 hypothetical protein 404 AAEL013040 hypothetical protein 405 AAEL002400 hypothetical protein 406 AAEL009382 lysine-specific demethylase NO66 (EC 1.14.11.27)(Nucleolar protein 66) 407 AAEL008320 conserved hypothetical protein 408 AAEL001667 multicopper oxidase 409 AAEL007073 hypothetical protein 410 AAEL003152 werner syndrome helicase 411 AAEL015522 conserved hypothetical protein 412 AAEL014368 sap18 413 AAEL004607 Adenylyltransferase and sulfurtransferase MOCS3 (Molybdenum cofactor synthesis protein 3) [Includes Adenylyltransferase MOCS3(EC 2.7.7.) (Sulfur carrier protein MOCS2A 414 AAEL001073 malic enzyme 415 AAEL006087 conserved hypothetical protein 416 AAEL006925 conserved hypothetical protein 417 AAEL015285 conserved hypothetical protein 418 AAEL010576 modifier of mdg4 419 AAEL011995 conserved hypothetical protein 420 AAEL002064 conserved hypothetical protein 421 AAEL009589 conserved hypothetical protein 422 AAEL000356 cysteine-rich venom protein, putative 423 AAEL000503 hypothetical protein 424 AAEL012920 GPCR Galanin/Allatostatin Family 425 AAEL014002 conserved hypothetical protein 426 AAEL005850 Hormone receptor-like in 4 (nuclear receptor) 427 AAEL000102 conserved hypothetical protein 428 AAEL011647 paired box protein, putative 429 AAEL005381 Dissatisfaction (Dsf) 430 AAEL009360 serine/threonine-protein kinase PLK4 (EC 2.7.11.21)(Polo-like kinase 4)(PLK-4) (Serine/threonine-protein kinase SAK) 431 AAEL012105 Zinc finger protein-like 1 homolog 432 AAEL007053 hypothetical protein 433 AAEL009822 GPCR Metabotropic glutamate Family 434 AAEL013175 hypothetical protein 435 AAEL009531 niemann-pick C1 436 AAEL009841 conserved hypothetical protein 437 AAEL010333 conserved hypothetical protein 438 AAEL005627 chordin 439 AAEL001526 zinc finger protein 440 AAEL007408 conserved hypothetical protein 441 AAEL013280 rho guanine exchange factor 442 AAEL009508 zinc finger protein 443 AAEL008839 hypothetical protein 444 AAEL015216 serine/threonine-protein kinase vrk 445 AAEL007436 conserved hypothetical protein 446 AAEL014392 hypothetical protein 447 AAEL004458 Zinc finger CCCH-type with G patch domain-containing protein 448 AAEL000087 macroglobulin/complement 449 AAEL000256 Class B Scavenger Receptor (CD36 domain). 450 AAEL000274 Copper-Zinc(CuZn) Superoxide Dismutase. 451 AAEL000709 TOLL pathway signaling. 452 AAEL000765 hexamerin 2 beta 453 AAEL001794 macroglobulin/complement 454 AAEL002585 serine protease 455 AAEL002595 serine protease 456 AAEL002629 serine protease 457 AAEL002730 Serine Protease Inhibitor (serpin) likely cleavage at R/V. 458 AAEL003119 C-Type Lectin (CTL). 459 AAEL003439 Caspase (Short). 460 AAEL003849 defensin anti-microbial peptide 461 AAEL004386 heme peroxidase 462 AAEL004388 heme peroxidase 463 AAEL004390 heme peroxidase 464 AAEL005064 Clip-Domain Serine Protease family B. 465 AAEL005325 dopachrome-conversion enzyme (DCE) isoenzyme, putative 466 AAEL005443 conserved hypothetical protein 467 AAEL005673 Serine Protease Inhibitor (serpin) likely cleavage at K/F. 468 AAEL005738 yellow protein precursor 469 AAEL005832 programmed cell death 470 AAEL006271 copper-zinc (CuZn) superoxide dismutase 471 AAEL006383 chymotrypsin, putative 472 AAEL006576 clip-domain serine protease, putative 473 AAEL006702 fibrinogen and fibronectin 474 AAEL008364 Serine Protease Inhibitor (serpin) likely cleavage at S/S. 475 AAEL009436 conserved hypothetical protein 476 AAEL009861 conserved hypothetical protein 477 AAEL010973 conserved hypothetical protein 478 AAEL011498 copper-zinc (CuZn) superoxide dismutase 479 AAEL011699 hypothetical protein 480 AAEL012267 macroglobulin/complement 481 AAEL012958 conserved hypothetical protein 482 AAEL013441 Toll-like receptor 483 AAEL013757 hexamerin 2 beta 484 AAEL013936 Serine Protease Inhibitor (serpin) likely cleavage at I/S. Transcript A. 485 AAEL014078 serine protease inhibitor, serpin 486 AAEL014079 serine protease inhibitor, serpin 487 AAEL014238 aromatic amino acid decarboxylase 488 AAEL014390 galactose-specific C-type lectin, putative 489 AAEL014548 Thioredoxin Peroxidase. 490 AAEL014755 tep2 491 AAEL014989 peptidoglycan recognition protein-1, putative 492 AAEL015322 slit protein 493 AAEL007097 4-nitrophenylphosphatase 494 AAEL007323 deoxyuridine 5-triphosphate nucleotidohydrolase 495 AAEL006239 glycerol kinase 496 AAEL002542 triosephosphate isomerase 497 AAEL010208 3-hydroxyisobutyrate dehydrogenase 498 AAEL000006 phosphoenolpyruvate carboxykinase 499 AAEL009245 3-hydroxyisobutyrate dehydrogenase, putative 500 AAEL015143 glycine rich RNA binding protein, putative 501 AAEL006684 Putative oxidoreductase GLYR1 homolog (EC 1...)(Glyoxylate reductase 1 homolog) (Nuclear protein NP60 homolog) 502 AAEL012580 3-hydroxyisobutyrate dehydrogenase 503 AAEL013819 Bj1 protein, putative 504 AAEL008849 selenophosphate synthase 505 AAEL003084 dolichyl-phosphate beta-D-mannosyltransferase, putative 506 AAEL014186 dolichyl-phosphate beta-D-mannosyltransferase, putative 507 AAEL010751 methylenetetrahydrofolate dehydrogenase 508 AAEL013877 Glucosamine-6-phosphate isomerase (EC 3.5.99.6)(Glucosamine-6-phosphate deaminase) (GlcN6P deaminase)(GNPDA) 509 AAEL008166 malate dehydrogenase 510 AAEL009721 paraplegin 511 AAEL012337 goliath E3 ubiquitin ligase 512 AAEL007593 Clip-Domain Serine Protease family C. 513 AAEL003769 methionine aminopeptidase 514 AAEL008416 pre-mRNA processing factor 515 AAEL005201 hydroxymethylglutaryl-coa synthase 516 AAEL008905 host cell factor C1 517 AAEL001112 conserved hypothetical protein 518 AAEL002655 matrix metalloproteinase 519 AAEL006323 hypothetical protein 520 AAEL007649 cell cycle checkpoint protein rad17 521 AAEL004589 small calcium-binding mitochondrial carrier, putative 522 AAEL011704 heat shock protein 523 AAEL001052 heat shock protein, putative 524 AAEL006362 mitochondrial solute carrier 525 AAEL010002 mitochondrial import inner membrane translocase subunit tim17 526 AAEL015575 mitochondrial import inner membrane translocase subunit tim17 527 AAEL005413 mitochondrial ribosomal protein, S11, putative 528 AAEL009964 conserved hypothetical protein 529 AAEL010673 NADH dehydrogenase, putative 530 AAEL001615 mitochondrial ribosomal protein, S18C, putative 531 AAEL003215 heat shock factor binding protein, putative 532 AAEL012499 histone H2A 533 AAEL008500 DEAD box ATP-dependent RNA helicase 534 AAEL007609 histone H2A 535 AAEL005114 RNA and export factor binding protein 536 AAEL015263 RNA and export factor binding protein 537 AAEL006473 arginine/serine-rich splicing factor 538 AAEL007928 eukaryotic translation initiation factor 4 gamma 539 AAEL010340 serine/arginine rich splicing factor 540 AAEL010402 DEAD box ATP-dependent RNA helicase 541 AAEL003401 DNA-directed RNA polymerase II 19 kDa polypeptide rpb7 542 AAEL006135 Nuclear cap-binding protein subunit 2 (20 kDa nuclear cap-binding protein)(NCBP 20 kDa subunit)(CBP20) 543 AAEL009913 DEAD box ATP-dependent RNA helicase 544 AAEL007078 Eukaryotic translation initiation factor 3 subunit A (eIF3a)(Eukaryotic translation initiation factor 3 subunit 10) 545 AAEL007923 eukaryotic translation initiation factor 4 gamma 546 AAEL010612 alternative splicing type 3 and, putative 547 AAEL011687 alternative splicing type 3 and, putative 548 AAEL003893 DNA repair protein xp-c/rad4 549 AAEL006883 conserved hypothetical protein 550 AAEL012585 60S ribosomal protein L7 551 AAEL014429 T-box transcription factor tbx20 552 AAEL000098 hypothetical protein 553 AAEL004174 T-box transcription factor tbx6 554 AAEL007458 amino acid transporter 555 AAEL011470 cis,cis-muconate transport protein MucK, putative 556 AAEL013146 mfs transporter 557 AAEL002525 amino acids transporter 558 AAEL006879 folate carrier protein 559 AAEL012183 mfs transporter 560 AAEL008878 diacylglycerol o-acyltransferase 561 AAEL001968 zinc transporter 562 AAEL009362 cationic amino acid transporter 563 AAEL008138 ABC transporter 564 AAEL005635 nucleoporin 565 AAEL011679 ion channel nompc 566 AAEL009421 cyclophilin-r 567 AAEL003433 copper-transporting ATPase 1, 2 (copper pump 1, 2) 568 AAEL006526 neurotransmitter gated ion channel 569 AAEL004268 Sialin, Sodium/sialic acid cotransporter, putative 570 AAEL005991 tricarboxylate transport protein 571 AAEL009206 organic cation transporter 572 AAEL002756 synaptotagmin-4, 573 AAEL001405 clathrin coat assembly protein 574 AAEL000675 hypothetical protein 575 AAEL000727 hypothetical protein 576 AAEL000969 hypothetical protein 577 AAEL002095 conserved hypothetical protein 578 AAEL002803 conserved hypothetical protein 579 AAEL002975 hypothetical protein 580 AAEL002979 conserved hypothetical protein 581 AAEL003089 conserved hypothetical protein 582 AAEL003131 conserved hypothetical protein 583 AAEL003316 hypothetical protein 584 AAEL003430 conserved hypothetical protein 585 AAEL004498 hypothetical protein 586 AAEL004604 hypothetical protein 587 AAEL004625 conserved hypothetical protein 588 AAEL004734 conserved hypothetical protein 589 AAEL004754 hypothetical protein 590 AAEL004976 conserved hypothetical protein 591 AAEL005121 conserved hypothetical protein 592 AAEL005192 hypothetical protein 593 AAEL005389 conserved hypothetical protein 594 AAEL006001 conserved hypothetical protein 595 AAEL006072 hypothetical protein 596 AAEL006243 hypothetical protein 597 AAEL006247 conserved hypothetical protein 598 AAEL006502 conserved hypothetical protein 599 AAEL006606 hypothetical protein 600 AAEL006755 conserved hypothetical protein 601 AAEL007744 hypothetical protein 602 AAEL007940 gustatory receptor Gr77 603 AAEL008439 conserved hypothetical protein 604 AAEL008492 conserved hypothetical protein 605 AAEL008636 conserved hypothetical protein 606 AAEL009070 hypothetical protein 607 AAEL009082 hypothetical protein 608 AAEL009247 conserved hypothetical protein 609 AAEL009322 hypothetical protein 610 AAEL009385 hypothetical protein 611 AAEL009473 conserved hypothetical protein 612 AAEL009565 conserved hypothetical protein 613 AAEL010022 hypothetical protein 614 AAEL010113 conserved hypothetical protein 615 AAEL010155 hypothetical protein 616 AAEL010407 conserved hypothetical protein 617 AAEL010898 conserved hypothetical protein 618 AAEL011737 hypothetical protein 619 AAEL011771 hypothetical protein 620 AAEL011826 conserved hypothetical protein 621 AAEL011872 conserved hypothetical protein 622 AAEL012058 hypothetical protein 623 AAEL012504 hypothetical protein 624 AAEL012742 conserved hypothetical protein 625 AAEL012754 hypothetical protein 626 AAEL013024 hypothetical protein 627 AAEL013037 conserved hypothetical protein 628 AAEL013169 conserved hypothetical protein 629 AAEL013776 predicted protein 630 AAEL013977 conserved hypothetical protein 631 AAEL014126 hypothetical protein 632 AAEL014294 conserved hypothetical protein 633 AAEL014816 hypothetical protein 634 AAEL015613 hypothetical protein 635 AAEL015634 conserved hypothetical protein 636 AAEL001411 myosin heavy chain, nonmuscle or smooth muscle 637 AAEL013778 F-actin capping protein alpha 638 AAEL010510 conserved hypothetical protein 639 AAEL011154 hypothetical protein 640 AAEL004936 conserved hypothetical protein 641 AAEL010979 growth factor receptor-bound protein 642 AAEL001477 laminin alpha-1, 2 chain 643 AAEL001904 arp2/3 644 AAEL002771 microtubule binding protein, putative 645 AAEL005845 beta chain spectrin 646 AAEL013808 fascin 647 AAEL004440 tubulin-specific chaperone e 648 AAEL000700 cadherin 649 AAEL002761 tropomyosin invertebrate 650 AAEL004668 septin 651 AAEL003027 conserved hypothetical protein 652 AAEL002185 cuticle protein, putative 653 AAEL009527 conserved hypothetical protein 654 AAEL014483 conserved hypothetical protein 655 AAEL006340 conserved hypothetical protein 656 AAEL012207 myosin light chain 1, 657 AAEL008185 conserved hypothetical protein 658 AAEL000048 gustatory receptor Gr4 659 AAEL003593 hypothetical protein 660 AAEL015071 gustatory receptor 64a, putative 661 AAEL013882 tkr 662 AAEL007653 allantoinase 663 AAEL000820 dimethylaniline monooxygenase 664 AAEL014301 hypothetical protein 665 AAEL003989 GTP-binding protein alpha subunit, gna 666 AAEL011384 hypothetical protein 667 AAEL010674 hypothetical protein 668 AAEL007401 roundabout, putative 669 AAEL006619 conserved hypothetical protein 670 AAEL011105 adducin 671 AAEL003220 hypothetical protein 672 AAEL013028 zinc finger protein 673 AAEL010755 hypothetical protein 674 AAEL011552 hypothetical protein 675 AAEL010301 conserved hypothetical protein 676 AAEL008027 hypothetical protein 677 AAEL014991 hypothetical protein 678 AAEL004710 spingomyelin synthetase 679 AAEL000405 odd Oz protein 680 AAEL014746 o-linked n-acetylglucosamine transferase, ogt 681 AAEL004715 b-cell translocation protein 682 AAEL009646 conserved hypothetical protein 683 AAEL003623 conserved hypothetical protein 684 AAEL014042 protein phosphatase pp2a regulatory subunit b 685 AAEL009249 coronin 686 AAEL004351 casein kinase 687 AAEL008806 testis development protein prtd 688 AAEL003470 conserved hypothetical protein 689 AAEL001434 coronin 690 AAEL013969 conserved hypothetical protein 691 AAEL012915 als2cr7 692 AAEL003571 factor for adipocyte differentiation 693 AAEL001946 four and a half lim domains 694 AAEL005795 conserved hypothetical protein 695 AAEL007705 hect E3 ubiquitin ligase 696 AAEL002705 nucleolar protein c7b 697 AAEL005241 lateral signaling target protein 2 698 AAEL001853 rac-GTP binding protein 699 AAEL003698 conserved hypothetical protein 700 AAEL008879 Kynurenine 3-monooxygenase (EC 1.14.13.9)(Kynurenine 3-hydroxylase) 701 AAEL004501 s-adenosylmethionine synthetase 702 AAEL003145 bestrophin 2,3,4 703 AAEL006786 GTPase_rho 704 AAEL008171 double-stranded RNA-binding protein zn72d 705 AAEL008007 conserved hypothetical protein 706 AAEL010665 developmentally regulated RNA-binding protein 707 AAEL013057 serine/threonine-protein kinase wnk 1,3,4 708 AAEL002082 latent nuclear antigen, putative 709 AAEL002090 conserved hypothetical protein 710 AAEL004041 flotillin-2 711 AAEL010676 regulator of g protein signaling 712 AAEL008739 shc transforming protein 713 AAEL011061 hypothetical protein 714 AAEL007479 hypothetical protein 715 AAEL014851 mediator complex subunit rgr-1 716 AAEL005930 ubiquitin-protein ligase 717 AAEL002277 cAMP-dependent protein kinase type i-beta regulatory subunit 718 AAEL009422 conserved hypothetical protein 719 AAEL006460 par-6 gamma 720 AAEL001848 conserved hypothetical protein 721 AAEL002607 conserved hypothetical protein 722 AAEL000090 secretory carrier-associated membrane protein (scamp) 723 AAEL005535 conserved hypothetical protein 724 AAEL010344 SEC14, putative 725 AAEL011006 Guanylate kinase 726 AAEL006539 serine/threonine protein kinase 727 AAEL005284 receptor tyrosine phosphatase type r2a 728 AAEL009495 rab6-interacting 729 AAEL005400 2-hydroxyacid dehydrogenase 730 AAEL000395 Ultra spiracleisoform A nuclear receptor 731 AAEL002175 conserved hypothetical protein 732 AAEL010170 ras-related protein Rab-8A, putative 733 AAEL007889 F-spondin 734 AAEL008078 clk2 735 AAEL014510 sprouty 736 AAEL011417 synaptojanin 737 AAEL000591 hypothetical protein 738 AAEL001528 hypothetical protein 739 AAEL005369 zinc finger protein 740 AAEL010668 quinone oxidoreductase 741 AAEL001099 DEAD box polypeptide 742 AAEL002451 zinc finger protein 743 AAEL003845 Ets domain-containing protein 744 AAEL011970 GPCR Purine/Adenosine Family 745 AAEL007322 phosphatidate phosphatase 746 AAEL010561 conserved hypothetical protein 747 AAEL006780 hypothetical protein 748 AAEL007436 conserved hypothetical protein 749 AAEL000737 rab6 GTPase activating protein, gapcena (rabgap1 protein) 750 AAEL001133 conserved hypothetical protein 751 AAEL005683 conserved hypothetical protein 752 AAEL007375 pyruvate dehydrogenase 753 AAEL001393 triple functional domain, trio 754 AAEL005238 mck1 755 AAEL009874 conserved hypothetical protein 756 AAEL001375 Y-box binding protein 757 AAEL013308 odd Oz protein 758 AAEL001398 guanine nucleotide exchange factor 759 AAEL009171 conserved hypothetical protein 760 AAEL004964 hypothetical protein 761 AAEL009264 hypothetical protein 762 AAEL001898 conserved hypothetical protein 763 AAEL000421 protein farnesyltransferase alpha subunit/rab geranylgeranyl transferase alpha subunit 764 AAEL012554 maltose phosphorylase 765 AAEL000262 conserved hypothetical protein 766 AAEL000770 platelet-activating factor acetylhydrolase isoform 1b alpha subunit 767 AAEL003976 conserved hypothetical protein 768 AAEL002937 hypothetical protein 769 AAEL003540 conserved hypothetical protein 770 AAEL005706 triacylglycerol lipase 771 AAEL007662 casein kinase 772 AAEL013619 dolichyl-diphosphooligosaccharide protein glycosyltransferase 773 AAEL004209 opioid-binding protein/cell adhesion molecule, putative 774 AAEL003750 conserved hypothetical protein 775 AAEL004709 protein phosphatase type 2c 776 AAEL009382 lysine-specific demethylase NO66 (EC 1.14.11.27)(Nucleolar protein 66) 777 AAEL014999 conserved hypothetical protein 778 AAEL012076 conserved hypothetical protein 779 AAEL013334 conserved hypothetical protein 780 AAEL005861 vacuolar sorting protein (vps) 781 AAEL002251 conserved hypothetical protein 782 AAEL009645 hypothetical protein 783 AAEL000713 reticulon/nogo 784 AAEL006651 dystrophin 785 AAEL009606 conserved hypothetical protein 786 AAEL008591 zinc finger protein, putative 787 AAEL013459 conserved hypothetical protein 788 AAEL006041 conserved hypothetical protein 789 AAEL013510 smaug protein 790 AAEL005528 conserved hypothetical protein 791 AAEL003824 conserved hypothetical protein 792 AAEL011575 conserved hypothetical protein 793 AAEL006990 conserved hypothetical protein 794 AAEL002306 hect E3 ubiquitin ligase 795 AAEL013068 protein phsophatase-2a 796 AAEL005320 skeletrophin 797 AAEL000079 hypothetical protein 798 AAEL010020 Mediator of RNA polymerase II transcription subunit 14 (Mediator complex subunit 14) 799 AAEL007011 conserved hypothetical protein 800 AAEL000399 conserved hypothetical protein 801 AAEL001919 protein tyrosine phosphatase, non-receptor type nt1 802 AAEL005302 beta-1,4-galactosyltransferase 803 AAEL003509 smap1 804 AAEL003955 hypothetical protein 805 AAEL003928 pdgf/vegf receptor 806 AAEL000824 hypothetical protein 807 AAEL004472 hypothetical protein 808 AAEL010750 hypothetical protein 809 AAEL002706 hypothetical protein 810 AAEL007884 conserved membrane protein at 44E, putative 811 AAEL008107 f14p3.9 protein (auxin transport protein) 812 AAEL000857 conserved hypothetical protein 813 AAEL014931 sarm1 814 AAEL001709 hypothetical protein 815 AAEL008733 histidine triad (hit) protein member 816 AAEL005502 conserved hypothetical protein 817 AAEL001640 multicopper oxidase 818 AAEL003799 autophagy related gene 819 AAEL002142 conserved hypothetical protein 820 AAEL015466 conserved hypothetical protein 821 AAEL007687 transmembrane 9 superfamily protein member 4 822 AAEL013280 rho guanine exchange factor 823 AAEL003454 phocein protein, putative 824 AAEL001152 beta-1,3-galactosyltransferase-6 825 AAEL008793 conserved hypothetical protein 826 AAEL007455 thrombospondin 827 AAEL013072 conserved hypothetical protein 828 AAEL007370 conserved hypothetical protein 829 AAEL002732 nephrin 830 AAEL002364 hypothetical protein 831 AAEL007665 hypothetical protein 832 AAEL002637 tripartite motif protein trim9 833 AAEL011623 conserved hypothetical protein 834 AAEL014622 conserved hypothetical protein 835 AAEL015487 zinc finger protein, putative 836 AAEL010229 hypothetical protein 837 AAEL004412 polo kinase kinase 838 AAEL002448 hypothetical protein 839 AAEL001388 hypothetical protein 840 AAEL012998 conserved hypothetical protein 841 AAEL013231 hypothetical protein 842 AAEL010062 conserved hypothetical protein 843 AAEL007199 hypothetical protein 844 AAEL005109 WD-repeat protein 845 AAEL003312 hypothetical protein 846 AAEL013430 putative G-protein coupled receptor (GPCR) 847 AAEL003508 serine-pyruvate aminotransferase 848 AAEL002120 zinc finger protein 849 AAEL004508 hypothetical protein 850 AAEL012570 hypothetical protein 851 AAEL001569 conserved hypothetical protein 852 AAEL001094 conserved hypothetical protein 853 AAEL000165 conserved hypothetical protein 854 AAEL012086 leucine-rich immune protein (Long) 855 AAEL009520 leucine-rich immune protein (Long) 856 AAEL000703 glycogen phosphorylase 857 AAEL007677 phospholysine phosphohistidine inorganic pyrophosphate phosphatase 858 AAEL011220 Ati or CPXV158 protein, putative 859 AAEL001635 conserved hypothetical protein 860 AAEL000541 fasciclin, putative 861 AAEL005216 Conserved hypothetical protein 862 AAEL004221 glycogen synthase 863 AAEL004150 fibrinogen and fibronectin 864 AAEL012187 lethal(3)malignant brain tumor 865 AAEL003651 conserved hypothetical protein 866 AAEL003729 Probable hydroxyacid-oxoacid transhydrogenase, mitochondrial Precursor (HOT)(EC 1.1.99.24) 867 AAEL013453 sarcolemmal associated protein, putative 868 AAEL001650 conserved hypothetical protein 869 AAEL002569 serine/threonine kinase 870 AAEL012238 glutaredoxin, putative 871 AAEL004229 glutathione transferase 872 AAEL011596 mitotic checkpoint serine/threonine-protein kinase bub1 and bubr1 873 AAEL006207 conserved hypothetical protein 874 AAEL014596 hypothetical protein 875 AAEL012391 conserved hypothetical protein 876 AAEL013974 conserved hypothetical protein 877 AAEL008719 Sm protein G, putative 878 AAEL008316 mitotic spindle assembly checkpoint protein mad2 879 AAEL008646 fibrinogen and fibronectin 880 AAEL011235 conserved hypothetical protein 881 AAEL008716 conserved hypothetical protein 882 AAEL015555 conserved hypothetical protein 883 AAEL012628 conserved hypothetical protein 884 AAEL000465 conserved hypothetical protein 885 AAEL008369 acyl phosphatase, putative 886 AAEL004512 zinc finger protein 887 AAEL005557 hypothetical protein 888 AAEL001653 fetal globin-inducing factor 889 AAEL010622 hypothetical protein 890 AAEL007907 serine/threonine protein kinase 891 AAEL010013 WD-repeat protein 892 AAEL002739 conserved hypothetical protein 893 AAEL011834 hypothetical protein 894 AAEL000147 single-stranded DNA binding protein, putative 895 AAEL013943 mediator complex, 100 kD-subunit, putative 896 AAEL005976 adenine phosphoribosyltransferase, putative 897 AAEL001838 conserved hypothetical protein 898 AAEL000425 conserved hypothetical protein 899 AAEL015060 Rad51A protein, putative 900 AAEL015658 conserved hypothetical protein 901 AAEL004086 aldo-keto reductase 902 AAEL009701 conserved hypothetical protein 903 AAEL011362 hypothetical protein 904 AAEL007395 conserved hypothetical protein 905 AAEL007564 zinc finger protein 906 AAEL002888 williams-beuren syndrome critical region protein 907 AAEL012771 leucine-rich immune protein (Coil-less) 908 AAEL009149 kinectin, putative 909 AAEL009425 hypothetical protein 910 AAEL012938 zinc finger protein 911 AAEL005719 cleavage stimulation factor 912 AAEL013844 diazepam binding inhibitor, putative 913 AAEL006787 conserved hypothetical protein 914 AAEL006948 tomosyn 915 AAEL004335 secreted ferritin G subunit precursor, putative 916 AAEL014438 juvenile hormone-inducible protein, putative 917 AAEL011606 conserved hypothetical protein 918 AAEL008486 protein kinase C inhibitor, putative 919 AAEL006628 conserved hypothetical protein 920 AAEL000065 conserved hypothetical protein 921 AAEL005297 guanine nucleotide exchange factor 922 AAEL013338 lethal(2)essential for life protein, l2efl 923 AAEL015636 interleukin enhancer binding factor 924 AAEL010472 helix-loop-helix protein hen 925 AAEL002950 conserved hypothetical protein 926 AAEL005395 conserved hypothetical protein 927 AAEL000629 adenylate kinase 3, 928 AAEL004004 chromatin regulatory protein sir2 929 AAEL011816 conserved hypothetical protein 930 AAEL002399 aspartate aminotransferase 931 AAEL006203 juvenile hormone-inducible protein, putative 932 AAEL015017 islet cell autoantigen 933 AAEL013644 ubiquitously transcribed sex (x/y) chromosome tetratricopeptide repeat protein 934 AAEL006965 NBP2b protein, putative 935 AAEL004566 myo inositol monophosphatase 936 AAEL012939 gamma-subunit,methylmalonyl-CoA decarboxylase, putative 937 AAEL001703 serine-type enodpeptidase, 938 AAEL002273 trypsin, putative 939 AAEL010951 glutamate decarboxylase 940 AAEL007363 leucine-rich transmembrane protein 941 AAEL007613 Toll-like receptor 942 AAEL002166 leucine rich repeat (in flii) interacting protein 943 AAEL002206 rap GTPase-activating protein 944 AAEL005832 programmed cell death 945 AAEL000709 TOLL pathway signaling. 946 AAEL003119 C-Type Lectin (CTL). 947 AAEL014989 peptidoglycan recognition protein-1, putative 948 AAEL014356 C-Type Lectin (CTL) - selectin like. 949 AAEL003554 leucine rich repeat protein 950 AAEL001914 scavenger receptor, putative 951 AAEL006702 fibrinogen and fibronectin 952 AAEL006699 fibrinogen and fibronectin 953 AAEL011764 prophenoloxidase 954 AAEL006137 Serine Protease Inhibitor (serpin) homologue - unlikely to be inhibitory. 955 AAEL009420 Class B Scavenger Receptor (CD36 domain). 956 AAEL013417 fibrinogen and fibronectin 957 AAEL000533 C-Type Lectin (CTL). 958 AAEL002354 heme peroxidase 959 AAEL002704 Serine Protease Inhibitor (serpin) homologue 960 AAEL000633 Toll-like receptor 961 AAEL008681 C-Type Lectin (CTL). 962 AAEL009551 Toll-like receptor 963 AAEL009176 Gram-Negative Binding Protein (GNBP) or Beta-1 3- Glucan Binding Protein (BGBP). 964 AAEL007768 TOLL pathway signaling. 965 AAEL000227 Class B Scavenger Receptor (CD36 domain). 966 AAEL001163 macroglobulin/complement 967 AAEL009474 Peptidoglycan Recognition Protein (Short) 968 AAEL011009 fibrinogen and fibronectin 969 AAEL009384 fibrinogen and fibronectin 970 AAEL005800 Clip-Domain Serine Protease family E. Protease homologue. 971 AAEL007107 serine protease, putative 972 AAEL002601 Clip-Domain Serine Protease family A. Protease homologue. 973 AAEL007626 Gram-Negative Binding Protein (GNBP) or Beta-1 3- Glucan Binding Protein (BGBP). 974 AAEL003632 Clip-Domain Serine Protease family B. 975 AAEL006161 Clip-Domain Serine Protease family B. 976 AAEL003857 defensin anti-microbial peptide 977 AAEL004868 hemomucin 978 AAEL009842 galectin 979 AAEL014246 glucosyl/glucuronosyl transferases 980 AAEL002688 glucosyl/glucuronosyl transferases 981 AAEL013128 elongase, putative 982 AAEL014664 AMP dependent coa ligase 983 AAEL001273 Sec24B protein, putative 984 AAEL013458 glutamine synthetase 1, 2 (glutamate- ammonia ligase) (gs) 985 AAEL010256 E3 ubiquitin ligase 986 AAEL006687 exportin 987 AAEL014871 methylenetetrahydrofolate dehydrogenase 988 AAEL002430 n-acetylglucosamine-6-phosphate deacetylase 989 AAEL010751 methylenetetrahydrofolate dehydrogenase 990 AAEL004952 protein N-terminal asparagine amidohydrolase, putative 991 AAEL008374 E3 ubiquitin-protein ligase nedd-4 992 AAEL008687 tar RNA binding protein (trbp) 993 AAEL004294 dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase 994 AAEL005763 lysosomal alpha-mannosidase (mannosidase alpha class 2b member 1) 995 AAEL008507 srpk 996 AAEL001593 glycerol-3-phosphate dehydrogenase 997 AAEL004865 cyclin g 998 AAEL003402 sphingomyelin phosphodiesterase 999 AAEL003091 glucosyl/glucuronosyl transferases 1000 AAEL008393 phosphatidylserine synthase 1001 AAEL001523 secretory Phospholipase A2, putative 1002 AAEL014965 nova 1003 AAEL005380 mixed-lineage leukemia protein, mll 1004 AAEL003873 glycerol-3-phosphate dehydrogenase 1005 AAEL004757 cleavage and polyadenylation specificity factor 1006 AAEL002528 histone deacetylase 1007 AAEL000690 steroid dehydrogenase 1008 AAEL011957 elongase, putative 1009 AAEL012446 Inhibitor of Apoptosis (IAP) containing Baculoviral IAP Repeat(s) (BIR domains). 1010 AAEL000006 phosphoenolpyruvate carboxykinase 1011 AAEL013525 Timp-3, putative 1012 AAEL002658 AMP dependent ligase 1013 AAEL013831 pyrroline-5-carboxylate dehydrogenase 1014 AAEL002542 triosephosphate isomerase 1015 AAEL012014 l-lactate dehydrogenase 1016 AAEL012418 deoxyribonuclease ii 1017 AAEL009237 glycoside hydrolases 1018 AAEL012994 glucose-6-phosphate isomerase 1019 AAEL012455 alcohol dehydrogenase 1020 AAEL015020 glycoside hydrolases 1021 AAEL004778 acyl-coa dehydrogenase 1022 AAEL008865 oligoribonuclease, mitochondrial 1023 AAEL007893 short chain type dehydrogenase 1024 AAEL014139 proacrosin, putative 1025 AAEL008668 Clip-Domain Serine Protease family B. 1026 AAEL008124 possible RNA methyltransferase, putative 1027 AAEL014353 conserved hypothetical protein 1028 AAEL003026 regulator of g protein signaling 1029 AAEL002663 kuzbanian 1030 AAEL008202 serine-type enodpeptidase, 1031 AAEL004138 signal peptide peptidase 1032 AAEL004980 conserved hypothetical protein 1033 AAEL003733 hypothetical protein 1034 AAEL001540 ubiquitin specific protease 1035 AAEL003965 calpain 4, 6, 7, invertebrate 1036 AAEL006542 retinoid-inducible serine carboxypeptidase (serine carboxypeptidase 1037 AAEL013605 hypothetical protein 1038 AAEL005107 hypothetical protein 1039 AAEL015272 zinc carboxypeptidase 1040 AAEL008769 serine-type enodpeptidase, 1041 AAEL003967 calpain 4, 6, 7, invertebrate 1042 AAEL010989 hypothetical protein 1043 AAEL005342 conserved hypothetical protein 1044 AAEL011850 cytochrome P450 1045 AAEL006386 mitochondrial 39S ribosomal protein L39 1046 AAEL010226 daughterless 1047 AAEL004589 small calcium-binding mitochondrial carrier, putative 1048 AAEL014608 cytochrome P450 1049 AAEL007235 mitochondrial uncoupling protein 1050 AAEL003215 heat shock factor binding protein, putative 1051 AAEL010546 heat shock factor binding protein, putative 1052 AAEL000895 peroxisome biogenesis factor 1 (peroxin-1) 1053 AAEL001024 mitochondrial carrier protein 1054 AAEL006318 short-chain dehydrogenase 1055 AAEL013350 heat shock protein 26 kD, putative 1056 AAEL007046 mitochondrial brown fat uncoupling protein 1057 AAEL010372 aldehyde oxidase 1058 AAEL013693 excision repair cross-complementing 1 ercc1 1059 AAEL012308 hypothetical protein 1060 AAEL003195 Carboxy/choline esterase Alpha Esterase 1061 AAEL010677 oxidoreductase 1062 AAEL010380 aldehyde oxidase 1063 AAEL002523 mitochondrial inner membrane protein translocase, 9 kD- subunit, putative 1064 AAEL002486 mitochondrial inner membrane protein translocase, 9 kD- subunit, putative 1065 AAEL004829 NADH dehydrogenase, putative 1066 AAEL011752 glutathione transferase 1067 AAEL006984 cytochrome P450 1068 AAEL007355 mitochondrial ribosomal protein, S18A, putative 1069 AAEL003770 conserved hypothetical protein 1070 AAEL002783 mitochondrial ribosomal protein, L37, putative 1071 AAEL004450 cytochrome b5, putative 1072 AAEL008601 mitochondrial ribosomal protein, L28, putative 1073 AAEL007946 glutathione transferase 1074 AAEL013790 mitochondrial ribosomal protein, L50, putative 1075 AAEL005113 Carboxy/choline esterase Alpha Esterase 1076 AAEL004716 chromodomain helicase DNA binding protein 1077 AAEL007923 eukaryotic translation initiation factor 4 gamma 1078 AAEL010467 heterogeneous nuclear ribonucleoprotein 1079 AAEL004119 ribonuclease p/mrp subunit 1080 AAEL013653 tata-box binding protein 1081 AAEL010222 transcription factor GATA-4 (GATA binding factor-4) 1082 AAEL015263 RNA and export factor binding protein 1083 AAEL002853 ccaat/enhancer binding protein 1084 AAEL003800 hypothetical protein 1085 AAEL002551 DNA topoisomerase type I 1086 AAEL008738 DEAD box ATP-dependent RNA helicase 1087 AAEL000193 histone-lysine n-methyltransferase 1088 AAEL001912 forkhead protein/forkhead protein domain 1089 AAEL002359 homeobox protein onecut 1090 AAEL006473 arginine/serine-rich splicing factor 1091 AAEL007801 exonuclease 1092 AAEL003985 small nuclear ribonucleoprotein, core, putative 1093 AAEL010642 poly (A)-binding protein, putative 1094 AAEL001280 28S ribosomal protein S15, mitochondrial precursor 1095 AAEL015236 signal recognition particle, 9 kD-subunit, putative 1096 AAEL015045 transcription factor IIIA, putative 1097 AAEL001363 small nuclear ribonucleoprotein Sm D1, putative 1098 AAEL005888 DNA polymerase theta 1099 AAEL007885 translation initiation factor-3 (IF3), putative 1100 AAEL006582 calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type 1101 AAEL005392 dihydropyridine-sensitive l-type calcium channel 1102 AAEL003393 ATP synthase beta subunit 1103 AAEL008928 inward-rectifying potassium channel 1104 AAEL010361 rer1 protein 1105 AAEL005043 ATP-dependent bile acid permease 1106 AAEL010470 calcineurin b subunit 1107 AAEL004141 phosphatidylinositol transfer protein/retinal degeneration b protein 1108 AAEL011657 importin alpha 1109 AAEL007971 tyrosine transporter 1110 AAEL009088 liquid facets 1111 AAEL000567 Facilitated trehalose transporter Tret1 1112 AAEL003789 exportin, putative 1113 AAEL010608 succinate dehydrogenase 1114 AAEL013704 beta-arrestin 1, 1115 AAEL013614 clathrin heavy chain 1116 AAEL002061 cation-transporting ATPase 13a1 (g-box binding protein) 1117 AAEL000417 monocarboxylate transporter 1118 AAEL004743 multidrug resistance protein 2 (ATP-binding cassette protein c) 1119 AAEL002412 monocarboxylate transporter 1120 AAEL008587 glutamate receptor, ionotropic, N-methyl d-aspartate 1121 AAEL010481 sugar transporter 1122 AAEL006047 histamine-gated chloride channel subunit 1123 AAEL010823 ATP synthase delta chain 1124 AAEL004025 glucose dehydrogenase 1125 AAEL003626 sodium/chloride dependent amino acid transporter 1126 AAEL005859 amino acid transporter 1127 AAEL000435 THO complex, putative 1128 AAEL004620 sorting nexin 1129 AAEL011423 sugar transporter 1130 AAEL013215 sulfonylurea receptor/ABC transporter 1131 AAEL001313 conserved hypothetical protein 1132 AAEL003025 hypothetical protein 1133 AAEL004447 hypothetical protein 1134 AAEL004149 hypothetical protein 1135 AAEL011064 hypothetical protein 1136 AAEL002757 hypothetical protein 1137 AAEL009776 conserved hypothetical protein 1138 AAEL002835 conserved hypothetical protein 1139 AAEL014693 conserved hypothetical protein 1140 AAEL012203 conserved hypothetical protein 1141 AAEL005867 conserved hypothetical protein 1142 AAEL007539 hypothetical protein 1143 AAEL001409 conserved hypothetical protein 1144 AAEL002963 conserved hypothetical protein 1145 AAEL010308 hypothetical protein 1146 AAEL009386 hypothetical protein 1147 AAEL011153 hypothetical protein 1148 AAEL006863 hypothetical protein 1149 AAEL001786 hypothetical protein 1150 AAEL007606 hypothetical protein 1151 AAEL007242 conserved hypothetical protein 1152 AAEL008054 conserved hypothetical protein 1153 AAEL014415 conserved hypothetical protein 1154 AAEL011703 conserved hypothetical protein 1155 AAEL002169 conserved hypothetical protein 1156 AAEL002168 conserved hypothetical protein 1157 AAEL010445 hypothetical protein 1158 AAEL004583 conserved hypothetical protein 1159 AAEL003373 hypothetical protein 1160 AAEL005843 conserved hypothetical protein 1161 AAEL012302 conserved hypothetical protein 1162 AAEL012293 conserved hypothetical protein 1163 AAEL007817 hypothetical protein 1164 AAEL002327 hypothetical protein 1165 AAEL010015 hypothetical protein 1166 AAEL004800 hypothetical protein 1167 AAEL013800 conserved hypothetical protein 1168 AAEL007454 conserved hypothetical protein 1169 AAEL001581 conserved hypothetical protein 1170 AAEL001376 hypothetical protein 1171 AAEL004854 conserved hypothetical protein 1172 AAEL007015 conserved hypothetical protein 1173 AAEL000258 conserved hypothetical protein 1174 AAEL002543 conserved hypothetical protein 1175 AAEL006520 hypothetical protein 1176 AAEL006275 conserved hypothetical protein 1177 AAEL014294 conserved hypothetical protein 1178 AAEL014022 conserved hypothetical protein 1179 AAEL004832 conserved hypothetical protein 1180 AAEL000316 hypothetical protein 1181 AAEL012754 hypothetical protein 1182 AAEL005007 hypothetical protein 1183 AAEL009163 conserved hypothetical protein 1184 AAEL001495 conserved hypothetical protein 1185 AAEL004934 hypothetical protein 1186 AAEL007071 conserved hypothetical protein 1187 AAEL004363 conserved hypothetical protein 1188 AAEL007433 conserved hypothetical protein 1189 AAEL010025 conserved hypothetical protein 1190 AAEL002984 hypothetical protein 1191 AAEL003126 conserved hypothetical protein 1192 AAEL008154 hypothetical protein 1193 AAEL000649 conserved hypothetical protein 1194 AAEL013724 conserved hypothetical protein 1195 AAEL012854 hypothetical protein 1196 AAEL012858 hypothetical protein 1197 AAEL014950 spaetzle-like cytokine 1198 AAEL011066 hypothetical protein 1199 AAEL009896 hypothetical protein 1200 AAEL001727 hypothetical protein 1201 AAEL001921 hypothetical protein 1202 AAEL012396 conserved hypothetical protein 1203 AAEL005233 hypothetical protein 1204 AAEL015446 conserved hypothetical protein 1205 AAEL007550 conserved hypothetical protein 1206 AAEL011886 hypothetical protein 1207 AAEL006761 hypothetical protein 1208 AAEL003778 conserved hypothetical protein 1209 AAEL002931 hypothetical protein 1210 AAEL013303 conserved hypothetical protein 1211 AAEL007414 conserved hypothetical protein 1212 AAEL003693 hypothetical protein 1213 AAEL010150 conserved hypothetical protein 1214 AAEL004498 hypothetical protein 1215 AAEL011598 hypothetical protein 1216 AAEL003798 hypothetical protein 1217 AAEL010746 hypothetical protein 1218 AAEL011266 hypothetical protein 1219 AAEL001271 conserved hypothetical protein 1220 AAEL005193 hypothetical protein 1221 AAEL007805 hypothetical protein 1222 AAEL013304 conserved hypothetical protein 1223 AAEL008142 hypothetical protein 1224 AAEL009322 hypothetical protein 1225 AAEL004018 conserved hypothetical protein 1226 AAEL006606 hypothetical protein 1227 AAEL007437 conserved hypothetical protein 1228 AAEL013684 conserved hypothetical protein 1229 AAEL007751 predicted protein 1230 AAEL005623 hypothetical protein 1231 AAEL006896 hypothetical protein 1232 AAEL003190 hypothetical protein 1233 AAEL007886 hypothetical protein 1234 AAEL004943 conserved hypothetical protein 1235 AAEL004561 conserved hypothetical protein 1236 AAEL005264 hypothetical protein 1237 AAEL011330 conserved hypothetical protein 1238 AAEL000186 conserved hypothetical protein 1239 AAEL012931 conserved hypothetical protein 1240 AAEL000561 hypothetical protein 1241 AAEL002921 conserved hypothetical protein 1242 AAEL001162 conserved hypothetical protein 1243 AAEL012361 conserved hypothetical protein 1244 AAEL013426 hypothetical protein 1245 AAEL013935 conserved hypothetical protein 1246 AAEL003264 conserved hypothetical protein 1247 AAEL005972 hypothetical protein 1248 AAEL008680 Ubiquitin-related modifier 1 homolog 1249 AAEL003088 hypothetical protein 1250 AAEL009270 hypothetical protein 1251 AAEL012878 hypothetical protein 1252 AAEL013895 conserved hypothetical protein 1253 AAEL003816 hypothetical protein 1254 AAEL011636 hypothetical protein 1255 AAEL004775 conserved hypothetical protein 1256 AAEL006225 conserved hypothetical protein 1257 AAEL009892 conserved hypothetical protein 1258 AAEL011640 hypothetical protein 1259 AAEL009767 conserved hypothetical protein 1260 AAEL003113 conserved hypothetical protein 1261 AAEL008557 conserved hypothetical protein 1262 AAEL002856 conserved hypothetical protein 1263 AAEL004250 conserved hypothetical protein 1264 AAEL003451 conserved hypothetical protein 1265 AAEL010249 conserved hypothetical protein 1266 AAEL014937 hypothetical protein 1267 AAEL004552 conserved hypothetical protein 1268 AAEL005000 conserved hypothetical protein 1269 AAEL010768 conserved hypothetical protein 1270 AAEL004960 hypothetical protein 1271 AAEL003822 conserved hypothetical protein 1272 AAEL004473 conserved hypothetical protein 1273 AAEL009952 hypothetical protein 1274 AAEL002109 conserved hypothetical protein 1275 AAEL007849 conserved hypothetical protein 1276 AAEL010507 hypothetical protein 1277 AAEL015340 hypothetical protein 1278 AAEL013725 conserved hypothetical protein 1279 AAEL000526 conserved hypothetical protein 1280 AAEL010770 hypothetical protein 1281 AAEL015507 conserved hypothetical protein 1282 AAEL001573 conserved hypothetical protein 1283 AAEL007045 conserved hypothetical protein 1284 AAEL008403 conserved hypothetical protein 1285 AAEL007859 conserved hypothetical protein 1286 AAEL011635 conserved hypothetical protein 1287 AAEL008059 conserved hypothetical protein 1288 AAEL014633 conserved hypothetical protein 1289 AAEL011119 hypothetical protein 1290 AAEL005640 conserved hypothetical protein 1291 AAEL013740 hypothetical protein 1292 AAEL009440 conserved hypothetical protein 1293 AAEL002087 conserved hypothetical protein 1294 AAEL008436 conserved hypothetical protein 1325 AAEL007698 (AuB) 1326 AAEL003832 1327 AAEL007562 1328 AAEL010179 1329 AAEL000598
[0126] Homologs and orthologs of gene symbols GNBPA2, GNBPB4, GNBPB6, CLIPB13B, SPZ5, PGRPLD, SOCS, SOCS16D, SOCS44A, SUMO, CECG, GAM, LYSC, DOME, HOP, STAT, REL1A and CTLMA12 are also contemplated in accordance with the present teachings.
[0127] In some embodiments, the pathogen resistance gene products include, but are not limited to sequences of AAEL000652, AAEL009178, AAEL003253, AAEL006936, AAEL000393, AAEL006794, AAEL011455, AAEL015312 or AAEL001702 or their corresponding homologs and orthologs.
[0128] According to one embodiment, the pathogen resistance gene product that is downregulated is as set forth in SEQ ID NO: 3, 5, 31, 98, 102, 122, 271, 291 or 299.
[0129] According to one embodiment, the pathogen resistance gene is selected from the group consisting of AAEL007768 (MyD88), AAEL000709 (Cactus), AAEL007698 (AuB), AAEL003832, AAEL007562, Rel1A (AAEL007696), AAEL000598 and AAEL010179.
[0130] According to one embodiment, pathogen resistance gene is selected from the group consisting of SEQ ID NOs: 964, 945, 1325, 1326, 1327, 1328 and 1329.
[0131] It will be appreciated that more than one gene may be targeted in order to maximize the cytotoxic effect on the mosquitoes.
[0132] As used herein, the term downregulates an expression or downregulating expression refers to causing, directly or indirectly, reduction in the transcription of a desired gene, reduction in the amount, stability or translatability of transcription products (e.g. RNA) of the gene, and/or reduction in translation of the polypeptide(s) encoded by the desired gene.
[0133] Downregulating expression of a pathogen resistance gene product of a mosquito can be monitored, for example, by direct detection of gene transcripts (for example, by PCR), by detection of polypeptide(s) encoded by the gene (for example, by Western blot or immunoprecipitation), by detection of biological activity of polypeptides encode by the gene (for example, catalytic activity, ligand binding, and the like), or by monitoring changes in the mosquitoes (for example, reduced motility of the mosquito etc). Additionally or alternatively downregulating expression of a pathogen resistance gene product may be monitored by measuring pathogen levels (e.g. viral levels, bacterial levels etc.) in the mosquitoes as compared to wild type (i.e. control) mosquitoes not treated by the agents of the invention.
[0134] Thus, according to some aspects of the invention there is provided an isolated nucleic acid agent comprising a nucleic acid sequence which specifically downregulates the expression of at least one mosquito pathogen resistance gene product.
[0135] According to one embodiment, the agent is a polynucleotide agent, such as an RNA silencing agent.
[0136] As used herein, the term RNA silencing agent refers to an RNA which is capable of inhibiting or silencing the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include noncoding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs. In one embodiment, the RNA silencing agent is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression.
[0137] In some embodiments of the invention, the nucleic acid agent is a double stranded RNA (dsRNA). As used herein the term dsRNA relates to two strands of anti-parallel polyribonucleic acids held together by base pairing. The two strands can be of identical length or of different lengths provided there is enough sequence homology between the two strands that a double stranded structure is formed with at least 80%, 90%, 95% or 100% complementarity over the entire length. According to an embodiment of the invention, there are no overhangs for the dsRNA molecule. According to another embodiment of the invention, the dsRNA molecule comprises overhangs. According to other embodiments, the strands are aligned such that there are at least 1, 2, or 3 bases at the end of the strands which do not align (i.e., for which no complementary bases occur in the opposing strand) such that an overhang of 1, 2 or 3 residues occurs at one or both ends of the duplex when strands are annealed.
[0138] It will be noted that the dsRNA can be defined in terms of the nucleic acid sequence of the DNA encoding the target gene transcript, and it is understood that a dsRNA sequence corresponding to the coding sequence of a gene comprises an RNA complement of the gene's coding sequence, or other sequence of the gene which is transcribed into RNA.
[0139] The inhibitory RNA sequence can be greater than 90% identical, or even 100% identical, to the portion of the target gene transcript. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under stringent conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 60 degrees C. hybridization for 12-16 hours; followed by washing). The length of the double-stranded nucleotide sequences complementary to the target gene transcript may be at least about 18, 19, 21, 25, 50, 100, 200, 300, 400, 491, 500, 550, 600, 650, 700, 750, 800, 900, 1000 or more bases. In some embodiments of the invention, the length of the double-stranded nucleotide sequence is approximately from about 18 to about 1000, about 18 to about 750, about 18 to about 510, about 18 to about 400, about 18 to about 250 nucleotides in length.
[0140] The term corresponds to as used herein means a polynucleotide sequence homologous to all or a portion of a reference polynucleotide sequence. In contradistinction, the term complementary to is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. For example, the nucleotide sequence TATAC corresponds to a reference sequence TATAC and is complementary to a reference sequence GTATA.
[0141] The present teachings relate to various lengths of dsRNA, whereby the shorter version i.e., x is shorter or equals 50 bp (e.g., 17-50), is referred to as siRNA or miRNA. Longer dsRNA molecules of 51-600 are referred to herein as dsRNA, which can be further processed for siRNA molecules. According to some embodiments, the nucleic acid sequence of the dsRNA is greater than 15 base pairs in length. According to yet other embodiments, the nucleic acid sequence of the dsRNA is 19-25 base pairs in length, 30-100 base pairs in length, 100-250 base pairs in length or 100-500 base pairs in length. According to still other embodiments, the dsRNA is 500-800 base pairs in length, 700-800 base pairs in length, 300-600 base pairs in length, 350-500 base pairs in length or 400-450 base pairs in length. In some embodiments, the dsRNA is 400 base pairs in length. In some embodiments, the dsRNA is 750 base pairs in length.
[0142] The term siRNA refers to small inhibitory RNA duplexes (generally between 17-30 basepairs, but also longer e.g., 31-50 bp) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is theorized to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.
[0143] It has been found that position of the 3-overhang influences potency of a siRNA and asymmetric duplexes having a 3-overhang on the antisense strand are generally more potent than those with the 3-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.
[0144] The strands of a double-stranded interfering RNA (e.g., a siRNA) may be connected to form a hairpin or stem-loop structure (e.g., a shRNA). Thus, as mentioned the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).
[0145] The term shRNA, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5-UUCAAGAGA-3 (Brummelkamp, T. R. et al. (2002) Science 296: 550, SEQ ID NO: 302) and 5-UUUGUGUAG-3 (Castanotto, D. et al. (2002) RNA 8:1454, SEQ ID NO: 303). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.
[0146] As used herein, the phrase microRNA (also referred to herein interchangeably as miRNA or miR) or a precursor thereof refers to a microRNA (miRNA) molecule acting as a post-transcriptional regulator. Typically, the miRNA molecules are RNA molecules of about 20 to 22 nucleotides in length which can be loaded into a RISC complex and which direct the cleavage of another RNA molecule, wherein the other RNA molecule comprises a nucleotide sequence essentially complementary to the nucleotide sequence of the miRNA molecule.
[0147] Typically, a miRNA molecule is processed from a pre-miRNA or as used herein a precursor of a pre-miRNA molecule by proteins, such as DCL proteins, and loaded onto a RISC complex where it can guide the cleavage of the target RNA molecules.
[0148] Pre-microRNA molecules are typically processed from pri-microRNA molecules (primary transcripts). The single stranded RNA segments flanking the pre-microRNA are important for processing of the pri-miRNA into the pre-miRNA. The cleavage site appears to be determined by the distance from the stem-ssRNA junction (Han et al. 2006, Cell 125, 887-901, 887-901).
[0149] As used herein, a pre-miRNA molecule is an RNA molecule of about 100 to about 200 nucleotides, preferably about 100 to about 130 nucleotides which can adopt a secondary structure comprising an imperfect double stranded RNA stem and a single stranded RNA loop (also referred to as hairpin) and further comprising the nucleotide sequence of the miRNA (and its complement sequence) in the double stranded RNA stem. According to a specific embodiment, the miRNA and its complement are located about 10 to about 20 nucleotides from the free ends of the miRNA double stranded RNA stem. The length and sequence of the single stranded loop region are not critical and may vary considerably, e.g. between 30 and 50 nucleotides in length. The complementarity between the miRNA and its complement need not be perfect and about 1 to 3 bulges of unpaired nucleotides can be tolerated. The secondary structure adopted by an RNA molecule can be predicted by computer algorithms conventional in the art such as mFOLD. The particular strand of the double stranded RNA stem from the pre-miRNA which is released by DCL activity and loaded onto the RISC complex is determined by the degree of complementarity at the 5 end, whereby the strand which at its 5 end is the least involved in hydrogen bounding between the nucleotides of the different strands of the cleaved dsRNA stem is loaded onto the RISC complex and will determine the sequence specificity of the target RNA molecule degradation. However, if empirically the miRNA molecule from a particular synthetic pre-miRNA molecule is not functional (because the wrong strand is loaded on the RISC complex), it will be immediately evident that this problem can be solved by exchanging the position of the miRNA molecule and its complement on the respective strands of the dsRNA stem of the pre-miRNA molecule. As is known in the art, binding between A and U involving two hydrogen bounds, or G and U involving two hydrogen bounds is less strong that between G and C involving three hydrogen bounds.
[0150] Naturally occurring miRNA molecules may be comprised within their naturally occurring pre-miRNA molecules but they can also be introduced into existing pre-miRNA molecule scaffolds by exchanging the nucleotide sequence of the miRNA molecule normally processed from such existing pre-miRNA molecule for the nucleotide sequence of another miRNA of interest. The scaffold of the pre-miRNA can also be completely synthetic. Likewise, synthetic miRNA molecules may be comprised within, and processed from, existing pre-miRNA molecule scaffolds or synthetic pre-miRNA scaffolds. Some pre-miRNA scaffolds may be preferred over others for their efficiency to be correctly processed into the designed microRNAs, particularly when expressed as a chimeric gene wherein other DNA regions, such as untranslated leader sequences or transcription termination and polyadenylation regions are incorporated in the primary transcript in addition to the pre-microRNA.
[0151] According to the present teachings, the dsRNA molecules may be naturally occurring or synthetic.
[0152] The dsRNA can be a mixture of long and short dsRNA molecules such as, dsRNA, siRNA, siRNA+dsRNA, siRNA+miRNA, or a combination of same.
[0153] The nucleic acid agent is designed for specifically targeting a target gene of interest (e.g. a mosquito pathogen resistance gene). It will be appreciated that the nucleic acid agent can be used to downregulate one or more target genes (e.g. as described in detail above). If a number of target genes are targeted, a heterogenic composition which comprises a plurality of nucleic acid agents for targeting a number of target genes is used. Alternatively the plurality of nucleic acid agents is separately formulated. According to a specific embodiment, a number of distinct nucleic acid agent molecules for a single target are used, which may be used separately or simultaneously (i.e., co-formulation) applied.
[0154] For example, in order to silence the expression of an mRNA of interest, synthesis of the dsRNA suitable for use with some embodiments of the invention can be selected as follows. First, the mRNA sequence is scanned including the 3 UTR and the 5 UTR. Second, the mRNA sequence is compared to an appropriate genomic database using any sequence alignment software, such as the BLAST software available from the NCBI server (wwwdotncbidotnlmdotnihdotgov/BLAST/). Putative regions in the mRNA sequence which exhibit significant homology to other coding sequences are filtered out.
[0155] Qualifying target sequences are selected as template for dsRNA synthesis. Preferred sequences are those that have as little homology to other genes in the genome to reduce an off-target effect.
[0156] It will be appreciated that the RNA silencing agent of some embodiments of the invention need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.
[0157] According to one embodiment, the dsRNA specifically targets a gene selected from the group consisting of AAEL007768 (MyD88), AAEL000709 (Cactus), AAEL007698 (AuB), AAEL003832, AAEL007562, Rel1A (AAEL007696), AAEL000598 and AAEL010179.
[0158] According to one embodiment, the dsRNA is selected from the group consisting of SEQ ID NOs: 1315-1324 and 1330.
[0159] The dsRNA may be synthesized using any method known in the art, including either enzymatic syntheses or solid-phase syntheses. These are especially useful in the case of short polynucleotide sequences with or without modifications as explained above. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), Molecular Cloning: A Laboratory Manual; Ausubel, R. M. et al., eds. (1994, 1989), Current Protocols in Molecular Biology, Volumes I-III, John Wiley & Sons, Baltimore, Md.; Perbal, B. (1988), A Practical Guide to Molecular Cloning, John Wiley & Sons, New York; and Gait, M. J., ed. (1984), Oligonucleotide Synthesis; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC.
[0160] According to a specific embodiment, the nucleic acid agent is provided to the mosquito in a configuration devoid of a heterologous promoter for driving recombinant expression of the dsRNA (exogenous), rendering the nucleic acid molecule of the instant invention a naked molecule. The nucleic acid agent may still comprise modifications that may affect its stability and bioavailability (e.g., PNA).
[0161] The term recombinant expression refers to an expression from a nucleic acid construct.
[0162] As used herein devoid of a heterologous promoter for driving expression of the dsRNA means that the molecule doesn't include a cis-acting regulatory sequence (e.g., heterologous) transcribing the dsRNA. As used herein the term heterologous refers to exogenous, not-naturally occurring within a native cell of the mosquito or in a cell in which the dsRNA is fed to the larvae or mosquito (such as by position of integration, or being non-naturally found within the cell).
[0163] The nucleic acid agent can be further comprised within a nucleic acid construct comprising additional regulatory elements. Thus, according to some embodiments of aspects of the invention there is provided a nucleic acid construct comprising isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one mosquito pathogen resistance gene product.
[0164] Although the instant teachings mainly concentrate on the use of dsRNA which is not comprised in or transcribed from an expression vector (naked), the present teachings also contemplate an embodiment wherein the nucleic acid agent is ligated into a nucleic acid construct comprising additional regulatory elements. Thus, according to some embodiments of the invention there is provided a nucleic acid construct comprising an isolated nucleic acid agent comprising a nucleic acid sequence.
[0165] For transcription from an expression cassette, a regulatory region (e.g., promoter, enhancer, silencer, leader, intron and polyadenylation) may be used to modulate the transcription of the RNA strand (or strands). Therefore, in one embodiment, there is provided a nucleic acid construct comprising the nucleic acid agent. The nucleic acid construct can have polynucleotide sequences constructed to facilitate transcription of the RNA molecules of the present invention operably linked to one or more promoter sequences functional in a mosquito cell. The polynucleotide sequences may be placed under the control of an endogenous promoter normally present in the mosquito genome. The polynucleotide sequences of the present invention, under the control of an operably linked promoter sequence, may further be flanked by additional sequences that advantageously affect its transcription and/or the stability of a resulting transcript. Such sequences are generally located upstream of the promoter and/or downstream of the 3 end of the expression construct. The term operably linked, as used in reference to a regulatory sequence and a structural nucleotide sequence, means that the regulatory sequence causes regulated expression of the linked structural nucleotide sequence. Regulatory sequences or control elements refer to nucleotide sequences located upstream, within, or downstream of a structural nucleotide sequence, and which influence the timing and level or amount of transcription, RNA processing or stability, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, pausing sequences, polyadenylation recognition sequences, and the like.
[0166] It will be appreciated that the nucleic acid agents can be delivered to the mosquito larva in a variety of ways.
[0167] According to one embodiment, the composition of some embodiments comprises cells, which comprise the nucleic acid agent.
[0168] As used herein the term cell or cells refers to a mosquito larva ingestible cell.
[0169] Examples of such cells include, but are not limited to, cells of phytoplankton (e.g., algae), fungi (e.g., Legendium giganteum), bacteria, and zooplankton such as rotifers.
[0170] Specific examples include, bacteria (e.g., cocci and rods), filamentous algae and detritus.
[0171] The choice of the cell may depend on the target larvae.
[0172] Analyzing the gut content of mosquitoes and larvae may be used to elucidate their preferred diet. The skilled artisan knows how to characterize the gut content. Typically the gut content is stained such as by using a fluorochromatic stain, 4,6-diamidino-2-phenylindole or DAPI.
[0173] Cells of particular interest are the prokaryotes and the lower eukaryotes, such as fungi. Illustrative prokaryotes, both Gram-negative and Gram-positive, include Enterobacteriaceae; Bacillaceae; Rhizobiceae; Spirillaceae; Lactobacillaceae; and phylloplane organisms such as members of the Pseudomonadaceae.
[0174] An exemplary list includes Bacillus spp., including B. megaterium, B. subtilis; B. cereus, Bacillus thuringiensis, Escherichia spp., including E. coli, and/or Pseudomonas spp., including P. cepacia, P. aeruginosa, and P. fluorescens.
[0175] Among eukaryotes are fungi, such as Phycomycetes and Ascomycetes, which includes yeast, such as Schizosaccharomyces; and Basidiomycetes, Rhodotorula, Aureobasidium, Sporobolomyces, Saccharomyces spp., and Sporobolomyces spp.
[0176] According to a specific embodiment, the cell is an algal cell.
[0177] Various algal species can be used in accordance with the teachings of the invention since they are a significant part of the diet for many kinds of mosquito larvae that feed opportunistically on microorganisms as well as on small aquatic animals such as rotifers.
[0178] Examples of algae that can be used in accordance with the present teachings include, but are not limited to, blue-green algae as well as green algae.
[0179] According to a specific embodiment, the algal cell is a cyanobacterium cell which is in itself toxic to mosquitoes as taught by Marten 2007 Biorational Control of Mosquitoes. American mosquito control association Bulletin No. 7.
[0180] Specific examples of algal cells which can be used in accordance with the present teachings are provided in Marten, G. G. (1986) Mosquito control by plankton management: the potential of indigestible green algae. Journal of Tropical Medicine and Hygiene, 89: 213-222, and further listed infra.
Green Algae
[0181] Actinastrum hantzschii, Ankistrodesmus falcatus, Ankistrodesmus spiralis, Aphanochaete elegans, Chlamydomonas sp., Chlorella ellipsoidea, Chlorella pyrenoidosa, Chlorella variegate, Chlorococcum hypnosporum, Chodatella brevispina, Closterium acerosum, Closteriopsis acicularis, Coccochloris peniocystis, Crucigenia lauterbornii, Crucigenia tetrapedia, Coronastrum ellipsoideum, Cosmarium botrytis, Desmidium swartzii, Eudorina elegans, Gloeocystis gigas, Golenkinia minutissima, Gonium multicoccum, Nannochloris oculata, Oocystis mars sonii, Oocystis minuta, Oocystis pusilla, Palmella texensis, Pandorina morum, Paulschulzia pseudovolvox, Pediastrum clathratum, Pediastrum duplex, Pediastrum simplex, Planktosphaeria gelatinosa, Polyedriopsis spinulosa, Pseudococcomyxa adhaerans, Quadrigula closterioides, Radiococcus nimbatus, Scenedesmus basiliensis, Spirogyra pratensis, Staurastrum gladiosum, Tetraedron bitridens, Trochiscia hystrix.
Blue-Green Algae
[0182] Anabaena catenula, Anabaena spiroides, Chroococcus turgidus, Cylindrospermum licheniforme, Bucapsis sp. (U. Texas No. 1519), Lyngbya spiralis, Microcystis aeruginosa, Nodularia spumigena, Nostoc linckia, Oscillatoria lutea, Phormidiumfaveolarum, Spinilina platensis.
Other
[0183] Compsopogon coeruleus, CTyptomonas ovata, Navicula pelliculosa.
[0184] The nucleic acid agent is introduced into the cells. To this end cells are typically selected exhibiting natural competence or are rendered competent, also referred to as artificial competence.
[0185] Competence is the ability of a cell to take up nucleic acid molecules e.g., the nucleic acid agent, from its environment.
[0186] A number of methods are known in the art to induce artificial competence.
[0187] Thus, artificial competence can be induced in laboratory procedures that involve making the cell passively permeable to the nucleic acid agent by exposing it to conditions that do not normally occur in nature. Typically the cells are incubated in a solution containing divalent cations (e.g., calcium chloride) under cold conditions, before being exposed to a heat pulse (heat shock).
[0188] Electroporation is another method of promoting competence. In this method the cells are briefly shocked with an electric field (e.g., 10-20 kV/cm) which is thought to create holes in the cell membrane through which the nucleic acid agent may enter. After the electric shock the holes are rapidly closed by the cell's membrane-repair mechanisms.
[0189] Yet alternatively or additionally, cells may be treated with enzymes to degrade their cell walls, yielding. These cells are very fragile but take up foreign nucleic acids at a high rate.
[0190] Exposing intact cells to alkali cations such as those of cesium or lithium allows the cells to take up nucleic acids. Improved protocols use this transformation method, while employing lithium acetate, polyethylene glycol, and single-stranded nucleic acids. In these protocols, the single-stranded molecule preferentially binds to the cell wall in yeast cells, preventing double stranded molecule from doing so and leaving it available for transformation.
[0191] Enzymatic digestion or agitation with glass beads may also be used to transform cells.
[0192] Particle bombardment, microprojectile bombardment, or biolistics is yet another method for artificial competence. Particles of gold or tungsten are coated with the nucleic acid agent and then shot into cells.
[0193] Astier C R Acad Sci Hebd Seances Acad Sci D. 1976 Feb. 23; 282(8):795-7, which is hereby incorporated by reference in its entirety, teaches transformation of a unicellular, facultative chemoheterotroph blue-green Algae, Aphanocapsa 6714. The recipient strain becomes competent when the growth reaches its second, slower, exponential phase.
[0194] Vzquez-Acevedo M.sup.1Mitochondrion. 2014 Feb. 21. pii: 51567-7249(14)00019-1. doi: 10.1016/j.mito.2014.02.005, which is hereby incorporated by reference in its entirety, teaches transformation of algal cells e.g., Chlamydomonas reinhardtii, Polytomella sp. and Volvox carteri by generating import-competent mitochondria.
[0195] According to a specific embodiment the composition of the invention comprises an RNA binding protein.
[0196] According to a specific embodiment, the dsRNA binding protein (DRBP) comprises any of the family of eukaryotic, prokaryotic, and viral-encoded products that share a common evolutionarily conserved motif specifically facilitating interaction with dsRNA. Polypeptides which comprise dsRNA binding domains (DRBDs) may interact with at least 11 bp of dsRNA, an event that is independent of nucleotide sequence arrangement. More than 20 DRBPs have been identified and reportedly function in a diverse range of critically important roles in the cell. Examples include the dsRNA-dependent protein kinase PKR that functions in dsRNA signaling and host defense against virus infection and DICER.
[0197] Alternatively or additionally, an siRNA binding protein may be used as taught in U.S. Pat. Application No. 20140045914, which is herein incorporated by reference in its entirety.
[0198] According to a specific embodiment the RNA binding protein is the p19 RNA binding protein. The protein may increase in vivo stability of an siRNA molecule by coupling it at a binding site where the homodimer of the p19 RNA binding proteins is formed and thus protecting the siRNA from external attacks and accordingly, it can be utilized as an effective siRNA delivery vehicle.
[0199] According to a specific embodiment, the RNA binding protein may be attached to a target-oriented peptide.
[0200] According to a specific embodiment, the target-oriented peptide is located on the surface of the siRNA binding protein.
[0201] According to specific embodiments of the invention, whole cell preparations, cell extracts, cell suspensions, cell homogenates, cell lysates, cell supernatants, cell filtrates, or cell pellets of cell cultures of cells comprising the nucleic acid agent can be used.
[0202] The composition of some embodiments of the invention may further comprise at least one of a surface-active agent, an inert carrier vehicle, a preservative, a humectant, a feeding stimulant, an attractant, an encapsulating agent, a binder, an emulsifier, a dye, an ultra-violet protector, a buffer, a flow agent or fertilizer, micronutrient donors.
[0203] According to a specific embodiment, the cells are formulated by any means known in the art. The methods for preparing such formulations include, e.g., desiccation, lyophilization, homogenization, extraction, filtration, encapsulation centrifugation, sedimentation, or concentration of one or more cell types.
[0204] Additionally, the composition may be supplemented with larval food (food bait) or with excrements of farm animals, on which the mosquito larvae feed.
[0205] In one embodiment, the composition comprises an oil flowable suspension. For example, in some embodiments, oil flowable or aqueous solutions may be formulated to contain lysed or unlysed cells, spores, or crystals.
[0206] In a further embodiment, the composition may be formulated as a water dispersible granule or powder.
[0207] In yet a further embodiment, the compositions of the present invention may also comprise a wettable powder, spray, emulsion, colloid, aqueous or organic solution, dust, pellet, or colloidal concentrate. Dry forms of the compositions may be formulated to dissolve immediately upon wetting, or alternatively, dissolve in a controlled-release, sustained-release, or other time-dependent manner.
[0208] Alternatively or additionally, the composition may comprise an aqueous solution. Such aqueous solutions or suspensions may be provided as a concentrated stock solution which is diluted prior to application, or alternatively, as a diluted solution ready-to-apply. Such compositions may be formulated in a variety of ways. They may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (silicone or silicon derivatives, phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like).
[0209] The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be employed as foams, suspensions, emulsifiable concentrates, or the like. The ingredients may include Theological agents, surfactants, emulsifiers, dispersants, or polymers.
[0210] As mentioned, the dsRNA of the invention may be administered as a naked dsRNA. Alternatively, the dsRNA of the invention may be conjugated to a carrier known to one of skill in the art, such as a transfection agent e.g. PEI or chitosan or a protein/lipid carrier.
[0211] The compositions may be formulated prior to administration in an appropriate means such as lyophilized, freeze-dried, microencapsulated, desiccated, or in an aqueous carrier, medium or suitable diluent, such as saline or other buffer. Suitable agricultural carriers can be solid, semi-solid or liquid and are well known in the art. The term agriculturally-acceptable carrier covers all adjuvants, e.g., inert components, dispersants, surfactants, tackifiers, binders, etc. that are ordinarily used in pesticide formulation technology.
[0212] According to one embodiment, the composition is formulated as a semi-solid such as in agarose (e.g. agarose cubes).
[0213] As mentioned, the nucleic acid agents can be delivered to the mosquito larva in various ways. Thus, administration of the composition to the mosquito larva may be carried out using any suitable or desired manual or mechanical technique for application of a composition comprising a nucleic acid agent, including but not limited to spraying, soaking, brushing, dressing, dripping, dipping, coating, spreading, applying as small droplets, a mist or an aerosol.
[0214] According to one embodiment, the composition is administered to the larvae by soaking or by spraying.
[0215] Soaking the larva with the composition can be effected for about 2 hours to 96 hours, about 2 hours to 84 hours, about 2 hours to 72 hours, for about 2 hours to 60 hours, about 2 hours to 48 hours, about 2 hours to 36 hours, about 2 hours to 24 hours, about 2 hours to 12 hours, 12 hours to 96 hours, about 12 hours to 84 hours, about 12 hours to 72 hours, for about 12 hours to 60 hours, about 12 hours to 48 hours, about 12 hours to 36 hours, about 12 hours to 24 hours, or about 24 hours to 48 hours.
[0216] According to a specific embodiment, the composition is administered to the larvae by soaking for 12-24 hours.
[0217] According to one embodiment, the composition is administered to the larvae by feeding.
[0218] Feeding the larva with the composition can be effected for about 2 hours to 120 hours, about 2 hours to 108 hours, about 2 hours to 96 hours, about 2 hours to 84 hours, about 2 hours to 72 hours, for about 2 hours to 60 hours, about 2 hours to 48 hours, about 2 hours to 36 hours, about 2 hours to 24 hours, about 2 hours to 12 hours, 12 hours to 24 hours, about 24 hours to 36 hours, about 24 hours to 48 hours, about 36 hours to 48 hours, for about 48 hours to 60 hours, about 60 hours to 72 hours, about 72 hours to 84 hours, about 84 hours to 96 hours, about 96 hours to 108 hours, or about 108 hours to 120 hours.
[0219] According to a specific embodiment, the composition is administered to the larvae by feeding for 48-96 hours.
[0220] According to one embodiment, feeding the larva with the composition is affected until the larva reaches pupa stage.
[0221] According to one embodiment, dsRNA is administered to the larva by soaking followed by feeding with food-containing dsRNA. Thus, for example, larvae (e.g. first, second, third or four instar larva, e.g. third instar larvae) are first treated (in groups of about 100 larvae) with dsRNA at a dose of about 0.001-5 g/L (e.g. 0.2 g/L), in a final volume of about 3 mL of dsRNA solution in autoclaved water. After soaking in the dsRNA solutions for about 12-48 hours (e.g. for 24 hrs) at 25-29 C. (e.g. 27 C.), the larvae are transferred into containers so as not to exceed concentration of about 200-500 larvae/1500 mL (e.g. 300 larvae/1500 mL) of chlorine-free tap water, and provided with food containing dsRNA (e.g. agarose cubes containing 300 g of dsRNA, e.g. 1 g of dsRNA/larvae). The larva are fed once a day until they reach pupa stage (e.g. for 2-5 days, e.g. four days). Larvae are also fed with additional food requirements, e.g. 2-10 mg/100 mL (e.g. 6 mg/100 mL) lab dog/cat diet suspended in water.
[0222] Feeding the larva can be effected using any method known in the art. Thus, for example, the larva may be fed with agrose cubes, chitosan nanoparticles, oral delivery or diet containing dsRNA.
[0223] Chitosan nanoparticles: A group of 15-20 3rd-instar mosquito larvae are transferred into a container (e.g. 500 ml glass beaker) containing 50-1000 ml, e.g. 100 ml, of deionized water. One sixth of the gel slices that are prepared from dsRNA (e.g. 32 g of dsRNA) are added into each beaker. Approximately an equal amount of the gel slices are used to feed the larvae once a day for a total of 2-5 days, e.g. four days (see Insect Mol Biol. 2010 19(5):683-93).
[0224] Oral delivery of dsRNA: First instar larvae (less than 24 hrs old) are treated in groups of 10-100, e.g. 50, in a final volume of 25-100 l of dsRNA, e.g. 75 l of dsRNA, at various concentrations (ranging from 0.01 to 5 g/l, e.g. 0.02 to 0.5 g/1-dsRNAs) in tubes e.g. 2 mL microfuge tube (see J Insect Sci. 2013; 13:69).
[0225] Diet containing dsRNA: larvae are fed a single concentration of 1-2000 ng dsRNA/mL, e.g. 1000 ng dsRNA/mL, diet in a diet overlay bioassay for a period of 1-10 days, e.g. 5 days (see PLoS One. 2012; 7(10): e47534.).
[0226] Diet containing dsRNA: Newly emerged larvae are starved for 1-12 hours, e.g. 2 hours, and are then fed with a single drop of 0.5-10 l, e.g. 1 l, containing 1-20 g, e.g. 4 g, dsRNA (1-20 g of dsRNA/larva, e.g. 4 g of dsRNA/larva) (see Appl Environ Microbiol. 2013 August; 79(15):4543-50).
[0227] Thus, according to a specific embodiment, the composition may be applied to standing water. The mosquito larva may be soaked in the water for several hours (1, 2, 3, 4, 5, 6 hours or more) to several days (1, 2, 3, 4 days or more) with or without the use of transfection reagents or dsRNA carriers.
[0228] Alternatively, the mosquito larva may be sprayed with an effective amount of the composition (e.g. via an aqueous solution).
[0229] If needed, the composition may be dissolved, suspended and/or diluted in a suitable solution (as described in detail above) before use.
[0230] The nucleic acid compositions of the invention may be employed in the method of the invention singly or in combination with other compounds, including, but not limited to, inert carriers that may be natural, synthetic, organic or inorganic, humectants, feeding stimulants, attractants, encapsulating agents (for example Algae, bacteria and yeast, nanoparticles), dsRNA binding proteins, binders, emulsifiers, dyes, sugars, sugar alcohols, starches, modified starches, dispersants, or combinations thereof may also be utilized in conjunction with the composition of some embodiments of the invention.
[0231] Compositions of the invention can be used to control (e.g. exterminate) mosquitoes. Such an application comprises administering to larvae of the mosquitoes an effective amount of the composition which renders an adult stage of the mosquitoes lethally susceptible to a pathogen, thereby controlling (e.g. exterminating) the mosquitoes.
[0232] Thus, regardless of the method of application, the amount of the active component(s) are applied at a effective amount for an adult stage of the mosquito to be lethally susceptible to a pathogen, which will vary depending on factors such as, for example, the specific mosquito to be controlled, the type of pathogen (bacteria, virus, protozoa, etc.), the water source to be treated, the environmental conditions, and the method, rate, and quantity of application of the composition.
[0233] The concentration of the composition that is used for environmental, systemic, or foliar application will vary widely depending upon the nature of the particular formulation, means of application, environmental conditions, and degree of biocidal activity.
[0234] Exemplary concentrations of dsRNA in the composition (e.g. for soaking) include, but are not limited to, about 1 pg-10 g of dsRNA/l, about 1 pg-1 g of dsRNA/l, about 1 pg-0.1 g of dsRNA/l, about 1 pg-0.01 g of dsRNA/l, about 1 pg-0.001 g of dsRNA/l, about 0.001 g-10 g of dsRNA/l, about 0.001 g-5 g of dsRNA/l, about 0.001 g-1 g of dsRNA/l, about 0.001 g-0.1 g of dsRNA/l, about 0.001 g-0.01 g of dsRNA/l, about 0.01 g-10 g of dsRNA/l, about 0.01 g-5 g of dsRNA/l, about 0.01 g-1 g of dsRNA/l, about 0.01 g-0.1 g of dsRNA/l, about 0.1 g-10 g of dsRNA/l, about 0.1 g-5 g of dsRNA/l, about 0.5 g-5 g of dsRNA/l, about 0.5 g-10 g of dsRNA/l, about 1 ig-5 ig of dsRNA/l, or about 1 g-10 g of dsRNA/l.
[0235] When formulated as a feed, the dsRNA may be effected at a dose of 1 pg/larvae-1000 g/larvae, 1 pg/larvae-500 g/larvae, 1 pg/larvae-100 g/larvae, 1 pg/larvae-10 g/larvae, 1 pg/larvae-1 g/larvae, 1 pg/larvae-0.1 g/larvae, 1 pg/larvae-0.01 g/larvae, 1 pg/larvae-0.001 g/larvae, 0.001-1000 g/larvae, 0.001-500 g/larvae, 0.001-100 g/larvae, 0.001-50 g/larvae, 0.001-10 g/larvae, 0.001-1 g/larvae, 0.001-0.1 g/larvae, 0.001-0.01 g/larvae, 0.01-1000 g/larvae, 0.01-500 g/larvae, 0.01-100 g/larvae, 0.01-50 g/larvae, 0.01-10 g/larvae, 0.01-1 g/larvae, 0.01-0.1 g/larvae, 0.1-1000 g/larvae, 0.1-500 g/larvae, 0.1-100 g/larvae, 0.1-50 g/larvae, 0.1-10 g/larvae, 0.1-1 g/larvae, 1-1000 g/larvae, 1-500 g/larvae, 1-100 g/larvae, 1-50 g/larvae, 1-10 g/larvae, 10-1000 g/larvae, 10-500 g/larvae, 10-100 g/larvae, 10-50 g/larvae, 50-1000 g/larvae, 50-500 g/larvae, 50-400 g/larvae, 50-300 g/larvae, 100-500 g/larvae, 100-300 g/larvae, 200-500 g/larvae, 200-300 g/larvae, or 300-500 g/larvae.
[0236] The mosquito larva food containing dsRNA may be prepared by any method known to one of skill in the art. Thus, for example, cubes of dsRNA-containing mosquito food may be prepared by first mixing 10-500 g, e.g. 300 g of dsRNA with 3 to 300 g, e.g. 10 g of a transfection agent e.g. Polyethylenimine 25 kDa linear (Polysciences) in 10-500 L, e.g. 200 L of sterile water. Alternatively, 2 different dsRNA (10-500 g, e.g. 150 g of each) plus 3 to 300 g, e.g. 30 g of Polyethylenimine may be mixed in 10-500 L, e.g. 200 L of sterile water. Alternatively, cubes of dsRNA-containing mosquito food may be prepared without the addition of transfection reagents. Then, a suspension of ground mosquito larval food (1-20 grams/100 mL e.g. 6 grams/100 mL) may be prepared with 2% agarose (Fisher Scientific). The food/agarose mixture can then be heated to 53-57 C., e.g. 55 C., and 10-500 L, e.g. 200 L of the mixture can then be transferred to the tubes containing 10-500 L, e.g. 200 L of dsRNA+PEI or dsRNA only. The mixture is then allowed to solidify into a gel. The solidified gel containing both the food and dsRNA can be cut into small pieces (approximately 1-10 mm, e.g. 1 mm, thick) using a razor blade, and can be used to feed mosquito larvae in water.
[0237] According to some embodiments, the nucleic acid agent is provided in amounts effective to reduce or suppress expression of at least one mosquito pathogen resistance gene product. As used herein a suppressive amount or an effective amount refers to an amount of dsRNA which is sufficient to downregulate (reduce expression of) the target gene by at least 20%, 30%, 40%, 50%, or more, say 60%, 70%, 80%, 90% or more even 100%.
[0238] Testing the efficacy of gene silencing can be effected using any method known in the art. For example, using quantitative RT-PCR measuring gene knockdown. Thus, for example, ten to twenty larvae from each treatment group can be collected and pooled together. RNA can be extracted therefrom and cDNA syntheses can be performed. The cDNA can then be used to assess the extent of RNAi by measuring levels of gene expression using qRT-PCR.
[0239] Reagents of the present invention can be packed in a kit including the nucleic acid agent (e.g. dsRNA), instructions for administration of the nucleic acid agent, construct or composition to mosquito larva.
[0240] Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, which may contain one or more dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration to the mosquito larva.
[0241] As used herein the term about refers to 10%.
[0242] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0243] The term consisting of means including and limited to.
[0244] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0245] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0246] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0247] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0248] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0249] As used herein, the term treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
[0250] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0251] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0252] Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
[0253] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., Eds. (1984); Animal Cell Culture Freshney, R. 1., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, Calif. (1990); Marshak et al., Strategies for Protein Purification and CharacterizationA Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Example 1
Materials and Experimental Procedures
[0254] Gene Target Selection
[0255] Target genes are selected according to reported microarray and RNAseq experiments that compare populations of infected versus uninfected mosquitoes. A list of about 100 potential genes for target is generated. Genes from different functional categories are targeted, such as: metabolism (MET), immunity (IMM), cytoskeleton, cell membrane, cell motility and extracellular structures (C-CWCM-ES), post-translational modification, protein turnover, chaperone (PM-PT-C), signal transduction (ST), proteolysis (PROT), oxidoreductase activity (REDOX), transcription and translation (TT), diverse (DIV), transport (TR), cell-cycle (CC), energy production and conversion (EPC), chromatin structure and dynamics (CSD). The specific sequence for targeting is selected according to siRNA analysis available on-line, such as://www(dot)med(dot)nagoya-u(dot)ac(dot)jp/neurogenetics/i_Score/i_score(dot)html. The selected sequences are ordered synthetically and serve as template for in vitro reverse transcription reaction.
[0256] For example, RNAi pathway genes, including the sequence of the gene
[0257] AAEL011753 (r2d2) by 76-575 (SEQ ID NO: 304, one of the proteins of the silencing complex) is selected for targeting and dsRNA targeting same is generated as described below.
[0258] dsRNA Preparation
[0259] dsRNA preparation is performed by reverse transcription reaction using T7 primers, such as with the Ambion MEGAscript RNAi Kit. dsRNA integrity is verified on gel and purified by a column based method. The concentration of the dsRNA is evaluated both by Nano-drop and gel-based estimation. This dsRNA serves for the following experiments.
[0260] Bioassays
[0261] A. aegypti is reared at 27 C., 50% humidity, on a 16:8 L:D photoperiod. Females are fed warmed cattle blood through a stretched film. Mosquito eggs are allowed to develop for a minimum of one week, then are submerged in dechlorinated tap water to induce hatching. Larvae are maintained on a ground powder diet compromising dry cat food, dry rabbit chow, fish flakes and yeast.
[0262] Groups of 20 first instar larvae are soaked for 2 hr in 75 l water containing 0.5 g/l dsRNA and 0.5% bromophenol blue. The larvae are photographed and the intensity of the dye in the gut is calculated using ImageJ image processing software (://rsbweb(dot)nih(dot)gov/ij/). The extent of dye in the gut is correlated with the extent of knockdown of the gene expression using quantitative reverse transcriptase PCR (see section below). Once it is determined that dsRNA is being ingested by larvae, subsequent dsRNA treatments are performed without the addition of the dye.
[0263] First instar larvae (less than 24 hr old) are treated in groups of 50 in a final volume 75 l of dsRNA at a concentration of 0.5 g/l dsRNAs) in a 2 mL microfuge tube. Negative control larvae are treated with either water alone or with scrambled dsRNA, which has no homology with any mosquito genes and has no adverse effects on several other insects.
[0264] Larvae are soaked in the dsRNA solutions for 2 hr at 27 C., and then transferred to 12-well tissue culture plates, which are also maintained at 27 C., and are provided with a restricted diet on a daily basis. This amount of food is equivalent to half-rations of food per day typically enabled for most of the insects' population to develop to the pupal stage in 5 days. The reduced food during these bioassays slows their development and facilitates easier monitoring of differential growth rates and/or survivorship. Growth and/or survival of the larvae are observed over a 2-week period, by which time all non-treated larvae are pupated and have developed into adults. Once becoming adults, the mosquitoes are infected with viruses, and the extant of infection is tested.
[0265] Quantitative RT-PCR to Measure Gene Knockdown
[0266] Ten to 20 larvae from each treatment is collected and pooled together 3 days after the single 2 hr dsRNA soakings. RNA extractions and cDNA syntheses are performed. Only live insects are used for the RNA extractions, as the RNA in dead insects could have degraded. The cDNA from each replicate treatment is then used to assess the extent of RNAi by measuring levels of gene expression using qRT-PCR. Reactions are performed in triplicate and compared to an internal reference to compare levels of RNAi. Larva with decreased levels of a tested gene are allowed to pupate and become adult. The adult mosquitoes are further submitted to virus infection.
[0267] Virus and Mosquito Oral Infection
[0268] Viruses are cultured in Ae. albopictus C6/36 cells and high passage (25 passages) viruses are used in oral challenges as previously described [Salazar et al. (2007) BMC Microbiol 30: 7-9]. Specifically, about 350 adult females are fed either a virus-infected meal diluted 1:1 in cattle's blood or uninfected C6/36 cell culture medium diluted 1:1 in cattle's blood, respectively. Blood meals are measured for their viral titer. After blood feeding, 20 virus infected mosquitoes are sacrificed and viral titers are determined for each individual using a standard method as previously described [Hess et al. (2011) BMC Microbiol 11: 45]. Specifically, mosquito bodies are homogenized in 270 ml of Dulbecco's Modified Eagle Medium (DMEM) and then centrifuged to eliminate large debris particles. The supernatant are then further filtered and used in serial dilutions to infect monolayers of Vero cells. The lowest concentration infecting Vero cells is used to calculate the viral titer of virus infected mosquitoes.
Results
Use of Externally Ingested dsRNA to Increase Susceptibility of Mosquitoes to Human Pathogenic Viruses
[0269] A recently published RNAseq analysis describing mosquito transcriptional profiles during Dengue fever virus infection (DENVI) showed that all transcripts representing immunity-related genes with differential accumulation in midgut samples were always more abundant in control than DENV mosquitoes, supporting the conclusion that there is a suppression of the insect immune system following infection. This result may reflect the general DENV downregulation trend observed. A similar pattern was seen in carcass samples at early time points postinfection, but the opposite was observed at 14 days post infection (dpi), reflecting a possible change in immune modulation during the course of the infection [Bonizzoni et al. (2012) PLoS ONE 7(11): e50512].
[0270] The present inventors contemplate that feeding dsRNA to mosquitoes that will make them more susceptible to a pathogenic human virus that they carry means that only those mosquitoes that contract the virus will die from the dsRNA delivered.
[0271] Accordingly, genes to be targeted are selected, for example, as those whose products were more abundant in DENV as compared to control non-infected mosquitoes in carcass samples. Therefore, mosquitoes are fed with dsRNA targeting chromatin structure and dynamics (AAEL003673 [histone H4]; AAEL003689 [histone H4]; AAEL003669 [histone H2]), proteolysis (AAEL002610 [serine protease]), transcription and translation (AAEL005004) and immunity (AAEL011455 [CTLMA12]; AAEL007599, AAEL007585, AAEL012216, AAEL015312 [cathepsin B]; AAEL017536 [holotricin]).
[0272] Furthermore, genes to be targeted are selected, for example, as those whose transcript accumulation levels are higher in midgut samples of DENV as compared to control non-infected mosquitoes. Accordingly, mosquitoes are fed with dsRNA targeting genes linked to transcription and translation (AAEL003603), redox activity (AAEL007669) and to unknown functions (AAEL001702; AAEL017571).
[0273] Furthermore, genes to be targeted are selected, for example, as those who are more abundant in salivary glands of DENV as compared to control non-infected mosquitoes. Accordingly, mosquitoes are fed with dsRNA targeting immunity-related genes (AAEL015312 and AAEL012216, both encoding for cathepsin B). Furthermore, mosquitoes are fed with dsRNA targeting a total of 12 genes which had read coverage in salivary glands of DENV mosquitoes, but not in the salivary gland of control mosquitoes and are associated with various functions in metabolism (AAEL008418 [pyrroline-5-carboxylate reductase]), proteolysis (AAEL013857), the cytoskeleton (AAEL000335 [lamin]), redox activity (AAEL003211), chromatin structure and dynamics (AAEL003950 [helicase]), transcription and translation (AAEL002422 [cytoplasmic polyadenylation element binding protein]) and signal transduction (AAEL015328).
[0274] Moreover, when exposed to arboviruses mosquitoes respond with anti-microbial immune pathways like Janus kinase-signal transducer and activator of transcription (JAK/STAT) and Toll pathways, immune deficiency (IMD) and RNA interference (RNAi) machinery. Accordingly, mosquitoes are fed with dsRNA targeting these pathways. This process enables high viral titers and mosquito death.
[0275] Thus, mosquitoes are fed with dsRNA targeting Toll pathway genes (see
TABLE-US-00003 TABLE 2 Toll pathway genes gene Gene ID name functional group AAEL000652 GNBPA2 pattern recognition receptor AAEL009178 GNBPB4 pattern recognition receptor AAEL007064 GNBPB6 pattern recognition receptor AAEL003253 CLIPB13B signal modulation AAEL001929 SPZ5 Toll AAEL011608 PGRPLD pattern recognition receptor AAEL007696 REL1A Toll AAEL015515 CECG Effector AAEL004522 GAM Effector AAEL015404 LYSC Effector
[0276] Mosquitoes are fed with dsRNA targeting JAK/STAT pathway genes (see
TABLE-US-00004 TABLE 3 JAK/STAT pathway genes Gene ID gene name AAEL012471 DOME AAEL012553 HOP AAEL009692 STAT AAEL006949, SOCS16D AAEL006936 AAEL000255 SOCS44A AAEL000393 SOCS AAEL015099 SUMO
[0277] Mosquitoes are fed with dsRNA targeting RNAi machinery including the gene AAEL011753 (r2d2), dcr2, and ago2.
[0278] The piRNA pathway, which has been suggested to function as an additional small RNA-mediated antiviral response to the known infection-induced siRNA response, is also targeted by the dsRNA. Exemplary genes which are targeted include those coding for the proteins Ago3, Ago4-like, Ago5-like, Armitage, Spn-E,Rm62-like. Accordingly mosquitoes are fed with dsRNA targeting these genes.
[0279] Other Pathways and Genes which are Targeted with the dsRNA
[0280] Mosquitoes are also fed with dsRNA targeting other pathways and genes, which may be involved in increasing susceptibility of the mosquitoes to viral infections. These include the genes listed in Table 4A, below.
TABLE-US-00005 TABLE 4A Other pathways and genes which may be targeted Gene Family or Pathway Dm Ag Aa 1:1:1 1:1 Total Attacins (ATTs) 4 1 1 0 0 6 Caspases (CASPs) 7 14 10 2 2 31 Catalases (CATs) 2 1 2 0 0 5 Cecropins (CECs) 5 4 10 0 1 19 CLIP-domain Serine Proteases 11 15 6 3 1 32 A (CLIPAs) CLIP-domain Serine Proteases 14 20 36 3 5 70 B (CLIPBs) CLIP-domain Serine Proteases 7 8 12 0 4 27 C (CLIPCs) CLIP-domain Serine Proteases 10 7 8 5 0 25 D (CLIPDs) CLIP-domain Serine Proteases 3 6 5 0 0 14 E (CLIPEs) C-Type Lectins (CTLs) 34 25 39 9 1 98 Defensins (DEFs) 1 4 4 0 0 9 Fibrinogen-Related proteins 14 61 37 2 3 112 (FREPs) Galectins (GALEs) 6 10 12 3 1 28 Glutathione Peroxidases (GPXs) 2 3 3 2 1 8 Gram-Negative Binding 3 7 7 1 4 17 Proteins (GNBPs) Heme Peroxidases (HPXs) 10 18 12 8 1 40 IMD Pathway Members 5 5 6 4 0 16 Inhibitors of Apoptosis 4 8 5 4 0 17 (IAPs) JAK/STAT Pathway Members 3 4 3 2 0 10 Lysozymes (LYSs) 13 8 7 1 1 28 MD2-like Proteins (MLs) 8 11 17 2 2 36 Other Anti-microbial Peptides 11 1 3 0 1 15 (AMPs)* Peptidoglycan Recognition 13 7 8 5 0 28 Proteins (PGRPs) Prophenoloxidases (PPOs) 3 9 10 0 3 22 Rel-like NFkappa-B Proteins 3 2 3 1 0 8 (RELs) Scavenger Receptors Class-A 5 5 5 4 1 15 (SCRAs) Scavenger Receptors Class-B 13 13 13 8 5 39 (SCRBs) Scavenger Receptors Class-C 4 1 2 0 1 7 (SCRCs) Serine Protease Inhibitors 30 17 23 2 14 70 (SRPNs) Spetzle-like Proteins (SPZs) 6 6 9 4 0 21 Superoxide Dismutatses (SODs) 4 5 6 4 1 15 Thio-Ester Containing 6 13 8 1 1 27 Proteins (TEPs) Thioredoxin Peroxidases 8 5 5 4 1 18 (TPXs) Toll Pathway Members 4 4 4 4 0 12 Toll Receptors (TOLLs) 9 10 12 3 2 30 Totals 285 338 353 91 57 976 *Diptericins, Drosomycins, Drosocin, Metchnikowin, Gambicin, Holotricin
[0281] Taken together, these genes can serve as valid target for dsRNA silencing, thus reducing the mosquito's self-defense against the virus infection, causing the mosquito to be more susceptible to virus infection.
Example 2
Materials and Experimental Procedures
[0282] Mosquito Maintenance
[0283] Mosquitoes were taken from an Ae. aegypti colony of the Rockefeller strain, which were reared continuously in the laboratory at 28 C. and 70-80% relative humidity. Adult mosquitoes were maintained in a 10% sucrose solution, and the adult females were fed with sheep blood for egg laying. The larvae were reared on dog/cat food unless stated otherwise.
[0284] Introducing dsRNA into a Mosquito Larvae
[0285] Soaking with Naked dsRNA Plus Additional Larvae Feeding with Food-Containing dsRNA
[0286] Third instar larvae were treated (in groups of 100 larvae) in a final volume of 3 mL of dsRNA solution in autoclaved water. Targets and dsRNA concentrations are shown in table 4B below. The control group was kept in 3 ml sterile water only. After soaking in the dsRNA solutions for 24 hr at 27 C., the larvae were transferred into new containers (300 larvae/1500 mL of chlorine-free tap water), and provided both agarose cubes containing 300 g of dsRNA once a day (for a total of two days) and 6 mg/100 mL lab dog/cat diet (Purina Mills) suspended in water. As pupae developed, they were transferred to individual vials to await eclosion and sex sorting. For bioassays purpose only females up to five days old were used. See Flowchart in
TABLE-US-00006 TABLE 4B Targets and dsRNA concentrations dsRNA Concentration (g/L per 100 larvae) MyD88 (AAEL007768) 0.2 Rel-1A (AAEL007696) 0.1 AAEL003832 0.1 AAEL000598 0.2 AAEL007562 0.2 AAEL010179 0.2
[0287] Preparation of Mosquito Larval Food Containing dsRNA
[0288] Cubes of dsRNA-containing mosquito food were prepared as follows: First, 300 g of dsRNA were mixed with 30 g of Polyethylenimine 25 kDa linear (Polysciences) in 200 L of sterile water. Alternatively, 2 different dsRNA (150 g of each) plus 30 g of Polyethylenimine were mixed in 200 L of sterile water. Then, a suspension of ground mosquito larval food (6 grams/100 mL) was prepared with 2% agarose (Fisher Scientific). The food/agarose mixture was heated to 55 C. and 200 L of the mixture was then transferred to the tubes containing 200 L of dsRNA+PEI or water only (control). The mixture was then allowed to solidify into a gel. The solidified gel containing both the food and dsRNA was cut into small pieces (approximately 1 mm thick) using a razor blade, which were then used to feed mosquito larvae in water.
[0289] RNA Isolation and dsRNA Production
[0290] Total RNA was extracted from groups of five Ae. aegypti fourth instar larvae and early adult male/female Ae. aegypti, using TRIzol (Invitrogen, Carlsbad, Calif., USA) according to the manufacturer's instructions. RNA was treated with amplification grade DNase I (Invitrogen) and 1 g was used to synthesize cDNA using a First Strand cDNA Synthesis kit (Invitrogen). The cDNA served as template DNA for PCR amplification of gene fragments using the primers listed in Table 5, below. PCR products were purified using a QIAquick PCR purification kit (Qiagen). The MEGAscript RNAi kit (Ambion) was then used for in vitro transcription and purification of dsRNAs (Table 6, below).
TABLE-US-00007 TABLE5 qPCRprimers Targetgene Accessionnumber qPCRprimers(5-3) FHVRNA-1 EF690537.1 F:CCAGATCACCCGAACTGAAT (SEQIDNO:1295) R:AGGCTGTCAAGCGGATAGAA (SEQIDNO:1296) Argonaute-3 XM_001652895.1 F:TCGGCATTCGTAGCTTCGTT AAEL007823 (SEQIDNO:1297) R:GCAGCTGACAGTTTGCCTTC (SEQIDNO:1298) AuB F:CAGAATCCCAGACCCGGAAC AAEL007698 (SEQIDNO:1299) R:TTGGCGAAACCGTACCTTGA (SEQIDNO:1300) Cactus XM_001650217.2 F:ACTTTCCCTGGCCTTTCCAC AAEL000709 (SEQIDNO:1301) R:GCGAAACGTGAAGGTGCTAC (SEQIDNO:1302) MyD88 XM_001658585.2 F:TGCCGAGAACAGTGATCAGG AAEL007768 (SEQIDNO:1303) R:CTCAGATTTTTCGCCGGTGC (SEQIDNO:1304) AAEL007696 XM_001652790.2 F:GGACTCGTCGGAGCTGAAAT Rel-1A (SEQIDNO:1305) R:AACTGTCCGAGAGGGTTTCG (SEQIDNO:1306) AAEL003832 XM_001657238.2 F:TGAGTTTCTCGAGAGGAAAACCT (SEQIDNO:1307) R:TCACTACCCCTCCCTCGTTT (SEQIDNO:1308) AAEL000598 XM_001649131.2 F:TTCGCAGCTTTCGTCATGTG (SEQIDNO:1309) R:TTTCGAAACGGCGCAATCAC (SEQIDNO:1310) AAEL007562 XM_001658400.1 F:AGCTGCCATGTCTCAATCGT (SEQIDNO:1311) R:CCAGTTGGAAATTTCGCGGG (SEQIDNO:1312) AAEL010179 XM_001654244.1 F:TTCTGTTGGACGGCCCTTAC (SEQIDNO:1313) R:AGCCCGCAAACGGTGTAATA (SEQIDNO:1314)
TABLE-US-00008 TABLE 6 dsRNA sequences Target gene Accession number dsRNA sequence Argonaute-3 XM_001652895.1 SEQ ID NO: 1315 AAEL007823 AuB SEQ ID NO: 1316 AAEL007698 Cactus XM_001650217.2 SEQ ID NO: 1317 AAEL000709 MyD88 XM_001658585.2 SEQ ID NO: 1318 AAEL007768 AAEL007696 XM_001652790.2 SEQ ID NO: 1319 Rel1A AAEL003832 XM_001657238.2 SEQ ID NO: 1320 AAEL007562 XM_001658400.1 SEQ ID NO: 1321 AAEL010179 XM_001654244.1 SEQ ID NO: 1322 B2 FVH X77156.1 SEQ ID NO: 1323 Dicer-2 AY713296.1 SEQ ID NO: 1324
[0291] qPCR Analysis
[0292] Approximately 1000 ng first-strand cDNA obtained as described previously was used as template. The qPCR reactions were performed using SYBR Green PCR Master Mix (Applied Biosystems) following the manufacturer's instructions. Briefly, approximately 50 ng/l cDNA and gene-specific primers (600 nM) were used for each reaction mixture. qPCR conditions used were 10 min at 95 C. followed by 35 cycles of 15 s at 94 C., 15 s at 54 C. and 60 s at 72 C. The ribosomal protein S7 and tubulin were used as the reference gene to normalize expression levels amongst the samples. Raw quantification cycle (Cq) values normalized against those of the tubulin and S7 standards were then used to calculate the relative expression levels in samples using the 2.sup.Ct method [Livak & Schmittgen, (2001) Methods. 25(4):402-8]. Results (meanSD) are representative of at least two independent experiments performed in triplicate.
[0293] Cells and Preparation of Flock House Virus (FHV) Stocks
[0294] D. melanogaster cells (S2) were grown at 26 C. in Schneider's insect cell medium (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (FBS). FHV stocks were prepared by propagation in S2 cells at a multiplicity of infection (MOI) of 5 for 72 hours. Then, cell-free supernatants were collected, aliquoted and stored at 80 C. until the moment of use. Viral loads were quantified in the S2-culture supernatants using a quantitative Real-Time PCR. Briefly, total viral RNA purified from 110.sup.8 PFU of FHV were 10-fold serially diluted to generate a standard curve. The viral RNA was purified using the QIAamp Viral RNA minikit (QIAGEN; Hamburg, Germany). Viral RNA was converted in cDNA using Improm II kit (Promega) and the quantitative PCR reaction was carried out with the Power SYBR Green Master mix (Invitrogen, Life Technologies) in a 7500-Real time PCR System (Applied Biosystems, Life Technologies). The primer sequences used for FHV detection were detailed in Table 5, above.
[0295] Infection of Mosquitoes with FHV
[0296] Female Aedes aegypti mosquitoes (Rockefeller strain) were infected with FHV by two different methods. In the first one, mosquitoes were fed an artificial blood meal mixed with FHV-infected S2 supernatants at a 1:1 ratio (virus titres were 1-210.sup.8 PFU/mL) through a pork gut membrane on a water-jacketed membrane feeder as previously described [Rutledge et al. (1964) Mosq News. 24:407-419], for 20 minutes, and then kept in breeding cages up to 15 days postinfection. Control mosquitoes were fed uninfected blood. In the second method of infection, the same source of FHV was diluted at 1:1 ratio in a 10%-solution of sugar. The mixture was then adsorbed in filter papers and placed into the breeding cages. The exposure to mosquitoes lasted 20 minutes. Control mosquitoes were exposed to sugar adsorbed in the filter papers.
[0297] Determination of Viral Loads in Infected Mosquitoes
[0298] Mosquitoes infected with FHV were collected at different time points postinfection, as indicated. Total RNA was extracted with TRIzol (Invitrogen) according to the manufacturer's protocol. cDNAs were synthesized by using Improm II Reverse transcriptase (Promega) and oligo dT (Thermo Scientific). Real-time quantitative PCRs were carried out using Power SYBR green Master Mix (Life technologies) and specific primers to FHV RNA1 (Table 6, above). The relative viral loads were estimated by the 2.sup.CT method, and normalized to a mosquito endogenous control (tubulin).
Results
Use of dsRNA to Increase Susceptibility of Ae. Aegypti Mosquitoes to Flock House Virus (FHV)
[0299] In this study, the present inventors explored the infection of Ae. aegypti mosquitoes with Flock House virus (FHV) as an experimental model to increase the mosquito susceptibility to virus infection. The purpose of this experiment was to treat mosquito larvae using dsRNA in order to increase virus replication inside mosquitoes. To do so, the present inventors designed dsRNA sequences to target specifically MYD88, Rel1A and defensin anti-microbial peptide.
[0300] It has been shown previously that FHV replicates in four species of mosquito, including Ae. aegypti. In this study, FHV growth was first monitored in Ae. aegypti mosquitoes at different intervals (2 hours, 3, 5, 7, 11 and 13 days) following an infectious blood meal or infectious sugar meal. The virus titer was high in both methods of infection 2 hours after infection and decreased thereafter until day 7 (
[0301] In order to evaluate the activation of immune response mechanism after FHV infection, the expression level of MYD88 and Rel1A were also evaluated in mosquitoes at different intervals (2 hours, 3, 5, 7, 11, 13 and 15 days) following an infectious blood meal. Interestingly, the mRNA levels of MYD88 (
[0302] It has been previously shown that MYD88-silenced mosquitoes (after intrathoracic inoculation of dsRNA into the mosquito) prior to dengue virus infection resulted in an increase of the virus load by 2.7 times compared to the GFP dsRNA control. On the other hand, cactus gene silencing reduced the extent of dengue infection in the midgut by 4.0-fold when compared to the GFP dsRNA control [PLoS Pathog. 2008 Jul. 4; 4(7):e1000098]. In the current experiment, third instar larvae were treated with dsRNA against MYD88 and Cactus. Larvae were reared until adult mosquitoes and then received an infectious blood meal. Using this approach, an increase in virus load was found two hours after infection in the MYD88, Cactus and AAEL007562 dsRNA-treated group (
[0303] At later time point (15 days) Rel1A and cactus-treated mosquitoes displayed the highest mortality rates (
[0304] Furthermore, MYD88 dsRNA-treated mosquitoes displayed a higher infection rate at 7 and 15 days postinfection (
[0305] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0306] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.